WO1998027207A1 - Recombinase-activatable aav packaging cassettes for use in the production of aav vectors - Google Patents
Recombinase-activatable aav packaging cassettes for use in the production of aav vectors Download PDFInfo
- Publication number
- WO1998027207A1 WO1998027207A1 PCT/US1997/023018 US9723018W WO9827207A1 WO 1998027207 A1 WO1998027207 A1 WO 1998027207A1 US 9723018 W US9723018 W US 9723018W WO 9827207 A1 WO9827207 A1 WO 9827207A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aav
- gene
- recombinase
- packaging
- ssr
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4712—Cystic fibrosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Definitions
- This invention relates to materials and methods used for the generation of viral vectors, particularly recombinant adeno-associated virus (AAV) vectors. More specifically, the invention relates to recombinase-activatable AAV packaging cassettes and cell lines comprising such cassettes for use in the production of AAV vectors.
- AAV adeno-associated virus
- Vectors based on adeno-associated virus are believed to have utility for gene therapy but a significant obstacle has been the difficulty in generating such vectors in amounts that would be clinically useful for human gene therapy applications. This is a particular problem for in vivo applications such as'direct delivery to the lung.
- Another important goal in the gene therapy context is the production of vector preparations that are essentially free of replication-competent virions. The following description briefly summarizes studies involving adeno-associated virus and AAV vectors, and then describes a number of novel improvements according to the present invention that are useful for efficiently generating high titer recombinant AAV vector (rAAV) preparations suitable for use in gene therapy.
- Adeno-associated virus is a defective parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus.
- General reviews of AAV may be found in, for example, Carter, 1989, Handbook of Parvoviruses, Vol. I, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York).
- co- infecting viruses that provide helper functions for AAV growth and replication are adenoviruses, herpesviruses and, in some cases, poxviruses such as vaccinia.
- the nature of the helper function is not entirely known but it appears that the helper virus indirectly renders the cell permissive for AAV replication. This belief is supported by the observation that AAV replication may occur at low efficiency in the absence of helper virus co-infection if the cells are treated with agents that are either genotoxic or that disrupt the cell cycle.
- AAV may replicate to a limited extent in the absence of helper virus in these unusual conditions more generally infection of cells with AAV in the absence of helper functions results in the proviral AAV genome integrating into the host cell genome. If these cells are superinfected with a helper virus such as adenovirus, the integrated AAV genome can be rescued and replicated to yield a burst of infectious progeny AAV particles.
- helper virus such as adenovirus
- AAV would be a useful vector for introducing genes into cells for uses such as human gene therapy.
- AAV has a very broad host range without any obvious species or tissue specificity and can replicate in virtually any cell line of human, simian or rodent origin provided that an appropriate helper is present.
- AAV is also relatively ubiquitous and has been isolated from a wide variety of animal species including most mammalian and several avian species.
- AAV is not associated with the cause of any disease.
- AAV a transforming or oncogenic virus, and integration of AAV into the genetic material of human cells generally does not cause significant alteration of the growth properties or morphological characteristics of the host cells.
- These properties of AAV also recommend it as a potentially useful human gene therapy vector because most of the other viral systems proposed for this application, such as retroviruses, adenoviruses, herpesviruses, or poxviruses, are disease-causing.
- AAV particles are comprised of a proteinaceous capsid having three capsid proteins, VP 1 ,
- the AAV DNA genome is a linear single-stranded DNA molecule having a molecular weight of about 1.5 x 10 ⁇ daltons and a length of approximately 4680 nucleotides. Individual particles package only one DNA molecule strand, but this may be either the "plus” or "minus” strand. Particles containing either strand are infectious and replication occurs by conversion of the parental infecting single strand to a duplex form and subsequent amplification of a large pool of duplex molecules from which progeny single strands are displaced and packaged into capsids.
- AAV genomes can be inserted into bacterial plasmids or phagemids and transfected into adenovirus-infected cells; these techniques have facilitated the study of AAV genetics and the development of AAV vectors.
- the AAV genome which encodes proteins mediating replication and encapsidation of the viral DNA, is generally flanked by two copies of inverted terminal repeats (ITRs).
- ITRs are each 145 nucleotides in length, flanking a unique sequence region of about 4470 nucleotides that contains two main open reading frames for the rep and cap genes (Srivastava et al., 1983, J.
- the AAV2 unique region contains three transcription promoters p5, pi 9, and p40 (Laughlin et al., 1979, Proc. Natl. Acad. Sci. USA, 76:5567-5571) that are used to express the rep and cap genes.
- the ITR sequences are required in cis and are sufficient to provide a functional origin of replication (ori), signals required for integration into the cell genome, and efficient excision and rescue from host cell chromosomes or recombinant plasmids. It has also been shown that the ITR can function directly as a transcription promoter in an AAV vector (Flotte et al., 1993, supra).
- the rep and cap gene products are required in trans to provide functions for replication and encapsidation of viral genome, respectively.
- the rep gene is expressed from two promoters, p5 and pi 9, and produces four proteins. Transcription from p5 yields an unspliced 4.2 kb mRNA encoding a first Rep protein (Rep78), and a spliced 3.9 kb mRNA encoding a second Rep protein (Rep68). Transcription from pi 9 yields an unspliced mRNA encoding a third Rep protein (Rep52), and a spliced 3.3 kb mRNA encoding a fourth Rep protein (Rep40). Thus, the four Rep proteins all comprise a common internal region sequence but differ in their amino and carboxyl terminal regions. Only the large Rep proteins (i.e. Rep78 and Rep68) are required for AAV duplex
- Rep52 and Rep40 small Rep proteins
- Rep68 and Rep78 bind specifically to the hairpin conformation of the AAV ITR and possess several enzyme activities required for resolving replication at the AAV termini.
- Rep52 and Rep40 have none of these properties.
- Recent reports by C. H ⁇ lscher et al. (1994, J. Virol. 68:7169-7177; and 1995, J. Virol. 69:6880-6885) suggest that expression of Rep78 or Rep 68 may in some circumstances be sufficient for infectious particle formation.
- Rep proteins primarily Rep78 and Rep68, also exhibit pleiotropic regulatory activities including positive and negative regulation of AAV genes and expression from some heterologous promoters, as well as inhibitory effects on cell growth (Tratschin et al., 1986, Mol. Cell. Biol.
- the capsid proteins VP1, VP2, and VP3 share a common overlapping sequence, but VP1 and VP2 contain additional amino terminal sequences. All three proteins are encoded by the same cap gene reading frame typically expressed from a spliced 2.3 kb mRNA transcribed from the p40 promoter. VP2 and VP3 can be generated from this mRNA by use of alternate initiation codons. Generally, transcription from p40 yields a 2.6 kb precursor mRNA which can be spliced at alternative sites to yield two different transcripts of about 2.3 kb. VP2 and VP3 can be encoded by either transcript (using either of the two initiation sites), whereas VP1 is encoded by only one of the transcripts.
- VP3 is the major capsid protein, typically accounting for about 90% of total virion protein.
- VP1 is coded from a minor mRNA using a 3' donor site that is 30 nucleotides upstream from the 3' donor used for the major mRNA that encodes VP2 and VP3. All three proteins are required for effective capsid production. Mutations which eliminate all three proteins (Cap- negative) prevent accumulation of single-strand progeny AAV DNA, whereas mutations in the VP1 amino-terminus (“Lip-negative” or "Inf-negative”) can permit assembly of single-stranded
- AAV AAV genomes cloned into bacterial plasmids.
- molecular clones of infectious genomes of AAV were constructed by insertion of double-strand molecules of AAV into plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. Sci.
- AAV vectors are generally constructed in AAV recombinant plasmids by substituting portions of the AAV coding sequence with foreign DNA to generate a recombinant AAV (rAAV) vector or "pro-vector".
- rAAV recombinant AAV
- the terminal (ITR) portions of the AAV sequence must generally be retained intact because these regions are generally required in cis for several functions, including excision from the plasmid after transfection, replication of the vector genome and integration and rescue from a host cell genome.
- the vector can then be packaged into an AAV particle to generate an AAV transducing virus by transfection of the vector into cells that are infected by an appropriate helper virus such as adenovirus or herpesvirus; provided that, in order to achieve replication and encapsidation of the vector genome into AAV particles, the vector must be complemented for any AAV functions required in trans, particularly rep and cap, that were deleted in construction of the vector.
- an appropriate helper virus such as adenovirus or herpesvirus
- AAV vectors are among a small number of recombinant virus vector systems which have been shown to have utility as in vivo gene transfer agents (reviewed in Carter, 1992, Current Opinion in Biotechnology, 3:533-539; Muzcyzka, 1992, Curr. Top. Microbiol. Immunol. 158:97- 129) and thus are potentially of great importance for human gene therapy.
- AAV vectors are capable of high-frequency transduction and expression in a variety of cells including cystic fibrosis
- CF bronchial and nasal epithelial cells
- Flotte et al., 1992a Am. J. Respir. Cell Mol. Biol. 7:349-356; Egan et al., 1992, Nature, 358:581-584; Flotte et al., 1993a, J. Biol. Chem. 268:3781-3790; and Flotte et al., 1993b, Proc. Natl. Acad. Sci. USA, 93: 10163-10167
- human bone marrow-derived erythroleukemia cells see, e.g., Walsh et al., 1992, Proc. Natl. Acad. Sci.
- AAV may not require active cell division for transduction and expression which would be another clear advantage over retroviruses, especially in tissues such as the human airway epithelium where most cells are terminally differentiated and non-dividing.
- the transducing vector must be generated at titers sufficiently high to be practicable as a delivery system. This is especially important for gene therapy stratagems aimed at in vivo delivery of the vector. For example, it is likely that for many desirable applications of AAV vectors, such as treatment of cystic fibrosis by direct in vivo delivery to the airway, the required dose of transducing vector may be in excess of 10 ⁇ particles.
- the vector preparations are preferably essentially free of wild-type AAV virus (or any replication-competent
- AAV AAV
- the attainment of high titers of AAV vectors has been difficult for several reasons including preferential encapsidation of wild-type AAV genomes (if they are present or generated by recombination), and the difficulty in generating sufficient complementing functions such as those provided by the wild-type rep and cap genes.
- Useful cell lines expressing such complementing functions have been especially difficult to generate, in part because of pleiotropic inhibitory functions associated with the rep gene products.
- cell lines in which the rep gene is integrated and expressed tend to grow slowly or express rep at very low levels.
- the first AAV vectors described contained foreign reporter genes such as neo, cat or dhfr expressed from AAV transcription promoters or an SV40 promoter (Tratschin et al., 1984b, Mol. Cell. Biol. 4:2072-2081 ; Hermonat & Muzyczka, 1984, Proc. Natl. Acad. Sci. USA, 81 :6466-6470; Tratschin et al., 1985, Mol. Cell. Biol. 5:3251-3260; McLaughlin et al., 1988, J.Virol., 62: 1963- 1973; Lebkowski et al., 1988 Mol. Cell. Biol., 7:349-356).
- foreign reporter genes such as neo, cat or dhfr expressed from AAV transcription promoters or an SV40 promoter
- Virol. 63:3822-3828 showed that the presence of wild-type AAV significantly enhanced the yield of packaged vector. Thus, in packaging systems where the production of wild-type AAV is eliminated, the yield of packaged vector may actually be decreased. Nevertheless, for use in any human clinical application it will be preferable to essentially eliminate production of replication-competent AAV. Additional studies (McLaughlin et al., 1988; Lebkowski et al., 1988) attempting to generate AAV vectors lacking the AAV rep or cap genes still generated replication-competent AAV and still produced very low transduction frequencies on human cell lines.
- Lebkowski et al., (1988) did not report the actual vector titers in a meaningful way but the biological assays, showing not more than 1% transduction frequency when 5 x 10 ⁇ cells were exposed to three ml of vector preparation, indicate that the titer was less than 2 x 10 ⁇ geneticin resistant units per ml. Also, the pBalA packaging plasmid contains overlapping homology with the ITR sequence in the vector and can lead to generation of replication-competent AAV by homologous recombination.
- Laface et al. (1988) used the same vector as that used by Hermonat & Muzyczka (1984) prepared in the same way and obtained a transduction frequency of 1.5% in murine bone marrow cultures, again showing very low titer.
- pSub201 plasmid which contained an intact AAV genome in a bacterial plasmid but which had a deletion of 13 nucleotides at the extremity of each ITR and thus was rescued and replicated less efficiently than other AAV plasmids that contained the entire AAV genome.
- AAV vectors based on pSub201 but deleted for rep and cap and containing either a hyg or neo gene expressed from an SV40 early gene promoter. They packaged these vectors by co-transfection with a packaging plasmid called pAAV/Ad which consisted of the entire AAV nucleotide sequence from nucleotide 190 to 4490 enclosed at either end with one copy of the adenovirus ITR. In this packaging plasmid the AAV rep and cap genes were expressed from their native AAV promoters (i.e. p5, pl9 and p40, as discussed above).
- adenovirus ITR in pAAV/Ad was thought to enhance the expression level of AAV capsid proteins.
- rep is expressed from its homologous promoter and is negatively regulated and thus its expression is limited.
- Samulski et al. generated AAV vector stocks that were substantially free of replication-competent AAV but had transducing titers of only 3 x l ⁇ 4 hygromycin-resistant units per ml of supernatant.
- the titer of the AAV vector prep was increased to 5 x l ⁇ 4 hygromycin-resistant units per ml.
- the low titer produced in this system thus appears to have been due in part to the defect in the ITR sequences of the basic pSub201 plasmid used for vector construction and in part due to limiting expression of AAV genes from pAAV/Ad.
- Samulski et al. generated vector stocks by transfecting, in bulk, thirty 10-cm dishes of 293 cells and concentrating the vector stock by banding in CsCl. This produced an AAVneo vector stock containing a total of 10°" particles as measured by a DNA dot-blot hybridization assay. When this vector stock was used at multiplicities of up to 1,000 particles per cell, a transduction frequency of 70% was obtained.
- the particle-to-transducing ratio is about 500 to 1,000 particles since at the ratio of one transducing unit per cell the expected proportion of cells that should be transduced is 63% according to the Poisson distribution.
- the system of Samulski et al. ( 1989) using the vector plasmid pSub201 and the packaging plasmid pAAV/Ad, did not have overlapping AAV sequence homology between the two plasmids, there is overlapping homology at the Xbal sites and recombination of these sites can lead to the generation of complete replication-competent AAV.
- AAV sequence is contained within the two plasmids and the plasmids share a short (non-AAV) sequence that might facilitate recombination to generate replication-competent AAV, which is undesirable. That this class of recombination occurs in AAV plasmids was shown by Senapathy & Carter (1984, J. Biol. Chem. 259:4661-4666). Given the problems of low titer, and the capability of generating wild-type recombinants, the system described by Samulski et al., 1989, does not have practical utility for human gene therapy.
- AAV vectors For example, Srivastava et al., (1989, Proc. Natl. Acad. Sci. USA, 86:8078-8082) described an AAV vector based on the pSub201 plasmid of Samulski et al. (1987), in which the coding sequences of AAV were replaced with the coding sequences of another parvovirus, B19. This vector was packaged into AAV particles using the pAAV/Ad packaging plasmid to generate a functional vector, but titers were not reported. This system was based on pSub201 and thus suffers from the defect described above for this plasmid.
- the vector and the packaging plasmid contained overlapping AAV sequences (the ITR regions) and thus recombination yielding contaminating wild-type virus is highly likely. Chatterjee et al. (1991, Vaccines 91, Cold Spring Harbor Laboratory Press, pp. 85-89),
- AAV vectors to express genes in human lymphocytes (Muro-Cacho et al., 1992, J. Immunotherapy, 11 :231-237) or a human erythroid leukemia cell line (Walsh et al., 1992, Proc. Natl. Acad. Sci. USA, 89:7257-7261) with vectors based on the pSub201 vector plasmid and pAAV/Ad packaging plasmid. Again, titers of vector stocks were not reported and were apparently low because a selective marker gene was used to identify those cells that had been successfully transduced with the vector.
