WO1998022497A1 - Preprotachykinin-c gene encoding substance z tachykinin precursor - Google Patents

Abstract

The present invention provides a new mammalian preprotachykinin-c gene (PPT-C) which encodes a precursor protein for a new tachykinin peptide called Substance Z. Substance Z has vasodilative effects and is expressed in hematopoietic tissues. The identification and isolation of this peptide provides the basis for development of therapeutic strategies for immune disorders in which Substance Z is involved as well as for development of antibodies and antagonists for the peptide.

Description

PREPROTACHYKININ-C GENE ENCODING SUBSTANCE Z TACHYKININ PRECURSOR

Field of the Invention

This invention relates to the biologically active peptides known as tachykinins . More particularly, the invention relates to a new tachykinin gene and to a new tachykinin peptide.

Background of the Invention In the description which follows, references are made to certain literature citations which are listed at the end of the specification.

A large number of biologically active peptides have been identified in higher animals. One family of biologically active peptides is the tachykinin family.

Previously identified mammalian tachykinins are produced in the nervous system and brain and have therefore been called neurokinins. Three have been identified, namely, Substance P (SP) , Neurokinin A (NKA; also called Substance K, neurokinin α, and neuromedin L) , and

Neurokinin B (NKB; also called neurokinin β, and neuromedin K) . Other tachykinins, found in non-mammalian species, include Kassinin, Eledoisin, and Physalaemin (1,

2) . All tachykinin peptides contain the characteristic carboxy-terminal amino acid motif Phe-X-Gly-Leu-Met-NH; or

F-X-G-L-M-NH₂.

Genes which encode the three mammalian neurokinins have been described (1, 2) . One gene, PPT-A, by alternate splicing encodes three different mR A transcripts. The first of these, αPPT mRNA, encodes the precursor protein, preprotachykinin (PPT) , from which

Substance P is released by cleavage.

The other two, β-PPT and γ-PPT, encode a precursor which yields both Substance P and an additional amino acid sequence of 36 or 21 amino acids respectively.

These peptides are long forms of NKA which has 10 amino acids. Both long forms of NKA are also neurokinins. A second gene, PPT-B, encodes NKB only.

The previously described neurokinin genes are expressed primarily in the nervous system and brain. The neurokinins are released from nerve endings and act on the immune system. Release of neurokinins is associated with pain and antagonists or inhibitors of the neurokinins act as analgesics (1,2) .

A wide variety of additional bioactivities have been attributed to the neurokinins, including decrease of blood pressure, plasma extravasation, smooth muscle contraction, release of neurotransmitters, modulation of neuronal activities, a variety of hematopoietic effects and release of histamine, prostaglandins and other inflammatory mediators. These effects are mediated by one of three cellular receptors (NK-1, NK2, and NK3) which have been identified on the plasma membrane of a variety of target cells (1,2).

Summary of the Invention

The present invention provides a new mammalian gene, preprotachykinin-C (PPT-C) , which encodes a precursor protein for a new tachykinin peptide called Substance Z. The identification of Substance Z and the role of this peptide in hematopoietic cells and tissues permits the development of therapeutic strategies in order to combat certain immune disorders as well as for the development of antagonists and specific antibodies for this peptide. In accordance with an aspect of the present invention is an isolated nucleic acid comprising a nucleotide sequence encoding a mammalian preprotachykinin-C protein (PPT-C) . The nucleic acid comprises the nucleotide sequence of Sequence ID No .1. In accordance with another aspect of the present invention is a substantially pure mammalian preprotachykinin-C precursor protein comprising the amino acid sequence of Sequence ID No.2. In accordance with a further aspect of the present invention is a functional peptide fragment encoded by the amino acid sequence of Sequence ID No. 3 and designated Substance Z tachykinin peptide. In accordance with another aspect of the present invention is a substantially pure preparation of mammalian Substance Z tachykinin peptide or a functional fragment or analogue thereof.

In accordance with a further aspect of the present invention is a functional peptide fragment encoded by the amino acid sequence of Sequence ID No .4 and designated Substance Z short tachykinin peptide.

In accordance with another aspect of the present invention is a substantially pure preparation of mammalian Substance Z short tachykinin peptide or a functional fragment or analogue thereof.

In accordance with another aspect of the invention is an antibody which selectively binds to an antigenic determinant of a protein or peptide of Sequence ID No .2. In accordance with another aspect of the present invention is a transgenic animal comprising a nucleic acid encoding a mammalian preprotachykinin-C protein. In accordance with another aspect of the present invention is a method for screening a candidate compound for effectiveness as an antagonist of Substance Z comprising:

(a) providing an assay method for determining a biological activity of Substance Z; and

(b) determining the biological activity of Substance Z in the presence or absence of the candidate compound, wherein a reduced biological activity in the presence of the candidate compound indicates antagonist activity of the compound. In accordance with another aspect of the present invention is a method for treating in a mammal a disorder associated with an undesired biological activity of Substance Z comprising administering to the mammal an effective amount of a Substance selected from the group consisting of:

(a) a Substance Z antagonist;

(b) an antibody which binds specifically to Substance Z; and (c) an antisense strand comprising a nucleic acid sequence complementary to the sequence or fragment of the sequence encoding Substances and capable of hybridizing to the nucleic acid sequence encoding Substance Z; and (d) an agent which down regulates the expression of the PPT-C gene encoding for Substance Z. According to another aspect of the present invention is a method for suppressing in a mammal, the proliferation of a cell capable of being stimulated to proliferate by Substance Z, the method comprising administering to the mammal an effective amount of a Substance Z antagonist or an antibody which binds specifically to Substance Z.

According to yet another aspect of the present invention is a method for alleviating pain in a mammal associated with the over production of Substance Z, said method comprising administering to the mammal an effective amount of a Substance Z antagonist or an antibody which binds specifically to Substance Z. According to a further aspect of the present invention is a method for producing vasodilation in a mammal in need of such treatment, said method comprising administering to the mammal an effective amount of Substance Z or an active analogue or fragment thereof, or a mimetic of Substance Z.

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

Summary of Drawings

Certain embodiments of the invention are described with reference being made to the accompanying drawings, wherein:

Figure 1 shows a Northern blot of poly (A) ⁺ RNA from the following cell lines and tissues:

70Z/3: Pre-B cell line; 70Z/3y: RAG-2 positive variant of 70Z/3; IIB4 CB17 1.1 and 5.1 are fetal liver cell lines transformed with Abelson murine leukemia virus; scid 2.1 and 4.1, RAG1-14 and -17, RAG2-5 and 21 are derived from bone marrow lines transformed with Abelson murine leukemia virus; EHI 231: immature B cell line; J558: myeloma cell line; RBL 5 and EL4 : T lymphoma cells; P338D1 yeloid lineage cell line; CB 5: erythroid lineage cell line; NIH 3Y3 and L929: fibroblast cell lines; BMS 2.2: stromal cell line.

Tissues were normal mouse tissues. Figure 2 shows the effect of Substance Z on murine mast cell degranulation. X axis is concentration of Substance Z (μM) and Y axis is mast cell degranulation expressed as % labelled serotonin release.

Figure 3 shows the activity of Substance Z on human synovial fibroblasts in a cartilage degradation assay. X axis: Sample numbers. Bars indicate % labelled glycosaminoglycans released from cartilage disc.

Figure 4 shows the effect of various concentrations of Substance Z on the proliferation of murine leukemia cells, proliferation expressed as colonies per 500 plated cells .

Figure 5 shows plasma extravasation induced by Substance Z in comparison with Substance P. Numbers on X axis indicate the concentrations of the peptides administered (Substance P or Z/antagonist in nM) .

Numbers on Y axis indicate the relative response, which was scored on a scale 0-3 (0-none, 1-minimum, 2-medium, 3 -maximum) .

Detailed Description of the Invention

The inventors have identified a new mammalian gene, designated preprotachykinin-C { PPT-C) , which encodes a precursor protein for a previously undescribed tachykinin peptide, designated Substance Z.

The cDNA sequence of the mouse PPT-C gene (Sequence ID No : 1 ) is shown in Table 1. It comprises a sequence of 1249 nucleotides including an open reading frame encoding a sequence of 128 amino acids. The start codon is underlined in Table 1. A portion of the genomic sequence of the mouse PPT-C gene is shown in Table 2.

The deduced amino acid sequence (Sequence ID No: 2) of the new precursor protein, designated Substance Z precursor protein, is shown in Table 3. Its structure shows it to be a typical tachykinin precursor protein.

