WO1998040100A1 - USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT - Google Patents
USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT Download PDFInfo
- Publication number
- WO1998040100A1 WO1998040100A1 PCT/US1998/004703 US9804703W WO9840100A1 WO 1998040100 A1 WO1998040100 A1 WO 1998040100A1 US 9804703 W US9804703 W US 9804703W WO 9840100 A1 WO9840100 A1 WO 9840100A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antigen
- oligonucleotide
- hepatitis
- nucleic acid
- cpg
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/29—Hepatitis virus
- A61K39/292—Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55505—Inorganic adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/5555—Muramyl dipeptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- This invention relates to generally to adjuvants, and specifically to the use of oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) as an adjuvant.
- CpG ODN unmethylated CpG dinucleotide
- PBMC peripheral blood mononuclear cells
- This lymphocyte activation is due to unmethylated CpG dinucleotides, which are present at the expected frequency in bacterial DNA (1/16), but are under-represented (CpG suppression, 1/50 to 1/60) and methylated in vertebrate DNA.
- Activation may also be triggered by addition of synthetic oligodeoxynucleotides (ODN) that contain an unmethylated CpG dinucleotide in a particular sequence context. It appears likely that the rapid immune activation in response to CpG DNA may have evolved as one component of the innate immune defense mechanisms that recognize structural patterns specific to microbial molecules.
- ODN synthetic oligodeoxynucleotides
- CpG DNA induces proliferation of almost all (>95%) B cells and increases immunoglobulin (Ig) secretion.
- This B cell activation by CpG DNA is T cell independent and antigen non-specific.
- B cell activation by low concentrations of CpG DNA has strong synergy with signals delivered through the B cell antigen receptor for both B cell proliferation and Ig secretion (Krieg et al., 1995). This strong synergy between the B cell signaling pathways triggered through the B cell antigen receptor and by CpG DNA promotes antigen specific immune responses.
- CpG DNA In addition to its direct effects on B cells, CpG DNA also directly activates monocytes, macrophages, and dendritic cells to secrete a variety of cytokines, including high levels of IL-12 (Klinman et al., 1996; Halpern et al, 1996; Cowdery et al., 1996). These cytokines stimulate natural killer (NK) cells to secrete g-interferon (IFN-g) and have increased lytic activity (Klinman et al., 1996, supra', Cowdery et al, 1996, supra; Yamamoto et al, 1992; Ballas et al, 1996).
- NK natural killer
- IFN-g g-interferon
- CpG DNA induces a Thl like pattern of cytokine production dominated by IL-12 and IFN-g with little secretion of Th2 cytokines (Klinman et al, 1996).
- a DNA vaccine induces immune responses against an antigenic protein expressed in vivo from an introduced gene.
- the DNA vaccine is most often in the form of a plasmid DNA expression vector produced in bacteria and then purified and delivered to muscle or skin (see Vogel and Sarver, 1995; Brazolot Millan and Davis, 1997; Donnelly eta , 1996).
- DNA vaccines have been demonstrated to show efficacy against numerous viral, bacterial and parasitic diseases in animal models. Almost all studies show induction of very strong and long-lasting humoral and cell-mediated immune responses, and protection against live pathogen challenge (where it could be evaluated).
- the efficacy of DNA vaccines is attributed, at least in part, to the continuous in vivo synthesis of antigen that leads to efficient antigen presentation.
- CTL cytotoxic T lymphocytes
- HBV Hepatitis B virus
- the current HBV vaccines are subunit vaccines containing particles of HBV envelope protein(s) which include several B and T cell epitopes known collectively as HBV surface antigen (HBsAg).
- HBsAg particles may be purified from the plasma of chronically infected individuals or more commonly are produced as recombinant proteins.
- These vaccines induce antibodies against HBsAg (anti-HBs), which confer protection if present in titers 10 milli-International Units per milliliter (mlU/ml) (Ellis, 1993). While the subunit vaccines are safe and generally efficacious, they fail to meet all current vaccination needs.
- the present invention is based on the finding that nucleic acids containing at least one unmethylated cytosine-guanine (CpG) dinucleotide affect the immune response in a subject by activating natural killer cells (NK) or redirecting a subject's immune response from a Th2 to a Thl response by inducing monocytic and other cells to produce Thl cytokines.
- CpG cytosine-guanine
- NK natural killer cells
- These nucleic acids containing at least one unmethylated CpG can be used as an adjuvant, specifically to induce an immune response against an antigenic protein.
- the invention provides a method of inducing an immune response in a subject by administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic protein and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
- the invention provides a method for treating a subject having or at risk of having a virally mediated disorder by administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
- the invention provides a method for treating a subject having or at risk of having a chronic viral infection by administering to the subject an effective amount of an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
- a pharmaceutical composition containing an immumostimulatory CpG oligonucleotide and a nucleic acid encoding an antigenic protein in a pharmaceutically acceptable carrier is provided.
- FIG. 1 is a graph illustrating humoral responses in BALB/c mice immunized with
- HBsAg protein 1 g recombinant HBsAg protein alone, adsorbed onto alum (25 mg Al 3+ /mg HBsAg), with 100 g of immunostimulatory CpG ODN, or with both alum and CpG ODN.
- the upper graph shows results on a linear scale and the lower graph shows results on a logarithmic scale (log 10 ).
- FIG. 2 is a graph illustrating humoral responses in BALB/c mice immunized with 1 g recombinant HBsAg protein with alum and with 0, 10, 100 or 500 g of CpG ODN added.
- IgGl and IgG2a isotypes as determined by end-point dilution ELISA assay.
- FIG. 1 1 is a graph of humoral responses in BALB/c mice primed with 10 g HBsAg-expressing DNA vaccine (pCMV-S) and given 2 g recombinant HBsAg protein at the same time in the same or a different muscle or given the HBsAg 2 or 8 weeks later.
- oligodeoxyribonucleotide as used herein is a deoxyribonucleic acid sequence from about 3-50 bases in length. Lymphocyte oligodeoxyribonucleotide uptake has been shown to be regulated by cell activation (Krieg, A.M., et al, Antisense Research and Development 161 , 1991 ). The present invention is based on the finding that certain oligonucleotides (ODN) containing at least one unmethylated cytosine-guanine (CpG) dinucleotide activate the immune response.
- ODN oligonucleotides
- CpG unmethylated cytosine-guanine
- the invention provides a method for stimulating an immune response in a subject by administering a therapeutically effective amount of a nucleic acid sequence containing at least one unmethylated CpG.
- nucleic acid or
- oligonucleotide refers to a polymeric form of nucleotides at least five bases in length.
- the nucleotides of the invention can be deoxyribonucleotides, ribonucleotides, or modified forms of either nucleotide.
- double-stranded molecules are more stable in vivo, while single-stranded molecules have increased activity.
- the nucleic acid molecule can include the use of phosphorothioate or phosphorodithioate rather than phosphodiesterase linkages within the backbone of the molecule, or methylphosphorothioate terminal linkages (Krieg, A.M., et al, Antisense and Nucl Acid Drug Dev 6: 133-9, 1996; Boggs, R.T., et al. , Antisense and Nucl Acid Drug Dev, 7:461-71, 1997).
- the phosphate backbone modification can occur at the 5' end of the nucleic acid, for example at the first two nucleotides of the 5' end of the nucleic acid.
- the phosphate backbone modification may occur at the 3' end of the nucleic acid, for example at the last five nucleotides of the 3' end of the nucleic acid.
- International Patent Application WO 95/26204 entitled “Immune stimulation by phosphorothioate oligonucleotide analogs” reports the nonsequence-specific immunostimulatory effect of phosphorothioate modified oligonucleotides.
- Nontraditional bases such as inosine and queosine, as well as acetyl-, thio- and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine can also be included, which are not as easily recognized by endogenous endonucleases.
- nucleic acid molecules include: nonionic DNA analogs, such as alkyl- and aryl- phosphonates (in which the charged oxygen moiety is alkylated). Nucleic acid molecules which contain a diol, such as tetrahyleneglycol or hexaethyleneglycol, at either or both termini are also included.
- oligonucleotide includes both single and double- stranded forms of DNA.
- CpG or "CpG motif refers to a nucleic acid having a cytosine followed by a guanine linked by a phosphate bond.
- methylated CpG refers to the methylation of the cytosine on the pyrimidine ring, usually occurring the 5-position of the pyrimidine ring.
- unmethylated CpG refers to the absence of methylation of the cytosine on the pyrimidine ring. Methylation, partial removal, or removal of an unmethylated CpG motif in an oligonucleotide of the invention is believed to reduce its effect.
- Methylation or removal of all unmethylated CpG motifs in an oligonucleotide substantially reduces its effect.
- the effect of methylation or removal of a CpG motif is "substantial" if the effect is similar to that of an oligonucleotide that does not contain a CpG motif.
- the CpG oligonucleotide is in the range of about 8 to 30 bases in size.
- the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art.
- the b-cyanoethyl phosphoramidite method eaucage, S.L., and Caruthers, M.H., 7et. Let. 22:1859, 1981
- nucleoside H-phosphonate method Gagg et al, Tet. Let. 27:4051-4054, 1986; Froehler et al, Nucl Acid. Res. 14:5399-5407, 1986, ; Garegg et al, Tet. Let. 22:4055-4058, 1986,
- oligonucleotide synthesizers available in the market.
- CpG dinucleotides can be produced on a large scale in plasmids, (see Sambrook, T., et al, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor laboratory Press, New York, 1989) which after being administered to a subject are degraded into oligonucleotides.
- Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
- nucleic acids are preferably relatively resistant to degradation (e.g. , via endo-and exo-nucleases). Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
- Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Patent No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and
- nucleic acids may be associated with a molecule that results in higher affinity binding to target cell (e.g., B-cell, monocytic cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form a "nucleic acid delivery complex.”
- target cell e.g., B-cell, monocytic cell and natural killer (NK) cell
- Nucleic acids can be ionically or covalently associated with appropriate molecules using techniques which are well known in the art.
- a variety of coupling or cross-linking agents can be used, e.g., protein A, carbodiimide, and N-succinimidyl- 3-(2-pyridyldithio) propionate (SPDP).
- SPDP N-succinimidyl- 3-(2-pyridyldithio) propionate
- Nucleic acids can alternatively be encapsulated in liposomes or virosomes using well-known techniques.
- the nucleic acid sequences useful in the methods of the invention are represented by the formula: wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X 2 is cytosine or thymine, N is any nucleotide and N, + N 2 is from about 0-26 bases. In a preferred embodiment, N, and N 2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
- nucleic acids of any size can be used in the invention if CpGs are present, as larger nucleic acids are degraded into oligonucleotides inside cells.
- Preferred synthetic oligonucleotides do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome.
- a "palindromic sequence” or "palindrome” means an inverted repeat (i.e., a sequence such as ABCDEE'D'C'B'A', in which A and A' are bases capable of forming the usual Watson-Crick base pairs.
- the method of the invention includes the use of an oligonucleotide which contains a CpG motif represented by the formula: 5' N ⁇ .X GX ⁇ y (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X
- CpG ODN are also preferably in the range of 8 to 30 bases in length, but may be of any size (even many kb long) if sufficient motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells.
- Preferred synthetic oligonucleotides of this formula do not include a CCGG quadmer or more than one CCG or CGG trimer at or near the 5' and/or 3' terminals and/or the consensus mitogenic CpG motif is not a palindrome.
- Other CpG oligonucleotides can be assayed for efficacy using methods described herein.
- An exemplary nucleic acid sequence of the invention is S'-TCCATGACGTTCCTGACGTT-S' (SEQ ID NO:3).
- a prolonged effect can be obtained using stabilized oligonucleotides, where the oligonucleotide incorporates a phosphate backbone modification (e.g. , a phosphorothioate or phbsphorodithioate modification). More particularly, the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid. Further, the phosphate backbone modification may occur at the 3' end of the nucleic acid for example, at the last five nucleotides of the 3* end of the nucleic acid.
- a phosphate backbone modification e.g. , a phosphorothioate or phbsphorodithioate modification.
- the phosphate backbone modification occurs at the 5' end of the nucleic acid for example, at the first two nucleotides of the 5' end of the nucleic acid.
- the phosphate backbone modification
- Preferred nucleic acids containing an unmethylated CpG have a relatively high stimulation with regard to B cell, monocyte, and/or natural killer cell responses (e.g., induction of cytokines, proliferative responses, lytic responses, among others).
- Nucleic acids containing an unmethylated CpG can be effective in any mammal, preferably a human. Different nucleic acids containing an unmethylated CpG can cause optimal immune stimulation depending on the mammalian species. Thus an oligonucleotide causing optimal stimulation in humans may not cause optimal stimulation in a mouse. One of skill in the art can identify the optimal oligonucleotides useful for a particular mammalian species of interest.
- the "stimulation index" is a measure of a CpG ODN to effect an immune response which can be tested in various immune cell assays.
- the stimulation of the immune response can be assayed by measuring various immune parameters, e.g., measuring the antibody- forming capacity, number of lymphocyte subpopulations, mixed leukocyte response assay, lymphocyte proliferation assay.
- the stimulation of the immune response can also be measured in an assay to determine resistance to infection or tumor growth. Methods for measuring a stimulation index are well known to one of skill in the art.
- one assay is the incorporation of 3 H uridine in a murine B cell culture, which has been contacted with a 20 ⁇ M of oligonucleotide for 20h at 37°C and has been pulsed with 1 ⁇ Ci of 3 H uridine; and harvested and counted 4h later.
- the induction of secretion of a particular cytokine can also be used to assess the stimulation index.
- the CpG ODN for use in vivo, for example to treat a subject at risk of exposure to a hepatitis virus, it is important that the CpG ODN be capable of effectively inducing cytokine secretion by monocytic cells and/or Natural Killer (NK) cell lytic activity.
- the stimulation index of the CpG ODN with regard to B-cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20, while recognizing that there are differences in the stimulation index among individuals.
- the CpG ODN of the invention stimulate cytokine production (e.g., IL-6, IL-12,
- Exemplary sequences include:
- TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:6).
- the CpG ODN of the invention are also useful for stimulating natural killer cell (NK) lytic activity in a subject such as a human.
- NK natural killer cell
- Specific, but nonlimiting examples of such sequences include:
- TCGTCGTCGTCGTT SEQ ID NO: 12
- the nucleic acid sequences of the invention are also useful for stimulating B cell proliferation. Specific, but nonlimiting examples of such sequences include:
- TCGTCGCTGTCTGCCCTTCTT SEQ ID NO: 15
- TCGTCGCTGTTGTCGTTTCTT SEQ ID NO: 16
- Preferred CpG ODN can effect at least about 500 pg/ml of TNF- ⁇ , 15 pg/ml IFN- ⁇ , 70 pg/ml of GM-CSF 275 pg/ml of IL-6, 200 pg/ml IL-12, depending on the therapeutic indication.
- These cytokines can be measured by assays well known in the art.
- the ODNs listed above or other preferred CpG ODN can effect at least about 10%, more preferably at least about 15% and most preferably at least about 20% YAC-1 cell specific lysis or at least about 30%, more preferably at least about 35%, and most preferably at least about 40% 2C11 cell specific lysis, in assays well known in the art.
- an "antigenic polypeptide” is any polypeptide that can, under appropriate - conditions, induce an immune response.
- Antigenic polypeptides include, but are not limited to, viral proteins, or fragments thereof. Minor modifications of the primary amino acid sequences of a viral polypeptide may also result in a polypeptide which have substantially equivalent antigenic activity as compared to the unmodified counte ⁇ art polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as antigenicity still exists.
- An antigenic viral polypeptide is the hepatitis B surface antigen.
- substantially purified refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated.
- One skilled in the art can purify viral polypeptides using standard techniques for protein purification.
- the substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel.
- the purity of the viral polypeptide can also be determined by amino-terminal amino acid sequence analysis.
- the invention utilizes polynucleotides encoding the antigenic polypeptides.
- These polynucleotides include DNA, cDNA and RNA sequences which encode an antigenic polypeptide.
- Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated polynucleotides. For example, polynucleotide enocing an antigenic polypeptide may be subjected to site-directed mutagenesis, so long as the polypeptide remains antigenic.
- polynucleotide or “nucleic acid sequence” refers to a polymeric form of nucleotides at least 10 bases in length.
- isolated polynucleotide is meant a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g. a cDNA) independent of other sequences.
- the nucleotides of the invention can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide.
- the term includes single and double forms of DNA.
- the polynucleotide sequences encoding an antigenic polypeptide may be inserted into an expression vector.
- expression vector refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incorporation of the genetic sequences encoding the antigenic polypeptide.
- Polynucleotide sequence which encode the antigenic polypeptide can be operatively linked to expression control sequences. "Operatively linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. An expression control sequence operatively linked to a coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the expression control sequences.
- expression control sequences refers to nucleic acid sequences that regulate the expression of a nucleic acid sequence to which it is operatively linked. Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence.
- expression control sequences can include appropriate promoters, enhancers, transcription terminators, as start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.
- control sequences is intended to included, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. Expression control sequences can include a promoter.
- promoter minimal sequence sufficient to direct transcription. Also included in the invention are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5' or 3' regions of the gene. Both constitutive and inducible promoters, are included in the invention (see e.g., Bitter et al, 1987, Methods in Enzymology 153:516-544).
- Promoters derived from the genome of mammalian cells e.g., metallothionein promoter
- mammalian viruses e.g., the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K promoter
- Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the nucleic acid sequences of the invention.
- terapéuticaally effective amount is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest symptoms in a subject.
- a subject is any mammal, preferably a human. Amounts effective for therapeutic use will, of course, depend on the severity of the disease and the weight and general state of the subject. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.
- oligonucleotide containing at least one unmethylated CpG can be used alone to activate the immune response or can be administered in combination with another adjuvant.
- adjuvant is any molecule or compound which can stimulate the humoral and/or cellular immune response.
- the oligonucleotide containing at least one unmethylated CpG when administered in conjunction with another adjuvant, the oligonucleotide can be administered before, after, and/or simultaneously with the other adjuvant.
- the oligonucleotide containing at least one unmethylated CpG can have an additional efficacy (e.g., through antisense or other means) in addition to its ability to activate the immune response.
- the invention further provides a method of modulating the level of a cytokine.
- modulate envisions the suppression of expression of a particular cytokine when it is overexpressed, or augmentation of the expression of a particular cytokine when it is underexpressed. Modulation of a particular cytokine can occur locally or systemically. It is believed that the CpG oligonucleotides do not directly activate purified NK cells, but rather render them competent to respond to IL-l 2 with a marked increase in their IFN- ⁇ production. By inducing IL-12 production and the subsequent increased IFN- ⁇ secretion by NK cells, the immunostimulatory nucleic acids also promote a Thl type immune response. No direct activation of proliferation or cytokine secretion by highly purified T cells has been found. Cytokine profiles determine T cell regulatory and effector functions in immune responses.
- Cytokines also play a role in directing the T cell response.
- Helper (CD4 + ) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells.
- Most mature CD4 + T helper cells express one of two cytokine profiles: Thl or Th2.
- Thl cells secrete IL-2, IL-3, IFN- ⁇ , TNF- ⁇ , GM-CSF and high levels of TNF- ⁇ .
- Th2 cells express IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-13, GM-CSF and low levels of TNF- ⁇ .
- the Thl subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG 2a .
- the Th2 subset induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgG, and IgE.
- IL-12 and IFN- ⁇ are positive Thl and negative Th2 regulators.
- IL-12 promotes IFN- ⁇ production, and IFN- ⁇ provides positive feedback for IL-12.
