WO1998031811A1 - Membre de la superfamille des recepteurs d'hematopoietine - Google Patents

Membre de la superfamille des recepteurs d'hematopoietine Download PDF

Info

Publication number
WO1998031811A1
WO1998031811A1 PCT/US1998/000334 US9800334W WO9831811A1 WO 1998031811 A1 WO1998031811 A1 WO 1998031811A1 US 9800334 W US9800334 W US 9800334W WO 9831811 A1 WO9831811 A1 WO 9831811A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
seq
sequence
nucleotide
amino acid
Prior art date
Application number
PCT/US1998/000334
Other languages
English (en)
Inventor
Debra D. Donaldson
Mary Collins
Tamlyn Neben
Matthew Whitters
Original Assignee
Genetics Institute, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetics Institute, Inc. filed Critical Genetics Institute, Inc.
Priority to EP98901207A priority Critical patent/EP1005552A1/fr
Priority to AU57338/98A priority patent/AU5733898A/en
Priority to JP53443598A priority patent/JP2001508309A/ja
Publication of WO1998031811A1 publication Critical patent/WO1998031811A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to new members of the mammalian hematopoietin superfamily of proteins (including without limitation human and murine receptor proteins), fragments thereof and recombinant polynucleotides and cells useful for expressing such proteins.
  • hematopoietins A variety of regulatory molecules, known as hematopoietins, have been identified which are involved in the development and proliferation of the various populations of hematopoietic or blood cells. Most hematopoietins exhibits certain biological activities by interacting with a receptor on the surface of target cells. Cytokine receptors are commonly composed of one. two or three chains. Many cytokine receptors and some cytokines, such as IL-12 p40, are members of the hematopoietin receptor superfamily of proteins.
  • Identification of new members of the hematopoietin receptor superfamily can be useful in regulation of hematopoiesis, in regulation of immune responses and in identification of other members of the hematopoietin superfamily, including cytokines and receptors.
  • polynucleotides encoding the U4 hematopoietin receptor superfamily chain are disclosed, including without limitation those from the murine and human sources.
  • the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:
  • nucleotide sequence of SEQ ID NO:4 from nucleotide 242 to nucleotide 1396
  • nucleotide sequence of SEQ ID NO:6 from nucleotide 71 to nucleotide 1225;
  • nucleotide sequence encodes a protein having a biological activity of the U4 hematopoietin receptor superfamily chain.
  • the nucleotide sequence may be operably linked to an expression control sequence.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO:4 from nucleotide 242 to nucleotide 1396; the nucleotide sequence of SEQ ID NO:4 from nucleotide 122 to nucleotide 1396; the nucleotide sequence of SEQ ID NO:6 from nucleotide 71 to nucleotide 1225; or the nucleotide sequence of SEQ ID NO:6 from nucleotide 11 to nucleotide 1225.
  • the invention also provides isolated polynucleotides comprising a nucleotide sequence encoding a peptide or protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:5;
  • Other preferred embodiments encode the amino acid sequence of SEQ ID NO:5; the amino acid sequence of SEQ ID NO:5 from amino acids 41 to 425; the amino acid sequence of SEQ ID NO:7; and the amino acid sequence of SEQ ID NO:7 from amino acids 24 to 408.
  • Host cells preferably mammalian cells, transformed with the polynucleotides are also provided.
  • the invention provides a process for producing a U4 protein.
  • the process comprises:
  • the present invention also provides for an isolated U4 protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:5;
  • the protein comprises the amino acid sequence of SEQ ID NO:5; the amino acid sequence of SEQ ID NO: 5 from amino acids 41 to 425; the amino acid sequence of SEQ ID NO:7; or the amino acid sequence of SEQ ID NO:7 from amino acids 24 to 408.
  • the specified amino acid sequence is part of a fusion protein (with an additional amino acid sequence not derived from U4).
  • Preferred fusion proteins comprise an antibody fragment, such as an Fc fragment.
  • Pharmaceutical compositions comprising a protein of the present invention and a pharmaceutically acceptable carrier are also provided.
  • the present invention further provides for compositions comprising an antibody which specifically reacts with a protein of the present invention.
  • U4 hematopoietin receptor superfamily chain hereinafter "U4"or "U4 protein"
  • U4 protein polynucleotides encoding murine and human U4.
  • EHKPLREWFV ⁇ VIMATICFILLIL, SEQ ID NO: l) was used to search the GenBank EST database using the TBLASTN algorithm.
  • EST W66776 was identified with homology to this region, suggesting that this might encode a novel hematopoietin receptor.
  • Translation of the reverse-complement of this EST using the GCG map program revealed a protein sequence in the second reading frame that contained the conserved WSXWS motif found in hematopoietin receptors. However, a stop codon was also present in this reading frame at nucleotide 227, indicating that this EST either was not a novel hematopoietin receptor, or that the DNA sequence in the EST was incorrect.
  • SEQ ID NO:4 provides the nucleotide sequence of a cDNA encoding the murine U4.
  • SEQ ID NO: 5 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-40. The mature murine U4 is believed to have the sequence of amino acids 41-383 of SEQ ID NO:5.
  • GenBank the W66776 sequence was used to search GenBank using the BLASTN algorithm. A closely related EST, HI 4009, derived from human genomic DNA was identified. An oligonucleotide derived from this EST CTGAGCGTGC GCTGGGTGTC GCCAC (SEQ ID NO: 3) was then used to isolate a cDNA clone from a human cDNA library.
  • a cDNA clone (HU4-3B) encoding a full-length mature protein homolog was completely sequenced. This clone does not have a complete signal sequence, but does encode the entire predicted full-length mature protein.
  • the human clone is 85% homologous at the DNA level with the mouse clone.
  • the predicted amino acid sequences have 95% identity between human and mouse.
  • the nucleotide and amino acid sequence for human U4 are reported as SEQ ID NO:6 and SEQ ID NO:
  • SEQ ID NO: 6 provides the nucleotide sequence of a cDNA encoding the human U4.