- AAV gene therapy has been the relative inefficiency of the vector packaging systems that have been used.
- packaging of AAV vectors has been achieved in adenovirus-infected cells by co-transfection of a packaging plasmid and a vector.
- the efficiency of this process is expected to be limited by the efficiency of transfection of each of the plasmid constructs, and by the low level of expression of Rep proteins from the packaging plasmids described to date.
- Each of these problems appears to relate to the biological activities of the AAV Rep proteins which are known to be associated with pleiotropic inhibitory effects.
- all of the packaging systems described above have the ability to generate replication-competent AAV by recombination.
- Rep78 or Rep68 protein after stable transfection of Hela or 293 cells with plasmids containing an AAV rep gene. Because of the absence of Rep78 and Rep68 proteins, vector could not be produced in the cell line. Another cell line made a barely detectable amount of Rep78 which was nonfunctional.
- Vincent et al. (1990, Vaccines 90, Cold Spring Harbor Laboratory Press, pp. 353-359) attempted to generate cell lines containing the AAV rep and cap genes expressed from the normal AAV promoters, but these attempts were not successful either because the vectors were contaminated with a 100-fold excess of wild-type AAV particles or because the vectors were produced at only very low titers of less than 4 x 10 ⁇ infectious particles.
- AAV Cap proteins that might be used to reconstitute AAV particles, e.g. by assembly in vitro (see, e.g., WO 96/00587, published 01 November 1996); systems employing AAV rep-cap genes on a helper virus (see, e.g., WO 95/06743, published 09 March 1995); and systems employing helper viruses from non-human mammals (see, e.g., WO 95/20671, published 03 August 1995).
- Lebkowski et al. (U.S. patent 5,173,414, issued 22 Dec. 1992) constructed cell lines containing AAV vectors in an episomal plasmid. These cell lines could then be infected with adenovirus and transfected with the trans-complementing AAV functions rep and cap to generate preparations of AAV vector. It is claimed that this allows higher titers of AAV stocks to be produced. However, in the examples shown, the only information relative to titer that is shown is that one human cell line, K562, could be transduced at efficiencies of only 1% or less, which does not indicate high titer production of any AAV vector.
- the vector is carried as an episomal (unintegrated) construct, and it is stated that integrated copies of the vector are not preferred.
- Lebkowski et al. introduce rep and cap genes into the cell genome but the method again requires the use of episomal AAV transducing vectors comprising an Epstein-Barr virus nuclear antigen (EBNA) gene and an Epstein-Barr virus latent origin of replication; and, again, the only information relative to titer indicated that it was fairly low.
- EBNA Epstein-Barr virus nuclear antigen
- AAV Rep proteins down-regulate their own expression from the AAV-p5 promoter which has been used in the various previously described packaging constructs such as pAAV/Ad (Samulski et al., 1989) or pBalA (Lebkowski et al., 1988, 1992).
- Another attempt to develop cell lines expressing functional rep activity was recently published by Holscher et al. (1994, J. Virol. 68:7169-7177). They described the generation of cell lines in which rep was placed under control of a glucocorticoid-responsive MMTV promoter.
- AAV vectors can achieve in vivo gene transfer, in the respiratory tract for example, but high titers are critical to allow the delivery of a sufficiently high multiplicity of vector in as small a volume as possible.
- Another important objective is the generation of recombinant AAV (rAAV) vector particles that are substantially free of replication-competent viral particles.
- rAAV recombinant AAV packaging methodology is of central importance in satisfying those objectives and promoting the effectiveness of AAV-based gene therapy.
- AAV packaging cell lines that are both stable and efficient has been elusive, mainly due to the activities of Rep proteins, which tend to down-regulate their own expression (particularly in the absence of helper virs functions) and can negatively affect the host cell.
- Rep proteins which tend to down-regulate their own expression (particularly in the absence of helper virs functions) and can negatively affect the host cell.
- the approaches described herein effectively circumvent these problems and have allowed for substantial improvements in AAV packaging.
- the present invention provides recombinase-activatable AAV packaging cassettes, and packaging cell lines comprising such cassettes, which are useful for generating recombinant AAV particles that mediate delivery of genes of interest to mammalian cells.
- an AAV packaging gene is "activatably linked" to a promoter based on the arrangement and relative orientation of various cassette components including first and second site-specific recombination (ssr) sites and an ssr-intervening sequence.
- the recombinase- activatable AAV packaging cassette is introduced into a mammalian cell to be used for packaging of recombinant AAV vector particles.
- the arrangement and orientation of elements in the cassette prevents operable linkage of the promoter and the AAV packaging gene.
- Activation can be triggered by introducing into the cell and/or causing the expression therein of a gene encoding a recombinase capable of mediating recombination between the first and second ssr sites.
- the recombination event catalyzed by the recombinase causes the cassette to be re-arranged in a manner that places the AAV packaging gene into operable linkage with a promoter.
- Expression of the AAV packaging gene which can be deleterious to the host cell, is effectively suppressed but is recombinase-activatable.
- the gene product(s) of the AAV packaging gene in conjunction with functions provided by an AAV helper virus, mediate replication and encapsidation of the rAAV vector, resulting in the production of a large number of infectious but replication-incompetent rAAV particles that can be used to deliver the gene of interest to a mammalian target cell.
- rAAV recombinant AAV
- Figure 1 shows the results of Southern blots indicating that recombinase-activatable AAV packaging cassettes of the present invention can be activated by plasmid-encoded recombinases
- Figure 2 shows the results of Southern blots indicating that recombinase-activatable AAV packaging cassettes of the present invention can be activated by helper-virus-encoded recombinase and used to provide AAV replication functions effective for the rescue and amplification of a stably-integrated rAAV pro-vector, as described in Examples 13 and 15.
- Figure 3 shows the results of Southern blots indicating that recombinase-activatable AAV packaging cassettes of the present invention can be activated by recombinase and used to provide AAV replication functions effective for the production of heat-stable infectious AAV vector particles useful for delivering a transgene to a target cell, as described in Example 16.
- Recombinant AAV vectors are potentially powerful tools for human gene therapy.
- a major advantage of rAAV vectors over other approaches to gene therapy is that they generally do not require ongoing replication of the target cell in order to become stably integrated into the host cell.
- the invention described herein provides methods and materials for use in the production of high titers of recombinant AAV vectors for use in gene therapy.
- the practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature.
- polypeptide refers to polymers of amino acids of any length. These terms also include proteins that are post- translationally modified through reactions that include, but are not limited to, glycosylation, acetylation and phosphorylation.
- Polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers only to the primary structure of the molecule. Thus, double- and single-stranded DNA, as well as double- and single- stranded RNA are included.
- a "gene” refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.
- a “transcriptional regulatory sequence” or “TRS”, as used herein, refers to a genomic region that controls the transcription of a gene or coding sequence to which it is operably linked.
- Transcriptional regulatory sequences of use in the present invention generally include at least one transcriptional promoter and may also include one or more enhancers and/or terminators of transcription.
- operably linked refers to an arrangement of two or more components, wherein the components so described are in a relationship permitting them to function in a coordinated manner.
- a transcriptional regulatory sequence or a promoter is operably linked to a coding sequence if the TRS or promoter promotes transcription of the coding sequence.
- An operably linked TRS is generally joined in cis with the coding sequence, but it is not necessarily directly adjacent to it.
- Recombinant refers to a genetic entity distinct from that generally found in nature. As applied to a polynucleotide or gene, this means that the polynucleotide is the product of various combinations of cloning, restriction and/or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature.
- Heterologous means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared.
- a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide).
- a TRS (Transcriptional Regulatory Sequence) or promoter that is removed from its native coding sequence and operably linked to a different coding sequence is a heterologous TRS or promoter.
- Sequence overlap occurs when the nucleotides share a homologous sequence.
- This homologous sequence is of sufficient length and identity, recombination is facilitated.
- the level of homology and corresponding frequency of recombination increase with increasing length of the homologous sequences and with their level of shared identity.
- the level of homology that may pose a concern in a given system can be determined theoretically and confirmed experimentally, as is known in the art.
- homologous recombination can be substantially reduced or eliminated if the two sequences do not share any stretch of at least 10 base pairs (bp) that is greater than 80% homologous (summed over its length), or any stretch of at least 20 bp that is at least 70% homologous, or any stretch of at least 50 bp that is at least 50% homologous, or any stretch of at least 100 bp that is at least 40% homologous; preferably the levels of homology are even less (preferably less than half of the stated levels), and preferably the lengths of partially homologous sequences are also less
- a “vector”, as used herein, refers to a recombinant plasmid or virus that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo.
- the polynucleotide to be delivered sometimes referred to as a "target polynucleotide” or “transgene”, may comprise a coding sequence of interest in gene therapy (such as a gene encoding a protein of therapeutic interest) and/or a selectable or detectable marker.
- a “replicon” refers to a polynucleotide comprising an origin of replication which allows for replication of the polynucleotide in an appropriate host cell.
- replicons include episomes (including plasmids), as well as chromosomes (such as the nuclear or mitochondrial chromosomes).
- "Stable integration" of a polynucleotide into a cell means that the polynucleotide has been integrated into a replicon that tends to be stably maintained in the cell.
- episomes such as plasmids can sometimes be maintained for many generations, genetic material carried episomally is generally more susceptible to loss than chromosomally-integrated material.
- maintenance of a polynucleotide can often be effected by incorporating a selectable marker into or adjacent to a polynucleotide, and then maintaining cells carrying the polynucleotide under selective pressure.
- sequences cannot be effectively maintained stably unless they have become integrated into a chromosome; and, therefore, selection for retention of a sequence comprising a selectable marker can result in the selection of cells in which the marker has become stably- integrated into a chromosome.
- Antibiotic resistance genes can be conveniently employed in that regard, as is well known in the art.
- stably- integrated polynucleotides would be expected to be maintained on average for at least about twenty generations, preferably at least about one hundred generations, still more preferably they would be maintained permanently.
- the chromatin structure of eukaryotic chromosomes can influence the level of expression of an integrated polynucleotide. Having the genes carried on episomes can be particularly useful where it is desired to have multiple stably-maintained copies of a particular gene. The selection of stable cell lines having properties that are particularly desirable in the context of the present invention are described and illustrated below.
- AAV is adeno-associated virus.
- Adeno-associated virus is a defective parvovirus that grows only in cells in which certain functions are provided by a co-infecting helper virus.
- AAV2 serotype was used in some of the illustrations of the present invention in the Examples. However, it is fully expected that these same principles will be applicable to other AAV serotypes since it is now known that the various serotypes are quite closely related - both functionally and structurally, even at the genetic level (see, e.g., Blacklow, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R. Pattison (ed); and Rose, 1974, Comprehensive Virology 3: 1-61).
- a "recombinant AAV vector” refers to a vector comprising one or more polynucleotides of interest (or “transgenes”) that are flanked by AAV inverted terminal repeat sequences (ITRs).
- Such rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus and is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap proteins).
- AAV rep and cap gene products i.e. AAV Rep and Cap proteins.
- an rAAV vector is incorporated into a larger polynucleotide (e.g. in a chromosome or in another vector such as a plasmid used for cloning or transfection)
- the rAAV vector is typically referred to as a "pro-vector" which can be "rescued” by replication and encapsidation in the presence of AAV packaging functions and necessary helper functions).
- helper virus for AAV refers to a virus that allows AAV (which is a “defective” parvovirus) to be replicated and packaged by a host cell.
- helper viruses have been identified, including adenoviruses, herpesviruses and poxviruses such as vaccinia.
- the adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC.
- Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are also available from depositories such as ATCC.
- HSV herpes simplex viruses
- EBV Epstein-Barr viruses
- CMV cytomegaloviruses
- PRV pseudorabies viruses
- Packaging refers to a series of subcellular events that results in the assembly and encapsidation of a viral vector, particularly an AAV vector.
- a suitable vector when introduced into a packaging cell line under appropriate conditions, it can be assembled into a viral particle. Functions associated with packaging of viral vectors, particularly AAV vectors, are described herein and in the art.
- AAV “rep” and “cap” genes are genes encoding replication and encapsidation proteins, respectively.
- AAV rep and cap genes have been found in all AAV serotypes examined, and are described herein and in the references cited. In wild-type AAV, the rep and cap genes are generally found adjacent to each other in the viral genome (i.e. they are “coupled” together as adjoining or overlapping transcriptional units), and they are generally conserved among AAV serotypes.
- AAV rep and cap genes are also individually and collectively referred to herein as "AAV packaging genes.” Modified AAV packaging genes (including modified rep genes and modified cap genes) are described below for use in the present invention.
- AAV split-packaging gene refers to a recombinant gene encoding one or more AAV packaging proteins (including AAV Rep proteins and/or AAV Cap proteins) wherein the split-packaging gene has been separated from one or more AAV packaging genes to which it is normally linked in the AAV genome.
- AAV split-packaging genes include
- AAV split-cap genes AAV rep78 genes and AAV rep52 genes, as described herein.
- one of more AAV split-packaging genes is "activatably linked" to a promoter, as described below.
- An AAV "split-cap” gene refers to a recombinant gene encoding one or more AAV Cap proteins, which gene is separated from Rep78-specific sequences of an AAV rep gene, but is operably linked to a promoter, preferably a heterologous promoter.
- the wild-type AAV rep gene contains two promoter sequences, p5 and pi 9, which drive expression of the "large Rep proteins” (Rep78 and Rep68) and the "small Rep proteins” (Rep52 and Rep40), respectively; and the wild-type AAV cap gene contains a promoter, p40, which drives expression of the AAV Cap proteins (VP1, VP2 and VP3).
- the Cap proteins are encoded by a split-cap gene which, unlike the situation in wild-type AAV, is not located next to a gene capable of encoding the large Rep proteins. Rather, an AAV "rep78" gene (a gene capable of encoding the large Rep proteins Rep78 and Rep68) is provided separately, at a different location.
- the split-cap genes can be physically separated from Rep78-specific sequences by being present on different replicons or vectors, or, if present on a single replicon or vector, by being separated from Rep78-specific sequences by intervening non-AAV DNA, as described and illustrated in more detail below.
- a split-cap gene is operably or activatably linked to a heterologous promoter (i.e. a promoter other than the AAV p40 promoter) which heterologous promoter is incorporated upstream of the split-cap coding region, either in place of or in addition to the p40 promoter.
- a heterologous promoter i.e. a promoter other than the AAV p40 promoter
- heterologous promoter i.e. a promoter other than the AAV p40 promoter
- heterologous promoter i.e. a promoter other than the AAV p40 promoter
- a rep78 gene is operably or activatably linked to a heterologous promoter (i.e. a promoter other than the AAV p5 promoter) which heterologous promoter is incorporated upstream of the rep78 coding region, either in place of or in addition to the p5 promoter.
- a heterologous promoter i.e. a promoter other than the AAV p5 promoter
- the rep78 gene is activatably linked to a promoter, as described below.
- An AAV "rep52 gene” is capable of separately encoding just the small Rep proteins (i.e. Rep52 and Rep40).
- a rep52 gene may be operably or activatably linked to a promoter (e.g. the pi 9 promoter or a heterologous promoter in place of or in addition to the AAV pi 9 promoter).
- An AAV split-cap gene, rep52 gene and/or rep78 gene can also be operably or activatably linked to other transcriptional regulatory sequences, including enhancers and polyadenylation (“polyA”) sequences (which additional TRS's can also be heterologous).
- AAV-derived split-cap genes, rep52 genes and rep78 genes as described herein are collectively referred to as "AAV split- packaging genes.”
- AAV split- packaging genes Various examples of the construction and use of such AAV split-packaging genes are described and illustrated below.
- a “recombinase-activatable AAV packaging cassette” refers to a polynucleotide comprising the following components in the relative order listed from upstream to downstream: (i) a first site-specific recombination (ssr) site; (ii) an ssr- intervening sequence; and (iii) a second site-specific recombination (ssr) site; wherein the cassette comprises a promoter and an AAV packaging gene selected from the group consisting of an AAV rep gene and an AAV cap gene, wherein the AAV packaging gene is located either within the ssr-intervening sequence or downstream of the second ssr site, and wherein the promoter is located either within the ssr-intervening sequence or upstream of the first ssr site, and the promoter is activatably linked to the AAV packaging gene.