The Substance P precursor protein preprotachykinin, for example, includes the amino acid sequence of Substance P, flanked by cleavage sites which are acted on by proteolytic enzymes known as convertases to release Substance P. The processing pathway has been described by Harris and Steiner et al. (3,4) . Cleavage takes place at a doublet of basic amino acids, such as Lys-Arg or Arg-Arg.

Harris has proposed two basic types of recognition sequence for endoproteolysis : 1) a monobasic amino acid in close proximity to a cleavage doublet of basic amino acids; or 2) a strongly polar amino acid (Glu or Asp) in close proximity to a cleavage doublet of basic amino acids. The neurokinin Substance P is an example of the first type, with an Arg in front of the cleavage doublet.

For this type of recognition sequence, cleavage may occur either between the amino acids of the doublet (like Substance P) or after the doublet.

Neurokinin A is an example of the second type, with a Glu residue in front of the doublet. For the second type, cleavage usually occurs after the doublet. Preprotachykinin-C or Substance Z precursor protein has cleavage sites at amino acids 55/56 and amino acids 68/69 (underlined in Table 3); these cleavage sites flank a putative peptide having the carboxy terminal motif FXGLM-NH₂ characteristic of all known tachykinins.

The recognition sequence N terminal to the putative tachykinin could be classified as either type described by Harris.

By analogy with the other tachykinin precursor proteins, it is predicted that Substance Z precursor protein is cleaved either within the amino acid doublet 55/56 (KR) , to give the 11 amino acid peptide RSRTRQFYGLM-NH₂ (Sequence ID No .3 and designated herein Substance Z) or C terminal to the second basic amino acid of the doublet, to give the 10 amino acid peptide

SRTRQFYGLM-NH₂ (Sequence ID No .4 and designated Substance Z-short form) . Both Substance Z and Substance Z-short form have been demonstrated to have the same biological activity in vi tro and in vivo . The characteristic tachykinin carboxy terminal motif of Substance Z is shown above in bold type. The remainder of its amino acid sequence differs from previously described tachykinins, as seen in Table 4. Substance Z precursor protein also differs considerably from the precursors of the previously described mammalian tachykinins .

Also included in the scope of the invention are fragments or analogues of the 11 amino acid peptide Substance Z, including the 10 amino acid peptide, Substance Z-short form, which are agonists retaining the biological activity of Substance Z or act as antagonists of Substance Z.

By analogy with studies on Substance P, it is predicted that up to about four N terminal amino acids may be deleted from Substance Z while retaining full or partial agonist activity. The amino acid sequence comprising the tachykinin carboxy terminal motif is likely to be useful as an antagonist of Substance Z activity .

Fragments or analogues of Substance Z may be conveniently screened for their effectiveness as agonists or antagonists. For example, agonist activity may be assessed in the cartilage degradation assay described herein. Identification of antagonists is discussed further below.

The PPT-C gene appears to be expressed in hematopoietic cells, for example but not limited to, pre- B cells, but not in tissues such as brain, lung, heart, adult liver and kidney, as can be seen in Figure 1. PPT- C expression has also been found in isolated fetal liver cells, where gene expression was increased by administration of IL-7 which stimulates progenitor cells within the fetal liver.

Substance Z is demonstrated to cause vasodilation and decrease of blood pressure which is the first and the best known in vivo activity observed for tachykinins. Previous studies have demonstrated that tachykinins exert the hypotensive function by inducing arterial vessel dilatation and plasma extravasation (46) . Synthetic Substance Z peptide intravenously injected into mice with Evan' s blue dye demonstrated the plasma extravasation effect of this Substance (Figure 5) . Plasma extravasation was manifested by leakage of the dye into the tissue. At all of the concentrations tested, Substance Z induced a general blueing of the extremities, particularly the front and hind feet. No major difference was found between Substance Z and Substance P in their relative potency.

The following embodiments of the present invention are provided. 1. Isolated Nucleic Acids

In accordance with one series of embodiments, the present invention provides isolated nucleic acids corresponding to, or related to, the PPT-C nucleic acid sequence disclosed herein. In accordance with a first embodiment, an isolated nucleic acid sequence is provided which encodes preprotachykinin-C precursor protein or the tachykinin peptide Substance Z. The invention includes degeneracy equivalents of the disclosed nucleic acid sequences and sequences which hybridize to the disclosed sequences under stringent conditions.

In one embodiment, the invention provides a cDNA sequence encoding murine preprotachykinin-C precursor protein comprising the nucleotide sequence of Sequence ID NO:l.

In addition to the disclosed nucleic acid sequences, one of ordinary skill in the art is now enabled to identify and isolate nucleic acids representing PPT-C genes or cDNAs allelic to the disclosed sequences or which are homologues of the disclosed sequences. One of ordinary skill in the art may now screen preparations of genomic or cDNA from any selected organism, including humans, other mammals, bacteria, viruses or yeasts or from genomic or cDNA libraries, using probes or PCR primers to identify allelic or homologous sequences.

In particular, the present invention enables the identification of the human homologue of the murine gene identified herein. It is also contemplated that additional PPT-C nucleic acid sequences will be isolated from human subjects suffering from a variety of disorders, enabling the identification of gene mutations which may contribute to these disorders.

Additionally, homologues of the mammalian PPT-C gene identified in lower organisms such as yeast, invertebrates or insects, may provide suitable means for agent screening.

As will be understood by those in the art, allelic or homologous nucleic acid sequences may be identified and isolated using standard hybridization screening or

PCR techniques, using short portions of the nucleic acid sequences disclosed herein. The present invention further provides portions of the disclosed nucleic acid sequences which are useful as probes and PCR primers, for example for identification of homologous genes, or for encoding fragments, functional domains or antigenic determinants of Substance Z precursor protein or for encoding Substance Z peptide or active fragments thereof.

The invention also provides portions of the disclosed nucleic acid sequences comprising about 10 consecutive nucleotides, (for use as probes, for example) to nearly the complete disclosed nucleic acid sequences. The invention provides isolated nucleic acid sequences corresponding to at least 10, preferably at least 15 and more preferably at least 20 consecutive nucleotides of the nucleotide sequences disclosed or enabled herein or their complements.

The invention further provides recombinant vectors comprising the disclosed nucleic acids and portions thereof and host cells comprising such vectors, for use in production of the peptides or proteins disclosed herein, as more fully described below.

2. Substantially Pure Proteins

The present invention further provides for substantially pure preparations of Substance Z precursor protein or fragments thereof. In a preferred embodiment of the invention, substantially pure preparations of Substance Z peptide or Substance Z-short form peptide are provided for uses described herein. Substance Z precursor protein, Substance Z peptide and Substance Z-short form peptide may be produced by recombinant methods or by chemical methods, as will be understood by those skilled in the art.

In accordance with a further series of embodiments, this invention provides substantially pure mammalian Substance Z peptide Substance Z short-form peptide or precursor protein, fragments of these proteins and peptides and fusion proteins including these proteins and peptide fragments.

The proteins and peptide fragments and fusion proteins have utility, as described herein, for the preparation of polyclonal and monoclonal antibodies to mammalian Substance Z peptides, for the identification of binding partners of the mammalian Substance Z peptide and for diagnostic and therapeutic methods, as described herein. For these uses, the present invention provides substantially pure peptides or derivatives of such peptides which comprise portions of mammalian Substance Z amino acid sequences disclosed or enabled herein and which may vary from as little as about 1 or 2 amino acids (e.g. for use as immunogens) to the complete amino acid sequence of the peptides. The invention provides substantially pure peptides comprising sequences corresponding to at least 5 consecutive amino acids of the mammalian Substance Z peptide or precursor protein disclosed or enabled herein. The peptides of the invention may be isolated and purified by any conventional method suitable in relation to the properties revealed by the amino acid sequences of these peptides and proteins.

Alternatively, cell lines may be produced which overexpress the PPT-C gene product, allowing purification of the proteins and cleaved peptides for biochemical characterization, large-scale production, antibody production, for use in assays and for patient therapy. For protein expression, eukaryotic and prokaryotic expression systems may be generated in which a PPT-C gene sequence is introduced into a plasmid or other vector which is then introduced into living cells. Constructs in which the PPT-C cDNA sequence containing the entire open reading frame is inserted in the correct orientation into an expression plasmid may be used for protein expression. Alternatively, portions of the sequence may be inserted. Prokaryotic and eukaryotic expression systems allow various important functional domains of the protein to be recovered as fusion proteins and used for binding, structural and functional studies and also for the generation of appropriate antibodies.