  • SEQ ID NO:7 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-23. The mature human U4 is believed to have the sequence of amino acids 24-380 of SEQ ID NO:
  • the murine and human clones were deposited with the American Type
  • Human U4 protein can be expressed by replacing the human leader sequence with the sequence of the murine leader, or by extending the human leader sequence with amino acids 1-14 of the murine sequence (MPAGRPGPVA QSAR, SEQ ID NO: 8). Additionally, a longer cDNA or genomic clone encoding the actual human leader can be isolated using the sequences disclosed herein as probes.
  • U4 proteins of less than full length are encompassed within the present invention and are referred to herein collectively with full length and mature forms as "U4" or "U4 proteins.”
  • U4 proteins of less than full length may be produced by expressing a corresponding fragment of the polynucleotide encoding the full-length U4 protein (SEQ ID NO:4 or SEQ ID NO:6). These corresponding polynucleotide fragments are also part of the present invention.
  • Modified polynucleotides as described above may be made by standard molecular biology techniques, including construction of appropriate desired deletion mutants, site-directed mutagenesis methods or by the polymerase chain reaction using appropriate oligonucleotide primers.
  • a protein has "a biological activity of the U4 hematopoietin receptor superfamily chain" if it possess one or more of the biological activities of the corresponding mature U4 protein.
  • U4 or active fragments thereof may be fused to carrier molecules such as immunoglobulins.
  • carrier molecules such as immunoglobulins.
  • soluble forms of the U4 may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
  • Other fusions proteins such as those with GST, Lex-A or MBP, may also be used.
  • the invention also encompasses allelic variants of the nucleotide sequences as set forth in SEQ ID NO:4 or SEQ ID NO:6, that is, naturally-occurring alternative forms of the isolated polynucleotide of SEQ ID NO:4 or SEQ ID NO:6 which also encode U4 proteins, preferably those proteins having a biological activity of U4. Also included in the invention are isolated polynucleotides which hybridize to the nucleotide sequence set forth in SEQ ID NO:4 or SEQ ID NO:6 under highly stringent conditions (for example, O.lxSSC at 65°C).
  • Isolated polynucleotides which encode U4 proteins but which differ from the nucleotide sequence set forth in SEQ ID NO:4 or SEQ ID NO:6 by virtue of the degeneracy of the genetic code are also encompassed by the present invention. Variations in the nucleotide sequence as set forth in SEQ ID NO:4 or SEQ ID NO: 6 which are caused by point mutations or by induced modifications are also included in the invention.
  • the present invention also provides polynucleotides encoding homologues of the murine and human U4 from other animal species, particularly other mammalian species.
  • Species homologues can be identified and isolated by making probes or primers from the murine or human sequences disclosed herein and screening a library from an appropriate species, such as for example libraries constructed from PBMCs, thymus or testis of the relevant species.
  • the isolated polynucleotides of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. ⁇ 9, 4485-4490 (1991), in order to produce the U4 protein recombinantly.
  • Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzymology 185, 537-566
  • operably linked means enzymatically or chemically ligated to form a covalent bond between the isolated polynucleotide of the invention and the expression control sequence, in such a way that the U4 protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
  • a number of types of cells may act as suitable host cells for expression of the U4 protein. Any cell type capable of expressing functional U4 protein may be used. Suitable mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
  • CHO Chinese Hamster Ovary
  • human kidney 293 cells human epidermal A431 cells
  • human Colo205 cells human Colo205 cells
  • CV-1 cells other transformed primate cell lines
  • normal diploid cells cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK
  • the U4 protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). incorporated herein by reference. Soluble forms of the U4 protein may also be produced in insect cells using appropriate isolated polynucleotides as described above.
  • the U4 protein may be produced in lower eukaryotes such as yeast or in prokaryotes such as bacteria.
  • suitable yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins.
  • Suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins.
  • Expression in bacteria may result in formation of inclusion bodies incorporating the recombinant protein.
  • refolding of the recombinant protein may be required in order to produce active or more active material.
  • Several methods for obtaining correctly folded heterologous proteins from bacterial inclusion bodies are known in the art. These methods generally involve solubilizing the protein from the inclusion bodies, then denaturing the protein completely using a chaotropic agent.
  • cysteine residues are present in the primary amino acid sequence of the protein, it is often necessary to accomplish the refolding in an environment which allows correct formation of disulfide bonds (a redox system).
  • a redox system disulfide bonds
  • the U4 protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a polynucleotide sequence encoding the U4 protein.
  • the U4 protein of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein. The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the U4 protein of the invention can be purified from conditioned media. Membrane-bound forms of U4 protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X- 100.
  • the U4 protein can be purified using methods known to those skilled in the art. For example, the U4 protein of the invention can be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit.
  • the concentrate can be applied to a purification matrix such as a gel filtration medium.
  • a purification matrix such as a gel filtration medium.
  • an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) or polyetheyleneimine (PEI) groups.
  • the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