- IL-4 and IL-10 appear to be required for the establishment of the Th2 cytokine profile and to down-regulate Thl cytokine production; the effects of IL-4 are in some cases dominant over those of IL-12.
- IL-13 was shown to inhibit expression of inflammatory cytokines, including IL-12 and TNF- ⁇ by LPS-induced monocytes, in a way similar to IL-4.
- the IL-12 p40 homodimer binds to the IL-12 receptor and antagonizes IL-12 biological activity; thus it blocks the pro-Thl effects of IL-12.
- This invention further provides administering to a subject having or at risk of having an virally mediated disorder, a therapeutical ly effective dose of a pharmaceutical composition containing the compounds of the present invention and a pharmaceutically acceptable carrier.
- administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
- compositions according to the invention are in general administered topically, intravenously, orally, parenterally or as implants, and even rectal use is possible in principle.
- suitable solid or liquid pharmaceutical preparation forms are, for example, granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, aerosols, drops or injectable solution in ampule form and also preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
- the pharmaceutical compositions are suitable for use in a variety of drug delivery systems.
- the pharmaceutical compositions are preferably prepared and administered in dose units. Solid dose units are tablets, capsules and suppositories.
- dose units are tablets, capsules and suppositories.
- different daily doses are necessary. Under certain circumstances, however, higher or lower daily doses may be appropriate.
- the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals.
- compositions according to the invention may be administered locally or systemically.
- therapeutically effective dose is meant the quantity of a compound according to the invention necessary to prevent, to cure or at least partially arrest the symptoms of the disorder and its complications. Amounts effective for this use will, of course, depend on the severity of the disease and the weight and general state of the patient.
- dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders.
- Various considerations are described, e.g., in Gilman et al, eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics. 8th ed., Pergamon Press, 1990; and Remington's Pharmaceutical Sciences. 17th ed., Mack Publishing Co., Easton, Pa., 1990, each of which is herein inco ⁇ orated by reference.
- CpG ODN as an adjuvant for immunization of mice against hepatitis B virus surface antigen (HbsAg) given as a recombinant protein or expressed in vivo from a DNA vaccine.
- HbsAg hepatitis B virus surface antigen
- CpG ODN Compared with the recombinant protein vaccine alone, addition of either CpG ODN or alum alone resulted in a 10-100 fold increase in the level of antibodies against HBsAg (anti-HBs). However when used together, these two adjuvants resulted in 500-1000 times higher levels of anti-HBs, indicating a strong synergistic response. Immunization with HBsAg alone or with alum resulted in a strong Th2-type response with almost all IgG being of the IgGl isotype. CpG ODN induced a high proportion of IgG2a, indicative of a Thl-type response, even in the presence of alum.
- DNA "vaccines” also induce potent Thl-type immune responses and this is likely due in large part to the presence of CpG motifs in the bacterial ly-derived plasmid DNA.
- CpG ODN was able to induce anti-HBs in mice injected on the day of birth.
- a combination approach of DNA prime and protein boost appears to be particularly effective for vaccination pu ⁇ oses, although a sufficient period (>2 weeks) must elapse before a boosting response is seen.
- mice were carried out using female BALB/c (H-2 d , good responder), C57BL/6 (B 10, H-2 b , fair responder) and B10.S (H-2 S ,MHC-restricted hypo-responder to HBsAg) mice (Charles River, Montreal, QC) at 6-8 weeks of age. Mice with class II MHC deficiency (C2D, H-2 b , GenPharm, Mountain View, CA) due to gene knockout were used as a model of a non-responder. Newborn mice were obtained through breeding male and female BALB/c mice (Charles River) in our own animal facility (Loeb Research Institute, Ottawa Civic Hospital, Ottawa, ON). Pregnant females were monitored daily to ensure accurate recording of the date of birth. Both male and female neonates were used for immunization.
- the subunit vaccine consisted of HBsAg (ay subtype) which had been produced as a recombinant protein in yeast cells (Medix Biotech #ABH0905). This was diluted in saline for use without adjuvant.
- HBsAg was also formulated with alum and/or CpG ODN as adjuvant.
- HBsAg protein was mixed with aluminum hydroxide (Alhydrogel 85, [Al 2 O 3 ],
- oligodeoxynucleotide (ODN #1826) of the sequence TCCATGACGTTCCTGACGTT synthesized with a phosphorothioate backbone (Oligos Etc. & Oligo Therapeutics, Wilsonville, OR) was added alone or with alum to HBsAg on the day of injection.
- ODN #1826 synthetic oligodeoxynucleotide
- TCCATGACGTTCCTGACGTT synthesized with a phosphorothioate backbone
- mice were immunized within 24 hours of birth or 7 days after birth by bilateral injection of a total of 1 g HBsAg into the posterior thigh muscles (2 x 10 1 @ 0.05 mg/ml). All injections were carried out with a 0.3 ml insulin syringe which has a fused 29G needle (Becton Dickenson, Franklin Lakes, NJ). For injection of adults, the needle was fitted with a collar of polyethylene (PE) tubing to limit penetration of the needle to about 3 mm. All intramuscular injections were carried out through the skin (unshaved) and under general anesthesia (Halothane, Halocarbon Laboratories, River Edge, NJ). DNA-based immunization of mice
- mice were immunized against HBsAg using plasmid constructs encoding the major protein (S) of the HBV envelope.
- the plasmid pCPIO containing two copies of the HBV genome (ayw subtype; GeneBank reference HPBAYW) as a head-to-tail fusion (Dubois et al, 1980), was the source of the envelope coding sequences and the 3' untranslated sequences which include the viral polyadenylation signal.
- a 1.9 kb J hol-BglTl restriction fragment from pCPIO (containing the S coding sequences) was cloned into the corresponding sites of a modified p Bluescript SK vector containing extra restriction sites in the polylinker (kindly provided by Dr.
- DNA was purified on Qiagen anion-exchange chromatography columns (Qiagen GmbH, Hilden, Germany). This method, which yields predominantly supercoiled, double-stranded, closed circular DNA, results in virtually no contamination with chromosomal DNA, RNA or protein and very low contamination with endotoxin.
- the DNA was resuspended in sterile saline (0.15M NaCl, BDH) and the concentration of DNA was calculated based on absorbance of ultraviolet light (OD 260). The final concentration was adjusted to 0.1 to 1 mg/ml and the DNA solutions were stored at -20C until required for injection.
- Direct gene transfer in adult mice was carried out by unilateral or bilateral IM injection into the TA muscle of DNA in 50 1 such that each animal received a total of 1, 10 or 100 g DNA.
- Newborn mice received a total of 10 g DNA by bilateral injection into the posterior thigh muscles (2 x 10 1 @ 0.5 mg/ml).
- Injections were with a 0.3 ml insulin syringe which has a fused 29G needle, and for injection of adults the needle was fitted with a collar of PE tubing to limit penetration of the needle to about 2 mm. All intramuscular injections were carried out (through shaved skin for adults) under general anesthesia (Halothane)
- Heparinized blood was collected by retrobulbar puncture of lightly anaesthetized mice as described elsewhere (Michel et al. , 1995). Plasma was recovered by centrifugation
- the bound antibodies were then detected by incubation for 1 hr at 37C with HRP-conjugated goat anti-mouse IgG, IgM, IgGl or IgG2a (1 :4000 in PBS-Tween, 10% FCS; 100 1/well, Southern Biotechnology Inc., Birmingham, AL), followed by incubation with OPD solution (100 1/well, Sigma, St. Louis, MO) for 30 minutes at RT in the dark. The reaction was stopped by the addition of sulfuric acid (50 1 of 4N H 2 S0 4 ).
- End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD 450) two times greater than that of non-immune plasma with a cut-off value of 0.05.
- Anti-HBs titers were expressed as group means of individual animal values, which were themselves the average of triplicate assays.
- mice no anti-HBs antibodies were detected with HBsAg alone and low titers were obtained if either CpG ODN or alum are added.
- CpG ODN CpG ODN
- alum and CpG together gives the best result although the synergy is less evident than in the BALB/c and C57BL/6 mice (FIG. 5).
- Non-responder (C2D) mice have no detectable anti-HBs after immunization with HBsAg alone. There are low levels of IgM with addition of alum and this is increased 4-fold with further addition of CpG ODN.
- ODN induces about ten-times more IgG2a than IgGl, indicating a real shift from Th2 to Thl (FIG. 7).
- CpG ODN as adjuvant to HBV DNA vaccine
- DNA vaccines induced higher levels of anti-HBs more rapidly than did HBsAg, even when alum was included (compare FIG.s 1 and 8).
- Addition of CpG ODN to the pCMV-S DNA vaccine increased anti-HBs titers a further five-fold by 4 weeks.
- the 500 g dose was slightly better than the 100 g dose (FIG. 8).
- the DNA vaccine was also superior to the HBsAg subunit vaccine in hypo-responder mice. A single injection of DNA induced earlier appearance of anti-HBs, and these reached higher titers than with two doses of protein given at 0 and 4 weeks (FIG. 9).
- CpG ODN is as good as or superior to alum when each is used alone as adjuvant with the HBsAg subunit vaccine in mice, This indicates that CpG ODN could be used to replace alum in vaccine formulations, which could be desirable to avoid associated side-effects due to local irritation in the muscle. Furthermore, for certain live-attenuated or multivalent vaccines, it is not possible to use alum which through chemical interactions interferes with the efficacy of the vaccine. This should not occur with CpG ODN.
- alum Aluminum hydroxide
- An important disadvantage of alum is that it induces a Th2- rather than a Thl-type immune response, and this may interfere with induction of CTL. Indeed, in mice immunized with recombinant HBsAg, the addition of alum selectively blocked activation of CD8 + CTL (Schirmbeck et al, 1994). Although not essential for protective immunity against HBV, CTL may nevertheless play an important role. For example, a lack of HBV-specific CTL is thought to contribute to the chronic carrier state. In contrast, one of the primary advantages of CpG DNA over alum as an adjuvant is the Thl-bias of the responses and thus the possibility to induce CTL.
- CpG can completely counteract the Th2-bias of alum when the two adjuvants are delivered together. This could allow one to capitalize on the strong synergistic action of the two adjuvants on the humoral response while still allowing CTL.
- Th2-type diseases The use of alum has been linked to Th2-type diseases.
- the much higher prevalence of asthma (another Th2-type disease) in more highly developed countries may be linked to the high hygiene level and rapid treatment of childhood infections (Cookson and Moffatt, 1997).
- Early exposure to bacterial DNA (and immunostimulatory CpG motifs) pushes the immune system away from Th2- and towards a Thl-type response and this may account for the lower incidence of asthma in less developed countries, where there is a much higher frequency of upper respiratory infections during childhood.
- Addition of CpG ODN as adjuvant to all pediatric vaccines could re-establish a Thl -type response thereby reducing the incidence of asthma.
- the DNA vaccine provides its own adjuvant in the form of CpG DNA. Since single-stranded but not double-stranded DNA can induce immunostimulation in vitro (Krieg et al, unpublished observation), the CpG adjuvant effect of DNA vaccines in vivo is likely due to oligonucleotides resulting from plasmid degradation by nucleases. Only a small portion of the plasmid DNA injected into a muscle actually enters a myofiber and is expressed, the majority of the plasmids is degraded in the extracellular space.
- DNA vaccines would offer additional advantages such as relatively low cost and ease of manufacturing, and heat-stability which circumvents the requirement for a cold-chain.
- Subunit or DNA vaccines with CpG adjuvant should reduce this further owing to a more rapid appearance and higher titers of anti-HBs antibodies and the induction of HBV-specific CTL, which could help clear virus from the liver of babies infected in utero, and which likely account for most of the failures with neonatal vaccination.
- DNA vaccines could be particularly effective if coupled with a protein boost.
- HBsAg vaccine Between 5 and 10% of individuals are non-responders or hypo-responders to the subunit HBsAg vaccine. This may be MHC-restricted (Kruskall et al, 1992) and is thought to result from a failure to recognize T-helper epitopes. In certain immunocompromised individuals (e.g., kidney dialysis patients, alcoholics) the rate of non-response can approach 50%. In the present study, alum plus CpG ODN gave higher anti-HBs titers than alum alone in a strain of mice which has MHC-restricted hypo-responsiveness to HBsAg, thought to result in a failure to recognize T-helper epitopes.
- CpG ODN also overcame non-response in mice genetically incapable of providing T-help owing to an absence of class II MHC (Milich, 1988). These results support the in vitro finding that CpG ODN drives the T cell independent activation of B cells.
- Use of CpG DNA as an adjuvant may increase the response rate to HBsAg in humans.
- a link between MHC phenotype and non-responsiveness to HBsAg has been demonstrated in humans (Kruskall et al, 1992).
- HBV chronicity results in 10-15% of individuals infected as adolescents or adults, but 90-95% for those infected (either vertically or horizontally) as infants. HBV chronicity eventually leads to cirrhosis and increased risk of hepatocellular carcinoma and an estimated one million people die each year from HBV-related liver disease. Persistent HBV infection of the liver results when acute infection fails to launch an appropriate immune response to clear the virus. Such chronic carriers have circulating HBsAg and HBV core antigen (HBcAg/HBeAg) without specific immunity. It is thought that the absence of HBV-specific CTL may contribute to the establishment and maintenance of the chronic carrier state.
- HBV chronic infection There is currently no cure for the HBV chronic infection. Interferon is used currently but this cures only 10-20% of treated individuals (Niederau et al, 1996).
- Anti-viral drugs e.g., lamivudine
- Each of these types of treatment is also expensive and has certain undesirable side-effects.
- the possibility to induce a strong Thl-type response with CpG ODN added to a subunit vaccine may help overcome the chronic carrier state.
- pre-Sl polypeptide may prevent secretion, it might be desirable to encode a truncated version of this such as that described by Li et al. (1994) with only amino acids 21-47 which include the hepatocyte receptor-binding site and induce anti-preSl immune responses yet still maintain particle secretion.
- a subunit vaccine containing the middle HBV envelope protein preS2 + S
- preS2 + S reduced viral replication in 50% of vaccinated chronic carriers
- a DNA vaccine might also prove very effective as a therapeutic vaccine for HBV chronic carriers.
- an HBsAg-expressing DNA vaccine could break tolerance to HBsAg in transgenic mice expressing HBsAg in the liver from before birth (Mancini et al. , 1996). This response appears to be mediated by T cells via a non-lytic mechanism. Addition of CpG dinucleotide motifs that preferentially induce Thl cytokines and strong CTL responses could further improve DNA vaccines for application to HBV chronic carriers.
- ODN containing CpG dinucleotides are useful as an adjuvant to protein vaccines (whole pathogen or subunit).
- the CpG ODN could be used alone or in combination with alum. Used alone, it will allow the possibility to adjuvant vaccines that cannot be mixed with alum (e.g., live attenuated pathogens, multivalent vaccines). Used together, it will capitalize on the synergistic effect to induce very potent immune responses, yet still maintain the Thl bias of CpG DNA.
- CpG dinucleotides also act to adjuvant DNA vaccines. Additional CpG given as ODN or cloned into the plasmid vector could further augment immune responses.
- CpG ODN could be added as an adjuvant to recombinant HBsAg subunit vaccines, either alone or in combination with alum, or can be cloned into an HBsAg-expressing DNA vaccine.
- These improved vaccines can (i) induce higher titers more quickly and reduce the number of doses required to induce protective immunity from three to two, (ii) overcome hypo- or non- responsiveness to HBsAg, (iii) control the chronic carrier state through induction of CTL, and (iv) induce rapid and stronger immunity in neonates in HBV endemic areas.
- a method of inducing an immune response in a subject comprising: administering to the subject a therapeutically effective amount of nucleic acid encoding an antigenic polypeptide, and a therapeutically effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
- oligonucleotide is from 8-30 bases in length.
- nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide are administered in a vector.
- nucleic acid encoding an antigenic protein encodes a viral antigen.
- hepatitis viral antigen is a hepatitis B virus surface antigen.
- the oligonucleotide has a formula: S'N ⁇ CGX ⁇ ' (SEQ ID NO: 1 ) wherein at least one nucleotide separates consecutive CpGs; X, is adenine, guanine, or thymidine; X 2 is cytosine or thymine, N is any nucleotide and N, + N 2 is from about 0-26 bases.
- N, and N 2 do not contain a CCGG quadmer or more than one CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
- the oligonucleotide has a formula: 5' N,X,X 2 CGX 3 X 4 N 2 3' (SEQ ID NO:2) wherein at least one nucleotide separates consecutive CpGs; X,X 2 is selected from the group consisting of GpT, GpG, GpA, ApT and ApA; X 3 X 4 is selected from the group consisting ofTpT or CpT; N is any nucleotide and N, +N 2 is from about 0-26 bases.
- N, and N 2 do not contain a CCGG quadmer or more than one CCG or CGG trimer; and the nucleic acid sequence is from about 8-30 bases in length.
- oligonucleotide is 5'- TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:3).
- a method for treating a subj ect having or at risk of having a viral-mediated disorder comprising administering to the subject a therapeutically effective amount of a nucleic acid encoding an antigenic polypeptide and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide.
- oligonucleotide is from 8-30 bases in length.
- nucleic acid encoding an antigenic protein and an effective amount of an oligonucleotide containing at least one unmethylated CpG dinucleotide are administered in a vector.
- hepatitis antigen is a hepatitis B surface antigen.