- the arrangement and relative orientation of various elements within the cassettes of the present invention results in the generation of a polynucleotide sequence from which the AAV packaging gene is not generally expressed until activation by a recombinase enzyme, which activation places the AAV packaging gene into operable linkage with a promoter, thereby resulting in expression of the AAV packaging gene.
- a recombinase enzyme which activation places the AAV packaging gene into operable linkage with a promoter
- a promoter is "activatably linked" to an AAV packaging gene within the AAV packaging cassettes of the present invention by being positioned, relative to the packaging gene and any intervening sequence, such that rearrangement of the ssr-intervening sequence (mediated by recombinase acting at the ssr sites) causes the promoter to become operably linked to the AAV packaging gene.
- Promoters that are activatably linked to an AAV packaging gene in the context of the present invention thus do not effectively promote transcription of the AAV packaging gene until the corresponding recombinase is introduced (and/or expressed). Examples of such constructs are described and illustrated below.
- a “terminator” refers to a polynucleotide sequence that tends to diminish or prevent read- through transcription (i.e.
- transcriptional termination sequences are specific sequences that tend to disrupt read-through transcription by RNA polymerase, presumably by causing the RNA polymerase molecule to stop and/or disengage from the DNA being transcribed.
- sequence-specific terminators include polyadenylation ("poly A") sequences, e.g., SV40 polyA.
- Terminators may thus prevent transcription from only one direction ("uni-directional" terminators) or from both directions (“bi-directional" terminators), and may be comprised of sequence-specific termination sequences or sequence-non-specific terminators or both. A variety of such terminator sequences are known in the art; and illustrative uses of such sequences within the context of the present invention are provided below.
- a "site-specific recombination site” or “ssr site” is a polynucleotide sequence that is recognized and acted upon by a site-specific recombinase enzyme, many of which are known to the art and described herein. Pairs of ssr sites surrounding an ssr-intervening sequence are employed in the context of the AAV packaging cassettes of the present invention. The recombinase acting at the ssr sites mediates an intramolecular DNA rearrangement event, causing either excision or inversion of the ssr-intervening sequence, depending on whether the ssr sites are arranged in tandem or inverted orientation, respectively, as illustrated below.
- a “recombinase” refers to a protein that recognizes particular site-specific recombination sites in DNA (termed “ssr sites”) and that mediates recombination via those sites. In the context of the present invention, the recombinase recognizes and mediates recombination at corresponding ssr sites incorporated on either side of an ssr-intervening sequence. Illustrative recombinases are described in more detail below and in the art.
- An “ssr-intervening sequence” refers to a segment of DNA lying between a pair of ssr sites.
- the ssr-intervening sequence may include a promoter, a terminator, a selectable marker gene, a packaging gene, a polyA signal, or any other DNA segment lying between a pair of ssr sites as described in connection with various AAV packaging cassettes exemplified herein.
- “Efficiency” when used in describing a cell line refers to certain useful attributes of the line; in particular, the growth rate, and (for packaging cell lines) the number of virus particles produced per cell. "High efficiency packaging” indicates production of at least 100 viral particles per cell, more preferably at least about 200 viral particles per cell, still more preferably at least about 400 viral particles per cell.
- High safety packaging indicates that, of the recombinant AAV viral particles produced, fewer than about 1 in 10 ⁇ are replication-competent AAV viral particles, preferably fewer than about 1 in 10* are replication-competent, more preferably fewer than about 1 in 10 ⁇ are replication-competent, still more preferably fewer than about 1 in 10 ⁇ 2 are replication-competent, most preferably none are replication-competent.
- Preferred packaging cells of the present invention exhibit combinations of such high efficiency and high safety.
- "Host cells”, “cell lines”, “cell cultures”, “packaging cell line” and other such terms denote higher eukaryotic cells, preferably mammalian cells, most preferably human cells, useful in the present invention.
- These cells can be used as recipients for recombinant vectors, viruses or other transfer polynucleotides, and include the progeny of the original cell that was transduced. It is understood that the progeny of a single cell may not necessarily be completely identical (in morphology or in genomic complement) to the original parent cell.
- a “therapeutic gene”, “target polynucleotide”, “transgene”, “gene of interest” and the like generally refer to a gene or genes to be transferred using a vector.
- such genes are located within the rAAV vector (which vector is flanked by inverted terminal repeat (ITR) regions and thus can be replicated and encapsidated into rAAV particles).
- ITR inverted terminal repeat
- Target polynucleotides can be used in this invention to generate rAAV vectors for a number of different applications.
- polynucleotides include, but are not limited to: (i) polynucleotides encoding proteins useful in other forms of gene therapy to relieve deficiencies caused by missing, defective or sub-optimal levels of a structural protein or enzyme; (ii) polynucleotides that are transcribed into anti-sense molecules; (iii) polynucleotides that are transcribed into decoys that bind transcription or translation factors; (iv) polynucleotides that encode cellular modulators such as cytokines; (v) polynucleotides that can make recipient cells susceptible to specific drugs, such as the herpes virus thymidine kinase gene; and (vi) polynucleotides for cancer therapy, such as El A tumor suppressor genes or p53 tumor suppressor genes for the treatment of various cancers.
- a promoter either its own or a heterologous promoter.
- rAAV vector may also contain a selectable marker.
- the present invention provides novel AAV packaging cassettes each of which comprises an AAV packaging gene that is "activatably linked" to a promoter.
- Each AAV packaging cassette also comprises a pair of site-specific recombination (or “ssr") sites, each of which is placed in a particular orientation with respect to each other (i.e. in tandem or in inverted orientation) on either side of a portion of the cassette which is referred to as the "ssr-intervening sequence".
- the ssr- intervening sequence may contain a transcriptional terminator, or it may contain the AAV packaging gene or its promoter, as described in connection with the exemplary embodiments of the invention below.
- the structural arrangement of the various components within the AAV packaging cassettes of the present invention results in the effective suppression of transcription of the AAV packaging gene(s) in the absence of recombinase; and, conversely, the arrangement and relative orientation of components in the cassette results in the activation of transcription of the AAV packaging gene(s) in the presence of the corresponding recombinase (the activation being the result of specific rearrangements of the AAV packaging cassettes that place the AAV packaging gene into operable linkage with a promoter).
- Packaging cells for use in accordance with the present invention may have one or more different AAV packaging cassettes (expressing one or more AAV replication or encapsidation gene products).
- AAV Rep and Cap proteins are expressed in a packaging cell comprising helper functions (such as those provided by an AAV helper virus like Adenovirus), and a recombinant AAV vector that includes a gene of interest, then the rAAV vector can be replicated and encapsidated into rAAV particles - which can be used to deliver the gene of interest to a target cell.
- helper functions such as those provided by an AAV helper virus like Adenovirus
- the present invention provides recombinase-activatable AAV packaging cassettes comprising the following components in the relative order listed from upstream to downstream: (i) a first site-specific recombination (ssr) site; (ii) an ssr-intervening sequence; and (iii) a second site-specific recombination (ssr) site; wherein the cassette comprises a promoter (which is located either within the ssr-intervening sequence or upstream of the first ssr site) and an AAV packaging gene selected from the group consisting of an AAV rep gene and an AAV cap gene (which is located either within the ssr-intervening sequence or downstream of the second ssr site), in a relative structural arrangement such that the promoter is activatably linked to the AAV packaging gene.
- a promoter which is located either within the ssr-intervening sequence or upstream of the first ssr site
- AAV packaging gene selected from the group consisting of an A
- Each site-specific recombination (ssr) site is a polynucleotide sequence that is recognized by a recombinase, many of which are known to the art and described herein.
- a DNA rearrangement event (either inversion or excision, depending on whether the cassette is "inversion-type” or “excision-type,” respectively) between the two ssr sites activates the packaging gene by placing it into operable linkage with its promoter.
- a promoter a first ssr site, an ssr-intervening sequence comprising a terminator, a second ssr site, and an AAV packaging gene, where the ssr sites are in tandem orientation relative to each other, and the terminator prevents transcription originating at the promoter from transcribing the packaging gene (whereby excision mediated by a recombinase acting at the ssr sites deletes the terminator and operably links the promoter to the AAV packaging gene);
- a promoter a first ssr site, an ssr-intervening sequence comprising a uni-directional terminator sequence, a second ssr site, and an AAV packaging gene, where the ssr sites are in inverted orientation relative to each other, the promoter and the AAV packaging gene are in tandem orientation relative to each other, and the uni-directional terminator blocks transcription only from one direction and is arranged in an orientation to prevent transcription originating at the promoter from transcribing the AAV packaging gene (whereby inversion mediated by a recombinase acting at the ssr sites inverts the uni-directional terminator and operably links the promoter to the packaging gene); and
- a promoter a first ssr site, an ssr-intervening sequence comprising an AAV packaging gene, and a second ssr site, where the ssr sites are in inverted orientation relative to each other and the packaging gene is in inverted orientation relative to the promoter (whereby inversion mediated by a recombinase acting at the ssr sites inverts the packaging gene and operably links the packaging gene to the promoter).
- Each AAV packaging cassette is thus arranged such that transcription of the AAV packaging is effectively suppressed in the absence of recombinase; and is effectively activated in the presence of the corresponding recombinase. Examples illustrating the construction, testing and use of such cassettes are provided below.
- Embodiment (1) above which is structurally and spatially arranged such that the cassette is activated by excision (which operably links the promoter to the AAV packaging gene), is referred to as an "excision-type” AAV packaging cassette.
- Embodiments (2)-(4) above which are arranged such that the cassette is activated by inversion of the ssr-intervening sequence are referred to as "inversion-type" AAV packaging cassettes.
- the cassette is activated by a recombinase protein which mediates recombination at the ssr sites.
- the ssr sites are arranged in tandem orientation and activation by recombinase results in excision the ssr-intervening sequence.
- the ssr sites are arranged in inverted orientation and activation by recombinase results in inversion of the ssr-intervening sequence.
- the recombinase tends to catalyze intramolecular recombination and excision of the ssr-intervening sequence.
- the ssr sites are arranged in tandem orientation and the ssr-intervening sequence comprises a terminator. Introduction of the corresponding recombinase mediates excision of the ssr-intervening sequence and places the AAV packaging gene into operable linkage with the promoter, thereby allowing activation of expression of the AAV packaging gene.
- the ssr sites are arranged in inverted orientation (relative to each other) on either side of the ssr-intervening sequence, then the recombinase tends to catalyze intramolecular recombination and inversion of the ssr-intervening sequence.
- the ssr sites are arranged in inverted orientation and the intervening sequence may comprise a promoter, an AAV packaging gene or a uni-directional terminator sequence.
- the recombinase-activatable cassettes of these latter embodiments of the present invention are "inversion-type" in that introduction of the corresponding recombinase mediates inversion of the ssr-intervening sequence, which again, as with excision-type cassettes, places the packaging gene into operable linkage with the promoter, thereby allowing activation of expression.
- the AAV packaging cassette can be prepared as a recombinant DNA construct in which the ssr-intervening sequence comprises a transcriptional terminator that effectively disrupts the linkage between the promoter and the AAV packaging gene.
- the degree to which transcription is disrupted by insertion of an ssr-intervening sequence comprising a terminator is generally dependent on the base sequence and/or the length of the DNA sequence.
- transcriptional termination sequences are specific sequences that tend to disrupt read-through transcription by RNA polymerase molecules, presumably by causing the RNA polymerase molecule to stop and/or disengage from the DNA template being transcribed.
- Terminators may thus prevent transcription from only one direction ("unidirectional" terminators) or from both directions (“bi-directional" terminators), and may be comprised of sequence-specific termination sequences or sequence-non-specific terminators or both. Any of a variety of terminators can be employed in conjunction with embodiment (1) above; whereas embodiment (3) above employs a uni-directional terminator. Where it is desired that transcriptional read-through is especially low prior to activation
- the terminator sequence will preferably contain one or more specific transcriptional termination sequences, and may also be lengthened by the inclusion of additional DNA sequence so as to further disrupt transcriptional read-through.
- Preferred terminator sequences of the present invention for use in embodiment (1) above will thus have transcription termination sequences and, especially in the case of rep genes, may have a large DNA sequence followed by a transcription termination sequence.
- such terminator sequences may be comprised of a gene that is followed by a transcription termination sequence, either its own termination sequence or a heterologous termination sequence. Examples of such termination sequences, including various polyadenylation sequences are known in the art and widely available.
- terminator is comprised of a gene
- a gene which encodes a detectable or selectable marker it can be advantageous to use a gene which encodes a detectable or selectable marker; thereby providing a means by which the presence and/or absence of the terminator sequence (and therefore the corresponding inactivation and/or activation of the cassette) can be detected and/or selected.
- Recombinase-activatable AAV packaging cassettes of the present invention can also be flanked by terminators if desired to reduce the possibility that transcriptional activity originating outside of the cassette might influence transcription of the cassette.
- a first exemplary inversion-type AAV packaging cassette of the present invention comprises in order a first ssr site, an ssr-intervening sequence comprising a promoter, a second ssr site, and an AAV packaging gene, where the ssr sites are in inverted orientation relative to each other and the promoter is initially in divergent orientation relative to the AAV packaging gene (whereby inversion mediated by a recombinase acting at the ssr sites inverts the promoter and operably links the promoter to the AAV packaging gene).
- the cassette is introduced into suitable host cells, in which a recombinase is later introduced or expressed. Inversion mediated by a recombinase at the ssr sites inverts the promoter and operably links the promoter to the packaging gene.
- no terminator is absolutely required for the cassette.
- a terminator may be placed upstream of the first ssr site. This upstream terminator would not be expected to interfere with the recombinase-activatable nature of the cassette, but should prevent undesirable exogenous transcription originating outside the cassette from promoting any transcription of the packaging gene.
- a second exemplary inversion-type AAV packaging cassette of the present invention comprises in order a promoter, a first ssr site, an ssr-intervening sequence comprising a uni-directional terminator sequence, a second ssr site, and an AAV packaging gene, where the ssr sites are in inverted orientation relative to each other, the promoter and the AAV packaging gene are in tandem orientation relative to each other, and the unidirectional terminator blocks transcription only from one direction and is arranged in an orientation to prevent transcription originating at the promoter from transcribing the AAV packaging gene (whereby inversion mediated by a recombinase acting at the ssr sites inverts the uni-directional terminator and operably links the promoter to the packaging gene).
- the ssr sites are inverted relative to each other and the uni-directional terminator blocks transcription only from one direction and is initially arranged in an orientation to prevent transcription originating at the promoter from transcribing the packaging gene.
- the cassette is introduced into suitable host cells, in which a recombinase is later introduced or expressed.
- Inversion mediated by a recombinase at the ssr sites inverts the uni-directional terminator and operably links the promoter to the packaging gene.
- the uni-directional terminator is a terminator which blocks incoming transcription only from one direction.
- a third exemplary inversion-type AAV packaging cassette of the present invention comprises in order a promoter, a first ssr site, an ssr-intervening sequence comprising an AAV packaging gene, and a second ssr site, where the ssr sites are in inverted orientation relative to each other and the packaging gene is in inverted orientation relative to the promoter (whereby inversion mediated by a recombinase acting at the ssr sites inverts the packaging gene and operably links the packaging gene to the promoter).
- the promoter is oriented so as to prevent transcription of the ssr-intervening sequence, but the AAV packaging gene located within that sequence is in an inverted orientation relative to the promoter. Any transcription of the ssr-intervening sequence that does occur prior to activation would thus be expected to result in "anti-sense" transcripts (which might be helpful for further suppressing expression of AAV packaging gene functions in the illustrated state).
- the AAV packaging cassette further comprises a transcriptional terminator located downstream of the second ssr site, and such a terminator should not be expected to interfere with the recombinase-activatable nature of the cassette, but should prevent undesirable exogenous transcription originating outside the cassette from promoting any transcription of the packaging gene.