  • a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred
  • the purification of the U4 protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl® or Cibacrom blue 3GA Sepharose®; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity chromatography.
  • affinity resins as concanavalin A-agarose, heparin-toyopearl® or Cibacrom blue 3GA Sepharose®
  • one or more reverse-phase high performance liquid chromatography (RP- HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the U4 protein.
  • Affinity columns including antibodies to the U4 protein can also be used in purification in accordance with known methods.
  • Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein.
  • the isolated U4 protein is purified so that it is substantially free of other mammalian proteins.
  • U4 proteins of the invention may also be used to screen for agents which are capable of binding to U4.
  • Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the U4 protein of the invention.
  • Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
  • U4 protein may be immobilized in purified form on a carrier and binding or potential ligands to purified U4 protein may be measured.
  • U4 proteins purified from cells or recombinantly produced, may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier may contain, in addition to U4 or inhibitor and carrier, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
  • pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
  • the pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, IL-1, BL-2, IL-3, IL-4, IL-5, IL-6, IE-?, IL-8, IL-9, IL-10, IL-1 1, IL-12, IL-14, JL- 15, G-CSF, stem cell factor, and erythropoietin.
  • the pharmaceutical composition may also include anti-cytokine antibodies.
  • the pharmaceutical composition may contain thrombolytic or anti-thrombotic factors such as plasminogen activator and
  • the pharmaceutical composition may further contain other anti- inflammatory agents.
  • additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with isolated U4 protein, or to minimize side effects caused by the isolated U4 protein.
  • isolated U4 protein may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti- inflammatory agent.
  • the pharmaceutical composition of the invention may be in the form of a liposome in which isolated U4 protein is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which in aqueous solution.
  • Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No.
  • the term "therapeutically effective amount” means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
  • a meaningful patient benefit e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
  • the term refers to that ingredient alone.
  • the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
  • a therapeutically effective amount of isolated U4 protein is administered to a mammal.
  • Isolated U4 protein may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors.
  • U4 protein may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti- thrombotic factors, or sequentially.
  • U4 protein used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is preferred.
  • U4 protein When a therapeutically effective amount of U4 protein is administered orally, U4 protein will be in the form of a tablet, capsule, powder, solution or elixir.
  • the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
  • the tablet, capsule, and powder contain from about 5 to 95% U4 protein, and preferably from about 25 to 90% U4 protein.
  • a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added.
  • the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
  • the pharmaceutical composition When administered in liquid form, contains from about 0.5 to 90% by weight of U4 protein, and preferably from about 1 to 50% U4 protein.
  • U4 protein When a therapeutically effective amount of U4 protein is administered by intravenous, cutaneous or subcutaneous injection, U4 protein will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • a preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to U4 protein an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
  • the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additive known to those of skill in the art.
  • the amount of U4 protein in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of U4 protein with which to treat each individual patient. Initially, the attending physician will administer low doses of U4 protein and observe the patient's response. Larger doses of U4 protein may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not generally increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.1 ⁇ g to about 100 mg of U4 protein per kg body weight.
  • the duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the U4 protein will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
  • the polynucleotide and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below. Uses or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).
  • a protein of the present invention may exhibit cytokine, cell proliferation (either inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may induce production of other cytokines in certain cell populations.
  • the activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation, 32D, DA2, DA1G, T10, B9, B9/11, BaF3, MC9/G,
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Assays for T-cell or thymocyte proliferation include without limitation those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H.
  • Assays for cytokine production and/or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in: Polyclonal T cell stimulation, Kruisbeek, A.M. and Shevach, E.M. In Current Protocols in Immunology.
  • Assays for T-cell clone responses to antigens include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter 6, Cytokines and their cellular receptors; Chapter 7, Immunologic studies in Humans); Weinberger et al.,
  • a protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are desc ⁇ bed herein
  • a protein may be useful in the treatment of vanous immune deficiencies and disorders (including severe combined immunodeficiency (SOD)), e g , in regulating (up or down) growth and proliferation of T and/or B lymphocytes, as well as effecting the cytolytic activity of NK cells and other cell populations
  • SOD severe combined immunodeficiency
  • e g severe combined immunodeficiency