- X is adenine, guanine, or
- thymidine cytosine or thymine
- N is any nucleotide and N, + N 2 is from about 0-26
- nucleic acid sequence is from about 8-30
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Saccharide Compounds (AREA)
- Seasonings (AREA)
Abstract
Description
Claims
Priority Applications (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU67595/98A AU753688B2 (en) | 1997-03-10 | 1998-03-10 | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
DE69841122T DE69841122D1 (en) | 1997-03-10 | 1998-03-10 | Use of non-methylated CpG dinucleotide in combination with aluminum as adjuvants |
AT98912919T ATE441432T1 (en) | 1997-03-10 | 1998-03-10 | USE OF NON-METHYLATED CPG DINUCLEOTIDE IN COMBINATION WITH ALUMINUM AS ADJUVANTS |
JP53973098A JP5087758B2 (en) | 1997-03-10 | 1998-03-10 | Use of nucleic acids containing unmethylated CpG dinucleotides as adjuvants |
DK98912919T DK1005368T3 (en) | 1997-03-10 | 1998-03-10 | Use of nucleic acids containing non-methylated CpG dinucleotide in combination with alum as adjuvants |
EP98912919A EP1005368B1 (en) | 1997-03-10 | 1998-03-10 | Use of nucleic acids containing unmethylated CpG dinucleotide in combination with alum as adjuvants |
CA 2283557 CA2283557A1 (en) | 1997-03-10 | 1998-03-10 | Use of nucleic acids containing unmethylated cpg dinucleotide as an adjuvant |
US10/023,909 US7488490B2 (en) | 1997-03-10 | 2001-12-18 | Method of inducing an antigen-specific immune response by administering a synergistic combination of adjuvants comprising unmethylated CpG-containing nucleic acids and a non-nucleic acid adjuvant |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US4037697P | 1997-03-10 | 1997-03-10 | |
US60/040,376 | 1997-03-10 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US15461498A A-371-Of-International | 1997-03-10 | 1998-03-10 | |
US09/325,193 Continuation-In-Part US6406705B1 (en) | 1997-03-10 | 1999-06-03 | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
Publications (2)
Publication Number | Publication Date |
---|---|
WO1998040100A1 true WO1998040100A1 (en) | 1998-09-17 |
WO1998040100A9 WO1998040100A9 (en) | 1999-02-25 |
Family
ID=21910655
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/004703 WO1998040100A1 (en) | 1997-03-10 | 1998-03-10 | USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT |
Country Status (10)
Country | Link |
---|---|
EP (2) | EP2172216A3 (en) |
JP (2) | JP5087758B2 (en) |
AT (1) | ATE441432T1 (en) |
AU (1) | AU753688B2 (en) |
CA (1) | CA2283557A1 (en) |
DE (1) | DE69841122D1 (en) |
DK (1) | DK1005368T3 (en) |
ES (1) | ES2333069T3 (en) |
PT (1) | PT1005368E (en) |
WO (1) | WO1998040100A1 (en) |
Cited By (271)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000015256A2 (en) * | 1998-09-11 | 2000-03-23 | Aventis Pasteur | Immunostimulant emulsion |
WO2000067023A1 (en) * | 1999-04-29 | 2000-11-09 | Coley Pharmaceutical Gmbh | Screening for immunostimulatory dna functional modifyers |
WO2000067787A2 (en) * | 1999-05-06 | 2000-11-16 | The Immune Response Corporation | Hiv immunogenic compositions and methods |
WO2001000231A2 (en) * | 1999-06-29 | 2001-01-04 | Smithkline Beecham Biologicals S.A. | Use of cpg as an adjuvant for malaria vaccine |
WO2001015726A2 (en) * | 1999-08-27 | 2001-03-08 | Inex Pharmaceuticals Corp. | Compositions for stimulating cytokine secretion and inducing an immune response |
WO2001022972A2 (en) * | 1999-09-25 | 2001-04-05 | University Of Iowa Research Foundation | Immunostimulatory nucleic acids |
US6218371B1 (en) | 1998-04-03 | 2001-04-17 | University Of Iowa Research Foundation | Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines |
US6225292B1 (en) | 1997-06-06 | 2001-05-01 | The Regents Of The University Of California | Inhibitors of DNA immunostimulatory sequence activity |
US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
WO2001051500A1 (en) * | 2000-01-14 | 2001-07-19 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
WO2001095935A1 (en) * | 2000-01-20 | 2001-12-20 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
US6406705B1 (en) | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
US6444233B1 (en) | 1998-05-19 | 2002-09-03 | Research Development Foundation | Triterpene compositions and methods for use thereof |
JP2002537353A (en) * | 1999-02-26 | 2002-11-05 | カイロン エセ.ピー.アー. | Enhancement of Neisseria antigen bactericidal activity using oligonucleotide containing CG motif |
WO2003014316A2 (en) | 2001-08-07 | 2003-02-20 | Dynavax Technologies Corporation | Immunomodulatory compositions, formulations, and methods for use thereof |
JP2003508494A (en) * | 1999-09-07 | 2003-03-04 | スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム | New composition |
US6544518B1 (en) | 1999-04-19 | 2003-04-08 | Smithkline Beecham Biologicals S.A. | Vaccines |
WO2003028656A2 (en) | 2001-10-03 | 2003-04-10 | Chiron Corporation | Adjuvant compositions |
US6558670B1 (en) | 1999-04-19 | 2003-05-06 | Smithkline Beechman Biologicals S.A. | Vaccine adjuvants |
US6589940B1 (en) | 1997-06-06 | 2003-07-08 | Dynavax Technologies Corporation | Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof |
WO2003066649A1 (en) * | 2002-02-04 | 2003-08-14 | Biomira Inc. | Immunostimulatory, covalently lipidated oligonucleotides |
WO2003070909A2 (en) | 2002-02-20 | 2003-08-28 | Chiron Corporation | Microparticles with adsorbed polypeptide-containing molecules |
JP2003526670A (en) * | 2000-03-10 | 2003-09-09 | ダイナバックス テクノロジーズ コーポレイション | Remission of symptoms of herpes infection using immunomodulatory polynucleotide sequences |
JP2003526673A (en) * | 2000-03-10 | 2003-09-09 | ダイナバックス テクノロジーズ コーポレイション | Methods for reducing papillomavirus infection using immunomodulatory polynucleotide sequences |
JP2003526672A (en) * | 2000-03-10 | 2003-09-09 | ダイナバックス テクノロジーズ コーポレイション | Methods of preventing and treating respiratory viral infections using immunomodulatory polynucleotide sequences |
WO2003030934A3 (en) * | 2001-10-06 | 2003-11-06 | Qiagen Gmbh | Cpg formulations and related methods |
JP2003535043A (en) * | 2000-03-10 | 2003-11-25 | ダイナバックス テクノロジーズ コーポレイション | Methods for preventing and treating viral infections using immunomodulatory polynucleotide sequences |
WO2004011650A2 (en) | 2002-07-24 | 2004-02-05 | Intercell Ag | Antigens encoded by alternative reading frame from pathogenic viruses |
US6727230B1 (en) | 1994-03-25 | 2004-04-27 | Coley Pharmaceutical Group, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
US6737066B1 (en) | 1999-05-06 | 2004-05-18 | The Immune Response Corporation | HIV immunogenic compositions and methods |
WO2004074454A2 (en) | 2003-02-20 | 2004-09-02 | University Of Connecticut Health Center | Methods and compositions for the treatment of cancer and infectious disease using alpha (2) macroglobulin-antigenic molecule complexes |
WO2004084938A1 (en) | 2003-03-24 | 2004-10-07 | Intercell Ag | Improved vaccines |
WO2004092360A2 (en) | 2003-04-10 | 2004-10-28 | Chiron Corporation | The severe acute respiratory syndrome coronavirus |
US6821957B2 (en) | 1997-05-20 | 2004-11-23 | University Of Iowa Research Foundation | Vectors and methods for immunization or therapeutic protocols |
US6887464B1 (en) | 1999-02-02 | 2005-05-03 | Biocache Pharmaceuticals, Inc. | Advanced antigen presentation platform |
US6943240B2 (en) | 2000-09-15 | 2005-09-13 | Coley Pharmaceuticals Gmbh | Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist |
US6949520B1 (en) | 1999-09-27 | 2005-09-27 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
US6964769B2 (en) * | 2000-05-05 | 2005-11-15 | Cytos Biotechnology Ag | Molecular antigen array |
US7001890B1 (en) | 1997-01-23 | 2006-02-21 | Coley Pharmaceutical Gmbh | Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination |
WO2006020581A2 (en) | 2004-08-09 | 2006-02-23 | Elan Pharmaceuticals, Inc. | Prevention and treatment of synucleinopathic and amyloidogenic disease |
US7038029B2 (en) | 2002-05-30 | 2006-05-02 | Immunotech S.A. | Immunostimulatory oligonucleotides and uses thereof |
US7049302B1 (en) | 1998-08-10 | 2006-05-23 | Antigenics Inc. | Compositions of CPG and saponin adjuvants and uses thereof |
WO2006086799A2 (en) | 2005-02-11 | 2006-08-17 | Novartis Vaccines And Diagnostics Inc. | Prion-specific peptide reagents |
US7094409B2 (en) | 2001-01-19 | 2006-08-22 | Cytos Biotechnology Ag | Antigen arrays for treatment of allergic eosinophilic diseases |
WO2006110655A2 (en) | 2005-04-08 | 2006-10-19 | Chimerix, Inc. | Compounds, compositions and methods for the treatment of poxvirus infections |
US7125857B2 (en) | 1997-08-29 | 2006-10-24 | The Regents Of The University Of California | Modulators of DNA cytosine-5 methyltransferase and methods for use thereof |
US7129222B2 (en) | 2000-03-10 | 2006-10-31 | Dynavax Technologies Corporation | Immunomodulatory formulations and methods for use thereof |
EP1746159A2 (en) * | 1996-10-30 | 2007-01-24 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
WO2007052058A1 (en) * | 2005-11-04 | 2007-05-10 | Novartis Vaccines And Diagnostics Srl | Influenza vaccines including combinations of particulate adjuvants and immunopotentiators |
US7223398B1 (en) | 1999-11-15 | 2007-05-29 | Dynavax Technologies Corporation | Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof |
US7250403B2 (en) | 2000-03-10 | 2007-07-31 | Dynavax Technologies Corporation | Biodegradable immunomodulatory formulations and methods for use thereof |
US7255868B2 (en) | 2001-06-21 | 2007-08-14 | Dynavax Technologies Corporation | Chimeric immunomodulatory compounds and methods of using the same—I |
US7279165B2 (en) | 2002-07-19 | 2007-10-09 | Cytos Biotechnology Ag | Amyloid β1-6 antigen arrays |
EP1841777A1 (en) * | 2005-01-28 | 2007-10-10 | Kwon, Hyung-Joo | Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell |
US7282476B2 (en) | 2001-08-24 | 2007-10-16 | University Of Victoria Innovation And Development Corporation | Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer |
WO2007119815A1 (en) | 2006-04-14 | 2007-10-25 | Kyowa Hakko Kirin Co., Ltd. | Toll-like receptor 9 agonists |
WO2008020335A2 (en) | 2006-06-09 | 2008-02-21 | Novartis Ag | Immunogenic compositions for streptococcus agalactiae |
WO2008042024A2 (en) | 2006-06-01 | 2008-04-10 | Elan Pharmaceuticals, Inc. | Neuroactive fragments of app |
US7378234B2 (en) | 2002-09-13 | 2008-05-27 | Intercell Ag | Method for isolating hepatitis C virus peptides |
EP1985702A2 (en) | 2000-12-08 | 2008-10-29 | Coley Pharmaceuticals GmbH | CPG-like nucleic acids and methods of use thereof |
EP1992635A1 (en) | 2002-12-23 | 2008-11-19 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
US7479285B1 (en) | 1999-08-19 | 2009-01-20 | Dynavax Technologies Corporation | Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein |
WO2009034473A2 (en) | 2007-09-12 | 2009-03-19 | Novartis Ag | Gas57 mutant antigens and gas57 antibodies |
US7514415B2 (en) | 2002-08-01 | 2009-04-07 | The United States Of America As Represented By The Department Of Health And Human Services | Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides |
US7514414B2 (en) | 2001-09-24 | 2009-04-07 | The United States Of America As Represented By The Department Of Health And Human Services | Suppressors of CpG oligonucleotides and methods of use |
US7517520B2 (en) | 2003-03-26 | 2009-04-14 | Cytos Biotechnology Ag | Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use |
US7534772B2 (en) * | 2000-06-22 | 2009-05-19 | University Of Iowa Research Foundation | Methods for enhancing antibody-induced cell lysis and treating cancer |
US7537767B2 (en) | 2003-03-26 | 2009-05-26 | Cytis Biotechnology Ag | Melan-A- carrier conjugates |
WO2009086539A2 (en) | 2007-12-28 | 2009-07-09 | Elan Pharmaceuticals, Inc. | Treatment and prophylaxis of amyloidosis |
US7597908B2 (en) | 1997-01-30 | 2009-10-06 | Novartis Vaccines And Diagnostics, Inc. | Use of microparticles with adsorbed antigen to stimulate immune responses |
EP2108374A1 (en) | 2004-04-30 | 2009-10-14 | Novartis Vaccines and Diagnostics S.r.l. | Combined meningococcal conjugates with common carrier protein |
EP2149583A1 (en) | 2004-09-24 | 2010-02-03 | Intercell AG | Modified VP1-capsid protein of parvovirus B19 |
WO2010032138A2 (en) | 2008-09-18 | 2010-03-25 | Novartis Ag | Vaccine adjuvant combinations |
EP2168597A1 (en) | 2001-07-26 | 2010-03-31 | Novartis Vaccines and Diagnostics S.r.l. | Vaccines comprising aluminium adjuvants and histidine |
EP2179729A1 (en) | 2003-06-02 | 2010-04-28 | Novartis Vaccines and Diagnostics, Inc. | Immunogenic compositions based on microparticles comprising adsorbed toxoid and a polysaccharide-containing antigen |
US7727712B2 (en) | 2000-03-10 | 2010-06-01 | Dynavax Technologies Corporation | Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences |
EP2193810A1 (en) | 2005-01-14 | 2010-06-09 | Novartis Vaccines and Diagnostics S.r.l. | Meningococcal conjugate vaccination |
WO2010067286A2 (en) | 2008-12-09 | 2010-06-17 | Pfizer Vaccines Llc | IgE CH3 PEPTIDE VACCINE |
WO2010079464A1 (en) | 2009-01-12 | 2010-07-15 | Novartis Ag | Cna_b domain antigens in vaccines against gram positive bacteria |
WO2010100632A2 (en) | 2009-03-06 | 2010-09-10 | Novartis Ag | Chlamydia antigens |
WO2010109323A1 (en) | 2009-03-24 | 2010-09-30 | Novartis Ag | Adjuvanting meningococcal factor h binding protein |
WO2010115118A2 (en) | 2009-04-03 | 2010-10-07 | Antigenics, Inc. | Methods for preparing and using multichaperone-antigen complexes |
WO2010138193A2 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents |
EP2258389A1 (en) | 2002-08-30 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Improved bacterial outer membrane vesicles |
EP2258717A2 (en) | 2002-11-22 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Variant form of meningococcal NadA |
EP2263687A1 (en) | 2002-12-27 | 2010-12-22 | Novartis Vaccines&Diagnostics, Inc. | Immunogenic compositions containing phospholipid |
EP2263688A1 (en) | 2001-06-20 | 2010-12-22 | Novartis AG | Neisseria meningitidis combination vaccines |
WO2010146414A1 (en) | 2009-06-15 | 2010-12-23 | National University Of Singapore | Influenza vaccine, composition, and methods of use |
US7858588B2 (en) | 2001-05-21 | 2010-12-28 | Intercell Ag | Immunostimulatory oligodeoxynucleic molecules |
EP2267036A1 (en) | 2003-10-02 | 2010-12-29 | Novartis Vaccines and Diagnostics S.r.l. | Hypo- and Hyper-Acetylated Meningococcal Capsular Saccharides |
US7867499B2 (en) | 2004-11-05 | 2011-01-11 | Novartis Ag | Methods of treating dementia by administering virus-like particles coupled to Aβ |
EP2272539A2 (en) | 2004-10-19 | 2011-01-12 | Elan Pharmaceuticals, Inc. | Truncated fragments of alpha-synuclein in lewy body disease |
EP2272531A2 (en) | 2004-04-30 | 2011-01-12 | Novartis Vaccines and Diagnostics S.r.l. | Integration of meningococcal conjugate vaccination |
WO2011008974A2 (en) | 2009-07-15 | 2011-01-20 | Novartis Ag | Rsv f protein compositions and methods for making same |
WO2011007257A1 (en) | 2009-07-16 | 2011-01-20 | Novartis Ag | Detoxified escherichia coli immunogens |
EP2277894A1 (en) | 2000-10-27 | 2011-01-26 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A & B |
EP2277538A1 (en) | 2003-10-02 | 2011-01-26 | Novartis Vaccines and Diagnostics S.r.l. | Combined meningitis vaccines |
EP2279747A1 (en) | 2004-10-29 | 2011-02-02 | Novartis Vaccines and Diagnostics S.r.l. | Immunogenic bacterial vesicles with outer membrane proteins |
EP2279746A2 (en) | 2002-11-15 | 2011-02-02 | Novartis Vaccines and Diagnostics S.r.l. | Surface proteins in neisseria meningitidis |
WO2011013034A1 (en) | 2009-07-30 | 2011-02-03 | Pfizer Vaccines Llc | Antigenic tau peptides and uses thereof |
EP2286792A1 (en) | 1999-02-26 | 2011-02-23 | Novartis Vaccines and Diagnostics, Inc. | Microemulsions with an adsorbent surface, comprising a microdroplet emulsion |
EP2289546A2 (en) | 2003-01-30 | 2011-03-02 | Novartis Vaccines and Diagnostics S.r.l. | Injectable vaccines against multiple meningococcal serogroups |
EP2289547A1 (en) | 2003-09-12 | 2011-03-02 | Antigenics Inc. | Vaccine for treatment and prevention of herpes simplex virus infection |
EP2289941A2 (en) | 2002-02-25 | 2011-03-02 | Elan Pharmaceuticals Inc. | Administration of agents for the treatment of inflammation |
WO2011024071A1 (en) | 2009-08-27 | 2011-03-03 | Novartis Ag | Adjuvant comprising aluminium, oligonucleotide and polycation |
WO2011024072A2 (en) | 2009-08-27 | 2011-03-03 | Novartis Ag | Hybrid polypeptides including meningococcal fhbp sequences |
US7901907B2 (en) | 1996-01-04 | 2011-03-08 | The Provost Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin | Process for production of Helicobacter pylori bacterioferritin |
EP2292247A2 (en) | 2002-03-05 | 2011-03-09 | Ramot at Tel Aviv University Ltd. | Immunizing composition and method for inducing an immune response against the beta-secretase cleavage site of amyloid precursor protein |
WO2011027257A2 (en) | 2009-09-03 | 2011-03-10 | Pfizer Vaccines Llc | Pcsk9 vaccine |
WO2011030218A1 (en) | 2009-09-10 | 2011-03-17 | Novartis Ag | Combination vaccines against respiratory tract diseases |
EP2298795A1 (en) | 2005-02-18 | 2011-03-23 | Novartis Vaccines and Diagnostics, Inc. | Immunogens from uropathogenic escherichia coli |
WO2011036562A1 (en) | 2009-09-28 | 2011-03-31 | Novartis Vaccines Institute For Global Health Srl | Purification of bacterial vesicles |