Typical expression vectors contain promoters that direct the synthesis of large amounts of mRNA corresponding to the gene. They may also include sequences allowing for their autonomous replication within the host organism, sequences that encode genetic traits that allow cells containing the vectors to be selected, and sequences that increase the efficiency with which the mRNA is translated. Stable long-term vectors may be maintained as freely replicating entities by using regulatory elements of viruses. Cell lines may also be produced which have integrated the vector into the genomic DNA and in this manner the gene product is produced on a continuous basis.

Expression of foreign sequences in bacteria such as E. coli require the insertion of the sequence into an expression vector, usually a plasmid which contains several elements such as sequences encoding a selectable marker that assures maintenance of the vector in the cell, a controllable transcriptional promoter which upon induction can produce large amounts of mRNA from the cloned gene, translational control sequences and a polylinker to simplify insertion of the gene in the correct orientation within the vector. A relatively simple E. coli expression system utilizes the lac promoter and a neighboring lacZ gene which is cut out of the expression vector with restriction enzymes and replaced by the PPT-C gene sequence. In vi tro expression of proteins encoded by cloned DNA is also possible using the T7 late-promoter expression system. Plasmid vectors containing late promoters and the corresponding RNA polymerases from related bacteriophages such as T3, T5 and SP6 may also be used for in vi tro production of proteins from cloned DNA. E. coli can also be used for expression by infection with M13 Phage mGPI-2. E. coli vectors can also be used with phage Lambda regulatory sequences, by fusion protein vectors, by maltose-binding protein fusions, and by glutathione-S-transferase fusion proteins .

Eukaryotic expression systems permit appropriate post-translational modifications to expressed proteins. This allows for studies of the PPT-C gene and gene products including determination of proper expression and post-translational modifications for biological activity, identifying regulatory elements in the 5' region of the gene and the role in tissue regulation of protein expression. It also permits the production of large amounts of normal proteins for isolation and purification, to test the effectiveness of pharmacological agents or as a component of a signal transduction system to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring polymorphisms and artificially produced mutated proteins.

The PPT-C DNA sequences can be altered using procedures such as restriction enzyme digestion, DNA polymerase fill-in, exonuclease deletion, terminal deoxynucleotide transferase extension, ligation of synthetic or cloned DNA sequences and site-directed in vi tro utagenesis, including site-directed sequence alteration using specific oligonucleotides together with PCR.

Once the appropriate expression vector containing the selected gene is constructed, it is introduced into an appropriate host cell by transformation techniques including calcium phosphate transfection, DEAE-dextran transfection, electroporation, microinj ection, protoplast fusion and liposome-mediated transfection.

The host cell which may be transfected with the vector of this invention may be selected from the group consisting of E. Coli , Pseudomonas , Bacillus subtilis, or other bacilli, other bacteria, yeast, fungi, insect (using baculoviral vectors for expression) , mouse or other animal or human tissue cells. Mammalian cells can also be used to express the PPT-C precursor protein and/or peptides using a vaccinia virus expression system.

Methods for producing appropriate vectors, for transforming cells with those vectors and for identifying transformants are described in the scientific literature, as for example but not limited to Sambrook et al . (1989), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. or the latest edition thereof. The cellular distribution of the PPT-C gene product (s) in tissues can be analyzed by reverse transcriptase PCR analysis. Antibodies can also be generated for several applications including both immunocytochemistry and immunofluorescence techniques to visualize the proteins directly in cells and tissues in order to establish the cellular location of the proteins.

3. Peptides

In accordance with a further and more preferred series of embodiments, the invention provides Substance Z peptide and fragments or analogues thereof which retain a biological activity of Substance Z peptide or are antagonists of Substance Z peptide activity.

Substance Z or fragments or analogues thereof may be prepared by any suitable peptide synthetic method.

Chemical synthesis may be employed, for example standard solid phase peptide synthetic techniques may be used. In standard solid phase peptide synthesis, peptides of varying length can be prepared using commercially available equipment. This equipment can be obtained from Applied Biosystems (Foster City, CA. ) . The reaction conditions in peptide synthesis are optimized to prevent isomerization of stereochemical centres, to prevent side reactions and to obtain high yields. The peptides are synthesized using standard automated protocols, using t-butoxycarbonyl-alpha-amino acids, and following the manufacturer's instructions for blocking interfering groups, protecting the amino acid to be reacted, coupling, deprotecting and capping of unreacted residues. The solid support is generally based on a polystyrene resin, the resin acting both as a support for the growing peptide chain, and as a protective group for the carboxy terminus. Cleavage from the resin yields the free carboxylic acid. Peptides are purified by HPLC techniques, for example on a preparative C18 reverse phase column, using acetonitrile gradients in 0.1% trifluoroacetic acid, followed by vacuum drying. The peptides of the invention may also be produced by recombinant synthesis. A DNA sequence encoding the desired peptide is prepared, for example by cloning the required fragment from the DNA sequence encoding the complete precursor protein, and subcloning into an expression plasmid DNA. Suitable mammalian expression plasmids include pRC/CMV from InVitrogen Inc. The gene construct is expressed in a suitable cell line, such as a Cos or CHO cell line and the expressed peptide is extracted and purified by conventional methods. Suitable methods for recombinant synthesis of peptides are readily available (5) .

Analogues of Substance Z may be prepared by similar synthetic methods. The term "analogue" extends to any functional and/or chemical equivalent of Substance Z and includes peptides having one or more conservative amino acid substitutions, peptides incorporating unnatural amino acids and peptides having modified side chains.

Examples of side chain modifications contemplated by the present invention include modification of amino groups such as by reductive alkylation by reaction with an aldehyde followed by reduction with NaBH₄; amidation with methylacetimidate; acetylation with acetic anhydride; carbamylation of amino groups with cyanate; trinitrobenzylation of amino groups with 2, 4, 6, trinitrobenzene sulfonic acid (TNBS) ; alkylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyridoxylation of lysine with pyridoxal- 5' phosphate followed by reduction with NaBH₄. The guanidino group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as 2, 3-butanedione, phenylglyoxal and glyoxal. The carboxyl group may be modified by carbodiimide activation via -acylisourea formation followed by subsequent derivatisation, for example, to a corresponding amide.

Tyrosine residues may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative. Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, but are not limited to, use of norleucine, 4-amino butyric acid, 4- amino-3-hydroxy-5-phenylpentanoic acid, 6-aminohexanoic acid-, t-butylglycine, norvaline, phenylglycine, ornithine, sarcosine, 4-amino-3-hydroxy-6-methylheptanoic acid, 2-thienyl alanine and/or D-isomers or amino acids.

Examples of conservative amino acid substitutions are substitutions within the following five groups of amino acids:

Group 1 F Y W

Group 2 V L I

Group 3 H K R

Group 4 M S T P A G Group 5 D E

For creation of antagonist compounds, C terminal residues are frequently susceptible targets. For illustrative example only, in Substance Z, Phe and/or Gly may be substituted with D-Trp and/or Met may be substituted with Leu.

Additionally, metabolically stable, non-peptide small molecules may be useful Substance Z antagonists, by analogy with the previous described non-peptide antagonists of Substance P (1) .

4. Antibodies

The present invention also provides antibodies, and methods of making antibodies, which selectively bind to Substance Z precursor protein (Sequence ID No .2 ) , Substance Z (the 11 amino acid peptide, Seq. ID No.3) and the Substance Z-short form (the 10 amino acid peptide, Seq. ID No .4 ) . The antibodies of the invention may be polyclonal or monoclonal, or may be antibody fragments, including Fab fragments and single chain antibody fragments. In addition, recombinant antibodies may be generated, as well as humanized antibodies based upon non-human antibodies to Substance Z. Antibody preparation techniques are generally described in references such as Antibody Engineering: A Practical Guide, (6), or Antibody Engineering, (7) .

In order to prepare polyclonal antibodies to Substance Z, Substance Z peptide may be conjugated to a carrier protein or may be expressed recombinantly as a fusion protein which contains the peptide sequence of Substance Z.

Preferably, the carrier protein or fused protein is conjugated to the carboxy terminal end of Substance Z peptide .

E. coli expression systems such as lacZ fusions using the pUR series of vectors and trpE fusions using the pATH vectors may, for example, be used to produce Substance Z fusion proteins. The expressed protein can then be purified, coupled to a carrier protein if desired, and mixed with Freund's adjuvant and injected into rabbits or other appropriate laboratory animals. Following booster injections at weekly intervals, the rabbits or other laboratory animals are then bled and the sera isolated. The sera can be used directly or purified by conventional methods, such as affinity chromatography. The sera can be used as probes to identify Substance Z on gels of protein extracts from cells and tissues. Monoclonal antibodies (MAbs) against Substance Z may be raised in a number of animals, such as mice. Methods for making MAbs are well known and are described in publications such as that by Harlow and Lane (8) . As an example, one such method is described.