  • T and/or B lymphocytes as well as effecting the cytolytic activity of NK cells and other cell populations
  • These immune deficiencies may be genetic or be caused by viral (e g , HIV) as well as bactenal or fungal infections, or may result from autoimmune disorders
  • infectious diseases causes by viral, bacte ⁇ al, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV, hepatitis viruses, herpesviruses,
  • a protein of the present invention may also be useful where a boost to the immune system generally may be desirable, t.e , in the treatment of cancer
  • Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent diabetes melhtis, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease
  • a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems
  • Other conditions, in which immune suppression is desired may also be treatable using a protein of the present invention
  • T cells may be inhibited by suppressing T cell responses or by inducing specific tolerance in T cells, or both Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent Tolerance, which involves inducing non-responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen-specific and persists after exposure to the tole ⁇ zing agent has ceased Operationally, tolerance can be demonstrated by the lack of a T cell response upon reexposure to specific antigen in the absence of the tole ⁇ zing agent Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as , for example, B7)), e.g., preventing high level lymphok
  • T cell function should result in reduced tissue destruction in tissue transplantation.
  • rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant.
  • the administration of a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells such as a soluble, monomeric form of a peptide having B7-2 activity alone or in conjunction with a monomeric form of a peptide having an activity of another B lymphocyte antigen (e.g., B7-
  • Blocking B lymphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an immunosuppressant. Moreover, the lack of costimulation may also be sufficient to anergize the T cells, thereby inducing tolerance in a subject. Induction of long-term tolerance by B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents. To achieve sufficient immunosuppression or tolerance in a subject, it may also be necessary to block the function of a combination of B lymphocyte antigens.
  • the efficacy of particular blocking reagents in preventing organ transplant rejection or GVHD can be assessed using animal models that are predictive of efficacy in humans.
  • appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in vivo as described in Lenschow et al., Science 257:789-792 (1992) and Turka et al., Proc. Natl. Acad. Sci USA, 89:11102-11105 (1992).
  • murine models of GVHD see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 846-847) can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of that disease.
  • Blocking antigen function may also be therapeutically useful for treating autoimmune diseases.
  • Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self tissue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases. Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms.
  • reagents which block costimulation of T cells by disrupting recepto ⁇ ligand interactions of B lymphocyte antigens can be used to inhibit T cell activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process. Additionally, blocking reagents may induce antigen- specific tolerance of autoreactive T cells which could lead to long-term relief from the disease.
  • the efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well-characterized animal models of human autoimmune diseases.
  • Examples include murine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRL/lpr/lpr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB rats, and murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New York, 1989, pp. 840-856).
  • Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy. Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an initial immune response. For example, enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection. In addition, systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B lymphocyte antigens systemically.
  • anti-viral immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro with viral antigen- pulsed APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient.
  • Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on their surface, and reintroduce the transfected cells into the patient.
  • the infected cells would now be capable of delivering a costimulatory signal to, and thereby activate, T cells in vivo.
  • up regulation or enhancement of antigen function may be useful in the induction of tumor immunity.
  • Tumor cells e.g., sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma
  • a nucleic acid encoding at least one peptide of the present invention can be administered to a subject to overcome tumor-specific tolerance in the subject. If desired, the tumor cell can be transfected to express a combination of peptides.
  • tumor cells obtained from a patient can be transfected ex vivo with an expression vector directing the expression of a peptide having B7-2-like activity alone, or in conjunction with a peptide having B7-l-like activity and/or B7-3-like activity.
  • the transfected tumor cells are returned to the patient to result in expression of the peptides on the surface of the transfected cell.
  • gene therapy techniques can be used to target a tumor cell for transfection in vivo.
  • tumor cells which lack MHC class I or MHC class II molecules, or which fail to reexpress sufficient amounts of MHC class I or MHC class II molecules, can be transfected with nucleic acid encoding all or a portion of (e.g., a cytoplasmic-domain truncated portion) of an MHC class I ⁇ chain protein and ⁇ 2 microglobulin protein or an MHC class II ⁇ chain protein and an MHC class II ⁇ chain protein to thereby express MHC class I or MHC class II proteins on the cell surface.
  • nucleic acid encoding all or a portion of (e.g., a cytoplasmic-domain truncated portion) of an MHC class I ⁇ chain protein and ⁇ 2 microglobulin protein or an MHC class II ⁇ chain protein and an MHC class II ⁇ chain protein to thereby express MHC class I or MHC class II proteins on the cell surface.
  • a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity.