- the recombinase tends to catalyze intra-molecular recombination and excision of the ssr-intervening sequence (i.e. the sequence located in-between the pair of ssr sites). If the ssr sites are arranged in an inverted orientation, then the recombinase tends to catalyze inversion of the ssr-intervening sequence.
- genes and cassettes of the present invention are "recombinase-activatable" in that introduction of the corresponding recombinase mediates excision of an ssr-intervening sequence comprising a terminator sequence or inversion of a ssr-intervening sequence comprising a promoter, an AAV packaging gene, or a uni-directional terminator.
- the cassettes are arranged such that activation by recombinase (via excision or inversion) places an AAV packaging gene into operable linkage with a promoter, allowing activation of expression.
- the recombinase can be contacted with the AAV packaging cassette in any of a variety of ways in which proteins can be caused to be expressed in cells.
- a gene encoding the recombinase can be introduced into the AAV packaging cell with the helper virus necessary to trigger AAV replication/encapsidation.
- an adenovirus vector can be modified to replace a sequence not essential for helper-virus activity with a gene encoding a recombinase, as described and illustrated below.
- any other expression vector comprising a recombinase gene could likewise be used to provide for the production of recombinase protein.
- the packaging cell may contain a gene for a recombinase which is either tightly regulated (e.g., using a tetracycline transactivator system as referred to below), or which produces an inactive form of a recombinase.
- the recombinase gene may be induced by introduction into the medium of a factor that induces expression of the recombinase gene (e.g., tetracycline or doxycycline in the Tet system).
- the host cells carrying the AAV packaging cassette may express an inactive form of recombinase, e.g. one which is temperature- sensitive, which lacks a necessary co-factor, or which has an extraneous amino acid sequence attached thereto.
- Activation of the inactive form of recombinase might be mediated by shifting to a permissive temperature, or introducing a factor (such as a co-factor) or other condition (such as expressing a proteinase that cleaves off the extraneous amino acid sequence) to effectively activate the recombinase.
- Providing recombinase activity can thus be mediated by causing the protein to be expressed, or by causing an inactive form of the protein to become enzymatically active.
- AAV packaging gene which may be an AAV rep or AAV cap gene or any variation or combination thereof. Expression of these genes is relatively complex and potentially deleterious to the host cells. Expression of the rep gene, mediated by multiple promoters (p5 and pi 9) and variable RNA splicing, yields large Rep proteins (i.e. Rep78 and Rep68) and small Rep proteins (i.e. Rep52 and Rep40). The cap gene partially overlaps the rep gene and encodes three separate proteins, whose production is mediated by RNA splicing and alternative translational start sites.
- the packaging genes suitable for use in AAV packaging cassettes of the present invention include but are not limited to:
- an AAV rep78 gene separated from cap-specific sequences of an AAV cap gene
- an AAV rep52 gene separated from Rep78-specific sequences of an AAV rep gene
- the split-cap and rep78 genes may be introduced separately into the host cell line (i.e. they are introduced using separate cassettes, and, if stably integrated into the cell, are stably integrated at different locations).
- An additional cassette comprising a rep52 gene can also be included as a means of further elevating expression of the small Rep proteins (i.e. Rep52 and Rep40).
- At least one of the AAV packaging genes (preferably at least an AAV rep78 gene) is placed under the control of a recombinase-activatable AAV packaging cassette according the present invention.
- AAV packaging genes can also be placed under the control of a recombinase-activatable AAV packaging cassette; or the expression of these can be controlled in another manner. In presently preferred embodiments, however, all AAV packaging genes are preferably placed under the control of recombinase-activatable AAV packaging cassettes.
- the split-cap and rep52 genes may be introduced separately into the host cell line (i.e. they are introduced using separate cassettes, and, if stably integrated into the cell, are stably integrated at different locations).
- Cassettes encoding various rep and/or split-cap genes may be introduced into the host cells simultaneously or sequentially, as described and illustrated below.
- the rep and cap genes may be introduced together on a common cassette in which at least the p5 promoter is preferably deleted, and the rep gene placed under the control of the recombinase- activatable AAV packaging cassette to avoid potentially deleterious effects of the large Rep proteins.
- the cassettes may be different types; e.g. one or more may be excision-type or inversion-type, or one may be excision-type while another is inversion-type. It is particularly convenient for all such AAV packaging cassettes in a given cell to be activated by the same recombinase protein (thereby providing concerted activation of all AAV packaging cassettes using a single recombinase).
- AAV packaging gene sequences are "separated” or “split” as referred to herein when they are located on different replicons or recombinant DNA constructs or, if present on a single replicon or recombinant DNA construct, when intervening non-AAV DNA sequences is present between them. Typically, they are separated by at least about 100 nucleotides of other (i.e. non- AAV) DNA, more typically by at least about 400 nucleotides, still more typically by at least about 1000 nucleotides (1 kb).
- non-AAV DNA refers to sequences that are not substantially homologous to AAV DNA along their length.
- the low level of substantial homology necessary to essentially avoid homologous recombination events varies in relation to the length of potentially homologous sequences and their level of sequence homology. See, e.g., the publication by Senpathy and Carter, supra, which investigated the degree of such recombination in AAV systems. As a general matter, it will be preferable for the intervening non-AAV sequences to share less than about 20% identity (over stretches of at least about 100 nucleotides) with AAV sequences.
- sequences should share less than about 10% identity (over stretches of at least about 100 nucleotides); still more preferably, such sequences should share less than about 5% identity (over stretches of at least about 100 nucleotides). Most preferably, such sequences should share less than about 1% identity (over stretches of at least about 100 nucleotides).
- one or more of the AAV packaging cassettes is stably maintained in the packaging cell line (by integration into a chromosome or a stably-maintained episome); more preferably, at least two of the AAV packaging cassettes are stably maintained in the packaging cell line; most preferably all of the AAV packaging genes are stably maintained in AAV packaging cassettes in the packaging cell line.
- stable maintenance can be mediated by integration of the cassette(s) into one or more stably-maintained episomes or into a chromosome of the cell.
- Cassettes comprising cap and rep genes are preferably maintained on different replicons or, if both are chromosomally integrated, they are preferably introduced separately into the packaging cell line such that they are likely to become integrated at separate sites in the genome. Confirmation that AAV packaging cassettes have become integrated into a packaging cell can be obtained using routine molecular biological techniques (such as Southern blotting with probes directed to each of the separate genes).
- certain preferred embodiments of the present invention will also comprise a rep52 gene.
- a rep52 gene will also be stably maintained in the packaging cell.
- the rep52 gene will preferably be introduced separately from the rep78 gene but may be introduced together with (or separately from) the split-cap gene, as discussed above.
- the closely-coupled and tightly- regulated rep and cap functions characteristic of wild-type AAV, and various prior packaging systems are thus separated and substantially reorganized in the packaging cell lines of the present invention.
- the redesigned system of the present invention is useful for providing packaging cell lines for the generation of recombinant AAV vector particles, while at the same time greatly reducing the possibility of generating replication-competent AAV particles.
- PROMOTERS FOR USE IN THE AAV PACKAGING CASSETTES Since transcription of the AAV packaging genes in the cassettes of the present invention can be effectively controlled within the cassette (thereby obviating the potential problems that can arise from expression of proteins such as the Rep proteins in the packaging cell line prior to actual packaging), it is possible to use any of a variety of promoters to effectuate expression of the AAV packaging genes. Thus, even strong and normally constitutive promoters can be employed since transcription of the AAV packaging gene(s) can be effectively suppressed in the recombinase- activatable cassette until the desired activation by a recombinase (which places the promoter into operable linkage with the AAV packaging gene).
- AAV promoters such as p5, pl9 and/or p40
- other heterologous promoters such as p5, pl9 and/or p40
- promoters and/or other transcriptional regulatory sequences such as enhancers can also be employed.
- the various rep and/or cap genes of the present invention may be stably integrated into the host cell genome, location effects (such as those due to chromatin structure) can also influence expression of the genes.
- the cassettes of the present invention can be further "insulated" from extraneous transcriptional activity (which might arise, for example, when an cassette becomes integrated downstream of a promoter) by including terminator sequences adjacent to the cassette.
- a terminator might be located upstream of the first ssr site to effectively block transcription in the downstream direction.
- the methodology described below can be used to generate and select packaging cells that exhibit the desired properties.
- promoters are known in the art and are generally available; including not only mammalian promoters but numerous promoters of viruses found to infect mammals (such as the commonly-used pCMV promoter illustrated below). A large variety of inducible promoters are also well known in the art and generally available.
- the cloning of various promoters and confirmation that promoters exhibit the desired levels of expression can be achieved using standard molecular biological techniques as illustrated below and in the references cited herein.
- As an initial test for the expression of various rep and/or cap genes cells can be readily screened using immunofluorescence or other standard molecular biological techniques to detect Rep and/or Cap proteins; and confirmation of packaging capabilities and efficiencies can be obtained using functional tests for replication and packaging of incoming rAAV vectors. Suitable techniques are described below and in the art.
- AAV split-packaging genes including rep78 genes, rep52 genes and split-cap genes
- rep78 genes, rep52 genes and split-cap genes can be prepared as recombinase-activatable AAV packaging cassettes as illustrated in the
- coding sequences for AAV packaging genes are generally separated from promoter sequences and are introduced into recombinase-activatable AAV packaging cassettes (comprising pairs of site-specific recombination sequences) in which the AAV packaging genes are activatably linked to promoters; see, e.g. Examples 1-8 below.
- at least one of the AAV packaging genes preferably at least the rep78 gene
- Other AAV packaging genes preferably AAV split-packaging genes, may also be included. These may also be activatably linked to promoters as described and illustrated below.
- such packaging genes may be operably linked to promoters.
- the following illustrations provide examples of AAV split- packaging genes that are operably linked to heterologous promoters.
- Such constructs can be used to provide AAV packaging genes that might be introduced into cell lines of the present invention (e.g. in addition to a recombinase- activatable cassette comprising an AAV rep78 gene); or, alternatively, such constructs can be used as sources of AAV split-packaging genes that can be incorporated into recombinase- activatable AAV packaging cassettes as described in Examples 1-8 below.
- AAV packaging genes for use in the recombinase-activatable AAV packaging cassettes of the present invention include wild-type AAV packaging genes (such as the AAV rep and/or cap genes) as well as split- packaging genes (such as a split-cap gene, rep78 gene and/or rep52 gene). Wild-type AAV packaging genes have been described in the art and are generally available from a variety of sources. The following illustrations exemplify the construction of various split-packaging genes operably linked to heterologous promoters.
- CMV-cap a plasmid which comprises a heterologous constitutive promoter operably linked to AAV cap sequences, and a heterologous polyadenylation (polyA) signal in the following order and relative orientation (the arrowhead symbols (">") as used herein designate the relative directionality, e.g., of promoter activity, transcription, termination, etc.):
- the CMV-cap plasmid was constructed using standard molecular biological techniques (as described, e.g., in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc, New York, 1987 and updates) to comprise the following component sections:
- the plasmid backbone consists of the following four components:
- nucleotides 1881-4496 from the pAV2 plasmid (Laughlin, C.A., et al., Gene 23:65- 73 (1983)) encoding the cap gene;
- mMTl-rep78 a plasmid which comprises a heterologous inducible promoter operably linked to AAV rep sequences, and by a heterologous polyA signal in the following order and orientation:
- the mMTl-rep78 plasmid was constructed using standard molecular biological techniques (as described, e.g., in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc, New York, 1987 and updates) to comprise the following four component sections: i) vector backbone: pBluescript KS (+) (available from Stratagene), into which had been inserted a neomycin resistance gene (under the control of an SV40 promoter and followed by an SV40 polyA sequence (as described for pMT-rep/cap//pKO-neo in WO 96/17947, by James M.
- mMTl mouse metallothionein I regulatory region on a Kpnl/Bglll fragment
- Kpnl is at -589 according to Bacolla, A. et al., Nucleic Acids Res. 19:1639-1647, 1991 ; Bglll is +64 according to Glanville et al., Nature 292:267-269, 1981
- rep7 AAV rep sequences from 311 to 2188 (sequence according to Srivastava et al, J. Virol. 45:555-564, 1983) followed by the sequence 5'-CTAGA CCTCC TCAGA TTAGC
- polyA signal from the mouse metallothionein I gene on an Sstll/Hindlll fragment (Sstll is at 925 and Hindlll is at 1246 according to Glanville et al., Nature 292:267-269, 1981).
- mMTl-rep52 a plasmid called "mMTl-rep52" which comprises a heterologous inducible promoter operably linked to AAV rep52 sequences, and a heterologous polyA signal in the following order and orientation:
- plasmid mMTl-rep52 was constructed using standard molecular biological techniques (as described, e.g., in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc, New York, 1987 and updates) to comprise the following four component sections: i) vector backbone: pBluescript KS (+) (available from Stratagene), into which had been inserted a neomycin resistance gene (under the control of an SV40 promoter and followed by an SV40 polyA sequence (as described for pMT-rep/cap//pKO-neo in WO 96/17947, by James M.
- mMTl mouse metallothionein I regulatory region on a Kpnl/Bglll fragment
- rep52 AAV rep sequences from 964 to 2188 (sequence according to Srivastava et al., J. Virol. 45:555-564, 1983) followed by the sequence 5'-CTAGA CCTCC TCAGA TTAGC
- GAGGG GCCAT AGCTT ATGAG CTAGC CGC-3' (SEQ ID NO:2), to provide the spliced second rep exon; and iv) polyA signal: from the mouse metallothionein I gene on a Sstll/Hindlll fragment (Sstll is at 925 and Hindlll is at 1246 according to Glanville et al., Nature 292:267-269, 1981).
- a plasmid called "CMV-cap/mMTl-rep52/version 1 (or tandem orientation)" was prepared which comprises a heterologous constitutive promoter operably linked to AAV cap sequences, and a heterologous inducible promoter operably linked to AAV rep52 sequences, each incorporated into the plasmid in the same transcriptional orientation.
- the CMV-cap/mMTl-rep52/version 1 plasmid contains: ⁇ (pCMV>)-(5p/ t-c p>)-(polyA>H mM T 1 promoter>)-(re/?52>)-(polyA>) ⁇ .
- plasmid CMV-cap/mMTl-rep52/version 1 was constructed using standard molecular biological techniques (as described, e.g., in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc, New York, 1987 and updates) to comprise the following three component sections: i) vector backbone: pBluescript KS (+) (as above); ii) a pCMV -split-cap gene (constructed as described above in Sample Construction 1), inserted into an mMTl-rep52 vector (as described above), by insertion at a Notl site in the polylinker 5' of the mMTl regulatory region such that the pCMV promoter is oriented in the same direction as the mMTl promoter; and iii) mMTl -rep52: (as described above).
- a plasmid called "CMV-cap/mMTl-rep52/version 2 (or divergent orientation)" was prepared which comprises a heterologous constitutive promoter operably linked to AAV cap sequences, and a heterologous inducible promoter operably linked to AAV rep52 sequences, incorporated into the plasmid in opposing transcriptional orientations.
- the CMV- cap/mMTl-rep52/version 2 plasmid contains, in order: - ( ⁇ polyA)-( ⁇ p/ t-cop)-( ⁇ pCMVHmMTl promoter>)-(re/?52>)-(polyA>)--.
- CMV-cap/mMTl-rep52/version 2 was constructed using standard molecular biological techniques (as described, e.g., in Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Assoc, New York, 1987 and updates) to comprise the following three component sections: i) vector backbone: pBluescript KS (+) (as above); ii) a pCMV -split-cap gene (constructed as described above), inserted into an mMTl- rep52 vector (as described above), by insertion at a Notl site in the polylinker 5' of the mMTl regulatory region such that the pCMV promoter is oriented in the opposite direction as the mMTl promoter; and iii) mMTl-rep52: (as described above).
- the recombinase is a protein that recognizes particular site-specific recombination sites in DNA (termed "ssr sites”) and mediates recombination via those sites.
- the recombinase recognizes and mediates recombination at corresponding ssr sites incorporated on either side of an ssr-intervening sequence.
- the effect of the recombination event depends on whether the ssr sites are arranged in a tandem or inverted fashion, resulting in excision or inversion respectively.