Substance Z is first coupled with the carrier protein, keyhole limpet haemocyanin, using carbodimide. The peptide-protein conjugate is then separated from free peptide by dialysis. The conjugate is injected into mice (typically 2-6 mice) at a dose of 50μg per mouse with complete Freund's adjuvant. At two-week intervals, the mice receive a second and third booster. Test bleeds are performed 10 days after each booster to assess the development of the antibody response to Substance Z. Antibody capture enzyme immunoassay may be used to determine the anti-Substance Z antibody titer. In one embodiment of this assay, polyvinylchloride wells are coated with 50μl of synthetic Substance Z at a concentration of 2mg/ml . The wells are then blocked with 3% BSA/PBS. Serum obtained from the immunized mice is serially diluted and 50μl of samples of each dilution are added to the wells. Unbound antibodies are removed by washing and the presence of mouse anti-Substance Z antibodies is then detected using horseradish peroxidase- labelled rabbit anti-mouse immunoglobulin antibody. The antibody titer is determined by the highest dilution of the serum which shows the presence of anti-Substance Z antibodies . A mouse with a high anti-Substance Z titer is selected for hybridoma production. After a final booster, spleen cells are obtained from the mouse and fused with myeloma cells such as sp2/0. Following fusion, the resultant hybridoma cells are diluted and plated in multi-well culture dishes. Supernatants of the cultures are screened for the presence of anti-Substance Z antibodies. Cells from positive wells are single-cell cloned. MAbs produced by these cloned hybridoma lines may be harvested from tissue culture supernatants or ascitic fluid.

Production of monoclonal antibodies as starting materials for obtaining humanised antibodies is well known (9) . There are several examples of humanisation of MAbs in the literature (10). Typically, a humanised antibody contains a binding portion obtained from non- human cells (e.g., mouse cells) and one or more human portions, particularly framework portions of antibody obtained from human sources. Particular examples are offered in the patent literature; United States Patent No. 5,558,864, issued September 24, 1996 to Bendig et al . described humanised and chimeric anti-epidermal growth factor receptor monoclonal antibodies; and United States Patent No. 5,482,856, issued January 9, 1996 to Fell, Jr. et al . described production of chimeric antibodies by homologous recombination. The specifications of both of these patent references and references mentioned therein are incorporated herein by reference.

Once a humanised antibody is obtained, it should be tested in one or more animal models (11-16) . Testing for toxic effects should also be conducted. For example, a single dosage (between 0.1 and 1 mg per kilogram of body weight) of antibody is administered mtraperitoneally to mice and/or guinea pigs. The animals are observed for a week or so for adverse effects such as weight change and other obvious signs of toxicity. Immunohistological studies involving human tissues can be carried out. For example, the reactivity of an antibody is evaluated using immunoperoxidase staining on a variety of normal human tissues. High dosage pharmacology/toxicology studies in adult chimpanzees can be carried out. Analysis of blood chemistry, hematology, and urinalysis is conducted. Further, an assay for immunocompetence is conducted. Animals are challenged with different strengths of dinitrochlorobenzene in acetone and the extent of response to DNCB is evaluated.

A dosage regimen used for treating a patient will be determined by the attending physician considering various factors which affect drug action, e.g., the condition, body weight, sex and diet of the patient, the severity of the disease, time of administration and other clinical factors. For example, for treatment of rheumatoid arthritis, a recommended dosage is likely to be in the range of 10 to 100 mg, over a period of a week or so (17) . Such recommendation must be based on an objective study, and particularly a study which measures the level of agent in patient serum over time. Development of recommended dosages would likely be preceded by analysis of plasma levels of MAb in chimpanzees.

The antibodies of the invention may be labelled or conjugated for diagnostic and/or therapeutic uses. For example, they may be coupled to radionuclides, fluorescent compounds, enzymes or toxic molecules for imaging or therapy or may be incorporated into liposomes for targeting to a specific tissue site. The antibodies of the invention have utility, for example, for Western blotting to identify cells or tissues expressing the PPT-C gene or immunocytochemistry or immunofluoresence techniques to identify the subcellular location of the precursor protein. Antibodies may also be utilized in bioassays to identify the presence of Substance Z or Substance Z binding partners such as Substance Z cell receptors.

Additionally, the antibodies of the invention may be used as therapeutic agents to selectively bind and inhibit the activity of Substance Z peptide or Substance Z short form peptide for treatment of disorders associated with excess or inappropriate production of Substance Z. For example, cancer cells such as leukemia cells, whose growth is stimulated by Substance Z, may be inhibited or suppressed by administration of antibodies against Substance Z.

Similarly, any cell type which is dependent for growth or activation on stimulation by Substance Z may be controlled by administration of anti-Substance Z antibodies. 5. Transgenic Animal Models

The present invention also provides for the production of transgenic non-human animal models for the study of the effects of over expression of the PPT-C gene and over-production of Substance Z, for the screening of candidate compounds as potential antagonists of Substance Z and for the evaluation of potential therapeutic interventions .

The transgenic animals of the invention also provide models of disease conditions associated with abnormalities of Substance Z production. For example, the transgenic animals of the invention may provide an animal model of at least some aspects of rheumatoid arthritis . Animal species suitable for use in the animal models of the invention include mice, rats, rabbits, dogs, cats, goats, sheep, pigs and non-human primates.

Animal models may be produced by inserting a selected nucleic acid sequence into a germ line cell or a stem cell using previously described techniques such as oocyte microinjection or transfection or microinj ection into embryonic stem cells. Alternatively, an endogenous PPT-C gene may be inactivated or replaced by homologous recombination within embryonic stem cells to produce "knock-out" or "knock-in" animal models. Techniques for obtaining transgenic animals are widely available in the literature. For example, laboratory techniques for the production of transgenic mice is described in Hogan et al. (18) and Capecchi (46). In accordance with one embodiment of the invention, transgenic animals generated by the introduction of a PPT-C transgene into a fertilized animal oocyte, with subsequent growth of the embryo to birth as a live animal. The PPT-C transgene is a transcription unit which directs the expression of PPT-C gene in eukaryotic cells. To create the transgene, PPT-C gene is ligated with an eukaryotic expression module. The basic eukaryotic expression module contains a promoter element to mediate transcription of PPT-C sequences and signals required for efficient for termination and polyadenylation of the transcript. Additional elements of the module may include enhancers which stimulate transcription of PPT-C sequences. The most frequently utilized termination and polyadenylation signals are those derived from SV40 (5) . The choice of promoter and enhancer elements to be incorporated into the PPT-C transgene is determined by the cell types in which PPT-C gene is to be expressed. To achieve expression in a broad range of cells, promoter and enhancer elements derived from viruses may be utilized, such as the herpes simplex virus thymidine kinase promoter and polyoma enhancer (19) . To achieve exclusive expression in a particular cell type, such as B cells, specific promoter and enhancer elements could be used, such as the promoter of the mb-1 gene and the intronic enhancer of the immunoglobulin heavy chain gene (20) .

The PPT-C transgene is inserted into a plasmid vector, such as pBR322 for amplification. The entire PPT- C transgene is then released from the plasmid by enzyme digestion, purified and injected into an oocyte. The oocyte is subsequently implanted into a pseudopregnant female animal. Southern blot analysis or other approaches are used to determined the genotype of the founder animals and animals generated in the subsequent backcross and intercross.

The PPT-C nucleic acid sequences of the invention may also be utilized in the creation of transgenic mice deficient in the production of Substance Z by homologous recombination.

Methods of disrupting the genes of an animal are well established and are described in publications such as Kitamura et al . (21) . As the first step, the genomic sequence which gives rise to the PPT-C mRNA is pulled out by screening a mouse genomic library with the PPT-C cDNA molecule as a probe. A fragment containing the coding sequence for Substance Z peptide and some flanking sequences is cloned into a plasmid vector such as pBR322 or any other suitable vector such as a bluescript vector. A lkb pMClneo fragment containing the neomycin resistant gene is then inserted into the sequences encoding Substance Z peptide. This resultant construct is linearized, and introduced into D3 embryonic stem (ES) cells by electroporation. Neomycin-resistant colonies are selected and expanded. Homologous recombination events are identified by PCR and Southern blotting. ES cell clones carrying the disrupted PPT-C genes are injected into blastocysts of C57BL/6 mice, and the resulting male chimeras are mated to C57BL/6 females. Agouti offspring are analyzed by Southern blotting for the presence of the mutant PPT-C gene. Heterozygous mice are intercrossed, and homozygous PPT-C-mutant mice are identified by Southern blotting.