  • a T cell mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Cu ⁇ ent Protocols in Immunology, Ed by J. E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W Strober, Pub. Greene Publishing Associates and Wiley-Interscience (Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-
  • MLR Mixed lymphocyte reaction
  • Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in: Guery et al., J. Immunol. 134:536-544, 1995; Inaba et al., Journal of Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal of Immunology 154:5071-5079, 1995; Porgador et al., Journal of Experimental Medicine 182:255-260, 1995; Nair et al., Joumal of Virology 67:4062-4069, 1993; Huang et al., Science 264:961- 965, 1994; Macatonia et al., Joumal of Experimental Medicine 169:1255-1264, 1989;
  • lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al., Cytometry 13:795-808, 1992; Gorczyca et al, Leukemia 7:659-670, 1993; Gorczyca et al., Cancer Research 53:1945-1951 , 1993; Itoh et al, Cell 66:233-243, 1991 ; Zacharchuk, Joumal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry 14:891-897, 1993; Gorczyca et al., International Joumal of Oncology 1 :639-648, 1992.
  • Assays for proteins that influence early steps of T-cell commitment and development include, without limitation, those described in: Antica et al., Blood 84:11 1-117, 1994; Fine et al., Cellular Immunology 155:1 11-122, 1994; Galy et al., Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551 , 1991.
  • a protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies. Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g.
  • erythroid progenitor cells in supporting the growth and proliferation of erythroid progenitor cells alone or in combination with other cytokines, thereby indicating utility, for example, in treating various anemias or for use in conjunction with i ⁇ adiation/chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo- suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of the above-mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell
  • a protein of the invention as normal cells or genetically manipulated for gene therapy.
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Assays for embryonic stem cell differentiation include, without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood
  • Assays for stem cell survival and differentiation include, without limitation, those described in: Methylcellulose colony forming assays, Freshney, M.G. In Culture of Hematopoietic Cells. R.I. Freshney, et al. eds. Vol pp. 265-268, Wiley-Liss, Inc., New York, NY. 1994;
  • polynucleotides provided by the present invention can be used by the research community for various purposes.
  • the polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use; as markers for tissues in which the co ⁇ esponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags (when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out" known sequences in the process of discovering other novel polynucleotides; for selecting and making oligomers for attachment to a "gene chip” or other support, including for examination of expression patterns; to raise anti-protein antibodies
  • the polynucleotide encodes a protein which binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction)
  • the polynucleotide can also be used in interaction trap assays (such as, for example, that described in Gyuris et al., Cell 75:791-803 (1993)) to identify polynucleotides encoding the other protein with which binding occurs or to identify inhibitors of the binding interaction.
  • the proteins provided by the present invention can similarly be used in assay to determine biological activity, including in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the co ⁇ esponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate co ⁇ elative receptors or ligands.
  • the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction)
  • the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Any or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as research products.
  • Polynucleotides and proteins of the present invention can also be used as nutritional sources or supplements. Such uses include without limitation use as a protein or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate.
  • the protein or polynucleotide of the invention can be added to the feed of a particular organism or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions or capsules.
  • the protein or polynucleotide of the invention can be added to the medium in or on which the microorganism is cultured.
  • U4 proteins of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the U4 protein and which may inhibit binding of ligands to the receptor. Such antibodies may be obtained using the entire U4 as an immunogen, or by using fragments of U4. Smaller fragments of the U4 may also be used to immunize animals.
  • the peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Additional peptide immunogens may be generated by replacing tyrosine residues with sulfated tyrosine residues.
  • KLH keyhole limpet hemocyanin
  • Neutralizing or non-neutralizing antibodies binding to U4 protein may also be useful therapeutics for certain tumors and also in the treatment of conditions described above. These neutralizing monoclonal antibodies may be capable of blocking ligand binding to the U4 receptor chain.
  • U4 Protein DNA encoding the full-length murine U4 protein was fused to a spacer sequence encoding Gly-Ser-Gly by PCR and ligated in frame with sequences encoding the hinge CH2 CH3 regions of human IgGl in the COS-1 expression vector pED.Fc .
  • the DNA was transfected into Cos cells and expression of the fusion protein was detected by ELISA using antibodies that detected the IgGl portion of the protein. This demonstrated that the protein could be expressed and secreted in Cos cells.
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE other nucleic acid
  • Gin Asp Pro Thr Phe Leu lie Gly Ser Ser Leu Gin Ala Thr Cys Ser 50 55 60 lie His Gly Asp Thr Pro Gly Ala Thr Ala Glu Gly Leu Tyr Trp Thr 65 70 75 80 Leu Asn Gly Arg Arg Leu Pro Ser Glu Leu Ser Arg Leu Leu Asn Thr 85 90 95
  • CTACTGGACC CTCAACGGGC GCCGCCTGCC CCCTGAGCTC TCCCGTGTAC TCAACGCCTC 240
  • CTCCTGCCGC CTGGCCGGCC TGAAACCCGG CACCGTGTAC TTCGTGCAAG TGCGCTGCAA 900
  • CAAGAAGCAC GCGTACTGCT CCAACCTCAG CTTCCGCCTC TACGACCAGT GGCGAGCCTG 1140
  • GACTCCCACG TGAGGCCACC TTTGGGTGCA CCCCAGTGGG TGTGTGTGTGTGTGTGTGAGGG 1440