WO2011036564A2 (en) | 2009-09-28 | 2011-03-31 | Novartis Vaccines Institute For Global Health Srl | Hyperblebbing shigella strains |
EP2305302A2 (en) | 1999-05-28 | 2011-04-06 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic disease |
WO2011039631A2 (en) | 2009-09-30 | 2011-04-07 | Novartis Ag | Expression of meningococcal fhbp polypeptides |
WO2011048561A1 (en) | 2009-10-20 | 2011-04-28 | Novartis Ag | Diagnostic and therapeutic methods for rheumatic heart disease based upon group a streptococcus markers |
WO2011051893A1 (en) | 2009-10-27 | 2011-05-05 | Novartis Ag | Modified meningococcal fhbp polypeptides |
WO2011058302A1 (en) | 2009-11-10 | 2011-05-19 | Guy's And St Thomas's Nhs Foundation Trust | Bacteremia-associated antigen from staphylococcus aureus |
EP2327719A1 (en) | 2001-09-06 | 2011-06-01 | Novartis Vaccines and Diagnostics S.r.l. | Hybrid and tandem expression of neisserial proteins |
US7956043B2 (en) | 2002-12-11 | 2011-06-07 | Coley Pharmaceutical Group, Inc. | 5′ CpG nucleic acids and methods of use |
EP2329843A2 (en) | 2005-04-18 | 2011-06-08 | Novartis Vaccines and Diagnostics, Inc. | Expressing Hepatitis B Virus surface antigen for vaccine preparation |
WO2011077309A2 (en) | 2009-12-22 | 2011-06-30 | Pfizer Vaccines Llc | Vaccine compositions |
EP1950296A3 (en) * | 2000-01-14 | 2011-07-06 | The Government of the United States of America, as represented by the Secretary of Health and Human Services | Oligodeoxynucleotide and its use to induce an immune response |
EP2341069A1 (en) | 2004-05-14 | 2011-07-06 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptides from non-typeable haemophilus influenzae |
EP2351579A1 (en) | 2002-10-11 | 2011-08-03 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptide vaccines for broad protection against hypervirulent meningococcal lineages |
EP2351772A1 (en) | 2005-02-18 | 2011-08-03 | Novartis Vaccines and Diagnostics, Inc. | Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli |
EP2357000A1 (en) | 2005-10-18 | 2011-08-17 | Novartis Vaccines and Diagnostics, Inc. | Mucosal and systemic immunizations with alphavirus replicon particles |
EP2357184A1 (en) | 2006-03-23 | 2011-08-17 | Novartis AG | Imidazoquinoxaline compounds as immunomodulators |
EP2360175A2 (en) | 2005-11-22 | 2011-08-24 | Novartis Vaccines and Diagnostics, Inc. | Norovirus and Sapovirus virus-like particles (VLPs) |
EP2361629A1 (en) | 2002-11-01 | 2011-08-31 | Elan Pharmaceuticals Inc. | Prevention and treatment of synucleinopathic disease |
EP2361928A1 (en) | 2003-05-19 | 2011-08-31 | Elan Pharmaceuticals Inc. | Truncated fragments of alpha-synuclein in Lewy body disease |
WO2011104632A1 (en) | 2010-02-26 | 2011-09-01 | Novartis Ag | Immunogenic proteins and compositions |
EP2364719A1 (en) | 1999-06-01 | 2011-09-14 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic diseases |
EP2368572A2 (en) | 2005-11-04 | 2011-09-28 | Novartis Vaccines and Diagnostics S.r.l. | Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture |
WO2011121576A2 (en) | 2010-04-01 | 2011-10-06 | Novartis Ag | Immunogenic proteins and compositions |
WO2011127316A1 (en) | 2010-04-07 | 2011-10-13 | Novartis Ag | Method for generating a parvovirus b19 virus-like particle |
EP2377551A2 (en) | 2005-11-04 | 2011-10-19 | Novartis Vaccines and Diagnostics S.r.l. | Adjuvanted influenza vaccines including cytokine-inducing agents |
EP2377552A2 (en) | 2005-11-04 | 2011-10-19 | Novartis Vaccines and Diagnostics S.r.l. | Influenza vaccines with reduced amount of emulsion adjuvant |
WO2011130379A1 (en) | 2010-04-13 | 2011-10-20 | Novartis Ag | Benzonapthyridine compositions and uses thereof |
US8043622B2 (en) | 2002-10-08 | 2011-10-25 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides |
EP2382987A1 (en) | 2006-03-24 | 2011-11-02 | Novartis Vaccines and Diagnostics GmbH | Storage of influenza vaccines without refrigeration |
EP2382988A1 (en) | 2006-03-31 | 2011-11-02 | Novartis AG | Combined mucosal and parenteral immunization against HIV |
EP2385126A1 (en) | 2005-11-25 | 2011-11-09 | Novartis Vaccines and Diagnostics S.r.l. | Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870 |
WO2011138636A1 (en) | 2009-09-30 | 2011-11-10 | Novartis Ag | Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides |
WO2011149564A1 (en) | 2010-05-28 | 2011-12-01 | Tetris Online, Inc. | Interactive hybrid asynchronous computer game infrastructure |
WO2011154878A1 (en) | 2010-06-07 | 2011-12-15 | Pfizer Vaccines Llc | Ige ch3 peptide vaccine |
WO2011154863A1 (en) | 2010-06-07 | 2011-12-15 | Pfizer Inc. | Her-2 peptides and vaccines |
WO2011161653A1 (en) | 2010-06-25 | 2011-12-29 | Novartis Ag | Combinations of meningococcal factor h binding proteins |
WO2011161551A2 (en) | 2010-06-11 | 2011-12-29 | Novartis Ag | Omv vaccines |
WO2012006293A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Norovirus derived immunogenic compositions and methods |
WO2012006359A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Delivery of self-replicating rna using biodegradable polymer particles |
WO2012009442A2 (en) | 2010-07-14 | 2012-01-19 | Merck Sharp & Dohme Corp. | Anti-addl monoclonal antibody and uses thereof |
WO2012020326A1 (en) | 2010-03-18 | 2012-02-16 | Novartis Ag | Adjuvanted vaccines for serogroup b meningococcus |
WO2012035519A1 (en) | 2010-09-16 | 2012-03-22 | Novartis Ag | Immunogenic compositions |
EP2433647A2 (en) | 2005-01-27 | 2012-03-28 | Children's Hospital & Research Center at Oakland | GNA1870-based vesicle vaccines for broad spectrum protection against diseases caused by Neisseria meningitidis |
US8153141B2 (en) | 2002-04-04 | 2012-04-10 | Coley Pharmaceutical Gmbh | Immunostimulatory G, U-containing oligoribonucleotides |
US8158768B2 (en) | 2002-12-23 | 2012-04-17 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
WO2012049662A1 (en) | 2010-10-15 | 2012-04-19 | Novartis Vaccines Institute For Global Health Srl | Hyperblebbing salmonella strains |
EP2450056A1 (en) | 2005-07-19 | 2012-05-09 | Elan Pharma International Limited | Prevention and treatment of synucleinopathic and amyloidogenic disease |
WO2012072769A1 (en) | 2010-12-01 | 2012-06-07 | Novartis Ag | Pneumococcal rrgb epitopes and clade combinations |
EP2465872A2 (en) | 2004-10-25 | 2012-06-20 | Merck Sharp & Dohme Corporation | Anti-ADDL Antibodies and uses thereof |
WO2012085668A2 (en) | 2010-12-24 | 2012-06-28 | Novartis Ag | Compounds |
US8222225B2 (en) | 2008-05-21 | 2012-07-17 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating pneumoconiosis with oligodeoxynucleotides |
EP2478916A1 (en) | 2006-01-27 | 2012-07-25 | Novartis Vaccines and Diagnostics GmbH | Influenza vaccines containing hemagglutinin and matrix proteins |
WO2012103361A1 (en) | 2011-01-26 | 2012-08-02 | Novartis Ag | Rsv immunization regimen |
EP2484377A1 (en) | 2007-06-27 | 2012-08-08 | Novartis AG | Low-additive influenza vaccines |
EP2497495A2 (en) | 2006-09-11 | 2012-09-12 | Novartis AG | Making influenza virus vaccines without using eggs |
WO2012131504A1 (en) | 2011-03-02 | 2012-10-04 | Pfizer Inc. | Pcsk9 vaccine |
EP2510947A1 (en) | 2009-04-14 | 2012-10-17 | Novartis AG | Compositions for immunising against Staphylococcus aureus |
EP2514437A1 (en) | 2006-07-20 | 2012-10-24 | Novartis AG | Frozen stockpiling of influenza vaccines |
WO2012143902A1 (en) | 2011-04-22 | 2012-10-26 | Wyeth Llc | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
WO2012158613A1 (en) | 2011-05-13 | 2012-11-22 | Novartis Ag | Pre-fusion rsv f antigens |
WO2012167046A1 (en) | 2011-06-01 | 2012-12-06 | Janus Biotherapeutics, Inc. | Novel immune system modulators |
EP2532362A1 (en) | 2006-12-06 | 2012-12-12 | Novartis AG | Vaccines including antigen from four strains of influenza virus |
EP2537857A2 (en) | 2007-12-21 | 2012-12-26 | Novartis AG | Mutant forms of streptolysin O |
WO2013006842A2 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic compositions and uses thereof |
WO2013006838A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic combination compositions and uses thereof |
EP2545931A1 (en) | 2004-03-19 | 2013-01-16 | Herbs Spring, LLC | Herbal therapy for the treatment of food allergy |
WO2013009564A1 (en) | 2011-07-08 | 2013-01-17 | Novartis Ag | Tyrosine ligation process |
EP2548895A1 (en) | 2007-01-11 | 2013-01-23 | Novartis AG | Modified saccharides |
WO2013016460A1 (en) | 2011-07-25 | 2013-01-31 | Novartis Ag | Compositions and methods for assessing functional immunogenicity of parvovirus vaccines |
US8372413B2 (en) | 2000-12-27 | 2013-02-12 | Dynavax Technologies Corporation | Immunomodulatory polynucleotides and methods of using the same |
WO2013030783A1 (en) | 2011-08-30 | 2013-03-07 | Novartis Ag | Immunogenic proteins and compositions |
WO2013038375A2 (en) | 2011-09-14 | 2013-03-21 | Novartis Ag | Methods for making saccharide-protein glycoconjugates |
WO2013038385A2 (en) | 2011-09-14 | 2013-03-21 | Novartis Ag | Escherichia coli vaccine combination |
EP2572726A1 (en) | 2007-08-01 | 2013-03-27 | Novartis AG | Compositions comprising pneumococcal antigens |
EP2583978A2 (en) | 2007-02-23 | 2013-04-24 | The Regents of the University of California | Prevention and treatment of synucleinopathic and amyloidogenic disease |
EP2586790A2 (en) | 2006-08-16 | 2013-05-01 | Novartis AG | Immunogens from uropathogenic Escherichia coli |
WO2013068949A1 (en) | 2011-11-07 | 2013-05-16 | Novartis Ag | Carrier molecule comprising a spr0096 and a spr2021 antigen |
WO2013084071A2 (en) | 2011-12-08 | 2013-06-13 | Novartis Ag | Clostridium difficile toxin-based vaccine |
EP2612679A1 (en) | 2004-07-29 | 2013-07-10 | Novartis Vaccines and Diagnostics, Inc. | Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae |
EP2614835A1 (en) | 2007-11-26 | 2013-07-17 | Novartis AG | Vaccination with multiple clades of H5 influenza A virus |
EP2614709A1 (en) | 2005-07-18 | 2013-07-17 | Novartis AG | Small animal model for HCV replication |
WO2013108272A2 (en) | 2012-01-20 | 2013-07-25 | International Centre For Genetic Engineering And Biotechnology | Blood stage malaria vaccine |
EP2631245A1 (en) | 2008-03-10 | 2013-08-28 | Children's Hospital & Research Center at Oakland | Chimeric factor H binding proteins (fHBP) containing a heterologous B domain and methods of use |
WO2013124473A1 (en) | 2012-02-24 | 2013-08-29 | Novartis Ag | Pilus proteins and compositions |
WO2013160335A2 (en) | 2012-04-26 | 2013-10-31 | Novartis Ag | Antigens and antigen combinations |
US8574599B1 (en) | 1998-05-22 | 2013-11-05 | Ottawa Hospital Research Institute | Methods and products for inducing mucosal immunity |
EP2659912A2 (en) | 2007-07-17 | 2013-11-06 | Novartis AG | Conjugate purification |
WO2013164754A2 (en) | 2012-05-04 | 2013-11-07 | Pfizer Inc. | Prostate-associated antigens and vaccine-based immunotherapy regimens |
DE202005022108U1 (en) | 2004-03-09 | 2013-11-12 | Novartis Vaccines And Diagnostics, Inc. | Influenza virus vaccines |
WO2013174832A1 (en) | 2012-05-22 | 2013-11-28 | Novartis Ag | Meningococcus serogroup x conjugate |
WO2014005958A1 (en) | 2012-07-06 | 2014-01-09 | Novartis Ag | Immunogenic compositions and uses thereof |
US8691209B2 (en) | 2001-09-14 | 2014-04-08 | Cytos Biotechnology Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
WO2014053612A1 (en) | 2012-10-03 | 2014-04-10 | Novartis Ag | Immunogenic composition |
WO2014060898A2 (en) | 2012-10-21 | 2014-04-24 | Pfizer Inc. | Compositions and methods relating to a mutant clostridium difficile toxin |
US8808692B2 (en) | 2001-12-21 | 2014-08-19 | Csl Limited | Compositions comprising immunoreactive reagents and saponins, and methods of use thereof |
US8834900B2 (en) | 2001-08-17 | 2014-09-16 | University Of Iowa Research Foundation | Combination motif immune stimulatory oligonucleotides with improved activity |
WO2014165271A2 (en) | 2013-03-13 | 2014-10-09 | Neotope Biosciences Limited | Tau immunotherapy |
US8895521B2 (en) | 2004-05-06 | 2014-11-25 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Methods and compositions for the treatment of uveitis |
EP2811027A1 (en) | 2004-05-21 | 2014-12-10 | Novartis Vaccines and Diagnostics, Inc. | Alphavirus vectors for RSV and PIV vaccines |
US8916161B2 (en) | 2005-06-14 | 2014-12-23 | Sophiris Bio Inc. | Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins |
US8932605B2 (en) | 2008-04-18 | 2015-01-13 | Vaxinnate Corporation | Deletion mutants of flagellin and methods of use |
WO2015022401A1 (en) * | 2013-08-14 | 2015-02-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Immunoadjuvant compositions and uses thereof |
US9006218B2 (en) | 2010-02-12 | 2015-04-14 | Chimerix Inc. | Nucleoside phosphonate salts |
WO2015063647A1 (en) | 2013-11-01 | 2015-05-07 | Pfizer Inc. | Vectors for expression of prostate-associated antigens |
WO2015068129A1 (en) | 2013-11-08 | 2015-05-14 | Novartis Ag | Salmonella conjugate vaccines |
WO2015075635A2 (en) | 2013-11-19 | 2015-05-28 | Prothena Biosciences Limited | Monitoring immunotherapy of lewy body disease from constipation symptoms |
EP2886551A2 (en) | 2008-02-21 | 2015-06-24 | Novartis AG | Meningococcal fhbp polypeptides |
US9066978B2 (en) | 2010-05-26 | 2015-06-30 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
EP2889042A2 (en) | 2008-03-18 | 2015-07-01 | Novartis AG | Improvements in preparation of influenza virus vaccine antigens |
EP2891498A1 (en) | 2007-12-20 | 2015-07-08 | Novartis AG | Fermentation processes for cultivating streptococci and purification processes for obtaining CPS therefrom |
WO2015123291A1 (en) | 2014-02-11 | 2015-08-20 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Pcsk9 vaccine and methods of using the same |
WO2015136470A1 (en) | 2014-03-12 | 2015-09-17 | Prothena Biosciences Limited | Anti-mcam antibodies and associated methods of use |
WO2015136469A1 (en) | 2014-03-12 | 2015-09-17 | Prothena Biosciences Limited | Anti-mcam antibodies and associated methods of use |
US9200042B2 (en) | 2006-03-07 | 2015-12-01 | Vaxinnate Corporation | Flagellin fusion proteins |
EP2952524A1 (en) | 2007-10-17 | 2015-12-09 | Janssen Sciences Ireland UC | Immunotherapy regimes dependent on apoe status |
US9353115B2 (en) | 2011-06-01 | 2016-05-31 | Janus Biotherapeutics, Inc. | Immune system modulators |
EP3067066A1 (en) | 2007-02-23 | 2016-09-14 | Prothena Biosciences Limited | Prevention and treatment of synucleinopathic and amyloidogenic disease |
EP3067048A1 (en) | 2007-12-07 | 2016-09-14 | Novartis Ag | Compositions for inducing immune responses |
WO2016183486A1 (en) | 2015-05-13 | 2016-11-17 | Agenus Inc. | Vaccines for treatment and prevention of cancer |
WO2016207853A2 (en) | 2015-06-26 | 2016-12-29 | Seqirus UK Limited | Antigenically matched influenza vaccines |
US9539217B2 (en) | 2013-04-03 | 2017-01-10 | Allertein Therapeutics, Llc | Nanoparticle compositions |
US9597385B2 (en) | 2012-04-23 | 2017-03-21 | Allertein Therapeutics, Llc | Nanoparticles for treatment of allergy |
WO2017046776A2 (en) | 2015-09-16 | 2017-03-23 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis |
WO2017046774A2 (en) | 2015-09-16 | 2017-03-23 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis |
WO2017125844A1 (en) | 2016-01-19 | 2017-07-27 | Pfizer Inc. | Cancer vaccines |
WO2017153955A1 (en) | 2016-03-09 | 2017-09-14 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases |
WO2017153953A1 (en) | 2016-03-09 | 2017-09-14 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases |
US9764027B2 (en) | 2012-09-18 | 2017-09-19 | Glaxosmithkline Biologicals Sa | Outer membrane vesicles |
US9809824B2 (en) | 2004-12-13 | 2017-11-07 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods |
WO2017191559A1 (en) | 2016-05-02 | 2017-11-09 | Prothena Biosciences Limited | Tau immunotherapy |
WO2017191561A1 (en) | 2016-05-02 | 2017-11-09 | Prothena Biosciences Limited | Antibodies recognizing tau |
WO2017191560A1 (en) | 2016-05-02 | 2017-11-09 | Prothena Biosciences Limited | Antibodies recognizing tau |
US9873694B2 (en) | 2011-10-04 | 2018-01-23 | Janus Biotherapeutics, Inc. | Imidazole quinoline-based immune system modulators |
US9931398B2 (en) | 2012-01-16 | 2018-04-03 | Labyrinth Holdings, Llc | Naturally-occurring CpG oligonucleotide compositions and therapeutic applications thereof |
EP3327028A1 (en) | 2010-03-30 | 2018-05-30 | Children's Hospital & Research Center at Oakland | Factor h binding proteins (fhbp) with altered properties and methods of use thereof |
US9994443B2 (en) | 2010-11-05 | 2018-06-12 | Selecta Biosciences, Inc. | Modified nicotinic compounds and related methods |
EP3398948A2 (en) | 2014-08-22 | 2018-11-07 | Janus Biotherapeutics, Inc. | 2,4,6,7-tetrasubstituted pteridine compounds and methods of synthesis and use thereof |
US10149869B2 (en) | 2012-01-16 | 2018-12-11 | Labyrinth Holdings, Llc | Compositions and methods for the treatment of hepatic diseases and disorders |
US10149901B2 (en) | 2009-02-10 | 2018-12-11 | Seqirus UK Limited | Influenza vaccines with reduced amounts of squalene |
WO2019064115A1 (en) | 2017-09-28 | 2019-04-04 | Pfizer Inc. | Compositions and methods for eliciting an immune response against clostridium difficile |
US10279026B2 (en) | 2012-04-26 | 2019-05-07 | Glaxosmithkline Biologicals Sa | Antigens and antigen combinations |
EP3498302A1 (en) | 2005-02-01 | 2019-06-19 | Novartis Vaccines and Diagnostics S.r.l. | Conjugation of streptococcal capsular saccharides to carrier proteins |