These mice will provide a model for study of the effects of Substance Z deficiency and the interrelationship between Substance Z and other factors in maintenance of health, including the maintenance of a normal immune response. These animals will also provide tools for screening candidate compounds for their interaction with Substance Z or the signalling pathway activated by Substance Z.

6. Pharmaceutical Compositions

In a further embodiment, the invention provides pharmaceutical compositions comprising Substance Z or a functional analogue or mimetic of Substance Z for the treatment of certain disorders characterized by abnormal immune responses and which require vasodilative effects. Such disorders may include but are not limited to Raynauds Syndrome, lupus, schleroderma, cryoglobulinemia or for general vasodilative effects such as is provided by prostacyclins . Such compositions may also have use for the treatment of stroke and related disorders wherein profound vasoconstriction follows the initial clinical event and rapid vasodilation is required. Such compositions as provided herein can be appropriately packaged and targeted to specific cells and/or tissues.

Administration of a therapeutically active amount of a pharmaceutical composition of the present invention means an amount effective, at dosages and for periods of time necessary to achieve the desired result. This may also vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the mammalian Substance Z peptide to elicit a desired response in the subject. Dosage regima may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. By pharmaceutically acceptable carrier as used herein is meant one or more compatible solid or liquid delivery systems. Some examples of pharmaceutically acceptable carriers are sugars, starches, cellulose and its derivatives, powdered tragacanth, malt, gelatin, collagen, talc, stearic acids, magnesium stearate, calcium sulfate, vegetable oils, polyols, agar, alginic acids, pyrogen-free water, isotonic saline, phosphate buffer, and other suitable non-toxic Substances used in pharmaceutical formulations. Other excipients such as wetting agents and lubricants, tableting agents, stabilizers, anti-oxidants and preservatives are also contemplated.

The compositions described herein can be prepared by known methods for the preparation of pharmaceutically acceptable compositions which can be administered to subjects, such that an effective quantity of the active Substance is combined in a mixture with a pharmaceutically acceptable carrier. Suitable carriers and formulations adapted for particular modes of administration are described, for example, in Remington' s Pharmaceutical Sciences (Remington' s Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., USA 1985) . On this basis the compositions include, albeit not exclusively, solutions of the Substance in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso-osmotic with the physiological fluids.

The pharmaceutical compositions of the invention may be administered therapeutically by various routes such as by injection or by oral, nasal, buccal, rectal, vaginal, transdermal or ocular routes in a variety of formulations, as is known to those skilled in the art.

7. Screening for Drugs Which Affect Expression of the PPT-C Gene

The present invention also enables the analysis of factors affecting the expression of the PPT-C gene in humans or in animal models. The invention further provides a system for screening candidate compounds for their ability to turn on or turn off expression of the PPT-C gene. For example, pre-B cells may be isolated from a mammal and grown in culture in the presence of IL-7 (43- 45) . Such a cell culture system can be used to identify compounds which activate production of Substance Z or, once Substance Z production has been activated in the cells, they can be used to identify compounds which lead to suppression or switching off of Substance Z production.

Compounds thus identified are useful as therapeutics in conditions where Substance Z production is deficient or excessive.

8. Identification of Antagonists

The present invention enables also a screening method for compounds of therapeutic utility as antagonists of the biological activity of Substance Z. Such antagonist compounds are useful, for example, to reduce or prevent tissue damage resulting from activation of synovial fibroblasts by Substance Z, for example in conditions such as rheumatoid arthritis, and to reduce or prevent symptoms or tissue damage resulting from mast cell activation by Substance Z, for example in conditions such as acute allergy or inflammation. Substance Z antagonists may also be used in the treatment of pain as it has been suggested that tachykinins may stimulate pain. Blocking the action of Substance Z by the use of an antagonist may therefore act to reduce levels of pain. Those skilled in the art will be able to devise a number of possible screening methods for screening candidate compounds for Substance Z antagonism.

For example, candidate compounds may be screened for biological activity and for antagonist activity in the cartilage degradation assay described herein. A screening method may also be based on binding to the Substance Z receptor. Such competitive binding assays are well known to those skilled in the art. Once binding has been established for a particular compound, a biological activity assay is employed to determine agonist or antagonist potential.

9. Diagnostic Methods

The present invention enables the identification of disorders associated with overproduction or underproduction of Substance Z by assay of Substance Z in appropriate tissue samples.

Substance Z may be assayed by a variety of methods, immunoassay being preferred. Many types of immunoassay are described in the literature. For example, radioimmunoassay may be employed (22) .

In accordance with one embodiment, Substance Z is labelled with ¹²⁵I by chloramine T, as described in Example 1, for use in radioimmunoassay.

A lOOμl aliquot of serially diluted Substance Z standard or sample is mixed with lOOμl of ¹²⁵I-labelled Substance Z and lOOμl of a dilution of anti-Substance Z MAb that gives approximately 50% binding in the absence of unlabelled peptide. One ml. of a mixture of 6mg/ml Norit A (Amend Drug and Chemical, Irvington, NJ) and 0.75mg/ml Dextran 70 in 0.25% BSA-Dulbecco ' s PBS buffer is added. The tubes are vortexed and centrifuged. A 1ml aliquot is counted in a gamma counter. Standard concentration is plotted against (cpm bound in the presence of standard) / (cpm bound in the absence of standard) . Concentration of Substance Z in tissue samples is determined by reference to the standard curve. A normal range of Substance Z levels is obtained by assay of a number of normal subject tissue samples, as is understood by those skilled in the art.

10. Therapeutic Methods The present invention further enables therapeutic intervention in disorders associated with an inappropriate level or location of Substance Z. Such interventions include; (a) in conditions associated with undesired biological activity of Substance Z, inhibition of its activity by administration of antagonist compounds, anti- Substance Z antibodies administration of targeted agents to down-regulate PPT-C gene expression or alternatively antisense methods to inhibit PPT-C gene function. Substance Z can be conjugated with selected toxic and target molecules to target specific tissues inappropriately over producing Substance Z and to induce cell death.

For example, tumour cells whose growth is responsive to Substance Z may be inhibited or suppressed by administration of Substance Z antagonists.

In conditions such as rheumatoid arthritis, acute allergy or inflammation, where cells are activated to produce Substance Z leading to tissue damage, therapeutic intervention may be achieved by administration of

Substance Z antagonists to reduce Substance Z activity. (b) conditions associated with a deficiency of Substance Z may be treated by administration of pharmaceutical compositions including Substance Z. Substance Z (both long and short form) or therapeutically effective analogues or fragments thereof may be administered therapeutically by injection or by oral, nasal, buccal, rectal, vaginal, transdermal or ocular routes in a variety of formulations, as is known to those in the art. For oral administration of peptides, various techniques can be used to improve stability, based for example on chemical modification, formulation and use of protease inhibitors. Stability can be improved if synthetic amino acids are used, such as peptoids or betidamino acids, or if metabolically stable analogues are prepared.

Formulation may be, for example, in water/oil emulsion or in liposomes for improved stability. Oral administration of peptides may be accompanied by protease inhibitors such as aprotinin, soybean trypsin inhibitor or FK-448, to provide protection for the peptide. Suitable methods for preparation of oral formulations of peptide drugs have been described, for example, by Saffran et al . , (23) (use of trasylol protease inhibitor); Lundin et al . (24) and Vilhardt et al., (25). Due to the high surface area and extensive vascular network, the nasal cavity provides a good site for absorption of both lipophilic and hydrophilic drugs, especially when coadministered with absorption enhancers. The nasal absorption of peptide-based drugs can be improved by using aminoboronic acid derivatives, amastatin, and other enzyme inhibitors as absorption enhancers and by using surfactants such as sodium glycolate, as described in Amidon et al . , (26). The transdermal route provides good control of delivery and maintenance of the therapeutic level of drug over a prolonged period of time. A means of increasing skin permeability is desirable, to provide for systemic access of peptides. For example, iontophoresis can be used as an active driving force for charged peptides or chemical enhancers such as the nonionic surfactant n- decylmethyl sulfoxide (NDMS) can be used. Transdermal delivery of peptides is described in Amidon et al . (26) and Choi et al . (27) .

Peptides may also be conjugated with water soluble polymers such as polyethylene glycol, dextran or albumin or incorporated into drug delivery systems such as polymeric matrices to increase plasma half-life.

More generally, formulations suitable for particular modes of administration of peptides are described, for example, in Remington's Pharmaceutical Sciences (28) .