Abstract

Cette invention concerne des polynucléotides qui codent la chaîne de la superfamille de récepteurs d'hématopïétine U4, ainsi que des fragments de ces polynucléotides. Cette invention concerne également des protéines U4 et des procédés de production de celles-ci.
PCT/US1998/000334 1997-01-16 1998-01-15 Membre de la superfamille des recepteurs d'hematopoietine WO1998031811A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP98901207A EP1005552A1 (fr) 1997-01-16 1998-01-15 Membre de la superfamille des recepteurs d'hematopoietine
AU57338/98A AU5733898A (en) 1997-01-16 1998-01-15 Member of the hematopoietin receptor superfamily
JP53443598A JP2001508309A (ja) 1997-01-16 1998-01-15 ヘマトポイエチン受容体スーパーファミリーのメンバー

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US78486397A 1997-01-16 1997-01-16
US08/784,863 1997-01-16

Publications (1)

Publication Number Publication Date
WO1998031811A1 true WO1998031811A1 (fr) 1998-07-23

Family

ID=25133760

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/000334 WO1998031811A1 (fr) 1997-01-16 1998-01-15 Membre de la superfamille des recepteurs d'hematopoietine

Country Status (4)

Country Link
EP (1) EP1005552A1 (fr)
JP (1) JP2001508309A (fr)
AU (1) AU5733898A (fr)
WO (1) WO1998031811A1 (fr)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998049307A1 (fr) * 1997-05-01 1998-11-05 Zymogenetics, Inc. Recepteurs de mammiferes analogues de la cytokine
WO1999020755A2 (fr) * 1997-10-16 1999-04-29 Glaxo Group Limited Nouveaux recepteurs de cytokine
WO1999037769A1 (fr) * 1998-01-22 1999-07-29 Regeneron Pharmaceuticals, Inc. Recepteurs orphelins
WO1999040195A1 (fr) * 1998-02-06 1999-08-12 Schering Corporation Proteines de recepteurs de mammiferes; reactifs et procedes apparentes
WO1999047675A1 (fr) * 1998-03-17 1999-09-23 Genetics Institute, Inc. Nouveau membre appele mu-1 de la famille des recepteurs de cytokine
WO1999053066A1 (fr) * 1998-04-10 1999-10-21 Genetics Institute, Inc. U4, un membre de la superfamille des recepteurs de l'hematopoietine
WO2000008152A1 (fr) * 1998-08-04 2000-02-17 Regeneron Pharmaceuticals, Inc. Nouveaux recepteurs de cytokine orphelins
WO2000017235A3 (fr) * 1998-09-23 2000-07-20 Zymogenetics Inc Recepteur de cytokine appele zalpha11
WO2000053631A1 (fr) * 1999-03-11 2000-09-14 Schering Corporation Cytokines de mammifere : reactifs et procedes associes
US6207413B1 (en) 1998-01-22 2001-03-27 Regeneron Pharmaceuticals, Inc. Nucleic acids encoding novel orphan cytokine receptors
US6271343B1 (en) 1997-05-01 2001-08-07 Zymogenetics, Inc. Mammalian cytokine-like receptor 5
WO2002029060A2 (fr) * 2000-10-06 2002-04-11 Immunex Corporation Récepteurs d'hématopoïétine hpr1 et hpr2
US6576744B1 (en) 1998-09-23 2003-06-10 Zymogenetics, Inc. Cytokine receptor zalpha11
WO2003064469A2 (fr) * 2002-02-01 2003-08-07 Bayer Healthcare Ag Regulation de la proteine du type de recepteur hematopoietique humain
US6777539B2 (en) 2000-04-05 2004-08-17 Zymogenetics, Inc. Soluble zalpha11 cytokine receptors
US6800460B1 (en) 1999-03-11 2004-10-05 Schering Corporation Mammalian cytokine complexes
US6803451B2 (en) 1998-09-23 2004-10-12 Zymogenetics, Inc. Cytokine receptor zalpha11 polypeptides
US7189400B2 (en) 1998-03-17 2007-03-13 Genetics Institute, Llc Methods of treatment with antagonists of MU-1
US7198789B2 (en) 1998-03-17 2007-04-03 Genetics Institute, Llc Methods and compositions for modulating interleukin-21 receptor activity
US7314623B2 (en) 2002-07-15 2008-01-01 Wyeth Methods and compositions for modulating T helper (Th) cell development and function
US7495085B2 (en) 2003-03-14 2009-02-24 Wyeth Antibodies against human or mouse IL-21 receptor

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996008510A1 (fr) * 1994-09-14 1996-03-21 Progenitor, Inc. L'Hu-B1.219, UN NOUVEAU RECEPTEUR HUMAIN DE L'HEMATOPOIETINE
WO1998011225A2 (fr) * 1996-09-11 1998-03-19 Amrad Operations Pty. Ltd. Nouveau recepteur d'hematopoietine et sequences genetiques codant ce dernier