- the recombinase from bacteriophage PI (called “Cre” for cyclization recombination) is a 38 kilodalton protein that specifically recognizes two 34-bp repeats termed loxP sites, each of which comprises two 13-bp inverted repeats flanking an 8-bp core region (see, e.g., Sternberg, N., Cold Spring Harbor Symp. Quant. Biol., 1978, 43: 1 143-1 146; Hoess, R., et al., 1982, Proc Natl. Acad. Sci.
- FLP recombinase from the 2 micron plasmid of Saccharomyces cerevisiae recognizes sites denoted "FRT" (FLP Recognition Target) sites and mediates recombination between them (see, e.g., Broach, J., et al., Cell, 1982, 29:227-234; Jayaram, M., Trends Biochem. Sci, 1994, 19:78- 82; and Fiering, et al., Proc. Natl. Acad. Sci. USA 90: 8469-8473, 1993).
- FRT FLP Recognition Target
- the recombinase can be contacted the AAV packaging cassette in any of a variety of ways in which proteins can be caused to be expressed in cells.
- a gene encoding a recombinase can be introduced into the AAV packaging cell as part of an AAV helper virus that is used to provide helper functions for AAV replication/encapsidation.
- AAV helper viruses include adenoviruses, herpesviruses, and other viruses as known in the art.
- an adenovirus vector can be modified to replace a sequence not essential for helper-virus activity (in a particular packaging cell) with a gene encoding a recombinase, as described and illustrated below.
- Any other expression vector comprising a recombinase gene could likewise be used to provide for the production and/or expression of recombinase protein.
- the packaging cell may contain a gene for a recombinase which is either tightly regulated, or which produces an inactive form of a recombinase. Providing recombinase activity could thus be mediated by causing the protein to be expressed, or by causing the inactive form of the protein to become enzymatically active.
- One mechanism that can be used to provide a tightly-controlled recombinase gene is to place the recombinase gene under the control of a tetracycline transactivator system such as that described in Gossen, M., et al., Science 268: 1766-1769, 1995.
- the recombinase is placed under the control of a "Tet-On" regulatory sequence such that expression of the recombinase gene can be turned on with the addition of tetracycline (or derivatives such as doxycycline) to the cell medium.
- the parental lines from which packaging cells are generated may be obtained from any cell line that is susceptible to AAV infection, and amenable to culture in vitro.
- AAV has a very broad host range and has been isolated from a variety of mammalian cell types, including simian, human and rodent cells.
- human cell lines in which appropriate helper functions can be expressed are typically preferred.
- Such human cell lines from which the packaging cell lines may be derived include, for example, Hela, A549, 293, KB, Detroit, and WI38 cells.
- Various derivatives of human 293 cells and derivatives of Hela cells were initially selected for demonstrations of the present invention.
- Preferred cell lines include those which are adapted or adaptable to growth in suspension, which can facilitate the use of large-scale vector production techniques (e.g., techniques employing "bioreactors").
- large-scale vector production techniques e.g., techniques employing "bioreactors”
- experiments were performed as described below using suspension-adapted cell lines derived from human Hela cells and 293 cells.
- a variety of mammalian packaging cell lines including "universal" packaging cell lines that can be used for the production of a variety of different rAAV vectors, are described below.
- rAAV vector particles i.e. containing an rAAV vector having a transgene of interest encapsidated into an AAV viral particle
- a susceptible mammalian cell i.e. a mammalian cell capable of infection and replication of AAV
- an rAAV vector or pro-vector which serves as the template for replication to generate progeny rAAV vector polynucleotides capable of being encapsidated into AAV particles
- AAV packaging proteins i.e.
- AAV Rep and Cap proteins necessary for catalyzing the replication and encapsidation of AAV pro-vector (in the context of the present invention, one or more of the AAV packaging proteins is encoded by a recombinase-activatable AAV packaging cassette whereby expression of the AAV packaging protein is suppressed until the packaging cassette is activated by recombinase); (iii) AAV helper functions provided by an AAV helper virus or genes derived therefrom, e.g.
- helper virus an adenovirus or adenovirus genes providing helper activities necessary for AAV replication and/or encapsidation (if a helper virus is used, the helper virus can also carry one or more AAV packaging genes and/or a recombinase gene);
- a recombinase protein (which can be expressed from the cellular genome, from the helper virus, or from another source as described and/or illustrated below).
- These elements can be provided on one or more replicons or vectors within a suitable AAV packaging cell.
- a "two-component" system can comprise:
- a packaging cell comprising an rAAV vector and AAV packaging genes; and (2) a helper virus providing a recombinase gene as well as helper functions.
- the packaging cell it may not be necessary to include any AAV packaging genes on the helper virus; although it may be beneficial to do so to increase expression of a particular gene product.
- some packaging genes can be carried in the cell and some in the helper virus.
- the rAAV vector can be conveniently provided in the packaging cell, but also can be introduced into a helper virus; it can also be introduced transiently by transfection or can be introduced by infection (see, e.g., the use of such cell lines for "passage packaging" as described below).
- One-component systems can also be designed in which all necessary components (including helper virus functions and the recombinase) are incorporated into the packaging cell (episomally or chromosomally).
- the recombinase gene is then preferably placed under inducible control (such as the tetracycline transactivator system described above), or the recombinase gene product is produced in an inactive form that can be activated by a shift in conditions (as discussed above).
- the generation of rAAV-specific packaging cells of the present invention can be obtained by infecting a packaging cell with an rAAV vector or transfecting it with an rAAV pro-vector or "vector" comprising, for example, a heterologous transgene, such as a therapeutic gene, flanked by AAV ITR regions.
- a heterologous transgene such as a therapeutic gene, flanked by AAV ITR regions.
- suitable conditions e.g., suitable growth conditions and the presence of helper virus functions
- recombinase-activated expression of rep and cap genes in the packaging cell results in the synthesis of Rep and Cap proteins, which in turn mediate replication and encapsidation of the AAV vector.
- Providing a polynucleotide of interest (also referred to as a "target polynucleotide” or “transgene”) in-between the AAV ITR sequences of the rAAV vector thus results in packaging of the transgene into infectious rAAV particles. These particles may subsequently be used to deliver the transgene to other desired host cells, ex vivo or in vivo.
- the transgene is operably linked to a promoter, either its own or a heterologous promoter.
- a large number of suitable promoters are known in the art, the choice of which depends on the desired level of expression of the transgene; whether one wants constitutive expression, inducible expression, cell-specific or tissue-specific expression, etc.
- An rAAV vector can be initially prepared within a "shuttle vector” such as a plasmid that can be used to facilitate cloning of the rAAV vector.
- the transgene can be cloned into a site in the shuttle vector using standard molecular biological techniques such that the transgene is operably linked to a heterologous promoter and the transgene-promoter cassette is flanked by AAV ITR sequences.
- selectable marker genes can also be used to facilitate cloning.
- the transgene can comprise a positive selectable marker (or the shuttle vector can comprise a negative selectable marker that is replaced by the transgene) thus facilitating selection of shuttle vector constructs comprising the transgene insert.
- the rAAV vector will also contain a positive selectable marker in order to allow for selection of cells that have been infected by the rAAV vector.
- the presence of contaminating replication- competent AAV particles can limit the therapeutic potential of rAAV vector preparations.
- the proportion of these undesirable AAV particles can be minimized by decreasing the sequence overlap between the rAAV vector and any AAV genes in the cassettes in the packaging cell line, which decreases the likelihood of homologous recombination.
- the rAAV pro-vector will preferably comprise at least one and, more preferably, two AAV ITR regions, but will preferably not share any significant sequence overlap with AAV rep or cap genes.
- the AAV packaging genes are also "split", or separated from each other, thereby further reducing the possibility that a replication-competent AAV particle could be reconstituted by even non-homologous recombination events.
- the packaging cell lines of the present invention enable the efficient production of rAAV preparations that are of high titer and are substantially free of any contaminating replication-competent AAV; attributes that are especially useful in the context of AAV-mediated gene therapy.
- transgenes of interest may be introduced into rAAV vectors.
- Such transgenes include "wild-type" genes encoding proteins of interest, as well as derivatives thereof which encode, for example, proteins that are functionally equivalent to the wild-type, or proteins that share one or more functions of the wild-type.
- rAAV vectors containing polynucleotides that encode a functional cystic fibrosis transmembrane conductance regulator polypeptide (CFTR) operably linked to a promoter.
- CFTR cystic fibrosis transmembrane conductance regulator polypeptide
- transgenes can be used in this invention to generate rAAV vectors for a number of different applications.
- Such transgenes include, but are not limited to: (i) polynucleotides encoding proteins useful in other forms of gene therapy to relieve deficiencies caused by missing, defective or sub-optimal levels of a structural protein or enzyme; (ii) polynucleotides that are transcribed into anti-sense molecules; (iii) polynucleotides that are transcribed into decoys that bind transcription or translation factors; (iv) polynucleotides that encode cellular modulators such as cytokines; (v) polynucleotides that can make recipient cells susceptible to specific drugs, such as the herpes virus thymidine kinase gene; and (vi) polynucleotides for cancer therapy, such as E1A or p53 tumor suppressor genes.
- an El A gene (which can be derived from an adenovirus) can be used to both suppress tumorigenesis (and/or metastasis) associated with a number of different cancer cell types, and can also function to render such cells more sensitive to other anti-cancer therapies such as chemotherapy or radiotherapy.
- the plasmid comprising the transgene can be introduced into the packaging cell for production of the AAV vector by one of several possible methods; including, for example, electroporation, transfection, lipofection and the like.
- the replication and packaging of rAAV vectors in a mammalian host cell generally involves: (i) an rAAV pro-vector, (ii) AAV Rep and Cap proteins, and (iii) helper virus functions necessary to promote AAV replication and packaging.
- a "helper virus” for AAV production is a virus that provides functions (including, but not limited to, the recombinase gene) necessary to allow the AAV vector to be replicated and packaged by a host cell.
- helper viruses have been identified, including adenoviruses, herpesviruses and poxviruses such as vaccinia. Helper viruses may be human or non-human in origin.
- Helper virus or helper virus functions can be introduced before, during or after introduction of the rAAV vector.
- a plasmid carrying the AAV packaging cassette can be co-introduced into the culture along with the helper virus.
- helper virus functions can be provided by introducing genes encoding such functions into a packaging cell (either transiently or stably).
- the cells can be cultured for a sufficient period, typically 2-5 days, in conditions suitable for replication and packaging as known in the art (see references above and examples below). Lysates can then be prepared, and the recombinant AAV vector particles can be purified by techniques known in the art.
- the present invention can be used to generate "universal" AAV packaging cells that can be used to produce any of a variety of rAAV vectors of interest.
- a universal packaging cell might contain, for example, one or more stably integrated AAV packaging genes (preferably within AAV packaging cassettes according to the present invention) which are collectively capable of providing AAV packaging proteins (i.e. AAV Rep and Cap proteins).
- AAV packaging proteins i.e. AAV Rep and Cap proteins
- helper virus functions an rAAV pro-vector and a recombinase
- a helper virus such as a recombinant adenovirus
- a helper virus can be used to provide helper virus functions as well as a recombinase and/or an rAAV pro-vector, since (as is known in the art) a number of genes in such a helper virus (e.g. the E3 gene of adenovirus) can be replaced without eliminating helper virus activity. Additional genes can be inserted into such a helper virus by providing any necessary helper virus functions in trans.
- human 293 cells contain adenoviral genes that can complement adenoviral El mutants.
- heterologous genes can also be cloned into an adenovirus in which the El genes have been deleted, for use in cells that can effectively provide such adenoviral functions in trans.
- the use of a helper virus can be eliminated by providing all necessary helper virus functions in the packaging cell. Effective construction of such a packaging cell is feasible in the context of the present invention because the AAV packaging genes (such as rep and cap), which are normally up-regulated in the presence of helper virus, can be effectively controlled within the recombinase-activatable AAV packaging cassettes of the present invention.
- any adenovirus function that has a deleterious effect on the host packaging cell can likewise be placed under the control of a recombinase-activatable cassette analogous to the recombinase-activatable AAV packaging cassettes described herein.
- Any other functions needed for rAAV production e.g. rAAV vector and recombinase
- rAAV vector and recombinase can be provided separately or together, by any of a variety of means, such as transfection, lipofection, electroporation and the like.
- Such techniques can be used to introduce the genes either stably or transiently, as is known in the art.
- Particularly preferred packaging cells of the present invention produce very little, if any, replication-competent AAV particles; preferably, the frequency of generation of replication- competent AAV particles is less than about 1 per 1 particles produced, preferably less than 1 per 10°% still more preferably less than 1 per 10 ⁇ 0, and most preferably, less than 1 per 10 ⁇ 2
- Preferred packaging cells of the present invention are also capable of replicating at least one half as rapidly as the parental cells from which they were derived, more preferably at least two-thirds as rapidly, still more preferably at least 90% as rapidly.
- Preferred packaging cells according to the present invention are also capable of producing at least about 100 rAAV particles/cell, more preferably at least about 200 rAAV particles/cell, still more preferably at least about 400 rAAV particles/cell.
- the recombinase of bacteriophage PI (called “Cre” for cyclization recombination) is a 38 kilodalton protein that specifically recognizes two 34-bp repeats termed loxP sites, each of which comprises two 13-bp inverted repeats flanking an 8-bp core region (see, e.g., Sternberg, N., Cold Spring Harbor Symp. Quant. Biol., 1978, 43: 1143-1 146; Hoess, R., et al., 1982, Proc Natl. Acad. Sci. USA, 79: 3398-3402; and Hoess, R., et al., Nucleic Acids and Molecular Biology, 1990, 4:90-109).
- loxP-loxP contained the following sequence:
- Inversion-type cassettes of the present invention can be prepared using an analogous ssr- ssr fragment in which the ssr sites are arranged in inverted orientation; e.g. one ssr site (either nucleotides 10 to 43 or nucleotides 58 to 91 in the sequence above) is reversed while the remainder of the sequence is left intact.
- the second loxP site is preferably inverted such that it faces the first, i.e. the sites are arranged in a convergent orientation with respect to each other.
- FRT FLP Recognition Target
- Preferred excision-type AAV packaging cassettes of the present invention comprise the following components in the relative order and orientation shown below: ⁇ (promoter>)-(ssr>)-(ssr-intervening sequence)-(ssr>)-(AAV packaging gene>)-
- the ssr-intervening sequence comprises a terminator that prevents transcription originating from the upstream promoter from causing transcription of the AAV packaging gene which is located downstream of the second ssr site. Activation of the cassette by recombinase results in excision of the ssr-intervening sequence and, in the rearranged cassette, the downstream AAV packaging gene is placed into operable linkage with the upstream promoter.
- pCMVloxP-loxP a generic intermediate vector, called "pCMVloxP-loxP" comprising a constitutive promoter (from CMV, i.e. an intermediate early promoter) and a pair of tandemly-oriented ssr sites, arranged in the relative order and orientation shown below:
- the plasmid "pCMVloxP-loxP” was first constructed by subcloning a Stu I/Hind III double stranded DNA oligonucleotide of about 100 bp (from the 112 bp loxP-loxP sequence described in Example 1) into the Stu I/Hind III sites of a 3.4 kb DNA fragment from pCMV ⁇ (commercially available from Clontech).
- the loxP-loxP oligonucleotide thus contains two loxP sites arranged in tandem, separated by a poly-cloning sequence that includes Not I and Sal I restriction sites. Additional restriction enzyme sites, including a Bgl II and an Xho I site are present downstream of the second loxP site.
- the resulting plasmid can be used to readily introduce an ssr-intervening sequence in-between the ssr sites, and can be used to generate complete excision-type AAV packaging cassettes by cloning AAV packaging genes downstream of the second ssr site (as illustrated in the following examples).
- the generic vector of Example 2a was modified by insertion of an ssr-intervening sequence, comprising a selectable marker gene and a transcriptional terminator, into the poly- cloning sequence separating the tandem ly- arranged ssr sites.