EP3639850A1 (en) | 2014-03-26 | 2020-04-22 | GlaxoSmithKline Biologicals S.A. | Mutant staphylococcal antigens |
EP3689375A1 (en) | 2013-05-15 | 2020-08-05 | The Governors Of The University Of Alberta | E1e2 hcv vaccines and methods of use |
WO2020201985A1 (en) | 2019-04-01 | 2020-10-08 | Pfizer Inc. | Compositions and methods for eliciting an immune response against clostridium difficile |
US10933129B2 (en) | 2011-07-29 | 2021-03-02 | Selecta Biosciences, Inc. | Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses |
WO2021255690A2 (en) | 2020-06-19 | 2021-12-23 | Pfizer Inc. | Immunogenic compositions against clostridioides (clostridium) difficile and methods thereof |
WO2022147373A1 (en) | 2020-12-31 | 2022-07-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Antibody-guided pcsk9-mimicking immunogens lacking 9-residue sequence overlap with human proteins |
WO2022196699A1 (en) | 2021-03-16 | 2022-09-22 | 国立大学法人大阪大学 | Follicular helper t (tfh) cells specific to sars-cov-2 virus |
WO2022196701A1 (en) | 2021-03-16 | 2022-09-22 | 国立大学法人大阪大学 | Novel medical technique using follicular t-cells |
US11633471B2 (en) | 2018-03-06 | 2023-04-25 | Unm Rainforest Innovations | Compositions and methods for reducing serum triglycerides |
US11707520B2 (en) | 2005-11-03 | 2023-07-25 | Seqirus UK Limited | Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture |
WO2023201109A1 (en) | 2022-04-15 | 2023-10-19 | Yale University | Exatecan formulation |
EP4272750A2 (en) | 2013-02-07 | 2023-11-08 | Children's Medical Center, Corp. | Protein antigens that provide protection against pneumococcal colonization and/or disease |
US11926659B2 (en) | 2019-03-03 | 2024-03-12 | Prothena Biosciences Limited | Antibodies recognizing tau |
US11958896B2 (en) | 2017-05-02 | 2024-04-16 | Prothena Biosciences Limited | Antibodies recognizing tau |
WO2024127215A2 (en) | 2022-12-13 | 2024-06-20 | Pfizer Inc. | Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile |
US12018063B2 (en) | 2020-02-26 | 2024-06-25 | Versitech Limited | PD-1-based vaccines against coronavirus infection |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2003517452A (en) * | 1999-02-05 | 2003-05-27 | アルク−アベル・アー/エス | New mucosal delivery system |
WO2007004979A1 (en) | 2005-07-01 | 2007-01-11 | Index Pharmaceuticals Ab | Method for modulating responsiveness to steroids |
DK2380584T3 (en) | 2005-07-01 | 2014-01-20 | Index Pharmaceuticals Ab | IMMUNSTIMULATING PROCEDURE |
CA2625969A1 (en) | 2005-10-28 | 2007-05-03 | Index Pharmaceuticals Ab | Composition and method for the prevention, treatment and/or alleviation of an inflammatory disease |
NZ602945A (en) | 2008-06-27 | 2014-05-30 | Zoetis Llc | Novel adjuvant compositions |
CN109675026A (en) | 2013-09-19 | 2019-04-26 | 硕腾服务有限责任公司 | Oil-based adjuvants |
SI3244920T1 (en) | 2015-01-16 | 2023-09-29 | The United States of America, represented by The Secretary of Agriculture, United States Department of Agriculture | Foot-and-mouth disease vaccine |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0092574A1 (en) | 1981-10-23 | 1983-11-02 | Molecular Biosystems Inc | Oligonucleotide therapeutic agent and methods of making same. |
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US5663153A (en) * | 1994-03-25 | 1997-09-02 | Isis Pharmaceuticals, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
WO1997040163A1 (en) * | 1996-04-19 | 1997-10-30 | Metin Colpan | Nucleic acid vaccination for parvoviral infections |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
ATE420171T1 (en) * | 1994-07-15 | 2009-01-15 | Univ Iowa Res Found | IMMUNOMODULATORY OLIGONUCLEOTIDES |
US5780448A (en) * | 1995-11-07 | 1998-07-14 | Ottawa Civic Hospital Loeb Research | DNA-based vaccination of fish |
EP0879284B1 (en) * | 1996-01-30 | 2009-07-29 | The Regents of The University of California | Gene expression vectors which generate an antigen specific immune response and methods of using the same |
ATE292980T1 (en) * | 1996-10-11 | 2005-04-15 | Univ California | IMMUNO-STIMULATING OLIGONUCLEOTIDE CONJUGATES |
EP0855184A1 (en) * | 1997-01-23 | 1998-07-29 | Grayson B. Dr. Lipford | Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination |
-
1998
- 1998-03-10 DK DK98912919T patent/DK1005368T3/en active
- 1998-03-10 CA CA 2283557 patent/CA2283557A1/en not_active Abandoned
- 1998-03-10 AU AU67595/98A patent/AU753688B2/en not_active Ceased
- 1998-03-10 WO PCT/US1998/004703 patent/WO1998040100A1/en active IP Right Grant
- 1998-03-10 PT PT98912919T patent/PT1005368E/en unknown
- 1998-03-10 EP EP20090166906 patent/EP2172216A3/en not_active Withdrawn
- 1998-03-10 DE DE69841122T patent/DE69841122D1/en not_active Expired - Lifetime
- 1998-03-10 EP EP98912919A patent/EP1005368B1/en not_active Expired - Lifetime
- 1998-03-10 AT AT98912919T patent/ATE441432T1/en active
- 1998-03-10 JP JP53973098A patent/JP5087758B2/en not_active Expired - Fee Related
- 1998-03-10 ES ES98912919T patent/ES2333069T3/en not_active Expired - Lifetime
-
2009
- 2009-08-06 JP JP2009183917A patent/JP2009280606A/en not_active Withdrawn
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
EP0092574A1 (en) | 1981-10-23 | 1983-11-02 | Molecular Biosystems Inc | Oligonucleotide therapeutic agent and methods of making same. |
US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
US5663153A (en) * | 1994-03-25 | 1997-09-02 | Isis Pharmaceuticals, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
WO1997040163A1 (en) * | 1996-04-19 | 1997-10-30 | Metin Colpan | Nucleic acid vaccination for parvoviral infections |
Non-Patent Citations (5)
Title |
---|
BRANDA R. F., ET AL.: "AMPLIFICATION OF ANTIBODY PRODUCTION BY PHOSPHOROTHIOATE OLIGODEOXYNUCLEOTIDES.", JOURNAL OF LABORATORY AND CLINICAL MEDICINE, vol. 128., no. 03., 1 September 1996 (1996-09-01), pages 329 - 338., XP002910128, ISSN: 0022-2143, DOI: 10.1016/S0022-2143(96)90035-9 * |
CHU R. S., ET AL.: "CPG OLIGODEOXYNUCLEOTIDES ACT AS ADJUVANTS THAT SWITCH ON T HELPER 1 (TH1) IMMUNITY.", THE JOURNAL OF EXPERIMENTAL MEDICINE, ROCKEFELLER UNIVERSITY PRESS, US, vol. 186., no. 10., 1 November 1997 (1997-11-01), US, pages 1623 - 1631., XP002910130, ISSN: 0022-1007, DOI: 10.1084/jem.186.10.1623 * |
GOODCHILD, J., BIOCONJUGATE CHEM., vol. I, 1990, pages 165 |
KLINMAN D. M., ET AL.: "CONTRIBUTION OF CPG MOTIFS TO THE IMMUNOGENICITY OF DNA VACCINES.", THE JOURNAL OF IMMUNOLOGY, THE AMERICAN ASSOCIATION OF IMMUNOLOGISTS, US, vol. 158., 1 January 1997 (1997-01-01), US, pages 3635 - 3639., XP002910129, ISSN: 0022-1767 * |
UHLMANN, E; PEYMAN, A., CHEM. REV, vol. 90, 1990, pages 544 |
Cited By (468)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6727230B1 (en) | 1994-03-25 | 2004-04-27 | Coley Pharmaceutical Group, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
US7888327B2 (en) | 1994-07-15 | 2011-02-15 | University Of Iowa Research Foundation | Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions |
US6239116B1 (en) | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US8258106B2 (en) * | 1994-07-15 | 2012-09-04 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US6429199B1 (en) | 1994-07-15 | 2002-08-06 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules for activating dendritic cells |
US7901907B2 (en) | 1996-01-04 | 2011-03-08 | The Provost Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin | Process for production of Helicobacter pylori bacterioferritin |
EP1746159A3 (en) * | 1996-10-30 | 2009-11-25 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
EP2322615A1 (en) * | 1996-10-30 | 2011-05-18 | University Of Iowa Research Foundation | Use of unmethylated CpG oligonucleotides for the treatment of allergy |
EP2360252A1 (en) * | 1996-10-30 | 2011-08-24 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules comprising GTCGTT motifs |
EP1746159A2 (en) * | 1996-10-30 | 2007-01-24 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
US7001890B1 (en) | 1997-01-23 | 2006-02-21 | Coley Pharmaceutical Gmbh | Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination |
US7597908B2 (en) | 1997-01-30 | 2009-10-06 | Novartis Vaccines And Diagnostics, Inc. | Use of microparticles with adsorbed antigen to stimulate immune responses |
US6406705B1 (en) | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
US6821957B2 (en) | 1997-05-20 | 2004-11-23 | University Of Iowa Research Foundation | Vectors and methods for immunization or therapeutic protocols |
US6589940B1 (en) | 1997-06-06 | 2003-07-08 | Dynavax Technologies Corporation | Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof |
US8729039B2 (en) | 1997-06-06 | 2014-05-20 | The Regents Of The University Of California | Use of inhibitory oligonucleotides to treat autoimmune disease |
US6225292B1 (en) | 1997-06-06 | 2001-05-01 | The Regents Of The University Of California | Inhibitors of DNA immunostimulatory sequence activity |
US7125857B2 (en) | 1997-08-29 | 2006-10-24 | The Regents Of The University Of California | Modulators of DNA cytosine-5 methyltransferase and methods for use thereof |
US7138384B1 (en) | 1997-08-29 | 2006-11-21 | The Regents Of The University Of California | Modulators of DNA cytosine-5 methyltransferase and methods for use thereof |
US6218371B1 (en) | 1998-04-03 | 2001-04-17 | University Of Iowa Research Foundation | Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines |
US6689398B2 (en) | 1998-05-19 | 2004-02-10 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US6444233B1 (en) | 1998-05-19 | 2002-09-03 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US7105186B2 (en) | 1998-05-19 | 2006-09-12 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US6962720B2 (en) | 1998-05-19 | 2005-11-08 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US8324177B2 (en) | 1998-05-19 | 2012-12-04 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US7985435B2 (en) | 1998-05-19 | 2011-07-26 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US7670632B2 (en) | 1998-05-19 | 2010-03-02 | Research Development Foundation | Triterpene compositions and methods for use thereof |
US8574599B1 (en) | 1998-05-22 | 2013-11-05 | Ottawa Hospital Research Institute | Methods and products for inducing mucosal immunity |
US7858589B2 (en) | 1998-08-10 | 2010-12-28 | Antigenics Inc. | Compositions of CpG and saponin adjuvants and uses thereof |
US7049302B1 (en) | 1998-08-10 | 2006-05-23 | Antigenics Inc. | Compositions of CPG and saponin adjuvants and uses thereof |
WO2000015256A2 (en) * | 1998-09-11 | 2000-03-23 | Aventis Pasteur | Immunostimulant emulsion |
WO2000015256A3 (en) * | 1998-09-11 | 2000-07-13 | Pasteur Merieux Serums Vacc | Immunostimulant emulsion |
US7279555B2 (en) | 1999-02-02 | 2007-10-09 | Virginia Commonwealth University | Advanced antigen presentation platform |
US6887464B1 (en) | 1999-02-02 | 2005-05-03 | Biocache Pharmaceuticals, Inc. | Advanced antigen presentation platform |
US8221761B1 (en) | 1999-02-26 | 2012-07-17 | Novartis Ag | Enhancement of bactericidal activity of neisseria antigens with oligonucleotides containing CG motifs |
EP2286792A1 (en) | 1999-02-26 | 2011-02-23 | Novartis Vaccines and Diagnostics, Inc. | Microemulsions with an adsorbent surface, comprising a microdroplet emulsion |
JP2010174044A (en) * | 1999-02-26 | 2010-08-12 | Chiron Srl | Enhancement of bactericidal activity of neisseria antigen with oligonucleotide containing cg motif |
JP2002537353A (en) * | 1999-02-26 | 2002-11-05 | カイロン エセ.ピー.アー. | Enhancement of Neisseria antigen bactericidal activity using oligonucleotide containing CG motif |
JP4812942B2 (en) * | 1999-02-26 | 2011-11-09 | ノバルティス ヴァクシンズ アンド ダイアグノスティクス エスアールエル | Enhancement of Neisseria antigen bactericidal activity using oligonucleotides containing CG motif |
US7399472B2 (en) | 1999-04-19 | 2008-07-15 | Smithkline Beecham Biologicals | Vaccines |
US6558670B1 (en) | 1999-04-19 | 2003-05-06 | Smithkline Beechman Biologicals S.A. | Vaccine adjuvants |
US6544518B1 (en) | 1999-04-19 | 2003-04-08 | Smithkline Beecham Biologicals S.A. | Vaccines |
WO2000067023A1 (en) * | 1999-04-29 | 2000-11-09 | Coley Pharmaceutical Gmbh | Screening for immunostimulatory dna functional modifyers |
WO2000067787A3 (en) * | 1999-05-06 | 2001-04-26 | Immune Response Corp Inc | Hiv immunogenic compositions and methods |
WO2000067787A2 (en) * | 1999-05-06 | 2000-11-16 | The Immune Response Corporation | Hiv immunogenic compositions and methods |
US6737066B1 (en) | 1999-05-06 | 2004-05-18 | The Immune Response Corporation | HIV immunogenic compositions and methods |
EP2305302A2 (en) | 1999-05-28 | 2011-04-06 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic disease |
EP2364719A1 (en) | 1999-06-01 | 2011-09-14 | Janssen Alzheimer Immunotherapy | Prevention and treatment of amyloidogenic diseases |
WO2001000231A2 (en) * | 1999-06-29 | 2001-01-04 | Smithkline Beecham Biologicals S.A. | Use of cpg as an adjuvant for malaria vaccine |
WO2001000231A3 (en) * | 1999-06-29 | 2001-07-05 | Smithkline Beecham Biolog | Use of cpg as an adjuvant for malaria vaccine |
US8333980B2 (en) | 1999-08-19 | 2012-12-18 | Dynavax Technologies Corporation | Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein |
US7479285B1 (en) | 1999-08-19 | 2009-01-20 | Dynavax Technologies Corporation | Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein |
JP2003509341A (en) * | 1999-08-27 | 2003-03-11 | イネックス ファーマスーティカルズ コーポレイション | Composition for stimulating secretion of cytokine and inducing immune response |
WO2001015726A2 (en) * | 1999-08-27 | 2001-03-08 | Inex Pharmaceuticals Corp. | Compositions for stimulating cytokine secretion and inducing an immune response |
WO2001015726A3 (en) * | 1999-08-27 | 2001-07-26 | Inex Pharmaceuticals Corp | Compositions for stimulating cytokine secretion and inducing an immune response |
JP2003508494A (en) * | 1999-09-07 | 2003-03-04 | スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム | New composition |
JP4694745B2 (en) * | 1999-09-07 | 2011-06-08 | グラクソスミスクライン バイオロジカルズ ソシエテ アノニム | New composition |
KR100863630B1 (en) * | 1999-09-25 | 2008-10-15 | 유니버시티 오브 아이오와 리써치 파운데이션 | Immunostimulatory Nucleic Acids |
CZ301488B6 (en) * | 1999-09-25 | 2010-03-24 | University Of Iowa Research Foundation | Use of immunostimulatory nucleic acids |
AU2005203408B2 (en) * | 1999-09-25 | 2008-10-23 | Coley Pharmaceutical Gmbh | Immunostimulatory nucleic acids |
AU780979B2 (en) * | 1999-09-25 | 2005-04-28 | Coley Pharmaceutical Gmbh | Immunostimulatory nucleic acids |
EP1700603A2 (en) * | 1999-09-25 | 2006-09-13 | Coley Pharmaceutical GmbH | Immunostimulatory nucleic acids |
WO2001022972A3 (en) * | 1999-09-25 | 2002-01-17 | Univ Iowa Res Found | Immunostimulatory nucleic acids |
JP2003510282A (en) * | 1999-09-25 | 2003-03-18 | ユニバーシティ オブ アイオワ リサーチ ファウンデーション | Immunostimulatory nucleic acids |
US7271156B2 (en) | 1999-09-25 | 2007-09-18 | University Of Iowa Research Foundation | Immunostimulatory nucleic acids |
AP1775A (en) * | 1999-09-25 | 2007-08-28 | Univ Iowa Res Found | Immunostimulatory nucleic acids. |
EP1700603A3 (en) * | 1999-09-25 | 2007-06-13 | Coley Pharmaceutical GmbH | Immunostimulatory nucleic acids |
WO2001022972A2 (en) * | 1999-09-25 | 2001-04-05 | University Of Iowa Research Foundation | Immunostimulatory nucleic acids |
US6949520B1 (en) | 1999-09-27 | 2005-09-27 | Coley Pharmaceutical Group, Inc. | Methods related to immunostimulatory nucleic acid-induced interferon |
US7776344B2 (en) | 1999-09-27 | 2010-08-17 | University Of Iowa Research Foundation | Methods related to immunostimulatory nucleic acid-induced interferon |
US7628990B2 (en) | 1999-11-15 | 2009-12-08 | Dynavax Technologies Corporation | Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof |
US7223398B1 (en) | 1999-11-15 | 2007-05-29 | Dynavax Technologies Corporation | Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof |
EP1950296A3 (en) * | 2000-01-14 | 2011-07-06 | The Government of the United States of America, as represented by the Secretary of Health and Human Services | Oligodeoxynucleotide and its use to induce an immune response |
US7919477B2 (en) | 2000-01-14 | 2011-04-05 | The United States Of America As Represented By The Department Of Health And Human Services | Multiple CpG oligodeoxynucleotides and their use to induce an immune response |
US8232259B2 (en) | 2000-01-14 | 2012-07-31 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Multiple CpG oligodeoxynucleotide and their use to induce an immune response |
WO2001051500A1 (en) * | 2000-01-14 | 2001-07-19 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | Oligodeoxynucleotide and its use to induce an immune response |
WO2001095935A1 (en) * | 2000-01-20 | 2001-12-20 | Ottawa Health Research Institute | Immunostimulatory nucleic acids for inducing a th2 immune response |
US8226957B2 (en) | 2000-03-10 | 2012-07-24 | Dynavax Technologies Corporation | Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences |
US8669237B2 (en) | 2000-03-10 | 2014-03-11 | Dynavax Technologies Corporation | Biodegradable immunomodulatory formulations and methods for use thereof |
JP2003535043A (en) * | 2000-03-10 | 2003-11-25 | ダイナバックス テクノロジーズ コーポレイション | Methods for preventing and treating viral infections using immunomodulatory polynucleotide sequences |
US7183111B2 (en) | 2000-03-10 | 2007-02-27 | Dynavax Technologies Corporation | Immunomodulatory formulations and methods for use thereof |
US7157437B2 (en) | 2000-03-10 | 2007-01-02 | Dynavax Technologies Corporation | Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences |
US7129222B2 (en) | 2000-03-10 | 2006-10-31 | Dynavax Technologies Corporation | Immunomodulatory formulations and methods for use thereof |
US7250403B2 (en) | 2000-03-10 | 2007-07-31 | Dynavax Technologies Corporation | Biodegradable immunomodulatory formulations and methods for use thereof |
US7727712B2 (en) | 2000-03-10 | 2010-06-01 | Dynavax Technologies Corporation | Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences |
EP2067487A2 (en) | 2000-03-10 | 2009-06-10 | Dynavax Technologies Corporation | Immunomodulatory formulations and methods for use thereof |
JP2003526672A (en) * | 2000-03-10 | 2003-09-09 | ダイナバックス テクノロジーズ コーポレイション | Methods of preventing and treating respiratory viral infections using immunomodulatory polynucleotide sequences |
JP2003526670A (en) * | 2000-03-10 | 2003-09-09 | ダイナバックス テクノロジーズ コーポレイション | Remission of symptoms of herpes infection using immunomodulatory polynucleotide sequences |
US8124590B2 (en) | 2000-03-10 | 2012-02-28 | Dynavax Technologies Corporation | Biodegradable immunomodulatory formulations and methods for use thereof |
JP2003526673A (en) * | 2000-03-10 | 2003-09-09 | ダイナバックス テクノロジーズ コーポレイション | Methods for reducing papillomavirus infection using immunomodulatory polynucleotide sequences |
US6964769B2 (en) * | 2000-05-05 | 2005-11-15 | Cytos Biotechnology Ag | Molecular antigen array |
US7534772B2 (en) * | 2000-06-22 | 2009-05-19 | University Of Iowa Research Foundation | Methods for enhancing antibody-induced cell lysis and treating cancer |
US6943240B2 (en) | 2000-09-15 | 2005-09-13 | Coley Pharmaceuticals Gmbh | Nucleic acids for high throughput screening of CpG-based immuno-agonist/antagonist |
US7820379B2 (en) | 2000-09-15 | 2010-10-26 | Coley Pharmaceutical Gmbh | Process for high throughput screening of CpG-based immuno-agonist/antagonist |
EP2277896A1 (en) | 2000-10-27 | 2011-01-26 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A & B |
EP2284183A1 (en) | 2000-10-27 | 2011-02-16 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A and B |
EP2277894A1 (en) | 2000-10-27 | 2011-01-26 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A & B |
EP2896629A1 (en) | 2000-10-27 | 2015-07-22 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus group A & B |
EP2284182A1 (en) | 2000-10-27 | 2011-02-16 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A and B |
EP2284181A1 (en) | 2000-10-27 | 2011-02-16 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A and B |
EP2277895A1 (en) | 2000-10-27 | 2011-01-26 | Novartis Vaccines and Diagnostics S.r.l. | Nucleic acids and proteins from streptococcus groups A & B |
EP1985702A2 (en) | 2000-12-08 | 2008-10-29 | Coley Pharmaceuticals GmbH | CPG-like nucleic acids and methods of use thereof |
US8372413B2 (en) | 2000-12-27 | 2013-02-12 | Dynavax Technologies Corporation | Immunomodulatory polynucleotides and methods of using the same |
US7094409B2 (en) | 2001-01-19 | 2006-08-22 | Cytos Biotechnology Ag | Antigen arrays for treatment of allergic eosinophilic diseases |
US7858588B2 (en) | 2001-05-21 | 2010-12-28 | Intercell Ag | Immunostimulatory oligodeoxynucleic molecules |
EP2277536A2 (en) | 2001-06-20 | 2011-01-26 | Novartis AG | Purification of bacterial capsular polysaccharides |
EP2277537A2 (en) | 2001-06-20 | 2011-01-26 | Novartis AG | Neisseria meningitidis conjugate combination vaccine |
EP2277539A2 (en) | 2001-06-20 | 2011-01-26 | Novartis AG | Neisseria meningitidis conjugate combination vaccine |
EP2263688A1 (en) | 2001-06-20 | 2010-12-22 | Novartis AG | Neisseria meningitidis combination vaccines |
US9028845B2 (en) | 2001-06-21 | 2015-05-12 | Dynavax Technologies Corporation | Chimeric immunomodulatory compounds and methods of using the same-IV |
US7255868B2 (en) | 2001-06-21 | 2007-08-14 | Dynavax Technologies Corporation | Chimeric immunomodulatory compounds and methods of using the same—I |
EP2423335A2 (en) | 2001-06-21 | 2012-02-29 | Dynavax Technologies Corporation | Chimeric immunomodulatory compounds and methods of using the same |
EP2266605A1 (en) | 2001-07-26 | 2010-12-29 | Novartis Vaccines and Diagnostics S.r.l. | Vaccines comprising aluminium adjuvants and histidine |
EP2168597A1 (en) | 2001-07-26 | 2010-03-31 | Novartis Vaccines and Diagnostics S.r.l. | Vaccines comprising aluminium adjuvants and histidine |
EP2255827A1 (en) | 2001-07-26 | 2010-12-01 | Novartis Vaccines and Diagnostics S.r.l. | Vaccines comprising aluminium adjuvants and histidine |
WO2003014316A2 (en) | 2001-08-07 | 2003-02-20 | Dynavax Technologies Corporation | Immunomodulatory compositions, formulations, and methods for use thereof |
US8586555B2 (en) | 2001-08-07 | 2013-11-19 | Dynavax Technologies Corporation | Immunomodulatory compositions, formulations, and methods for use thereof |
US8834900B2 (en) | 2001-08-17 | 2014-09-16 | University Of Iowa Research Foundation | Combination motif immune stimulatory oligonucleotides with improved activity |
US7282476B2 (en) | 2001-08-24 | 2007-10-16 | University Of Victoria Innovation And Development Corporation | Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer |
US7745395B2 (en) | 2001-08-24 | 2010-06-29 | University of Victoria Innovatiion and Development Corporation | Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer |
US7838266B2 (en) | 2001-08-24 | 2010-11-23 | University Of Victoria Innovation And Development Corporation | Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer |
EP2327719A1 (en) | 2001-09-06 | 2011-06-01 | Novartis Vaccines and Diagnostics S.r.l. | Hybrid and tandem expression of neisserial proteins |
EP2829549A2 (en) | 2001-09-06 | 2015-01-28 | Novartis Vaccines and Diagnostics S.r.l. | Hybrid and tandem expression of neisserial derived proteins |
EP2360176A2 (en) | 2001-09-06 | 2011-08-24 | Novartis Vaccines and Diagnostics S.r.l. | Hybrid and tandem expression of neisserial derived proteins |
US8691209B2 (en) | 2001-09-14 | 2014-04-08 | Cytos Biotechnology Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
US9950055B2 (en) | 2001-09-14 | 2018-04-24 | Kuros Biosciences Ag | Packaging of immunostimulatory substances into virus-like particles: method of preparation and use |
US9163244B2 (en) | 2001-09-24 | 2015-10-20 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Suppressors of CpG oligonucleotides and methods of use |
US8580944B2 (en) | 2001-09-24 | 2013-11-12 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Suppressors of CpG oligonucleotides and methods of use |
US8227438B2 (en) | 2001-09-24 | 2012-07-24 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Suppressors of CpG oligonucleotides and methods of use |
US7514414B2 (en) | 2001-09-24 | 2009-04-07 | The United States Of America As Represented By The Department Of Health And Human Services | Suppressors of CpG oligonucleotides and methods of use |
WO2003028656A2 (en) | 2001-10-03 | 2003-04-10 | Chiron Corporation | Adjuvant compositions |
WO2003030934A3 (en) * | 2001-10-06 | 2003-11-06 | Qiagen Gmbh | Cpg formulations and related methods |
US8808692B2 (en) | 2001-12-21 | 2014-08-19 | Csl Limited | Compositions comprising immunoreactive reagents and saponins, and methods of use thereof |
US7741297B2 (en) | 2002-02-04 | 2010-06-22 | Oncothyreon Inc. | Immunostimulatory, covalently lipidated oligonucleotides |
WO2003066649A1 (en) * | 2002-02-04 | 2003-08-14 | Biomira Inc. | Immunostimulatory, covalently lipidated oligonucleotides |
EP2572707A2 (en) | 2002-02-20 | 2013-03-27 | Novartis Vaccines and Diagnostics, Inc. | Microparticles with adsorbed polypeptide-containing molecules |
WO2003070909A2 (en) | 2002-02-20 | 2003-08-28 | Chiron Corporation | Microparticles with adsorbed polypeptide-containing molecules |
EP3173426A1 (en) | 2002-02-25 | 2017-05-31 | Biogen MA Inc. | Administration of agents for the treatment of inflammation |
EP2360185A2 (en) | 2002-02-25 | 2011-08-24 | Elan Pharmaceuticals Inc. | Administration of agents for the treatment of inflammation |
EP2336184A2 (en) | 2002-02-25 | 2011-06-22 | Elan Pharmaceuticals Inc. | Administration of agents for the treatment of inflammation |
EP3674322A1 (en) | 2002-02-25 | 2020-07-01 | Biogen MA Inc. | Administration of agents for the treatment of inflammation |
EP2289941A2 (en) | 2002-02-25 | 2011-03-02 | Elan Pharmaceuticals Inc. | Administration of agents for the treatment of inflammation |
EP2292247A2 (en) | 2002-03-05 | 2011-03-09 | Ramot at Tel Aviv University Ltd. | Immunizing composition and method for inducing an immune response against the beta-secretase cleavage site of amyloid precursor protein |
US8658607B2 (en) | 2002-04-04 | 2014-02-25 | Zoetis Belgium | Immunostimulatory G, U-containing oligoribonucleotides |
US9428536B2 (en) | 2002-04-04 | 2016-08-30 | Zoetis Belgium Sa | Immunostimulatory G, U-containing oligoribonucleotides |
US8153141B2 (en) | 2002-04-04 | 2012-04-10 | Coley Pharmaceutical Gmbh | Immunostimulatory G, U-containing oligoribonucleotides |
US7943316B2 (en) | 2002-05-30 | 2011-05-17 | David Horn, Llc | Immunostimulatory oligonucleotides and uses thereof |
US7381807B2 (en) | 2002-05-30 | 2008-06-03 | Immunotech S.A. | Immunostimulatory oligonucleotides and uses thereof |
US7038029B2 (en) | 2002-05-30 | 2006-05-02 | Immunotech S.A. | Immunostimulatory oligonucleotides and uses thereof |
US7279165B2 (en) | 2002-07-19 | 2007-10-09 | Cytos Biotechnology Ag | Amyloid β1-6 antigen arrays |
WO2004011650A2 (en) | 2002-07-24 | 2004-02-05 | Intercell Ag | Antigens encoded by alternative reading frame from pathogenic viruses |
US7528223B2 (en) | 2002-07-24 | 2009-05-05 | Intercell Ag | Antigens encoded by alternative reading frames from pathogenic viruses |
US7514415B2 (en) | 2002-08-01 | 2009-04-07 | The United States Of America As Represented By The Department Of Health And Human Services | Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides |
US7951786B2 (en) | 2002-08-01 | 2011-05-31 | The United States Of America As Represented By The Department Of Health And Human Services | Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides |
US8288359B2 (en) | 2002-08-01 | 2012-10-16 | The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides |
US8557789B2 (en) | 2002-08-01 | 2013-10-15 | The United States of America as represented by the Secretary of the Development of Health and Human Services | Method of treating inflammatory arthropathies with supressors of CPG oligonucleotides |
EP2258390A1 (en) | 2002-08-30 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Improved bacterial outer membrane vesicles |
EP2258388A1 (en) | 2002-08-30 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Improved bacterial outer membrane vesicles |
EP2258389A1 (en) | 2002-08-30 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Improved bacterial outer membrane vesicles |
EP2402026A2 (en) | 2002-09-13 | 2012-01-04 | Intercell AG | Method for isolating hepatitis C virus peptides |
US7378234B2 (en) | 2002-09-13 | 2008-05-27 | Intercell Ag | Method for isolating hepatitis C virus peptides |
US8501188B2 (en) | 2002-10-08 | 2013-08-06 | The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides |
US8043622B2 (en) | 2002-10-08 | 2011-10-25 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides |
US9006203B2 (en) | 2002-10-08 | 2015-04-14 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of reducing inflammatory infiltration in subjects with inflammatory lung disease |
EP2353608A1 (en) | 2002-10-11 | 2011-08-10 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptide-vaccines for broad protection against hypervirulent meningococcal lineages |
EP2351579A1 (en) | 2002-10-11 | 2011-08-03 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptide vaccines for broad protection against hypervirulent meningococcal lineages |
EP2361629A1 (en) | 2002-11-01 | 2011-08-31 | Elan Pharmaceuticals Inc. | Prevention and treatment of synucleinopathic disease |
EP2279746A2 (en) | 2002-11-15 | 2011-02-02 | Novartis Vaccines and Diagnostics S.r.l. | Surface proteins in neisseria meningitidis |
EP2258716A2 (en) | 2002-11-22 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Multiple variants of meningococcal protein NMB1870 |
EP2258717A2 (en) | 2002-11-22 | 2010-12-08 | Novartis Vaccines and Diagnostics S.r.l. | Variant form of meningococcal NadA |
EP2261239A2 (en) | 2002-11-22 | 2010-12-15 | Novartis Vaccines and Diagnostics S.r.l. | Multiple variants of meningococcal protein NMB1870 |
US7956043B2 (en) | 2002-12-11 | 2011-06-07 | Coley Pharmaceutical Group, Inc. | 5′ CpG nucleic acids and methods of use |
US9422564B2 (en) | 2002-12-23 | 2016-08-23 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
US10196643B2 (en) | 2002-12-23 | 2019-02-05 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
US11312965B2 (en) | 2002-12-23 | 2022-04-26 | Trisalus Life Sciences, Inc. | Immunostimulatory sequence oligonucleotides and methods of using the same |
US8158768B2 (en) | 2002-12-23 | 2012-04-17 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
US7745606B2 (en) | 2002-12-23 | 2010-06-29 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
US8871732B2 (en) | 2002-12-23 | 2014-10-28 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
EP1992635A1 (en) | 2002-12-23 | 2008-11-19 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
EP2263687A1 (en) | 2002-12-27 | 2010-12-22 | Novartis Vaccines&Diagnostics, Inc. | Immunogenic compositions containing phospholipid |
EP2289546A2 (en) | 2003-01-30 | 2011-03-02 | Novartis Vaccines and Diagnostics S.r.l. | Injectable vaccines against multiple meningococcal serogroups |
WO2004074454A2 (en) | 2003-02-20 | 2004-09-02 | University Of Connecticut Health Center | Methods and compositions for the treatment of cancer and infectious disease using alpha (2) macroglobulin-antigenic molecule complexes |
EP2345420A1 (en) | 2003-03-24 | 2011-07-20 | Intercell AG | Use of a TH1 immune response inducing adjuvant for enhancing immune responses |
US7704514B2 (en) | 2003-03-24 | 2010-04-27 | Intercell Ag | Vaccines |
WO2004084938A1 (en) | 2003-03-24 | 2004-10-07 | Intercell Ag | Improved vaccines |
US8784837B2 (en) | 2003-03-24 | 2014-07-22 | Valneva Austria Gmbh | Vaccines comprising an immunostimulatory peptide and an immunostimulatory oligodeoxynucleic acid molecule |
US7517520B2 (en) | 2003-03-26 | 2009-04-14 | Cytos Biotechnology Ag | Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use |
US7537767B2 (en) | 2003-03-26 | 2009-05-26 | Cytis Biotechnology Ag | Melan-A- carrier conjugates |
WO2004092360A2 (en) | 2003-04-10 | 2004-10-28 | Chiron Corporation | The severe acute respiratory syndrome coronavirus |
EP2361928A1 (en) | 2003-05-19 | 2011-08-31 | Elan Pharmaceuticals Inc. | Truncated fragments of alpha-synuclein in Lewy body disease |
EP2179729A1 (en) | 2003-06-02 | 2010-04-28 | Novartis Vaccines and Diagnostics, Inc. | Immunogenic compositions based on microparticles comprising adsorbed toxoid and a polysaccharide-containing antigen |
EP2289547A1 (en) | 2003-09-12 | 2011-03-02 | Antigenics Inc. | Vaccine for treatment and prevention of herpes simplex virus infection |
EP2267036A1 (en) | 2003-10-02 | 2010-12-29 | Novartis Vaccines and Diagnostics S.r.l. | Hypo- and Hyper-Acetylated Meningococcal Capsular Saccharides |
EP2277538A1 (en) | 2003-10-02 | 2011-01-26 | Novartis Vaccines and Diagnostics S.r.l. | Combined meningitis vaccines |
DE202005022108U1 (en) | 2004-03-09 | 2013-11-12 | Novartis Vaccines And Diagnostics, Inc. | Influenza virus vaccines |
EP2545931A1 (en) | 2004-03-19 | 2013-01-16 | Herbs Spring, LLC | Herbal therapy for the treatment of food allergy |
EP2108374A1 (en) | 2004-04-30 | 2009-10-14 | Novartis Vaccines and Diagnostics S.r.l. | Combined meningococcal conjugates with common carrier protein |
EP2272531A2 (en) | 2004-04-30 | 2011-01-12 | Novartis Vaccines and Diagnostics S.r.l. | Integration of meningococcal conjugate vaccination |
US8895521B2 (en) | 2004-05-06 | 2014-11-25 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Methods and compositions for the treatment of uveitis |
EP2351773A1 (en) | 2004-05-14 | 2011-08-03 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptides from non-typeable haemophilus influenzae |
EP2351774A1 (en) | 2004-05-14 | 2011-08-03 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptides from non-typeable haemophilus influenzae |
EP2343313A1 (en) | 2004-05-14 | 2011-07-13 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptides from non-typeable haemophilus influenzae |
EP2341069A1 (en) | 2004-05-14 | 2011-07-06 | Novartis Vaccines and Diagnostics S.r.l. | Polypeptides from non-typeable haemophilus influenzae |
EP2811027A1 (en) | 2004-05-21 | 2014-12-10 | Novartis Vaccines and Diagnostics, Inc. | Alphavirus vectors for RSV and PIV vaccines |
EP2848692A1 (en) | 2004-05-21 | 2015-03-18 | Novartis Vaccines and Diagnostics, Inc. | Alphavirus vectors for influenza virus vaccines |
EP2612679A1 (en) | 2004-07-29 | 2013-07-10 | Novartis Vaccines and Diagnostics, Inc. | Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae |
EP3369433A1 (en) | 2004-08-09 | 2018-09-05 | Janssen Alzheimer Immunotherapy | Prevention and treatment of synucleinopathic and amyloidogenic disease |
WO2006020581A2 (en) | 2004-08-09 | 2006-02-23 | Elan Pharmaceuticals, Inc. | Prevention and treatment of synucleinopathic and amyloidogenic disease |