As an alternative therapy in Substance Z deficiency, gene therapy may be carried out, comprising administration of a PPT-C gene to a Substance Z deficient subject. Appropriate techniques may be employed to target the introduced gene to a desired target tissue. Gene therapy has the potential to avoid life long administration of exogenous peptides and may provide for a more physiologically-appropriate level of Substance Z than exogenous administration.

EXAMPLES The examples are described for the purposes of illustration and are not intended to limit the scope of the invention.

Methods of molecular genetics, protein and peptide biochemistry and immunology referred to but not explicitly described in this disclosure and examples are reported in the scientific literature and are well known to those skilled in the art.

Example 1; Isolation of PPT-C cDNA R A preparation and Northern analysis

Total RNA was isolated from CD1 mouse tissues and cultured cell lines as described by Bergman et al . (29) and Sambrook et al . (5) . Poly (A) ⁺ RNA was selected by passage over oligo (dT) -cellulose (Pharmacia). For

Northern analysis, 5μg of poly(A)⁺RNA was separated on 1% agarose gels containing 20mM NaHP0₄, and 1M formaldehyde, transferred onto Hybond-N nylon membranes (Amersham) , UV- immobilized, and hybridized with ³²P-labelled probes prepared by a random hexamer-primed method (30) .

Hybridization was at 42^°C in 5X SSPE (750mM NaCl, 5mM EDTA, 50mM NaH₂P0₄, pH 7.4), 2% SDS, 5X Denhart ' s solution, lOOμg of sheared/boiled salmon sperm DNA, lOOμg of poly A, and 50% formamide. Washing was in 0. IX SSC (15mM NaCl, 1.5mM sodium citrate, pH 7.0), 0.1% SDS at

65^°.

Differential display PCR

Differential display PCR was performed following the method described by Liang and Pardee (31) with GenHunter

Kit (Brookline, MA). Poly (A) ⁺RNA (0.2μg) from IIB4 and 70Z/3 cells (both transformed murine pre-B cell lines) was used for first strand cDNA synthesis with each of the four modified oligo (dT) primers (T12MN) . The synthesized first strand cDNA was used as a template in the subsequent PCR reaction. In a 0.2ml PCR tube the following were added: 2μl of 10X PCR buffer (500mM KC1, 15mM MgCl₂, lOOmM Tris-HCl at pH 8.3), 5'-arbitrary lO er (2μM) , T12 MN (lOμM, same as used in cDNA synthesis), cDNA synthesis), cDNA template, 1.6μl of dNTP mix (25μM) , 12.5μCi ²⁵S-dATP (100 Ci/mmole) , 1 U of Taq DNA polymerase (Perkin Elmer), and 9.2μl of dH₂0. PCR was performed as follows: 94^°C, 30s; 40^°C, 2min; 72^°C, 30s for 40 cycles. Four microliters of the PCR products from the two starting cells were run side by side on a 6% urea: acrylamide sequencing gel. The dried gel was exposed to an X-ray film and the autoradiogram was analyzed for differentially displayed bands. These bands were cut out from the gel, and the DNA was eluted by soaking the gel slices in lOOμl of TE buffer for lOmin and then boiling for lOmin. The eluted DNA was precipitated using glycogen and ethanol, air-dried, and redissolved in lOμl of dH₂0. This DNA was reamplified with the same combination of primers used in the first PCR. The reamplified DNA was gel-purified and used as a probe in Northern analysis. Once the differential expression was confirmed, the DNA was cloned using the TA Cloning Kit (Invitrogen, CA) . cDNA library construction and screening A 70Z/3 cDNA library was constructed using standard procedures essentially as described by Sambrook et al . , (5) . Reverse transcription was carried out on 5μg of poly(A)⁺RNA to generate first strand cDNA using an oligo (dT) 12-18 primer. The RNA-cDNA hybrid was treated with Rnase H. Remnants of mRNA served as primers for the synthesis of second strand cDNA. The double strand cDNA was treated with Klenow to create blunt-ends, and then ligated to an EcoR I/Not I adapter. This adapter-ligated cDNA was purified to remove the unligated adapters, and then inserted into lambda ZAPII vectors (Stratagene, CA) . The constructs were packaged into infectious phage particles, amplified in E. coli strain XLl-Blue. The percent of recombinants in the library was over 85%. The total yield of the recombinants was 4xl0⁶. The size of cDNA inserts from 12 randomly picked up clones ranged from 0.8-4.5kb with an average of 1.4kb. Using the 440bp differential display PCR fragment as a probe, 2xl0⁶ plaques were screened. Up to 20 positive clones were isolated by three rounds of screening. The in vivo excision procedure was followed to release pBluescript plasmid from the lambda ZAPII vector. The insert size of the ten clones varied from 0.5-1.1 kb . Nucleotide sequence of each clone from both strands was determined by the dideoxynucleotide chain termination method (6). 5' RACE of mRNA

The largest cDNA clone which was isolated from the above mentioned library still lacked the 5' end of the gene. Therefore the 5' end of PPT-C cDNA was amplified using the method of 5' RACE (rapid amplification of complementary DNA ends) using standard protocols included with a reagent kit from Clontech (Palo Alto, CA) . The PPT-C gene specific primer sequence used was

5'GGACAGAGAGGCACCTGCTC-3' . The amplified PCR product was cloned using the TA Cloning kit (Invitrogen, CA) . Nucleotide sequences were determined by dideoxynucleotide chain reaction termination method. The nucleotide sequence of the cDNA is shown in

Table 1 and the amino acid sequence deduced from the open reading frame is shown in Table 2.

Example 2: Expression of PPT-C gene RNA was extracted from cells and tissues, and poly (A) ⁺ RNA was isolated by passage over oligo (dT) - cellulose. Northern blot analysis was performed as described in Example 1. 7G9 was a probe derived from PPT- C cDNA. L32, a ribosomal protein-coding gene, was used as a loading control. IIB4, CB17 1.1 and 5.1, RAG2 5 and 21 are fetal liver cell lines transformed with Abelson Murine Leukemia virus. Scid 2.1 and 4.1 and RAG1 14 and 17 are derived from bone marrow. 70Z/3 is a pre-B cell line. 70Z/3y is a RAG-positive variant of 70Z/3. WEHI 231 is an immature B cell line. J558 is a myeloma cell line. RBL5 and EL4 are T lymphoma cells. P338D1 and CB5 are cell lines of myeloid and erythroid lineage respectively. NIH3T3 and L929 are fibroblasts. BMS2.2 is a stromal cell line. Mouse tissues included in the scheme were brain, lung, heart, liver, spleen, thymus and kidney. The results are shown in Figure 1. Expression of PPT-C mRNA appeared restricted to cells of B lineage at its early developmental stage.

To test PPT-C expression in primary cells representing pre-B cells, RT-PCR was used to amplify PPT- C mRNA (5) from fresh mouse fetal liver cells and from mouse fetal liver cells expanded with IL-7 for enrichment of B lineage cells. The primers used were 5'- TAACCACCAGCAACGAGA-3' and 5 ' -ATGGCTGAGGAAGCTACCT-3 ' . PCR products were blotted on a nylon membrane, and probed with 7G9.

PPT-C was expressed in fetal liver cells and culturing of the cells in the presence of IL-7 further increased PPT-C expression (data not shown) .

Example 3: Preparation of Substance Z

Peptides RSRTRQFYGLM (Substance Z) and SRTRQFYGLM (Substance Z - short form) were synthesised using conventional solid phase peptide synthesis (33) . Analytical and preparative high-performance liquid chromatography were utilized to characterize and isolate the final compounds. Fast bombardment mass spectrometry was used to confirm the molecular weight.

Synthetic Substance Z was used for the studies of biological activity described in the following examples.

Example 4 : Effect of Substance Z on cartilage degradation by human fibroblasts

Generation of Synovial Fibroblast Lines

The ability of 3 human fibroblast cell lines, synovial fibroblast lines RA1 and RA2 and skin fibroblast cell line CCD-967, to degrade cartilage discs was tested. RA1 and RA2 were synovial fibroblast lines derived from synovium obtained from Rheumatoid Arthritis patients (according to ACR criteria (34) ) undergoing knee replacement. They were established by placing finely minced synovial tissue into a 25cm² tissue culture flask with medium, consisting of OPTI-MEM (Gibco, Grand Island, NY., USA) supplemented with 10% FCS (Gibco, Grand Island, NY, USA) , antibiotic-antimycotic mix (penicillin G sodium [1000 units] /streptomycin sulfate [1000 units] /amphotericin B [2.5 mg/ml]) (Gibco, Grand Island, NY, USA), 5.5 x 10^~5M β-mercaptoethanol (Sigma, St. Louse, MO, USA) and 2.4 g/L sodium carbonate (Mallinckrodt Inc., Point-Claire, Quebec, Canada) . Minced synovial tissue was left in the culture flask for a period of 1 week to allow the fibroblasts to grow out of the tissue and onto the surface of the culture flask, at which point the tissue was removed. Although there was variation from line to line, in general, cells were passaged every 2 weeks and media was replenished every 3 days. The distinct morphology of fibroblasts along with their unique ability to survive multiple passages in the absence of added growth factors in vi tro was used to assign a lineage to these cells.