- an ssr-intervening sequence comprising a selectable marker gene and a transcriptional terminator
- a 4.3 kb Not I/Sal I fragment containing the " ⁇ -geo" gene (a reporter gene encoding a protein with both ⁇ - galactosidase and neomycin phosphotransferase activity, as described in Friedrich, G., et al.
- pCMVloxP- ⁇ -geo-loxP comprises the following components in the relative order and orientation shown below: ⁇ (pCMV>)(ssr>)( ⁇ -geo>)(term>)(ssr>) ⁇
- This plasmid can then be used to generate any of a variety of excision-type AAV packaging cassettes by introducing an AAV packaging gene into the position downstream of the second ssr site (e.g., by cloning into one of the restriction endonuclease sites located in the polycloning sequence introduced adjacent to the ssr, as described in Example 1). Illustrative constructions and uses of such cassettes are described below.
- CMVOFFRep78 As a first illustration of a recombinase-activatable AAV packaging cassette of the present invention, we constructed a plasmid called "CMVOFFRep78".
- a 2.3 kb Bgl II/Xho I DNA fragment containing the AAV rep gene (from the plasmid pMt-rep/cap//pKO-neo as described in a commonly-owned application published as WO 96/17947 on 13 June 1996) and an SV40 polyAdenylation (polyA) signal was subcloned into the Bgl II/Xho I sites of pCMVloxP- ⁇ -geo- loxP.
- the resulting plasmid is designated pCMVOFFRep78 and comprises the following components in the relative order and orientation shown below:
- the packaging cassette ⁇ (pCMV>)-(ssr>)-[( ⁇ -geo>)-(polyA>)]-(ssr>)-(rep7S>)-(polyA>) ⁇
- the ssr-intervening sequence is excised and the rearranged cassette contains the AAV packaging gene in operable linkage with the promoter, as follows:
- AAV packaging cassette As a second illustrative AAV packaging cassette according to the present invention, we constructed an excision-type cassette in which a different AAV packaging gene (rep52) is activatably linked to a promoter via an ssr-intervening sequence that comprises a different heterologous gene (hisD) (effectively blocking transcription from the promoter).
- the cassette is constructed such that activation by recombinase results in removal of the ssr-intervening sequence and, in the resulting rearranged cassette, the AAV packaging gene is placed into operable linkage with the promoter, thereby allowing transcription.
- pCMVloxP-loxPRep52 This exemplary excision-type AAV packaging cassette was first generated as a plasmid termed "pCMVloxP-loxPRep52".
- the significant components of pCMVloxP-loxPRep52 are as follows, in order: an pCMV, a first ssr site (loxP site), a second ssr site (loxP site), and an AAV rep52 gene.
- the loxP sites are in tandem arrangement.
- the hisD gene and the adjoining polyA signal represent the ssr-intervening sequence, as they lie between the two loxP sites.
- the pCMVloxP-loxPRep52 vector comprises the following components in the relative order and orientation shown below: -(pCMV>)-(ssr>)-[(/z 5/)>)-(polyA>)]-(ssr>)-(rep52>)-(polyA>)-
- a 1.6 kb Bel I/Xho I DNA fragment containing the rep52 gene including its polyA signal was subcloned into the Bgl II/Xho I sites of pCMVloxP-loxP (Example 2).
- Notl-Sall DNA fragment containing the L-histidinol resistance (HisD r ) gene was subcloned into the Not I/Sal I sites of pCMVloxP-loxPRep52.
- the resulting construct was denoted pCMVOFFRep52.
- the source of the HisD r gene was the plasmid pHD-1 (as described in Hartmann et al., id.). A 1.4 kb BamHI DNA fragment containing the HisD r gene was subcloned at the Ba HI site of pBluescript II SK(-) to create the construct pSK(-)HisD r .
- the plasmid pREP-8 (Invitrogen) was digested with BspE I and Sal I and a 1.8 kb DNA fragment encompassing the 3' half of the HisD r gene followed by an SV40 polyA signal was subcloned into the BspE I/Sal I sites of pSK(-)HisD r after removal of a 0.3 kb DNA fragment.
- the resulting plasmid was denoted as pSK(-)HwZX pA.
- pSK(-)HisD pA was digested with Not I and Sal I, and a 2.8 kb DNA fragment containing the HisD r gene (including the SV40 polyA signal) was subcloned into the Not I/Sal I sites of pCMVloxP-loxPRep52, to generate pCMVOFFRep52.
- the ssr-intervening sequence is excised and the rearranged cassette contains the
- AAV packaging gene in operable linkage with the promoter as follows:
- a AAV packaging cassette in which a different AAV packaging gene (split-cap) is activatably linked to a promoter via an ssr-intervening sequence that comprises a different heterologous gene (pac) that effectively blocks transcription from the promoter.
- the cassette is constructed such that activation by recombinase results in removal of the ssr- intervening sequence and, in the resulting rearranged cassette, the AAV packaging gene is placed into operable linkage with the promoter, thereby allowing transcription.
- This exemplary excision-type AAV packaging cassette was generated as a plasmid termed "pCMVOFFCap" using techniques analogous to those described above.
- pCMVOFFCap The significant components of pCMVOFFCap are as follows, in order: an pCMV, a first ssr site (loxP site), a pac gene with a polyA signal (from SV40), a second ssr site (loxP site), and an AAV split-cap gene.
- the ssr sites are in tandem arrangement to promote excision.
- the pac gene and the adjoining polyA signal represent the ssr-intervening sequence, as they lie between the two loxP sites.
- the pCMVOFFCap vector comprises the following components in the relative order and orientation shown below:
- pCMVOFFCap a 2.6 kb Hindlll/BamHI DNA fragment containing a split-cap gene (nucleotides 1881-4496 encoding the Cap protein of AAV, e.g.
- plasmid pAV2 Laughlin, C.A., et al., Gene 23:65-73, 1983
- an SV40 polyA site was filled in using the Klenow reagent and blunt-end ligated downstream of the loxP sites of pCMVloxP-loxP, which had been previously digested with Bglll and Xhol and filled in with Klenow.
- the resulting plasmid was denoted "pCMVloxP-loxPCAPpA".
- Cre protein the ssr-intervening sequence is excised and the rearranged cassette contains the AAV packaging gene in operable linkage with the promoter, as follows:
- an inversion-type AAV packaging cassette As an illustrative embodiment of an inversion-type AAV packaging cassette according to the present invention, techniques as described above can be used to generate an cassette in which an AAV packaging gene (rep78) is activatably linked to a promoter via an ssr-intervening sequence that comprises the promoter in an inverted orientation (such that transcription is initially directed away from the AAV packaging gene).
- the cassette is constructed such that activation by recombinase results in inversion of the ssr-intervening sequence and, in the resulting rearranged cassette, the AAV packaging gene is placed into operable linkage with the promoter, thereby allowing transcription.
- This exemplary inversion-type AAV packaging cassette is generated as a plasmid termed "p(invPR)Rep78".
- the significant components of p(invPR)Rep78 are as follows, in order: a first ssr site (e.g. a loxP site), a promoter (such as the pCMV) orientated such it promotes transcription in an upstream direction (i.e., toward the first ssr site), a second ssr site (e.g. loxP site), and an AAV split-packaging gene (e.g., rep78).
- the ssr sites are in inverted arrangement.
- the p(invPR)Rep78 vector contains, in order (arrowheads following the ssr sites represent the orientation of those sites relative to each other): --(ssr >)-( ⁇ promoter)-(ssr ⁇ )-(rep75>)-(polyA>) ⁇ .
- a polynucleotide comprising a pair of ssr sites arranged in inverted orientation can be generated essentially using the techniques described above in Example 1 (wherein the second ssr site is inverted relative to the first).
- a generic vector can be constructed that can be used for the preparation of a variety of such inversion-type cassettes, by cloning a sequence containing a promoter in-between the ssr sites such that the promoter is arranged to promote transcription in the upstream direction (i.e. toward the first ssr site). That generic vector can then be used to generate an inversion-type AAV packaging cassette by cloning an AAV packaging gene into a position downstream of the second ssr site; such that inversion of the ssr-intervening sequence (upon contact with recombinase) results in the promoter being inverted and placed into operable linkage with the downstream AAV packaging gene.
- the ssr- intervening sequence is inverted and the rearranged cassette would contain the AAV packaging gene in operable linkage with the promoter, as follows:
- AAV packaging genes such as rep52, split-cap and/or wild-type AAV packaging genes
- rep52, split-cap and/or wild-type AAV packaging genes can be incorporated in an analogous fashion in place of rep 78.
- other ssr sites such as FRT sites could be employed in place of loxP sites, as discussed above.
- a terminator is included upstream of the first ssr site to prevent upstream transcription from effecting expression of the rep78 gene.
- an cassette is constructed in which an AAV packaging gene (rep78) is activatably linked to a promoter by placing the AAV packaging gene within the ssr- intervening sequence in an inverted orientation relative to the promoter (which is outside of the ssr-intervening sequence).
- the cassette is thus constructed such that activation by recombinase results in inversion of the ssr-intervening sequence and, in the resulting rearranged cassette, the
- AAV packaging gene is placed into operable linkage with the promoter, thereby allowing transcription.
- This exemplary inversion-type AAV packaging cassette is generated as a plasmid termed "pPR(invRep78)".
- the significant components of pPR(invRep78) are as follows, in order: a promoter (such as the pCMV) orientated such that transcription is in the direction of the first ssr site, a first ssr site (e.g. a loxP site), an AAV split-packaging gene (e.g., rep78) oriented such that the direction of transcription is toward the first ssr site, and a second ssr site (e.g. loxP site).
- a promoter such as the pCMV
- AAV split-packaging gene e.g., rep78
- the inverted AAV packaging gene is preceded by a transcriptional terminator.
- the ssr sites are in inverted arrangement.
- the pPR(invRep78) vector contains, in order (arrowheads following the ssr sites represent the orientation of those sites relative to each other):
- a polynucleotide comprising a pair of ssr sites arranged in inverted orientation can be generated essentially using the techniques described above in Example 1. Then, following techniques analogous to those in Example 2, a generic vector can be constructed that can be used for the preparation of a variety of such inversion-type cassettes, by cloning a sequence containing a promoter upstream of the first ssr site (oriented so as to promote transcription toward the ssr sites).
- That generic vector can then be used to generate an inversion-type AAV packaging cassette by cloning an AAV packaging gene into position as the ssr-intervening sequence but in an orientation such that it faces the upstream promoter (as shown above); whereby activation of the cassette (upon contact with recombinase) results in the AAV packaging gene being inverted and placed into operable linkage with the upstream promoter.
- the cassette upon contact with recombinase
- the ssr- intervening sequence is inverted and the rearranged cassette would contain the AAV packaging gene in operable linkage with the promoter, as follows:
- AAV packaging genes such as rep52, split-cap and/or wild-type AAV packaging genes
- rep52, split-cap and/or wild-type AAV packaging genes can be incorporated in an analogous fashion in place of rep 78.
- other ssr sites such as FRT sites could be employed in place of loxP sites, as discussed above.
- a transcriptional terminator can also be located downstream of the second ssr site in the cassette to block any exogenous transcriptional activity from influencing transcription of the packaging gene in the non-activated state.
- an cassette is constructed in which an AAV packaging gene (rep78) is activatably linked to a promoter by placing a uni-directional terminator within the ssr- intervening sequence.
- the cassette is thus constructed such that activation by recombinase results in inversion of the ssr-intervening sequence and, in the resulting rearranged cassette, the AAV packaging gene is placed into operable linkage with the promoter, thereby allowing transcription.
- This exemplary inversion-type AAV packaging cassette is generated as a plasmid, the significant components of which are as follows, in order: a promoter (such as the pCMV) orientated such that transcription is in the direction of the first ssr site, a first ssr site (e.g. a loxP site), a uni-directional terminator (such as SV40 polyA) oriented to block transcription originating from the promoter, a second ssr site (e.g. loxP site), an AAV split-packaging gene (e.g., rep78) oriented such that the direction of transcription is toward the first ssr site.
- a promoter such as the pCMV
- a first ssr site e.g. a loxP site
- a uni-directional terminator such as SV40 polyA
- a second ssr site e.g. loxP site
- an AAV split-packaging gene e.g., rep
- the vector contains, in order (arrowheads following the ssr sites represent the orientation of those sites relative to each other):
- a polynucleotide comprising a pair of ssr sites arranged in inverted orientation can be generated essentially using the techniques described above in Example 1 (wherein the second ssr site is inverted relative to the first).
- a generic vector can be constructed that can be used for the preparation of a variety of such inversion-type cassettes, by cloning a promoter upstream of the first ssr site and a uni-directional terminator in-between the ssr sites such that the terminator is arranged to prevent transcription in the downstream direction (i.e. toward the second ssr site), as shown above.
- That generic vector can then be used to generate an inversion-type AAV packaging cassette by cloning an AAV packaging gene into a position downstream of the second ssr site; such that inversion of the ssr- intervening sequence (upon contact with recombinase) results in the uni-directional terminator being inverted, thus effectively placing the AAV packaging into operable linkage with the upstream promoter.
- the ssr-intervening sequence is inverted and the rearranged cassette would contain the AAV packaging gene in operable linkage with the promoter, as follows: — (promoter>)-(ssr>)-( ⁇ term)-( ⁇ ssr)-(rep75>)-(polyA>) ⁇ .
- Other AAV packaging genes can be incorporated in an analogous fashion in place of rep 78.
- other ssr sites such as FRT sites could be employed in place of loxP sites, as discussed above.
- Enzymatically-active recombinase proteins for use in the present invention can be provided by any of a variety of means as described above.
- the gene encoding the recombinase can be carried on any of various replicons in the packaging cell.
- a recombinase gene is included within the genome of an AAV helper virus that is used to activate AAV replication and encapsidation in the packaging cell.
- Recombinase genes can alternatively be carried in a cellular chromosome, or on any other replicon within the packaging cell; or the recombinase gene can be introduced into the cell in a manner that results in transient expression of the recombinase in the cell (e.g., by transfection with a plasmid or other vector comprising the recombinase gene), with or without subsequent integration of the recombinase gene into a stably-maintained replicon of the packaging cell.
- recombinase genes that can be used to express the recombinase directly (e.g., by transient expression in a transfected mammalian cell), or can be used as a source of recombinase genes to be introduced and/or expressed in other ways (e.g., by subcloning the recombinase gene(s) into a helper virus, or directly into a chromosome).
- the recombinase activity is preferably initiated in the packaging cell concurrently with the desired initiation of AAV replication/encapsidation functions (e.g. by introducing a recombinase gene as part of the helper virus or by a separate event such as transfection that is closely-associated in time with the introduction of helper virus, by initiating the expression of a recombinase gene in concert with the desired initiation of replication/encapsidation, or by initiating the enzymatic activity of a recombinase protein such as by a temperature or other environmental shift).
- AAV replication/encapsidation functions e.g. by introducing a recombinase gene as part of the helper virus or by a separate event such as transfection that is closely-associated in time with the introduction of helper virus, by initiating the expression of a recombinase gene in concert with the desired initiation of replication/encapsidation, or by initiating the en
- recombinase gene will necessarily depend on the site-specific recognition sequences selected for incorporation into the AAV packaging cassettes of the present invention.
- the Cre recombinase gene was selected to provide a source of protein that can activate cassettes comprising pairs of loxP sites as described above.
- a number of recombinases are known and their encoding genes have been cloned or are readily obtainable.
- a 1031 bp sequence encompassing the ORF of bacteriophage PI Cre recombinase from the plasmid pHSG-cre was used as a template for PCR.
- the following oligonucleotides were used as PCR primers:
- the forward amplimer, 5'-GCGCG GCGGC CGCGG TACCA GATCT ATGTC CAATT TACTG ACCGTA- 3' (SEQ ID NO:4), contains a Not I, Asp 718 and Bgl II restriction enzyme sites followed by the first six codons of Cre.
- GCGCGCGGTACCCAGACCGTGCATCATGAGCGGCCCTCCAAAAAAGAAGA GAAAGGTAGAAGACCCGAGATCTGCGC-3' (SEQ ID NO:6) containing an initiation codon fitting Kozak's rule (Kozak, M. 1981. Nucleic Acid Res., 9, 5233-5252) and a coding sequence of NLS from SV40 T antigen, was subcloned between the Asp 718 and Bgl II sites of pCMVCre.