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996008510A1 (fr) * 1994-09-14 1996-03-21 Progenitor, Inc. L'Hu-B1.219, UN NOUVEAU RECEPTEUR HUMAIN DE L'HEMATOPOIETINE
WO1998011225A2 (fr) * 1996-09-11 1998-03-19 Amrad Operations Pty. Ltd. Nouveau recepteur d'hematopoietine et sequences genetiques codant ce dernier

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HILLIER L ET AL.: "AC: W46604. Homo sapiens cDNA clone 324067 3'.", EMBL SEQUENCE DATABASE, 28 May 1996 (1996-05-28), HEODELBERG, GERMANY, XP002062037 *
LI Q Y: "AC: H14009. EST00035 Homo sapiens genomic clone D2-17 5'.", EMBL SEQUENCE DATABASE, 3 July 1995 (1995-07-03), HEIDELBERG, GERMANY, XP002062036 *
MARRA M ET AL.: "AC: AA049280. Mus musculus cDNA clone 479043 5' end similar to SW: IL6B_MOUSE Q00560 interleukin-6 receptor beta chain precursor.", EMBL SEQUENCE DATABASE, 31 December 1996 (1996-12-31), HEIDELBERG, GERMANY, XP002062032 *
MARRA M ET AL.: "AC: W66776. Mus musculus cDNA clone 387741 5' end similar to PIR:B38252 granulocyte colony-stimulating factor receptor precursor.", EMBL SEQUENCE DATABASE, 15 June 1996 (1996-06-15), HEIDELBERG, GERMANY, XP002062033 *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998049307A1 (fr) * 1997-05-01 1998-11-05 Zymogenetics, Inc. Recepteurs de mammiferes analogues de la cytokine
US6271343B1 (en) 1997-05-01 2001-08-07 Zymogenetics, Inc. Mammalian cytokine-like receptor 5
WO1999020755A2 (fr) * 1997-10-16 1999-04-29 Glaxo Group Limited Nouveaux recepteurs de cytokine
WO1999020755A3 (fr) * 1997-10-16 1999-07-29 Glaxo Group Ltd Nouveaux recepteurs de cytokine
WO1999037769A1 (fr) * 1998-01-22 1999-07-29 Regeneron Pharmaceuticals, Inc. Recepteurs orphelins
US6207413B1 (en) 1998-01-22 2001-03-27 Regeneron Pharmaceuticals, Inc. Nucleic acids encoding novel orphan cytokine receptors
WO1999040195A1 (fr) * 1998-02-06 1999-08-12 Schering Corporation Proteines de recepteurs de mammiferes; reactifs et procedes apparentes
US7705123B2 (en) 1998-03-17 2010-04-27 Genetics Institute, Llc MU-1, member of the cytokine receptor family
US7994292B2 (en) 1998-03-17 2011-08-09 Genetics Institute, Llc MU-1, member of the cytokine receptor family
WO1999047675A1 (fr) * 1998-03-17 1999-09-23 Genetics Institute, Inc. Nouveau membre appele mu-1 de la famille des recepteurs de cytokine
US7198789B2 (en) 1998-03-17 2007-04-03 Genetics Institute, Llc Methods and compositions for modulating interleukin-21 receptor activity
US7189400B2 (en) 1998-03-17 2007-03-13 Genetics Institute, Llc Methods of treatment with antagonists of MU-1
EP1681348A1 (fr) * 1998-03-17 2006-07-19 Genetics Institute, LLC MU-1, membre de la famille des récepteurs de la cytokine
WO1999053066A1 (fr) * 1998-04-10 1999-10-21 Genetics Institute, Inc. U4, un membre de la superfamille des recepteurs de l'hematopoietine
WO2000008152A1 (fr) * 1998-08-04 2000-02-17 Regeneron Pharmaceuticals, Inc. Nouveaux recepteurs de cytokine orphelins
US6803451B2 (en) 1998-09-23 2004-10-12 Zymogenetics, Inc. Cytokine receptor zalpha11 polypeptides
US7411056B2 (en) 1998-09-23 2008-08-12 Zymogenetics, Inc. Polynucleotides encoding cytokine receptor zalpha11
US8372602B2 (en) 1998-09-23 2013-02-12 Zymogenetics, Inc. Methods for producing cytokine receptor ZALPHA11
US8110372B2 (en) * 1998-09-23 2012-02-07 Zymogenetics, Inc. Methods for detecting modulators of cytokine receptor zalpha11
US7638286B2 (en) 1998-09-23 2009-12-29 Zymogenetics, Inc. Antibodies to cytokine receptor zalpha11
WO2000017235A3 (fr) * 1998-09-23 2000-07-20 Zymogenetics Inc Recepteur de cytokine appele zalpha11
US6576744B1 (en) 1998-09-23 2003-06-10 Zymogenetics, Inc. Cytokine receptor zalpha11
US6692924B2 (en) 1998-09-23 2004-02-17 Zymogenetics, Inc. Methods of using cytokine receptor zalpha11 to detect its ligands
US7923212B2 (en) 1998-09-23 2011-04-12 Zymogenetics, Inc. Antibodies to cytokine receptor zalpha11
EA014417B1 (ru) * 1998-09-23 2010-12-30 Займодженетикс, Инк. Экспрессирующий вектор, содержащий полинуклеотид, кодирующий зрелый полипептид zalpha11 рецептора цитокина человека класса i или его функциональные компоненты, культивируемые клетки, содержащие экспрессирующий вектор, способ получения зрелого полипептида zalpha11 или его функциональных компонентов, полипептид, полученный данным способом, антитело, которое связывается с полипептидом, и полинуклеотид, кодирующий полипептид
US7435550B2 (en) 1998-09-23 2008-10-14 Zymogenetics, Inc. Methods of using cytokine receptor zalpha11 to detect its ligands
US6800460B1 (en) 1999-03-11 2004-10-05 Schering Corporation Mammalian cytokine complexes
US7390481B2 (en) 1999-03-11 2008-06-24 Schering Corporation Mammalian cytokine complexes
WO2000053631A1 (fr) * 1999-03-11 2000-09-14 Schering Corporation Cytokines de mammifere : reactifs et procedes associes
US7189695B2 (en) 2000-04-05 2007-03-13 Zymogenetics, Inc. Soluble zalpha11 cytokine receptors
US7629452B2 (en) 2000-04-05 2009-12-08 Zymogenetics, Inc. Polynucleotides encoding soluble zalpha11 cytokine receptors
US7763713B2 (en) 2000-04-05 2010-07-27 Zymogenetics, Inc. Zalpha11 cytokine receptors
US6777539B2 (en) 2000-04-05 2004-08-17 Zymogenetics, Inc. Soluble zalpha11 cytokine receptors
WO2002029060A2 (fr) * 2000-10-06 2002-04-11 Immunex Corporation Récepteurs d'hématopoïétine hpr1 et hpr2
WO2002029060A3 (fr) * 2000-10-06 2003-03-27 Immunex Corp Récepteurs d'hématopoïétine hpr1 et hpr2
WO2003064469A2 (fr) * 2002-02-01 2003-08-07 Bayer Healthcare Ag Regulation de la proteine du type de recepteur hematopoietique humain
WO2003064469A3 (fr) * 2002-02-01 2004-04-08 Bayer Healthcare Ag Regulation de la proteine du type de recepteur hematopoietique humain
US7314623B2 (en) 2002-07-15 2008-01-01 Wyeth Methods and compositions for modulating T helper (Th) cell development and function
US7731946B2 (en) 2002-07-15 2010-06-08 Wyeth Llc Methods and compositions for modulating T helper (TH) cell development and function
US7495085B2 (en) 2003-03-14 2009-02-24 Wyeth Antibodies against human or mouse IL-21 receptor
US8143385B2 (en) 2003-03-14 2012-03-27 Wyeth Llc Nucleic acids coding for antibodies against human IL-21 receptor and uses therefor