Skin fibroblast cell line CCD-967 (Skin 1) was obtained from ATCC and cultured exactly as described for the synovial fibroblast cell lines.

The macrophage cell line U937 was used to generate a conditioned medium. To prepare U937-conditioned medium, U937 cells were grown to a concentration of approximately lxl0⁶/ml of OPTI-MEM. This medium was subsequently centrifuged (3000rpm for 15min at 4^°C) and filtered (0.2mm millex-GV filter, Millipore, Bedford, MA, USA) prior to use in the assay. If the conditioned medium was not used immediately, it was stored immediately at -70 C. Cartilage degradation assay

The cartilage degradation assay originally described by Steinberg et al . (35), and modified by Janusz and Hare (36) was used with human cell lines and human normal cartilage. In brief, measurement of degradation of cartilage was performed by culturing of fibroblasts in the presence of radiolabelled human cartilage discs. Cartilage discs (4mm x 1mm) were prepared from normal human femoral cartilage using a 4mm cork bore. Femoral cartilage was obtained from "normal appearing" cartilage in patients with osteoarthritis undergoing joint arthroplasty. Discs were incubated overnight with OPTI- MEM containing S³⁵ Na₂S0₄ (lOμCi/ml) (Amersham, Oakville, ON, Canada) . Label was incorporated into the glycosaminoglycan side chains of the proteoglycan within the cartilage. The discs were then washed (x5) with sterile PBS to remove unincorporated radiosotope. Discs were then freeze-thawed 5 times and heated at 65^°C for 15 min. to inactivate endogenous enzymes and cytokine activity. The discs were stored at -20 C prior to use. Incorporation of radionuclide was normally found to be between 50,000 to 100,000 dpms/disc.

Adherent fibroblasts to be cocultured were trypsinized from culture flasks with 0.05% trypsin/0.53 mM EDTA 4Na (Gibco, Grand Island, NY, USA) . 1 x 10⁴ fibroblasts were cultured together with a radioactive cartilage disc, either in U937-conditioned medium or with 1 nM Substance Z for 7 days in 96 well Nunclon plates (Nunc, Roskilde, Denmark) . On day 3, the original medium was removed and replaced with 200μl fresh medium, supplemented as before. In some experiments, cells were cultured with U937-conditioned medium or with Substance Z in transwell tissue culture inserts for 96 well tissue culture plates with a 0.2mm pore membrane (Nunc, Roskilde, Denmark) between disc and fibroblasts. On day 7, 200μl of medium was removed and added to 3ml scintillation fluid (Beckman Instruments Inc., Fullerton, CA, USA) and counted in a scintillation counter (Beckman Instruments Inc., Fullerton, CA, USA LS1071) . The remaining isotope in the cartilage disc was measured by completely digesting the disc in 0.5ml of tissue solubilizer (Beckman Instruments Inc., Fullerton, CA, USA) . Solubilized discs were counted in scintillation counter using 3ml scintillation fluid (Beckman Instruments Inc., Fullerton, CA, USA). Data were expressed as % of S³⁵ released into the supernatant using the equation: %= (dpm in supernatant) / (dpm in supernatant + disc) X 100.

In all experiments, culture of the radio-labeled disc alone was performed as a control. All experiments reported were carried out in quadruplicate and the % release of S³⁵ calculated for each individual replicate. The results are shown in Figure 3. The results show that synovial fibroblast lines degraded cartilage if both contact with cartilage discs (Contact) and U937-conditioned medium (U937) were present. In the absence of either factor, degradation did not occur. Substance Z, however, stimulated the degradation of cartilage by synovial fibroblasts when neither contact nor conditioned medium was present.

Skin fibroblasts did not degrade cartilage when provided with contact and U937-conditioned medium or when challenged with Substance Z.

Example 5 : Effect of Substance Z on growth of leukemia cells

Growth of 70Z/3 Leukemia Cells 70Z/3 murine leukemia cells were maintained in liquid culture using the supplemented OPTI-MEM medium described in Example 4, except that 5% FCS was used instead of 10%. To examine the effects of Substance Z on the growth of 70Z/3, cells were cloned in medium containing 0.3% melted agar (Bacto Agar, Gibco) following standard procedures described by Sauter and Paige (37) . Briefly this consisted of pouring 1ml of medium containing 0.3% melted agar into a 35mm tissue culture plate. This layer was allowed to gel for 20min at room temperature after which a second 1ml layer, containing 70Z/3 cells (300 - 1000/plate) in medium supplemented with 0.3% agar was poured. After 7 days of culture, the colonies (Foci containing at least 50 cells) were enumerated visually with the aid of a stereomicroscope. The results are shown in Figure 4 and show that leukemia cell growth was augmented by Substance Z. Example 6: Enhanced Mast Cell Degranulation by Substance Z

Primary mast cells were obtained by culturing bone marrow cells in IL-3-containing WEHI-3 conditioned medium as described by Berger (38) . By 6 weeks, >99% of the cells in the culture were mast cells. Experiments were carried out generally as described by Berger (38), except that degranulation was measured by checking the release of ³H-serotonin instead of that of β-hexosaminidase . Mast cells were cultured overnight in Opti-MEM

(Gibco) + 5%FCS + β-mercaptoethanol + WEHI-3 conditioned medium plus 3.5μCi/ml of ³H-serotonin. ³H-serotonin would be preferentially incorporated into granules of mast cells during the culture. The cells were then washed to remove excess serotonin, and cultured in fresh medium for 15 min. Subsequently, cells were washed and resuspended in Tyrode's buffer (lOmM Hepes, pH7.4, 130mM NaCl, 5mM KC1, 1.4mM CaCl₂, lmM MgCl₂, 5.6mM glucose, 0.1% BSA) . Aliquots of 2X10⁵ cells were incubated with 5mg/ml SPE-7 anti-DNP monoclonal IgE antibodies ( Sigma Chemicals Co.) for 30-60 min, washed and treated with DNP-HSA antigen (Sigma Chemicals Co.) at a concentration of 0, 1 and

5ng/ml for 30-60 min at 37^°C. Substance Z was included in the final incubation at a concentration ranging from 0- 50μM. Cells were pelleted at 3000rpm for 5 min. An aliquot of supernatant was removed and placed in scintillation vials with appropriate scintillation fluid. Remaining supernatant was discarded, cell pellet was lysed in an equivalent volume of Tyrode's + 0.5% Triton X-100 and l/5th of the lysate was transferred to a fresh scintillation vial with scintillation fluid. Samples were counted in scintillation counter.

% Degranulation = counts in supernatant x 100

counts in (Supernatant + pellet)

The results are shown in Figure 2. Mast cells express high affinity receptors for IgE antibodies. Cross-linking of surface-bound IgE by antigen, typically at high concentrations, leads to the activation of these cells and the release of granules containing inflammatory mediators. This process of degranulation is also regulated by other signals.

Substance P, for example, has been shown to increase the sensitivity of mast cells to degranulation stimulated by exposure to antigen (39) .

As demonstrated here, Substance Z also enhanced IgE- mediated degranulation of mast cells.

Example 7 : Isolation of receptor for Substance Z

For identification and isolation of the receptor for Substance Z, Substance Z is labelled with an easily detectable marker or label. For example, Substance Z is labelled with a radio-label such as ¹²⁵I by a conventional method such as those described by Harlow and Lane (8) . One such method employs chloramine T. lOμg of synthetic Substance Z in 25μl of 0.5M sodium phosphate (pH 7.5) is mixed with 500μci of Na¹²⁵I and 25μl of 2mg/ml chloramine T. After a incubation of 60sec, 50μl of stop solution (2.4mg/ml sodium metabisulfite, lOmg/ml tyrosine, 10% glycerol, 0.1% xylene cylanol in PBS) is added. The iodinated Substance Z is subsequently separated from the iodotyrosine on gel filtration column.