- pCMVNCre The resulting plasmid is designated pCMVNCre and is introduced by methods known in the art into host cells already carrying AAV packaging cassettes.
- the recombinase encoded by pCMVNCre mediates recombination of the AAV packaging cassettes, which then express packaging genes necessary to replicate and encapsidate rAAV vectors.
- the recombinase protein used to activate the AAV packaging cassettes is expressed from a recombinant AAV helper virus (such as a recombinant adenovirus) that also provides other necessary functions for promoting AAV replication and/or encapsidation.
- a recombinant AAV helper virus such as a recombinant adenovirus
- recombinant adenovirus comprising recombinase genes (with or without an NLS as described in the preceding example) can be prepared using standard molecular biological techniques.
- recombinase genes can be conveniently incorporated into a recombinant adenovirus at a site in the adenoviral genome that is either unnecessary for viral replication and/or helper functions, or at a site encoding a necessary gene product which can be complemented in trans (e.g., by providing a copy of the necessary gene in a packaging cell to be used in conjunction with the present invention).
- a recombinase gene can be introduced into the non-essential E3 region of adenovirus.
- a recombinase gene can be introduced into the essential El region of adenovirus for use in cells such as human 293 cells which are capable of complementing the El deficiency in trans.
- Techniques for facilitating cloning into adenovirus vectors, e.g. into the El and/or E3 regions, are known in the art (see, e.g., Bett, A.J., et al., Proc Natl. Acad. Sci. USA 91 :8802-8806, 1994; and Kanegae, Y., et al., Nucl.
- plasmids such as pCMVCre and/or pCMVNCre can thus be used as sources of recombinase genes to be sub-cloned into another site (such as within the El or E3 regions of adenovirus).
- Ad helper virus in which an NLS-tagged recombinase (Cre) is inserted into the E3 region of adenovirus, which can be used to introduce recombinase protein into any of variety of cells useful as mammalian packaging cells.
- Cre NLS-tagged recombinase
- the El region of adenovirus is left intact and the E3 region is generally non-essential, it is possible to employ such a recombinant adenovirus to deliver helper virus functions (as well as recombinase) even to cells such as Hela cells which, unlike 293 cells, do not contain adenovirus complementing sequences.
- Re NLS-tagged recombinase
- AAV packaging cassettes is stably integrated into a mammalian cell that can be useful as a mammalian packaging cell for the production of rAAV particles.
- Stable integrants can be readily obtained using standard molecular biological techniques.
- Inclusion of a selectable marker either within or adjacent to the AAV packaging cassette to be stably introduced can facilitate the selection of cells that obtain and/or retain the AAV packaging cassette.
- an AAV packaging cassette comprising an AAV rep78 gene into a human cell line (a 293 cell line sometimes referred to as "293-1 ") into which an rAAV pro-vector had been stably integrated (briefly, this line, referred to as 293AAVCFTR herein, was previously generated by transfecting 293 cells with a plasmid "tgAAVCFTR" which contains the AAV2 inverted terminal repeats (nucleotides 1-145 and 4490-4681) flanking nucleotides 133 to 4573 of the CFTR cDNA (entire coding sequence) and a synthetic polyadenylation signal based on the murine beta-globin at the 3' end, see, Afione, S.A., et al., J. Virol. 70:3235-3241,
- Human cells such as 293 cells (ATCC CRL 1573) were generally maintained in Dulbecco's modified Eagle's Medium (DMEM) supplemented with 10% calf serum and 100 units/ml penicillin and streptomycin. Cells were grown in a humidified 37 degree C incubator supplemented with 10% CO2. Generally, electroporation was performed using 15-30 micrograms of plasmid DNA for 2-5 xl 0 ⁇ cells, and was routinely performed in about 800 microliters of serum-free medium in a 0.4 cm cuvette at 210 volts, 960 microF using a Gene Pulser (Bio-Rad).
- DMEM Dulbecco's modified Eagle's Medium
- cells were typically plated in a T-75 flask in DMEM comprising a selective component (e.g., 0.65 mg/ml G418 (Gibco-BRL) for cells having a neomycin resistance gene such as a neo or geo gene).
- a selective component e.g. 0.65 mg/ml G418 (Gibco-BRL) for cells having a neomycin resistance gene such as a neo or geo gene.
- the selected cell population was expanded and maintained in selective medium.
- human 293AAVCFTR cells containing integrated tgAAVCFTR
- pCMVOFFREP78 as described above.
- Polyclonal cell lines resistant to G418 were obtained after 10-12 days of drug selection and designated HB Cl .
- Individual clones were picked, expanded into clonal populations and tested for the presence of a stable- integrated AAV packaging cassette.
- a number of stable integrants typically comprising from one to five integrated copies of the AAV packaging cassette, were readily obtained using such techniques. For these examples, we elected to proceed with clones having only a single full-length copy of the AAV packaging cassette (although clones having multiple integrated copies may well be useful as a means of providing additional sources of the AAV packaging functions).
- HB Cl human 293AAVCFTR cells having a stably-integrated copy of plasmid pCMVOFFRep78 (i.e. a "single integrant" prepared as described above)] (approximately 4x10 ⁇ cells in a T-75 flask) was transfected by electroporation with 10 micrograms of either pCMVCre or pCMVNCre as described above in Example 9, and then plated in DMEM overnight. The cells were then infected with adenovirus [Ad5 at an moi (multiplicity of infection) of about 5], and incubated for 48 hours at 37 degrees Celsius.
- adenovirus Ad5 at an moi (multiplicity of infection) of about 5
- the intensely-hybridizing band at about
- elimination of the AAV packaging cassette, the recombinase or the helper virus infection essentially prevented the effective rescue and amplification of the rAAV pro-vector.
- HB Cl cells human 293AAVCFTR cells having a stably- integrated copy of plasmid pCMVOFFRep78 (prepared as described above)] (approximately 2x1 ⁇ 6 cells in a T-75 flask) was infected with adenovirus at an moi of about 5 (Ad5, AdAxCANCre or an AdNCre comprising the cre gene and an associated Nuclear Localization
- Controls included parental-type cells that were transfected with a plasmid (pRS5 as described in WO 95/13365) or a combination of plasmids (pmMTlRep, as described in WO 96/17947, and pCMVCap as described above) providing AAV rep-cap sequences, and then infected with either Ad5 or AdNCre.
- pRS5 as described in WO 95/13365
- pmMTlRep as described in WO 96/17947
- pCMVCap as described above
- mammalian packaging cells prepared according to the present invention can and preferably do comprise multiple different AAV packaging cassettes.
- Preferred cell lines of the present invention comprise at least one AAV packaging cassette comprising an AAV rep 75 gene and comprise a second AAV packaging cassette comprising an AAV split-cap gene.
- Preferred cell lines can also include an AAV packaging cassette comprising an AAV rep52 gene.
- double integrants comprising a first AAV packaging cassettes having a re 75 gene and a second AAV packaging cassette having a rep52 gene.
- double integrants were obtained by expanding a clonal population of cells having a single integrated rep 75 cassette (as in Example 1 1 ), and electroporating those cells with a plasmid comprising an AAV packaging cassette having a rep52 gene (in this example, pCMVOFFRep52, as described in Example 4).
- the first and second AAV packaging cassettes will contain different selectable markers to facilitate selection and maintenance of both cassettes.
- the rep 75 cassette comprised a ⁇ -geo selectable marker and the rep52 cassette comprised an L-histidinol resistance gene.
- Individual clones that were capable of growth under both G418 (as indicated above) and L-histidinol (1.2 mM) were then screened for the presence of integrated copies of the corresponding AAV packaging cassettes.
- cells containing from one to more than five copies of the integrated cassettes are readily obtainable.
- the single integrant had been first selected for possessing only a single intact copy of the recombinase-activatable rep 75 cassette.
- Double integrants were likewise screened to identify cells that comprised a single full-length copy of the recombinase-activatable rep52 cassette.
- double integrants prepared according to Example 14 (approximately 2x10 ⁇ cells in DMEM medium in a T-75 flask) were infected with an adenovirus (AdNCre or AdAxCANCre at moi of 5 or 10) comprising a recombinase gene (Cre) operably linked to a nuclear localization signal (as described by Kanegae, Y., et al., Nucleic Acids Res. 23:3816-3821 , 1995).
- AdNCre or AdAxCANCre at moi of 5 or 10
- pCMVCap 10 to 15 micrograms of plasmid per 2.5 x 10 ⁇ cells as described above. After 48-72 hours further incubation, a portion of the cells was harvested and used to obtain DNA or used to purify cell lysates. After purification, DNA was digested with EcoRl, blotted as described above, and probed with a CFTR-specific hybridization probe. Controls included parental-type cells transfected with a plasmid (pRS5) or a combination of plasmids (pmMTlRep and pCMVCap) comprising AAV rep-cap sequences (as described in
- Example 13 Infected with either Ad5 or AdNCre.
- mammalian cells lines comprising various stably- integrated AAV packaging cassettes to produce heat-stable infectious rAAV vector particles that can be used transfer a gene of interest to a targeted mammalian cell.
- Single and double integrants (having rep 75 and re 75 plus rep52 cassettes, respectively, as described above) were infected with adenovirus and transfected with pCMVCap as described in the preceding example. After transfection, incubation was continued for 48-72 hours. From each T-75 flask, one ml samples of cells in medium were lysed by sonication and the lysate was treated with Benzonase (25 units/ml) and incubated for 30 minutes at 37 degrees Celsius.
- infectious rAAV particles can be used to infect clone 37 cells (which contain an integrated copy of an AAV rep-cap cassette in which the rep gene is placed under the control of the mMTl promoter). Since clone 37 cells provide both AAV rep and cap gene functions, an incoming rAAV vector can (in combination with infection by adenovirus) be replicated and thus amplified.
- adenovirus was present in the first sample and had not been inactivated by heating, the use of adenovirus carrying a recombinase gene in the El region (which would be proficient in 293 cells which can complement the loss of El) do not provide sufficient helper functions in other cells such as clone 37 cells
- adenovirus (which are derived from Hela cells). Therefore, we routinely included additional adenovirus in the unheated sample as well when performing the clone 37 assay.
- the lysate was heated at 56 degrees Celsius for 1 hour, inactivating any adenovirus present in the sample (which thus served as an Ad-minus control).
- the lysate was first heated at 56 degrees Celsius for 1 hour (inactivating adenovirus) and then supplemented with additional adenovirus. Each of the lysates was then used to infect clone 37 cells during a 48-72 hour incubation period.
- FIG. 3 is a copy of an autoradiograph reflecting hybridization of the CFTR probe to
- both single-integrant and double-integrant cell lines comprising AAV packaging cassettes of the present invention could be used to produce heat-stable infectious rAAV viral particles that were capable of mediating transfer of the rAAV vector to mammalian target cells.
- preferred cell lines of the present invention comprise at least one AAV packaging cassette comprising an AAV rep 75 gene and comprise a second AAV packaging cassette comprising an AAV split-cap gene.
- Preferred cell lines can also comprise an AAV packaging cassette comprising an AAV rep52 gene.
- triple integrants comprising a first AAV packaging cassettes having a rep 75 gene, a second AAV packaging cassette having a rep52 gene, and a third AAV packaging cassette having a split-cap gene.
- triple integrants are obtained by expanding a clonal population of double integrants (as in Example 15), and electroporating those cells with a plasmid comprising an AAV packaging cassette having a split- cap gene (in this example, pCMVOFFCap, as described in Example 5).
- AAV packaging cassettes will contain different selectable markers to facilitate selection and maintenance of the cassettes.
- the rep 75 cassette comprised a ⁇ -geo selectable marker
- the rep52 cassette comprised an L-histidinol resistance gene
- the spit-cap cassette comprised a pac gene providing puromycin resistance.
- single, double and/or triple integrants can also be readily prepared in other cell lines that can be used for packaging various rAAV vectors.
- the present invention can be used to generate "universal" (as opposed to rAAV-specific) cell lines which can then be used for the production of any of a variety of rAAV vectors (i.e. rAAV vectors comprising any of a variety of transgenes of interest).
- rAAV vectors comprising any of a variety of transgenes of interest.
- human 293 cells which (as noted above), have functions that are capable of complementing adenoviruses carrying heterologous genes in the El region; human 293 "N3S” cells, which is a suspension-adaptable cell line derived from 293 cells that would further facilitate the production of rAAV vector using packaging cells in suspension cultures (see, e.g., Graham, F.L., J. Gen. Virol., 68: 937-940, 1987); and Hela S3 cells, which are a suspension-adaptable human Hela cell line (ATCC CCL 2.2). If the adenovirus is to carry the recombinase gene and the packaging cells do not have El- complementing functions (e.g.
- the packaging cells can be modified by introduction of El complementing functions or the recombinase can be introduced into the adenovirus at a different location, preferably in a region such as E3 that is not required for adenovirus replication or helper functions.
- Example 11 the techniques described in Example 11 were used to generate single integrants of each of the foregoing cell lines comprising a stably-integrated AAV packaging cassette having a rep 75 gene.
- the techniques described in Example 15 were then used to generate double integrants of each of the foregoing cell lines comprising two different stably-integrated AAV packaging cassettes (one comprising a rep 75 gene and the other comprising a rep52 gene).
- Such universal AAV packaging cell lines prepared according to the present invention can be used to replicate and encapsidate any rAAV vector, provided that the necessary complementing activities (such as helper virus functions and recombinase) are present as described above.
- such universal AAV packaging cell lines can be used to replicate and encapsidate rAAV vector that has been introduced to the cells by any of a variety of methods.
- rAAV vector can be stably introduced into a universal packaging cell to produce a dedicated rAAV producer cell (as described and illustrated above).
- the rAAV vector can be introduced to the packaging cell coincident with the initiation of packaging (e.g. introduced on a plasmid or with the helper virus).
- Such universal AAV packaging cell lines can also be used to carry out an amplification process referred to as "passage packaging.”
- the replication functions that form an integral part of the AAV packaging system can be used to effectively amplify an rAAV vector stock since each virus particle that infects a suitable AAV packaging cell can be replicated many fold, and the replicated pro-vectors can then be packaged into a population of progeny rAAV vector particles.