Also Published As

Publication number Publication date
JP2001508309A (ja) 2001-06-26
AU5733898A (en) 1998-08-07
EP1005552A1 (fr) 2000-06-07

Similar Documents

Publication Publication Date Title
EP0994947B1 (fr) Nouveau membre appele mu-1 de la famille des recepteurs de cytokine
US8048984B2 (en) Human GIL-19/AE289 proteins
WO1998031811A1 (fr) Membre de la superfamille des recepteurs d'hematopoietine
US20030049798A1 (en) MU-1, member of the cytokine receptor family
WO2000021990A1 (fr) Etiquettes de sequences exprimees secretees (sests)
WO1998049302A1 (fr) Proteines secretees et polynucleotides les codant
AU2001263088C1 (en) MU-1, member of the cytokine receptor family
AU2001263088A1 (en) MU-1, member of the cytokine receptor family
WO1998040485A1 (fr) Proteine secretee humaine ba3.1 et polynucleotides les codant
US20020039760A1 (en) Polynucleotides encoding novel secreted proteins
AU769279B2 (en) U4, a member of the hematopoietin receptor superfamily
AU2003208117C1 (en) MU-1, member of the cytokine receptor family
CA2284109A1 (fr) Proteines secretees et polynucleotides les codant
MXPA00009834A (en) U4, a member of the hematopoietin receptor superfamily
US20020192779A1 (en) Secreted protein, BA3.1, and polynucleotides encoding same
MXPA99010596A (en) Mu-1, member of the cytokine receptor family
CA2285447A1 (fr) Proteines secretees et polynucleotides les codant
CA2291477A1 (fr) Semaphorine e d'origine humaine et polynucleotides codant cette semaphorine e

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: US

Ref document number: 1998 58660

Date of ref document: 19980410

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)

Free format text: (EXCEPT US)

121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 534435

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1998901207

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1998901207

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1998901207

Country of ref document: EP