EP2149583A1 (en) | 2004-09-24 | 2010-02-03 | Intercell AG | Modified VP1-capsid protein of parvovirus B19 |
EP2371396A1 (en) | 2004-10-19 | 2011-10-05 | Elan Pharmaceuticals Inc. | Truncated fragments of alpha synuclein in lewy body disease |
EP2272539A2 (en) | 2004-10-19 | 2011-01-12 | Elan Pharmaceuticals, Inc. | Truncated fragments of alpha-synuclein in lewy body disease |
EP2465872A2 (en) | 2004-10-25 | 2012-06-20 | Merck Sharp & Dohme Corporation | Anti-ADDL Antibodies and uses thereof |
EP2279747A1 (en) | 2004-10-29 | 2011-02-02 | Novartis Vaccines and Diagnostics S.r.l. | Immunogenic bacterial vesicles with outer membrane proteins |
US8617566B2 (en) | 2004-11-05 | 2013-12-31 | Novartis Ag | Composition comprising VLP and amyloid beta peptide |
US7867499B2 (en) | 2004-11-05 | 2011-01-11 | Novartis Ag | Methods of treating dementia by administering virus-like particles coupled to Aβ |
US8460676B2 (en) | 2004-11-05 | 2013-06-11 | Novartis Ag | Composition comprising VLP and amyloid beta peptide |
US9809824B2 (en) | 2004-12-13 | 2017-11-07 | The United States Of America, Represented By The Secretary, Department Of Health And Human Services | CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods |
EP2193810A1 (en) | 2005-01-14 | 2010-06-09 | Novartis Vaccines and Diagnostics S.r.l. | Meningococcal conjugate vaccination |
EP2433647A2 (en) | 2005-01-27 | 2012-03-28 | Children's Hospital & Research Center at Oakland | GNA1870-based vesicle vaccines for broad spectrum protection against diseases caused by Neisseria meningitidis |
US7902161B2 (en) | 2005-01-28 | 2011-03-08 | Hyung-Joo Kwon | Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell |
EP1841777A4 (en) * | 2005-01-28 | 2008-10-29 | Kwon Hyung Joo | Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell |
EP1841777A1 (en) * | 2005-01-28 | 2007-10-10 | Kwon, Hyung-Joo | Oligonucleotides derived from mycobacterium for stimulating immune function, treating immune-related diseases, atopic dermatitis and/or protecting normal immune cell |
EP3498302A1 (en) | 2005-02-01 | 2019-06-19 | Novartis Vaccines and Diagnostics S.r.l. | Conjugation of streptococcal capsular saccharides to carrier proteins |
WO2006086799A2 (en) | 2005-02-11 | 2006-08-17 | Novartis Vaccines And Diagnostics Inc. | Prion-specific peptide reagents |
EP2298795A1 (en) | 2005-02-18 | 2011-03-23 | Novartis Vaccines and Diagnostics, Inc. | Immunogens from uropathogenic escherichia coli |
EP2351772A1 (en) | 2005-02-18 | 2011-08-03 | Novartis Vaccines and Diagnostics, Inc. | Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli |
WO2006110655A2 (en) | 2005-04-08 | 2006-10-19 | Chimerix, Inc. | Compounds, compositions and methods for the treatment of poxvirus infections |
US8642577B2 (en) | 2005-04-08 | 2014-02-04 | Chimerix, Inc. | Compounds, compositions and methods for the treatment of poxvirus infections |
EP2329843A2 (en) | 2005-04-18 | 2011-06-08 | Novartis Vaccines and Diagnostics, Inc. | Expressing Hepatitis B Virus surface antigen for vaccine preparation |
US8916161B2 (en) | 2005-06-14 | 2014-12-23 | Sophiris Bio Inc. | Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins |
US9950029B2 (en) | 2005-06-14 | 2018-04-24 | Sophiris Bio Inc. | Method of treating or preventing benign prostatic hyperplasia using modified pore-forming proteins |
EP2614709A1 (en) | 2005-07-18 | 2013-07-17 | Novartis AG | Small animal model for HCV replication |
EP2450056A1 (en) | 2005-07-19 | 2012-05-09 | Elan Pharma International Limited | Prevention and treatment of synucleinopathic and amyloidogenic disease |
EP2357000A1 (en) | 2005-10-18 | 2011-08-17 | Novartis Vaccines and Diagnostics, Inc. | Mucosal and systemic immunizations with alphavirus replicon particles |
US11707520B2 (en) | 2005-11-03 | 2023-07-25 | Seqirus UK Limited | Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture |
EP2368572A2 (en) | 2005-11-04 | 2011-09-28 | Novartis Vaccines and Diagnostics S.r.l. | Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture |
EP2368573A2 (en) | 2005-11-04 | 2011-09-28 | Novartis Vaccines and Diagnostics S.r.l. | Influenza vaccines including combinations of particulate adjuvants and immunopotentiators |
EP2377551A2 (en) | 2005-11-04 | 2011-10-19 | Novartis Vaccines and Diagnostics S.r.l. | Adjuvanted influenza vaccines including cytokine-inducing agents |
US8697087B2 (en) | 2005-11-04 | 2014-04-15 | Novartis Ag | Influenza vaccines including combinations of particulate adjuvants and immunopotentiators |
WO2007052058A1 (en) * | 2005-11-04 | 2007-05-10 | Novartis Vaccines And Diagnostics Srl | Influenza vaccines including combinations of particulate adjuvants and immunopotentiators |
US10842867B2 (en) | 2005-11-04 | 2020-11-24 | Seqirus UK Limited | Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture |
EP2377552A2 (en) | 2005-11-04 | 2011-10-19 | Novartis Vaccines and Diagnostics S.r.l. | Influenza vaccines with reduced amount of emulsion adjuvant |
EP3714900A1 (en) | 2005-11-04 | 2020-09-30 | Seqirus UK Limited | Adjuvanted vaccines with non-virion antigens prepared from influenza viruses grown in cell culture |
EP2360175A2 (en) | 2005-11-22 | 2011-08-24 | Novartis Vaccines and Diagnostics, Inc. | Norovirus and Sapovirus virus-like particles (VLPs) |
EP3346009A1 (en) | 2005-11-25 | 2018-07-11 | GlaxoSmithKline Biologicals S.A. | Chimeric, hybrid and tandem polypeptides of meningococcal nmb1870 |
EP2385126A1 (en) | 2005-11-25 | 2011-11-09 | Novartis Vaccines and Diagnostics S.r.l. | Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870 |
EP2385127A1 (en) | 2005-11-25 | 2011-11-09 | Novartis Vaccines and Diagnostics S.r.l. | Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870 |
EP3753574A1 (en) | 2006-01-27 | 2020-12-23 | Seqirus UK Limited | Influenza vaccines containing hemagglutinin and matrix proteins |
EP2478916A1 (en) | 2006-01-27 | 2012-07-25 | Novartis Vaccines and Diagnostics GmbH | Influenza vaccines containing hemagglutinin and matrix proteins |
US9200042B2 (en) | 2006-03-07 | 2015-12-01 | Vaxinnate Corporation | Flagellin fusion proteins |
EP2357184A1 (en) | 2006-03-23 | 2011-08-17 | Novartis AG | Imidazoquinoxaline compounds as immunomodulators |
EP2382987A1 (en) | 2006-03-24 | 2011-11-02 | Novartis Vaccines and Diagnostics GmbH | Storage of influenza vaccines without refrigeration |
EP2382988A1 (en) | 2006-03-31 | 2011-11-02 | Novartis AG | Combined mucosal and parenteral immunization against HIV |
WO2007119815A1 (en) | 2006-04-14 | 2007-10-25 | Kyowa Hakko Kirin Co., Ltd. | Toll-like receptor 9 agonists |
WO2008042024A2 (en) | 2006-06-01 | 2008-04-10 | Elan Pharmaceuticals, Inc. | Neuroactive fragments of app |
WO2008020335A2 (en) | 2006-06-09 | 2008-02-21 | Novartis Ag | Immunogenic compositions for streptococcus agalactiae |
EP2514437A1 (en) | 2006-07-20 | 2012-10-24 | Novartis AG | Frozen stockpiling of influenza vaccines |
EP2586790A2 (en) | 2006-08-16 | 2013-05-01 | Novartis AG | Immunogens from uropathogenic Escherichia coli |
EP3456348A1 (en) | 2006-09-11 | 2019-03-20 | Seqirus UK Limited | Making influenza virus vaccines without using eggs |
EP2497495A2 (en) | 2006-09-11 | 2012-09-12 | Novartis AG | Making influenza virus vaccines without using eggs |
EP2532362A1 (en) | 2006-12-06 | 2012-12-12 | Novartis AG | Vaccines including antigen from four strains of influenza virus |
EP2679240A1 (en) | 2006-12-06 | 2014-01-01 | Novartis AG | Vaccines including antigen from four strains of influenza virus |
EP2548895A1 (en) | 2007-01-11 | 2013-01-23 | Novartis AG | Modified saccharides |
EP2583978A2 (en) | 2007-02-23 | 2013-04-24 | The Regents of the University of California | Prevention and treatment of synucleinopathic and amyloidogenic disease |
EP3067066A1 (en) | 2007-02-23 | 2016-09-14 | Prothena Biosciences Limited | Prevention and treatment of synucleinopathic and amyloidogenic disease |
EP2484377A1 (en) | 2007-06-27 | 2012-08-08 | Novartis AG | Low-additive influenza vaccines |
US9463250B2 (en) | 2007-07-17 | 2016-10-11 | Glaxosmithkline Biologicals Sa | Conjugate purification |
EP2659912A2 (en) | 2007-07-17 | 2013-11-06 | Novartis AG | Conjugate purification |
EP2572726A1 (en) | 2007-08-01 | 2013-03-27 | Novartis AG | Compositions comprising pneumococcal antigens |
WO2009034473A2 (en) | 2007-09-12 | 2009-03-19 | Novartis Ag | Gas57 mutant antigens and gas57 antibodies |
EP2952524A1 (en) | 2007-10-17 | 2015-12-09 | Janssen Sciences Ireland UC | Immunotherapy regimes dependent on apoe status |
EP2614835A1 (en) | 2007-11-26 | 2013-07-17 | Novartis AG | Vaccination with multiple clades of H5 influenza A virus |
EP3067048A1 (en) | 2007-12-07 | 2016-09-14 | Novartis Ag | Compositions for inducing immune responses |
EP2891498A1 (en) | 2007-12-20 | 2015-07-08 | Novartis AG | Fermentation processes for cultivating streptococci and purification processes for obtaining CPS therefrom |
EP2537857A2 (en) | 2007-12-21 | 2012-12-26 | Novartis AG | Mutant forms of streptolysin O |
EP2730659A2 (en) | 2007-12-28 | 2014-05-14 | Elan Pharmaceuticals Inc. | Treatment and Prophylaxis of Amyloidosis |
EP3693470A1 (en) | 2007-12-28 | 2020-08-12 | Prothena Therapeutics Limited | Treatment and prophylaxis of amyloidosis |
WO2009086539A2 (en) | 2007-12-28 | 2009-07-09 | Elan Pharmaceuticals, Inc. | Treatment and prophylaxis of amyloidosis |
EP2886551A2 (en) | 2008-02-21 | 2015-06-24 | Novartis AG | Meningococcal fhbp polypeptides |
EP3263591A1 (en) | 2008-02-21 | 2018-01-03 | GlaxoSmithKline Biologicals S.A. | Meningococcal fhbp polypeptides |
EP2631245A1 (en) | 2008-03-10 | 2013-08-28 | Children's Hospital & Research Center at Oakland | Chimeric factor H binding proteins (fHBP) containing a heterologous B domain and methods of use |
EP2889042A2 (en) | 2008-03-18 | 2015-07-01 | Novartis AG | Improvements in preparation of influenza virus vaccine antigens |
EP3459563A1 (en) | 2008-03-18 | 2019-03-27 | Seqirus UK Limited | Improvements in preparation of influenza virus vaccine antigens |
US8932605B2 (en) | 2008-04-18 | 2015-01-13 | Vaxinnate Corporation | Deletion mutants of flagellin and methods of use |
US9211320B2 (en) | 2008-04-18 | 2015-12-15 | Vaxinnate Corporation | Deletion mutants of flagellin and methods of use |
US9205138B2 (en) | 2008-04-18 | 2015-12-08 | Vaxinnate Corporation | Deletion mutants of flagellin and methods of use |
US8222225B2 (en) | 2008-05-21 | 2012-07-17 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Method of treating pneumoconiosis with oligodeoxynucleotides |
WO2010032138A2 (en) | 2008-09-18 | 2010-03-25 | Novartis Ag | Vaccine adjuvant combinations |
US8298547B2 (en) | 2008-12-09 | 2012-10-30 | Pfizer Vaccines, LLC | IgE CH3 peptide vaccine |
US9216229B2 (en) | 2008-12-09 | 2015-12-22 | Pfizer Vaccines Llc | IgE CH3 peptide vaccine |
EP2865389A1 (en) | 2008-12-09 | 2015-04-29 | Pfizer Vaccines LLC | IgE CH3 peptide vaccine |
US8475801B2 (en) | 2008-12-09 | 2013-07-02 | Pfizer Vaccines, LCC | IgE CH3 peptide vaccine |
WO2010067286A2 (en) | 2008-12-09 | 2010-06-17 | Pfizer Vaccines Llc | IgE CH3 PEPTIDE VACCINE |
WO2010079464A1 (en) | 2009-01-12 | 2010-07-15 | Novartis Ag | Cna_b domain antigens in vaccines against gram positive bacteria |
US11246921B2 (en) | 2009-02-10 | 2022-02-15 | Seqirus UK Limited | Influenza vaccines with reduced amounts of squalene |
US10149901B2 (en) | 2009-02-10 | 2018-12-11 | Seqirus UK Limited | Influenza vaccines with reduced amounts of squalene |
WO2010100632A2 (en) | 2009-03-06 | 2010-09-10 | Novartis Ag | Chlamydia antigens |
EP3549602A1 (en) | 2009-03-06 | 2019-10-09 | GlaxoSmithKline Biologicals S.A. | Chlamydia antigens |
WO2010109323A1 (en) | 2009-03-24 | 2010-09-30 | Novartis Ag | Adjuvanting meningococcal factor h binding protein |
WO2010115118A2 (en) | 2009-04-03 | 2010-10-07 | Antigenics, Inc. | Methods for preparing and using multichaperone-antigen complexes |
EP3263128A2 (en) | 2009-04-14 | 2018-01-03 | GlaxoSmithKline Biologicals S.A. | Compositions for immunising against staphylococcus aureus |
EP2510947A1 (en) | 2009-04-14 | 2012-10-17 | Novartis AG | Compositions for immunising against Staphylococcus aureus |
WO2010138193A2 (en) | 2009-05-27 | 2010-12-02 | Selecta Biosciences, Inc. | Targeted synthetic nanocarriers with ph sensitive release of immunomodulatory agents |
EP2944320A1 (en) | 2009-06-15 | 2015-11-18 | National University of Singapore | Influenza vaccine, composition, and methods of use |
WO2010146414A1 (en) | 2009-06-15 | 2010-12-23 | National University Of Singapore | Influenza vaccine, composition, and methods of use |
WO2011008974A2 (en) | 2009-07-15 | 2011-01-20 | Novartis Ag | Rsv f protein compositions and methods for making same |
EP3178490A2 (en) | 2009-07-15 | 2017-06-14 | GlaxoSmithKline Biologicals S.A. | Rsv f protein compositions and methods for making same |
WO2011007257A1 (en) | 2009-07-16 | 2011-01-20 | Novartis Ag | Detoxified escherichia coli immunogens |
EP2837386A1 (en) | 2009-07-16 | 2015-02-18 | Novartis AG | Detoxified Escherichia coli immunogens |
WO2011013034A1 (en) | 2009-07-30 | 2011-02-03 | Pfizer Vaccines Llc | Antigenic tau peptides and uses thereof |
WO2011024071A1 (en) | 2009-08-27 | 2011-03-03 | Novartis Ag | Adjuvant comprising aluminium, oligonucleotide and polycation |
WO2011024072A2 (en) | 2009-08-27 | 2011-03-03 | Novartis Ag | Hybrid polypeptides including meningococcal fhbp sequences |
EP3017828A1 (en) | 2009-08-27 | 2016-05-11 | GlaxoSmithKline Biologicals SA | Hybrid polypeptides including meningococcal fhbp sequences |
WO2011027257A2 (en) | 2009-09-03 | 2011-03-10 | Pfizer Vaccines Llc | Pcsk9 vaccine |
EP2865752A1 (en) | 2009-09-03 | 2015-04-29 | Pfizer Vaccines LLC | PCSK9 vaccine |
EP3358008A1 (en) | 2009-09-03 | 2018-08-08 | Pfizer Vaccines LLC | Pcsk9 vaccine |
WO2011030218A1 (en) | 2009-09-10 | 2011-03-17 | Novartis Ag | Combination vaccines against respiratory tract diseases |
WO2011036564A2 (en) | 2009-09-28 | 2011-03-31 | Novartis Vaccines Institute For Global Health Srl | Hyperblebbing shigella strains |
EP3279313A2 (en) | 2009-09-28 | 2018-02-07 | GlaxoSmithKline Biologicals S.A. | Hyperblebbing shigella strains |
WO2011036562A1 (en) | 2009-09-28 | 2011-03-31 | Novartis Vaccines Institute For Global Health Srl | Purification of bacterial vesicles |
US11339367B2 (en) | 2009-09-28 | 2022-05-24 | Glaxosmithkline Biologicals Sa | Hyperblebbing Shigella strains |
WO2011138636A1 (en) | 2009-09-30 | 2011-11-10 | Novartis Ag | Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides |
WO2011039631A2 (en) | 2009-09-30 | 2011-04-07 | Novartis Ag | Expression of meningococcal fhbp polypeptides |
WO2011048561A1 (en) | 2009-10-20 | 2011-04-28 | Novartis Ag | Diagnostic and therapeutic methods for rheumatic heart disease based upon group a streptococcus markers |
WO2011051893A1 (en) | 2009-10-27 | 2011-05-05 | Novartis Ag | Modified meningococcal fhbp polypeptides |
WO2011058302A1 (en) | 2009-11-10 | 2011-05-19 | Guy's And St Thomas's Nhs Foundation Trust | Bacteremia-associated antigen from staphylococcus aureus |
EP3257525A2 (en) | 2009-12-22 | 2017-12-20 | Celldex Therapeutics, Inc. | Vaccine compositions |
WO2011077309A2 (en) | 2009-12-22 | 2011-06-30 | Pfizer Vaccines Llc | Vaccine compositions |
US9006218B2 (en) | 2010-02-12 | 2015-04-14 | Chimerix Inc. | Nucleoside phosphonate salts |
US9765100B2 (en) | 2010-02-12 | 2017-09-19 | Chimerix, Inc. | Nucleoside phosphonate salts |
WO2011104632A1 (en) | 2010-02-26 | 2011-09-01 | Novartis Ag | Immunogenic proteins and compositions |
WO2012020326A1 (en) | 2010-03-18 | 2012-02-16 | Novartis Ag | Adjuvanted vaccines for serogroup b meningococcus |
EP4036104A1 (en) | 2010-03-30 | 2022-08-03 | Children's Hospital & Research Center at Oakland | Factor h binding proteins (fhbp) with altered properties and methods of use thereof |
EP3327028A1 (en) | 2010-03-30 | 2018-05-30 | Children's Hospital & Research Center at Oakland | Factor h binding proteins (fhbp) with altered properties and methods of use thereof |
WO2011121576A2 (en) | 2010-04-01 | 2011-10-06 | Novartis Ag | Immunogenic proteins and compositions |
WO2011127316A1 (en) | 2010-04-07 | 2011-10-13 | Novartis Ag | Method for generating a parvovirus b19 virus-like particle |
WO2011130379A1 (en) | 2010-04-13 | 2011-10-20 | Novartis Ag | Benzonapthyridine compositions and uses thereof |
US9764031B2 (en) | 2010-05-26 | 2017-09-19 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
US9066978B2 (en) | 2010-05-26 | 2015-06-30 | Selecta Biosciences, Inc. | Dose selection of adjuvanted synthetic nanocarriers |
WO2011149564A1 (en) | 2010-05-28 | 2011-12-01 | Tetris Online, Inc. | Interactive hybrid asynchronous computer game infrastructure |
US8722053B2 (en) | 2010-06-07 | 2014-05-13 | Pfizer Vaccines Llc | IgE CH3 peptide vaccine |
EP2942061A2 (en) | 2010-06-07 | 2015-11-11 | Pfizer Vaccines LLC | Ige ch3 peptide vaccine |
US9249233B2 (en) | 2010-06-07 | 2016-02-02 | Pfizer Vaccines Llc | IgE CH3 peptide vaccine |
WO2011154878A1 (en) | 2010-06-07 | 2011-12-15 | Pfizer Vaccines Llc | Ige ch3 peptide vaccine |
WO2011154863A1 (en) | 2010-06-07 | 2011-12-15 | Pfizer Inc. | Her-2 peptides and vaccines |
EP3399021A1 (en) | 2010-06-11 | 2018-11-07 | GlaxoSmithKline Biologicals S.A. | Omv vaccines |
WO2011161551A2 (en) | 2010-06-11 | 2011-12-29 | Novartis Ag | Omv vaccines |
WO2011161653A1 (en) | 2010-06-25 | 2011-12-29 | Novartis Ag | Combinations of meningococcal factor h binding proteins |