- CORRESPONDENCE ADDRESS (A ADDRESSEE: MORRISON & FOERSTER (B STREET: 755 PAGE MILL ROAD (C CITY: PALO ALTO (D STATE: CA (E COUNTRY: USA (F ZIP: 94304-1018
- TELECOMMUNICATION INFORMATION (A TELEPHONE: 650-813-5600 (B TELEFAX: 650-494-0792 (C TELEX: 706141
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Virology (AREA)
- Pulmonology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Automatic Tape Cassette Changers (AREA)
- Packaging Of Annular Or Rod-Shaped Articles, Wearing Apparel, Cassettes, Or The Like (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU56039/98A AU5603998A (en) | 1996-12-18 | 1997-12-12 | Recombinase-activatable AAV packaging cassettes for use in the production of AV vectors |
CA002269661A CA2269661A1 (en) | 1996-12-18 | 1997-12-12 | Recombinase-activatable aav packaging cassettes for use in the production of aav vectors |
EP97952436A EP0946723A1 (en) | 1996-12-18 | 1997-12-12 | Recombinase-activatable aav packaging cassettes for use in the production of aav vectors |
JP52788098A JP2001506132A (en) | 1996-12-18 | 1997-12-12 | Recombinase activatable AAV packaging cassette for use in producing AAV vectors |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US4168996P | 1996-12-18 | 1996-12-18 | |
US60/041,689 | 1996-12-18 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998027207A1 true WO1998027207A1 (en) | 1998-06-25 |
Family
ID=21917821
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/023018 WO1998027207A1 (en) | 1996-12-18 | 1997-12-12 | Recombinase-activatable aav packaging cassettes for use in the production of aav vectors |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP0946723A1 (en) |
JP (1) | JP2001506132A (en) |
AU (1) | AU5603998A (en) |
CA (1) | CA2269661A1 (en) |
WO (1) | WO1998027207A1 (en) |
Cited By (29)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000022152A1 (en) * | 1998-10-13 | 2000-04-20 | Avigen, Inc. | Compositions and methods for producing recombinant adeno-associated virus |
DE19941186A1 (en) * | 1999-08-30 | 2001-03-01 | Peter Droege | Sequence-specific DNA recombination in eukaryotic cells |
WO2001066774A1 (en) * | 2000-03-08 | 2001-09-13 | Universite De Geneve | A system to control the expression of a given gene using another gene that encodes a polypeptide with recombinant activity |
WO2002083909A2 (en) * | 2001-04-17 | 2002-10-24 | Multigen International B.V. | Recombinant nucleotide sequence coding for a gene |
US6537540B1 (en) | 1999-05-28 | 2003-03-25 | Targeted Genetics Corporation | Methods and composition for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
US6566118B1 (en) | 1997-09-05 | 2003-05-20 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
US6596535B1 (en) | 1999-08-09 | 2003-07-22 | Targeted Genetics Corporation | Metabolically activated recombinant viral vectors and methods for the preparation and use |
US6893865B1 (en) | 1999-04-28 | 2005-05-17 | Targeted Genetics Corporation | Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles |
US6924128B2 (en) | 1994-12-06 | 2005-08-02 | Targeted Genetics Corporation | Packaging cell lines for generation of high titers of recombinant AAV vectors |
WO2005077091A2 (en) | 2004-02-10 | 2005-08-25 | Trustees Of Dartmouth College | Nicotinamide riboside kinase compositions and methods for using the same |
US6989264B2 (en) | 1997-09-05 | 2006-01-24 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
US7109029B2 (en) | 2001-02-23 | 2006-09-19 | Cell Genesys, Inc. | Vector constructs |
EP1916258A2 (en) | 1999-08-09 | 2008-04-30 | Targeted Genetics Corporation | Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms instrastrand base pairs |
EP1939300A1 (en) | 1999-05-28 | 2008-07-02 | Targeted Genetics Corporation | Methods and compositions for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
WO2010109053A1 (en) | 2009-03-27 | 2010-09-30 | Proyeto De Biomedicina Cima, S.L. | Methods and compositions for the treatment of cirrhosis and liver fibrosis |
WO2011054994A1 (en) | 2009-11-05 | 2011-05-12 | Proyecto De Biomedicina Cima, S.L. | Regulated expression systems |
WO2013164793A2 (en) | 2012-05-04 | 2013-11-07 | Novartis Ag | Viral vectors for the treatment of retinal dystrophy |
WO2014165349A1 (en) | 2013-04-04 | 2014-10-09 | Trustees Of Dartmouth College | Compositions and methods for in vivo excision of hiv-1 proviral dna |
US9415119B2 (en) | 2009-05-02 | 2016-08-16 | Genzyme Corporation | Gene therapy for neurodegenerative disorders |
WO2017081204A1 (en) * | 2015-11-11 | 2017-05-18 | Targeted Transgenesis Limited | Tissue selective transgene expression |
US9873868B2 (en) | 2003-01-22 | 2018-01-23 | Duke University | Constructs for expressing lysosomal polypeptides |
US10214730B2 (en) | 2011-04-19 | 2019-02-26 | The Research Foundation For The State University Of New York | Adeno-associated-virus Rep sequences, vectors and viruses |
US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
WO2020174368A1 (en) | 2019-02-25 | 2020-09-03 | Novartis Ag | Compositions and methods to treat bietti crystalline dystrophy |
WO2020174369A2 (en) | 2019-02-25 | 2020-09-03 | Novartis Ag | Compositions and methods to treat bietti crystalline dystrophy |
US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
WO2022079082A1 (en) | 2020-10-15 | 2022-04-21 | F. Hoffmann-La Roche Ag | Nucleic acid constructs for simultaneous gene activation |
US11781116B2 (en) | 2017-02-17 | 2023-10-10 | Lonza Ltd. | Mammalian cells for producing adeno-associated viruses |
US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996017947A1 (en) * | 1994-12-06 | 1996-06-13 | Targeted Genetics Corporation | Packaging cell lines for generation of high titers of recombinant aav vectors |
WO1997006272A2 (en) * | 1995-08-03 | 1997-02-20 | Avigen, Inc. | High efficiency helper system for aav vector production |
WO1998010086A1 (en) * | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | Methods using cre-lox for production of recombinant adeno-associated viruses |
-
1997
- 1997-12-12 WO PCT/US1997/023018 patent/WO1998027207A1/en not_active Application Discontinuation
- 1997-12-12 EP EP97952436A patent/EP0946723A1/en not_active Withdrawn
- 1997-12-12 AU AU56039/98A patent/AU5603998A/en not_active Abandoned
- 1997-12-12 JP JP52788098A patent/JP2001506132A/en active Pending
- 1997-12-12 CA CA002269661A patent/CA2269661A1/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996017947A1 (en) * | 1994-12-06 | 1996-06-13 | Targeted Genetics Corporation | Packaging cell lines for generation of high titers of recombinant aav vectors |
WO1997006272A2 (en) * | 1995-08-03 | 1997-02-20 | Avigen, Inc. | High efficiency helper system for aav vector production |
WO1998010086A1 (en) * | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | Methods using cre-lox for production of recombinant adeno-associated viruses |
Non-Patent Citations (5)
Title |
---|
ANTON M ET AL: "SITE-SPECIFIC RECOMBINATION MEDIATED BY AN ADENOVIRUS VECTOR EXPRESSING THE CRE RECOMBINASE PROTEIN: A MOLECULAR SWITCH FOR CONTROL OF GENE EXPRESSION", JOURNAL OF VIROLOGY, vol. 69, no. 8, August 1995 (1995-08-01), pages 4600 - 4606, XP002011775 * |
KANEGAE Y ET AL: "EFFICIENT GENE ACTIVATION IN MAMMALIAN CELLS BY USING RECOMBINANT ADENOVIRUS EXPRESSING SITE-SPECIFIC CRE RECOMBINASE", NUCLEIC ACIDS RESEARCH, vol. 23, no. 19, 11 October 1995 (1995-10-11), pages 3816 - 3821, XP002011774 * |
KANEGAE Y ET AL: "EFFICIENT GENE ACTIVATION SYSTEM ON MAMMALIAN CELL CHROMOSOMES USING RECOMBINANT ADENOVIRUS PRODUCING CRE RECOMBINASE", GENE, vol. 181, no. 1/02, 28 November 1996 (1996-11-28), pages 207 - 212, XP000644465 * |
SNAITH M R ET AL: "Multiple cloning sites carrying loxP and FRT recognition sites for the Cre and Flp site-specific recombinases", GENE, vol. 166, no. 1, 1 January 1995 (1995-01-01), pages 173-174, XP002061817 * |
WANG P ET AL: "HIGH FREQUENCY RECOMBINATION BETWEEN LOXP SITES IN HUMAN CHROMOSOMES MEDIATED BY AN ADENOVIRUS VECTOR EXPRESSING CRE RECOMBINASE", SOMATIC CELL AND MOLECULAR GENETICS, vol. 21, no. 6, November 1995 (1995-11-01), pages 429 - 441, XP000617918 * |
Cited By (46)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6924128B2 (en) | 1994-12-06 | 2005-08-02 | Targeted Genetics Corporation | Packaging cell lines for generation of high titers of recombinant AAV vectors |
US6566118B1 (en) | 1997-09-05 | 2003-05-20 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
US6995006B2 (en) | 1997-09-05 | 2006-02-07 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
US6989264B2 (en) | 1997-09-05 | 2006-01-24 | Targeted Genetics Corporation | Methods for generating high titer helper-free preparations of released recombinant AAV vectors |
WO2000022152A1 (en) * | 1998-10-13 | 2000-04-20 | Avigen, Inc. | Compositions and methods for producing recombinant adeno-associated virus |
US6416992B1 (en) | 1998-10-13 | 2002-07-09 | Avigen, Inc. | Compositions and methods for producing recombinant adeno-associated virus |
US6893865B1 (en) | 1999-04-28 | 2005-05-17 | Targeted Genetics Corporation | Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles |
EP1939300A1 (en) | 1999-05-28 | 2008-07-02 | Targeted Genetics Corporation | Methods and compositions for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
US6537540B1 (en) | 1999-05-28 | 2003-03-25 | Targeted Genetics Corporation | Methods and composition for lowering the level of tumor necrosis factor (TNF) in TNF-associated disorders |
US7846729B2 (en) | 1999-08-09 | 2010-12-07 | Genzyme Corporation | Metabolically activated recombinant viral vectors and methods for their preparation and use |
US7125717B2 (en) | 1999-08-09 | 2006-10-24 | Targeted Genetics Corporation | Metabolically activated recombinant viral vectors and methods for their preparation and use |
US8093054B2 (en) | 1999-08-09 | 2012-01-10 | Genzyme Corporation | Metabolically activated recombinant viral vectors and methods for their preparation and use |
EP2369002A1 (en) | 1999-08-09 | 2011-09-28 | Targeted Genetics Corporation | Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms intrastrand base pairs |
US6596535B1 (en) | 1999-08-09 | 2003-07-22 | Targeted Genetics Corporation | Metabolically activated recombinant viral vectors and methods for the preparation and use |
US7785888B2 (en) | 1999-08-09 | 2010-08-31 | Genzyme Corporation | Metabolically activated recombinant viral vectors and methods for their preparation and use |
EP1916258A2 (en) | 1999-08-09 | 2008-04-30 | Targeted Genetics Corporation | Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms instrastrand base pairs |
DE19941186A1 (en) * | 1999-08-30 | 2001-03-01 | Peter Droege | Sequence-specific DNA recombination in eukaryotic cells |
EP1134287A1 (en) * | 2000-03-08 | 2001-09-19 | Universite De Geneve | A system to control the expression of a given gene using another gene that encodes a polypeptide with recombinant activity |
WO2001066774A1 (en) * | 2000-03-08 | 2001-09-13 | Universite De Geneve | A system to control the expression of a given gene using another gene that encodes a polypeptide with recombinant activity |
US7109029B2 (en) | 2001-02-23 | 2006-09-19 | Cell Genesys, Inc. | Vector constructs |
WO2002083909A2 (en) * | 2001-04-17 | 2002-10-24 | Multigen International B.V. | Recombinant nucleotide sequence coding for a gene |
NL1017852C2 (en) * | 2001-04-17 | 2002-10-29 | Multigen Holding S A | Recombinant nucleotide sequence which encodes a gene. |
WO2002083909A3 (en) * | 2001-04-17 | 2002-12-27 | Multigen Holding S A | Recombinant nucleotide sequence coding for a gene |
US9873868B2 (en) | 2003-01-22 | 2018-01-23 | Duke University | Constructs for expressing lysosomal polypeptides |
WO2005077091A2 (en) | 2004-02-10 | 2005-08-25 | Trustees Of Dartmouth College | Nicotinamide riboside kinase compositions and methods for using the same |
WO2010109053A1 (en) | 2009-03-27 | 2010-09-30 | Proyeto De Biomedicina Cima, S.L. | Methods and compositions for the treatment of cirrhosis and liver fibrosis |
US9415119B2 (en) | 2009-05-02 | 2016-08-16 | Genzyme Corporation | Gene therapy for neurodegenerative disorders |
US11975043B2 (en) | 2009-05-02 | 2024-05-07 | Genzyme Corporation | Gene therapy for neurodegenerative disorders |
US11911440B2 (en) | 2009-05-02 | 2024-02-27 | Genzyme Corporation | Gene therapy for neurodegenerative disorders |
US10369193B2 (en) | 2009-05-02 | 2019-08-06 | Genzyme Corporation | Gene therapy for neurodegenerative disorders |
WO2011054994A1 (en) | 2009-11-05 | 2011-05-12 | Proyecto De Biomedicina Cima, S.L. | Regulated expression systems |
US10214730B2 (en) | 2011-04-19 | 2019-02-26 | The Research Foundation For The State University Of New York | Adeno-associated-virus Rep sequences, vectors and viruses |
EP3326655A1 (en) | 2012-05-04 | 2018-05-30 | Novartis AG | Aav viral vectors for the treatment of rlbp1-associated retinal dystrophy |
WO2013164793A2 (en) | 2012-05-04 | 2013-11-07 | Novartis Ag | Viral vectors for the treatment of retinal dystrophy |
WO2014165349A1 (en) | 2013-04-04 | 2014-10-09 | Trustees Of Dartmouth College | Compositions and methods for in vivo excision of hiv-1 proviral dna |
WO2017081204A1 (en) * | 2015-11-11 | 2017-05-18 | Targeted Transgenesis Limited | Tissue selective transgene expression |
US10851388B2 (en) | 2015-11-11 | 2020-12-01 | Genome Biologics Ug | Tissue selective transgene expression |
US11781116B2 (en) | 2017-02-17 | 2023-10-10 | Lonza Ltd. | Mammalian cells for producing adeno-associated viruses |
US10610606B2 (en) | 2018-02-01 | 2020-04-07 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US11951183B2 (en) | 2018-02-01 | 2024-04-09 | Homology Medicines, Inc. | Adeno-associated virus compositions for PAH gene transfer and methods of use thereof |
US11306329B2 (en) | 2018-02-19 | 2022-04-19 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
US11891619B2 (en) | 2018-02-19 | 2024-02-06 | City Of Hope | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof |
WO2020174368A1 (en) | 2019-02-25 | 2020-09-03 | Novartis Ag | Compositions and methods to treat bietti crystalline dystrophy |
WO2020174369A2 (en) | 2019-02-25 | 2020-09-03 | Novartis Ag | Compositions and methods to treat bietti crystalline dystrophy |
US11952585B2 (en) | 2020-01-13 | 2024-04-09 | Homology Medicines, Inc. | Methods of treating phenylketonuria |
WO2022079082A1 (en) | 2020-10-15 | 2022-04-21 | F. Hoffmann-La Roche Ag | Nucleic acid constructs for simultaneous gene activation |
Also Published As
Publication number | Publication date |
---|---|
JP2001506132A (en) | 2001-05-15 |
EP0946723A1 (en) | 1999-10-06 |
CA2269661A1 (en) | 1998-06-25 |
AU5603998A (en) | 1998-07-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6541258B2 (en) | AAV split-packaging genes and cell lines comprising such genes for use in the production of recombinant AAV vectors | |
WO1998027207A1 (en) | Recombinase-activatable aav packaging cassettes for use in the production of aav vectors | |
US6642051B1 (en) | Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors | |
WO1998027204A9 (en) | Aav split-packaging genes and cell lines comprising such genes for use in the production of recombinant aav vectors | |
AU707866B2 (en) | Packaging cell lines for generation of high titers of recombinant AAV vectors | |
US6936466B2 (en) | Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors | |
AU688428B2 (en) | Generation of high titers of recombinant AAV vectors | |
US6924128B2 (en) | Packaging cell lines for generation of high titers of recombinant AAV vectors | |
US6893865B1 (en) | Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles | |
US20040087026A1 (en) | Host cells for packing a recombinant adeno-associated virus (raav), method for the production and use thereof | |
WO1996017947A9 (en) | Packaging cell lines for generation of high titers of recombinant aav vectors | |
AU749352B2 (en) | A conditional replication and expression system | |
AU758541B2 (en) | Amplifiable adeno-associated virus (AAV) packaging cassettes for the production of recombinant AAV vectors | |
EP1025243A2 (en) | TRANSCRIPTIONALLY-ACTIVATED AAV INVERTED TERMINAL REPEATS (ITRs) FOR USE WITH RECOMBINANT AAV VECTORS | |
US7208315B2 (en) | Compositions and methods for efficient AAV vector production | |
AU2003203790B2 (en) | Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 08981319 Country of ref document: US |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2269661 Country of ref document: CA Ref country code: CA Ref document number: 2269661 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997952436 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 56039/98 Country of ref document: AU |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 527880 Kind code of ref document: A Format of ref document f/p: F |
|
WWP | Wipo information: published in national office |
Ref document number: 1997952436 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1997952436 Country of ref document: EP |