EP3153578A1 (en) | 2010-07-06 | 2017-04-12 | Novartis Ag | Norovirus derived immunogenic compositions and methods |
WO2012006359A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Delivery of self-replicating rna using biodegradable polymer particles |
WO2012006293A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Norovirus derived immunogenic compositions and methods |
EP3611269A1 (en) | 2010-07-06 | 2020-02-19 | GlaxoSmithKline Biologicals SA | Delivery of self-replicating rna using biodegradable polymer particles |
WO2012009442A2 (en) | 2010-07-14 | 2012-01-19 | Merck Sharp & Dohme Corp. | Anti-addl monoclonal antibody and uses thereof |
WO2012035519A1 (en) | 2010-09-16 | 2012-03-22 | Novartis Ag | Immunogenic compositions |
WO2012049662A1 (en) | 2010-10-15 | 2012-04-19 | Novartis Vaccines Institute For Global Health Srl | Hyperblebbing salmonella strains |
US9994443B2 (en) | 2010-11-05 | 2018-06-12 | Selecta Biosciences, Inc. | Modified nicotinic compounds and related methods |
WO2012072769A1 (en) | 2010-12-01 | 2012-06-07 | Novartis Ag | Pneumococcal rrgb epitopes and clade combinations |
WO2012085668A2 (en) | 2010-12-24 | 2012-06-28 | Novartis Ag | Compounds |
EP3527224A1 (en) | 2011-01-26 | 2019-08-21 | GlaxoSmithKline Biologicals S.A. | Rsv immunization regimen |
WO2012103361A1 (en) | 2011-01-26 | 2012-08-02 | Novartis Ag | Rsv immunization regimen |
EP4159232A1 (en) | 2011-01-26 | 2023-04-05 | GlaxoSmithKline Biologicals S.A. | Rsv immunization regimen |
EP4144368A1 (en) | 2011-01-26 | 2023-03-08 | GlaxoSmithKline Biologicals S.A. | Rsv immunization regimen |
WO2012131504A1 (en) | 2011-03-02 | 2012-10-04 | Pfizer Inc. | Pcsk9 vaccine |
WO2012143902A1 (en) | 2011-04-22 | 2012-10-26 | Wyeth Llc | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
USRE48863E1 (en) | 2011-04-22 | 2021-12-28 | Wyeth Llc | Compositions relating to a mutant Clostridium difficile toxin and methods thereof |
USRE46376E1 (en) | 2011-04-22 | 2017-04-25 | Wyeth Llc | Compositions relating to a mutant Clostridium difficile toxin and methods thereof |
EP3505531A1 (en) | 2011-04-22 | 2019-07-03 | Wyeth LLC | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
US9187536B1 (en) | 2011-04-22 | 2015-11-17 | Wyeth Llc | Compositions relating to a mutant Clostridium difficile toxin and methods thereof |
EP4365196A2 (en) | 2011-04-22 | 2024-05-08 | Wyeth LLC | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
EP3549949A1 (en) | 2011-04-22 | 2019-10-09 | Wyeth LLC | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
US9745354B2 (en) | 2011-04-22 | 2017-08-29 | Wyeth Llc | Compositions relating to a mutant Clostridium difficile toxin and methods thereof |
US10774117B2 (en) | 2011-04-22 | 2020-09-15 | Wyeth Llc | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
US10597428B2 (en) | 2011-04-22 | 2020-03-24 | Wyeth Llc | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
US11535652B2 (en) | 2011-04-22 | 2022-12-27 | Wyeth Llc | Compositions relating to a mutant clostridium difficile toxin and methods thereof |
WO2012158613A1 (en) | 2011-05-13 | 2012-11-22 | Novartis Ag | Pre-fusion rsv f antigens |
EP3275892A2 (en) | 2011-05-13 | 2018-01-31 | GlaxoSmithKline Biologicals S.A. | Pre-fusion rsv f antigens |
US9353115B2 (en) | 2011-06-01 | 2016-05-31 | Janus Biotherapeutics, Inc. | Immune system modulators |
US10117875B2 (en) | 2011-06-01 | 2018-11-06 | Janus Biotherapeutics, Inc. | Immune system modulators |
WO2012167046A1 (en) | 2011-06-01 | 2012-12-06 | Janus Biotherapeutics, Inc. | Novel immune system modulators |
US9359361B2 (en) | 2011-06-01 | 2016-06-07 | Janus Biotherapeutics, Inc. | Immune system modulators |
US9637489B2 (en) | 2011-06-01 | 2017-05-02 | Janus Biotherapeutics, Inc. | Immune system modulators |
US9126996B2 (en) | 2011-06-01 | 2015-09-08 | Janus Biotherapeutics, Inc. | Immune system modulators |
WO2013006838A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic combination compositions and uses thereof |
WO2013006842A2 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic compositions and uses thereof |
EP3332802A1 (en) | 2011-07-06 | 2018-06-13 | GlaxoSmithKline Biologicals SA | Immunogenic combination compositions and uses thereof |
EP3854413A1 (en) | 2011-07-06 | 2021-07-28 | GlaxoSmithKline Biologicals SA | Immunogenic combination compositions and uses thereof |
WO2013009564A1 (en) | 2011-07-08 | 2013-01-17 | Novartis Ag | Tyrosine ligation process |
WO2013016460A1 (en) | 2011-07-25 | 2013-01-31 | Novartis Ag | Compositions and methods for assessing functional immunogenicity of parvovirus vaccines |
US10933129B2 (en) | 2011-07-29 | 2021-03-02 | Selecta Biosciences, Inc. | Methods for administering synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte responses |
WO2013030783A1 (en) | 2011-08-30 | 2013-03-07 | Novartis Ag | Immunogenic proteins and compositions |
US9511130B2 (en) | 2011-09-14 | 2016-12-06 | Glaxosmithkline Biologicals Sa | Escherichia coli vaccine combination |
WO2013038375A2 (en) | 2011-09-14 | 2013-03-21 | Novartis Ag | Methods for making saccharide-protein glycoconjugates |
US10105429B2 (en) | 2011-09-14 | 2018-10-23 | Glaxosmithkline Biologicals Sa | Escherichia coli vaccine combination |
WO2013038385A2 (en) | 2011-09-14 | 2013-03-21 | Novartis Ag | Escherichia coli vaccine combination |
US9873694B2 (en) | 2011-10-04 | 2018-01-23 | Janus Biotherapeutics, Inc. | Imidazole quinoline-based immune system modulators |
WO2013068949A1 (en) | 2011-11-07 | 2013-05-16 | Novartis Ag | Carrier molecule comprising a spr0096 and a spr2021 antigen |
WO2013084071A2 (en) | 2011-12-08 | 2013-06-13 | Novartis Ag | Clostridium difficile toxin-based vaccine |
US9931398B2 (en) | 2012-01-16 | 2018-04-03 | Labyrinth Holdings, Llc | Naturally-occurring CpG oligonucleotide compositions and therapeutic applications thereof |
US11857577B2 (en) | 2012-01-16 | 2024-01-02 | Labyrinth Holdings, Llc | Compositions and methods for the treatment of hepatic diseases and disorders |
US10149869B2 (en) | 2012-01-16 | 2018-12-11 | Labyrinth Holdings, Llc | Compositions and methods for the treatment of hepatic diseases and disorders |
US10688177B2 (en) | 2012-01-16 | 2020-06-23 | Labyrinth Holdings, Llc | Naturally-occurring CpG oligonucleotide compositions and therapeutic applications thereof |
WO2013108272A2 (en) | 2012-01-20 | 2013-07-25 | International Centre For Genetic Engineering And Biotechnology | Blood stage malaria vaccine |
WO2013124473A1 (en) | 2012-02-24 | 2013-08-29 | Novartis Ag | Pilus proteins and compositions |
US11071776B2 (en) | 2012-04-23 | 2021-07-27 | N-Fold Llc | Nanoparticles for treatment of allergy |
US9597385B2 (en) | 2012-04-23 | 2017-03-21 | Allertein Therapeutics, Llc | Nanoparticles for treatment of allergy |
US10279026B2 (en) | 2012-04-26 | 2019-05-07 | Glaxosmithkline Biologicals Sa | Antigens and antigen combinations |
EP3804749A2 (en) | 2012-04-26 | 2021-04-14 | GlaxoSmithKline Biologicals S.A. | Antigens and antigen combinations |
WO2013160335A2 (en) | 2012-04-26 | 2013-10-31 | Novartis Ag | Antigens and antigen combinations |
WO2013164754A2 (en) | 2012-05-04 | 2013-11-07 | Pfizer Inc. | Prostate-associated antigens and vaccine-based immunotherapy regimens |
EP3563865A2 (en) | 2012-05-04 | 2019-11-06 | Pfizer Inc | Prostate-associated antigens and vaccine-based immunotherapy regimens |
US10124051B2 (en) | 2012-05-22 | 2018-11-13 | Glaxosmithkline Biologicals Sa | Meningococcus serogroup X conjugate |
WO2013174832A1 (en) | 2012-05-22 | 2013-11-28 | Novartis Ag | Meningococcus serogroup x conjugate |
WO2014005958A1 (en) | 2012-07-06 | 2014-01-09 | Novartis Ag | Immunogenic compositions and uses thereof |
US9764027B2 (en) | 2012-09-18 | 2017-09-19 | Glaxosmithkline Biologicals Sa | Outer membrane vesicles |
EP3400960A1 (en) | 2012-09-18 | 2018-11-14 | GlaxoSmithKline Biologicals S.A. | Outer membrane vesicles |
EP3482770A1 (en) | 2012-10-03 | 2019-05-15 | GlaxoSmithKline Biologicals S.A. | Immunogenic compositions |
WO2014053607A1 (en) | 2012-10-03 | 2014-04-10 | Novartis Ag | Immunogenic compositions |
WO2014053612A1 (en) | 2012-10-03 | 2014-04-10 | Novartis Ag | Immunogenic composition |
US11208633B2 (en) | 2012-10-21 | 2021-12-28 | Pfizer Inc. | Compositions and methods relating to a mutant Clostridium difficile toxin |
US10787652B2 (en) | 2012-10-21 | 2020-09-29 | Pfizer Inc. | Compositions and methods relating to a mutant clostridium difficile toxin |
US11952597B2 (en) | 2012-10-21 | 2024-04-09 | Pfizer Inc. | Compositions and methods relating to a mutant Clostridium difficile toxin |
EP3912990A1 (en) | 2012-10-21 | 2021-11-24 | Pfizer Inc. | Compositions and methods relating to a mutant clostridium difficile toxin |
US10982198B2 (en) | 2012-10-21 | 2021-04-20 | Pfizer Inc. | Compositions and methods relating to a mutant Clostridium difficile toxin |
WO2014060898A2 (en) | 2012-10-21 | 2014-04-24 | Pfizer Inc. | Compositions and methods relating to a mutant clostridium difficile toxin |
EP4272750A2 (en) | 2013-02-07 | 2023-11-08 | Children's Medical Center, Corp. | Protein antigens that provide protection against pneumococcal colonization and/or disease |
US11643457B2 (en) | 2013-03-13 | 2023-05-09 | Prothena Biosciences Limited | Tau immunotherapy |
WO2014165271A2 (en) | 2013-03-13 | 2014-10-09 | Neotope Biosciences Limited | Tau immunotherapy |
EP3689904A1 (en) | 2013-03-13 | 2020-08-05 | Prothena Biosciences Limited | Tau immunotherapy |
US9539217B2 (en) | 2013-04-03 | 2017-01-10 | Allertein Therapeutics, Llc | Nanoparticle compositions |
US9999600B2 (en) | 2013-04-03 | 2018-06-19 | N-Fold Llc | Nanoparticle compositions |
EP3689375A1 (en) | 2013-05-15 | 2020-08-05 | The Governors Of The University Of Alberta | E1e2 hcv vaccines and methods of use |
WO2015022401A1 (en) * | 2013-08-14 | 2015-02-19 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Immunoadjuvant compositions and uses thereof |
EP3524262A1 (en) | 2013-11-01 | 2019-08-14 | Pfizer Inc | Vectors for expression of prostate-associated antigens |
WO2015063647A1 (en) | 2013-11-01 | 2015-05-07 | Pfizer Inc. | Vectors for expression of prostate-associated antigens |
WO2015068129A1 (en) | 2013-11-08 | 2015-05-14 | Novartis Ag | Salmonella conjugate vaccines |
WO2015075635A2 (en) | 2013-11-19 | 2015-05-28 | Prothena Biosciences Limited | Monitoring immunotherapy of lewy body disease from constipation symptoms |
US10279019B2 (en) | 2014-02-11 | 2019-05-07 | Stc.Unm | PCSK9 peptide vaccine conjugated to a Qbeta carrier and methods of using the same |
US11696941B2 (en) | 2014-02-11 | 2023-07-11 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Compositions comprising a PCSK9 peptide conjugated to a qbeta carrier and methods of using the same |
US10925938B2 (en) | 2014-02-11 | 2021-02-23 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Composition comprising PCSK9 peptide conjugated to a Qbeta carrier and methods of using the same |
WO2015123291A1 (en) | 2014-02-11 | 2015-08-20 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Pcsk9 vaccine and methods of using the same |
WO2015136469A1 (en) | 2014-03-12 | 2015-09-17 | Prothena Biosciences Limited | Anti-mcam antibodies and associated methods of use |
WO2015136470A1 (en) | 2014-03-12 | 2015-09-17 | Prothena Biosciences Limited | Anti-mcam antibodies and associated methods of use |
EP3639850A1 (en) | 2014-03-26 | 2020-04-22 | GlaxoSmithKline Biologicals S.A. | Mutant staphylococcal antigens |
EP3398948A2 (en) | 2014-08-22 | 2018-11-07 | Janus Biotherapeutics, Inc. | 2,4,6,7-tetrasubstituted pteridine compounds and methods of synthesis and use thereof |
WO2016183486A1 (en) | 2015-05-13 | 2016-11-17 | Agenus Inc. | Vaccines for treatment and prevention of cancer |
WO2016207853A2 (en) | 2015-06-26 | 2016-12-29 | Seqirus UK Limited | Antigenically matched influenza vaccines |
WO2017046776A2 (en) | 2015-09-16 | 2017-03-23 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis |
WO2017046774A2 (en) | 2015-09-16 | 2017-03-23 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of giant cell arteritis, polymyalgia rheumatica or takayasu's arteritis |
EP3733201A1 (en) | 2016-01-19 | 2020-11-04 | Pfizer Inc | Cancer vaccines |
WO2017125844A1 (en) | 2016-01-19 | 2017-07-27 | Pfizer Inc. | Cancer vaccines |
WO2017153955A1 (en) | 2016-03-09 | 2017-09-14 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases |
WO2017153953A1 (en) | 2016-03-09 | 2017-09-14 | Prothena Biosciences Limited | Use of anti-mcam antibodies for treatment or prophylaxis of granulomatous lung diseases |
US11584791B2 (en) | 2016-05-02 | 2023-02-21 | Prothena Biosciences Limited | Antibodies recognizing tau |
WO2017191559A1 (en) | 2016-05-02 | 2017-11-09 | Prothena Biosciences Limited | Tau immunotherapy |
WO2017191560A1 (en) | 2016-05-02 | 2017-11-09 | Prothena Biosciences Limited | Antibodies recognizing tau |
WO2017191561A1 (en) | 2016-05-02 | 2017-11-09 | Prothena Biosciences Limited | Antibodies recognizing tau |
US11958896B2 (en) | 2017-05-02 | 2024-04-16 | Prothena Biosciences Limited | Antibodies recognizing tau |
WO2019064115A1 (en) | 2017-09-28 | 2019-04-04 | Pfizer Inc. | Compositions and methods for eliciting an immune response against clostridium difficile |
US11633471B2 (en) | 2018-03-06 | 2023-04-25 | Unm Rainforest Innovations | Compositions and methods for reducing serum triglycerides |
US11926659B2 (en) | 2019-03-03 | 2024-03-12 | Prothena Biosciences Limited | Antibodies recognizing tau |
WO2020201985A1 (en) | 2019-04-01 | 2020-10-08 | Pfizer Inc. | Compositions and methods for eliciting an immune response against clostridium difficile |
US12018063B2 (en) | 2020-02-26 | 2024-06-25 | Versitech Limited | PD-1-based vaccines against coronavirus infection |
WO2021255690A2 (en) | 2020-06-19 | 2021-12-23 | Pfizer Inc. | Immunogenic compositions against clostridioides (clostridium) difficile and methods thereof |
WO2022147373A1 (en) | 2020-12-31 | 2022-07-07 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Antibody-guided pcsk9-mimicking immunogens lacking 9-residue sequence overlap with human proteins |
WO2022196701A1 (en) | 2021-03-16 | 2022-09-22 | 国立大学法人大阪大学 | Novel medical technique using follicular t-cells |
WO2022196699A1 (en) | 2021-03-16 | 2022-09-22 | 国立大学法人大阪大学 | Follicular helper t (tfh) cells specific to sars-cov-2 virus |
WO2023201109A1 (en) | 2022-04-15 | 2023-10-19 | Yale University | Exatecan formulation |
WO2024127215A2 (en) | 2022-12-13 | 2024-06-20 | Pfizer Inc. | Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile |
Also Published As
Publication number | Publication date |
---|---|
EP1005368A1 (en) | 2000-06-07 |
DK1005368T3 (en) | 2010-01-04 |
EP2172216A2 (en) | 2010-04-07 |
CA2283557A1 (en) | 1998-09-17 |
EP1005368B1 (en) | 2009-09-02 |
AU753688B2 (en) | 2002-10-24 |
EP1005368A4 (en) | 2004-09-29 |
DE69841122D1 (en) | 2009-10-15 |
ES2333069T3 (en) | 2010-02-16 |
JP5087758B2 (en) | 2012-12-05 |
ATE441432T1 (en) | 2009-09-15 |
JP2002511841A (en) | 2002-04-16 |
AU6759598A (en) | 1998-09-29 |
PT1005368E (en) | 2009-11-19 |
EP2172216A3 (en) | 2010-11-24 |
JP2009280606A (en) | 2009-12-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1005368B1 (en) | Use of nucleic acids containing unmethylated CpG dinucleotide in combination with alum as adjuvants | |
WO1998040100A9 (en) | USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE AS AN ADJUVANT | |
Kayraklioglu et al. | CpG oligonucleotides as vaccine adjuvants | |
KR101329374B1 (en) | Immunostimulatory oligonucleotides | |
ES2628744T3 (en) | Methods and products to induce immunity in mucous membranes | |
JP4620251B2 (en) | Composition of CPG and saponin adjuvant and method thereof | |
US6406705B1 (en) | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant | |
AU2001275294A1 (en) | Immunostimulatory RNA/DNA hybrid molecules | |
EP0855184A1 (en) | Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination | |
JP2001526688A (en) | Oligonucleotide adjuvant | |
WO2006056142A1 (en) | Cpg single-strand deoxynucleotides for use as adjuvant | |
US7279555B2 (en) | Advanced antigen presentation platform | |
JP2023506441A (en) | Pharmaceutical composition and use thereof | |
EP1165773A1 (en) | Advanced antigen presentation platform | |
CN117897487A (en) | Application of artificially synthesized CpG-containing single-chain deoxyoligonucleotide in vaccine | |
WO2002011761A2 (en) | Vaccine against rsv | |
JP2013510189A (en) | Non-DNA base-containing polynucleotide compositions and their use for modulating immune responses |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ENP | Entry into the national phase |
Ref country code: US Ref document number: 1998 153730 Date of ref document: 19980915 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09154614 Country of ref document: US |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
COP | Corrected version of pamphlet |
Free format text: PAGES 1-33, DESCRIPTION, REPLACED BY NEW PAGES 1-33 |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 67595/98 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref document number: 2283557 Country of ref document: CA Ref country code: CA Ref document number: 2283557 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998912919 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1998912919 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 67595/98 Country of ref document: AU |