Labeled Substance Z is utilized to determine the distribution of its receptor in various cells and tissues, and to elucidate the binding affinity and kinetics of Substance Z with its receptor (1) . Various approaches may be employed for the isolation of the receptor gene for Substance Z. Expression cloning is one of the most frequently applied strategies in receptor cloning (41, 42) . For example, RNA is extracted from the cells or tissues which express Substance Z receptor as determined by using ¹²⁵I -labeled Substance

Z. Pol (A) ⁺ RNA is isolated using oligo-dT cellulose, cDNA is synthesized and ligated into the mammalian expression vector pMET7 (42) . Ligated DNA is EtOH precipitated and resuspended in dH₂0 at 25μg/ml. DNA (lμl) is used to transform each of 40μl of competent DH10B E. coli cells by electroporation. Based on the titers of the cDNA transformations, 96-well plates are inoculated with

150cfu per well in 200μl of LB-Amp . Cultures are grown for 15-16hr at 37 C. lOOμl of each culture is removed and added to lOOμl of 50% Glycerol, mixed, and stored at -

80^°C. Plasmid DNA is prepared from the rest of the culture. The library is thus produced as pools of 150 clones .

To screen the library, plasmid DNA is transiently transfected into a 10cm dish of COS cells with lipofectamine. DNA from eight pools is used for each transfection. After 48hr, the cells, just at or before confluence, are transferred onto culture slides, and then incubated with 0.5nM ¹²⁵I -labeled Substance Z. After two washes , the slides are exposed to film. Positive pools are subsequently broken down to subpools of 150 clones each. The positive subpools are further divided until a single clone encoding a Substance Z-binding activity is identified.

The nucleotide sequences of the isolated clones are determined, and deduced amino acid sequences are obtained. In order to confirm that the isolated clones encode receptor specific for Substance Z, COS cells are transfected with each of the individual clones. Substance Z binding characteristics conferred by these clones should be comparable with that observed in receptor- bearing cells. In addition, the value of the dissociation constant (K_D) as determined by Scatchard analysis should be similar, and the binding of ¹²⁵I - labeled Substance Z to the transfected cell should be able to be completely blocked by cold Substance Z, but not by other tachykinins. Example 8 : Plasma Extravasation Assay

Balb/c mice were injected intravenously with 0.2ml of PBS with 0.1% Evan's blue dye. Substance Z or Substance P was added to achieve tissue concentration of 0.25, 0.5 and InM. Antagonists, when applicable, were included in 10-fold excess. Plasma extravasation was manifested by leakage of the dye into the tissue. The blueing of the extremities was scored in a double-blinded way by two investigators using a 0-3 scale. The results are shown in Figure 5.

The present invention is not limited to the features of the embodiments described herein, but includes all variations and modifications within the scope of the claims .

TABLE 1

1 ggagaggctg tcccatgaag cagtgcaaag gtggggtgag gcataggaag gaagcagaga 61 gtctaggaca catctcagcc acatacaagt ggccccgtgg ggaccggagc ctgctggagg 121 aggtggcatc aggctgagtg gggctccctg gacagagagg cacctgctca ccatgttgcc 181 tctccttgcc ctgcttctcc tgatcgggcc atcagtgtgc actacagcag gagacagaga 241 ggaactggct tttggtgcag aggcagagtc ctgggtgacc gtgaacctga agggaatccc 301 cgtccccagc attgaactta agcttcagga gttgaagaga agcaggactc gccagttcta 361 tggtctgatg gggaagcggg tgggagggta tcagctggga cgtatagtgc aggatctcct 421 tggcacgaga ggtttgtcca tagaagggac ctgcagacag gcggcgagtc aacagagggc 481 acgacccgga gcagtgacca gagaaagcct ccagagtcga gaggaagatg aggctcccct 541 aaccaccagc aacgtgtagc actctgccac ccatctctcc ccagaacatc acagctgagg 601 agcctcagcc aacagtcctg tcttttgtcc tcaacttggg tatttcctgc caggccctcg 661 tcacactctg cattttctcc caggactcac tcttggcatc tggtagcaac gacacacaaa 721 gcacggctgc ctcctcacaa gctggactga cccagctctc ccttgtccct acagcaaagc 781 ttcacactct gtatcccagg cctagcacac agtagggctc aatcaacgac gagttagcag 841 taataggtag cttcctcagc catgcagggt agagggtggg atgtcagaaa agcagagacc 901 aacattacac agcccaggtc taatgtctaa tccttgggtg ggaagagagc ttggggcctg 961 gctaaaacgg caatagaaac aagaaaaaga ccctggtgga gaagacgctg catgtattgt 1021 atttgggggc ggggtcagga gccttcttcc ctttagattc ctgatgttgc taccaacaga 1081 catctccctc tgtgctgagg ctatggctca gtgggctaag gcgattgtgg ccaagcctga 1141 caacttgagt tcaatcccca ggacccacaa agtggaagaa aaaaattgtc cttttacctc 1201 tgcatgtgtc atggcatatg ttacacaaaa taaaaagaca gtttggaaa

TABLE 2 Partial Mouse PPT-C Genomic Sequence

This sequence contains an intron begining at base 52 and ending at base 1816. Sequence shown begins at base 334 and ends at base 405 of 7G9 cDNA sequence. Intron is inserted between bases 385 and 386 of 7G9 cDNA sequence.

10 20 30 0 50 60 70

AAGAGAAGCAGGACTCGCCAGTTCTATGGTCTGATGGGGAAGCGGGTGGGAGGTGAGTGACAAAGGCTGT 70 GAGCGTGGCTCAGAGTGGCTTCTGCAATACCCAGGAGAGGGAGGGTGCTCATGGGATAGTGAGGTACACT 140 GTCTATCAGTTGTCAATCAAGCAGGATGCTCTAGGGAGTGCCAATGGTAACAGGTATATAAGGCTATTCA 210 GTAGATGAGGGGCTGATGGTTTGCACCCTGGTTCCACATCAGAGAGACGGGAGAGTGCTCTGAGGCTGGA 280 CAGCGGCACTGAGATGTGAACGAGACAGGCTTTCCAGTCAGTTCTGTGCAGAAGCTGTCCCAGAGACGGA 350

360 370 380 390 400 410 420

GACGAGTCAACTGGACAAAAGCTGTTCTCTTAGGTTGCGATTTTTTTTCTTCGACACCATTGTCCTGCGG 420 AGCCACGCTCAGTACGAGCACTTGCTCTGTCCATTTGGAGCACACTGGCTGCATCCATCAGAGGCGGAAT 490 GTATCACTTTTCACCAATAGTTTCACATCAGGAAATCTCAAGTTCGTGGGAGGATGTCACGTGAGCCCTG 560 AGATGTTGCACCATGAGGCTCATTGCTGAGTTGATCATAGCAGCAAAACCTAAGACCACTAGTGGGGGAA 630 AGGTCAAAATGTAGAACATAAGTGCAACACAGTGGCACATGACAGTAGTCCTGACACTCGGGAGGTAGAC 700

710 720 730 740 750 760 770

ACAAGGTGTTAAGTTCAAGCTCATTGTCAGCTACACAGTGAGTTTGAGGCCTACATGAGATCCTGCCTTT 770 AAAAAAAAAAGGGATCAGGGAGATGGCTCAACTCAAACATGTGCAGCTGAAGTCAGCAGCCAACACCCAC 840 ATGAAAAGCTAGGTCGTGCACCTGTAACTCCGGCACTGGGGAACGAAAGGCCGGACGATACTTGGGACTT 910 GGTGGTTAACCAGTCAAACCAAATGGTGAGCTTCAGGCTCGTGAGAGGCCTGCCTCAAAGACAAAGTGGA 980 CAGTGATTCAGAAAGGCAATCAGTGTCCACCTCTGGCTGACACACACACACACACACACACACACACACA 1050

1060 1070 1080 1090 1100 1110 1120

CACCCCTACAAATACACTTATACAGGCGTATACACACATATGCTACACCACGCATACATACATACATACA 1120 CACACATCTACTCACACAGACATACACACATACCATGTGCTAGCCATTGACAACCCTGGACTAAACAGTG 1190 ACCTCCAGCTGGGGGCACGGGCTGGGGACATGCCTGGCCAGCGCTGCTATAGCACTGGAGAGCTGCTGTG 1260 ACTTGACCAGAAGACTGGGCTCTCAGGTTGTTCCCCAGAGGGTGGGATGCGCACGCCTAGAGAGTGCCTG 1330 CAGGGGTATGAGTCAGAGCCAGAGCTGTAGAATTACCAGAGCTAAGAAAATGCATCAACCAGGAAGATAA 1400

1410 1420 1430 1440 1450 • 1460 1470

GAGAGCTCAGAGCTTCAGCCCTTGGCCCCCTGAGGATGTAAGAACTGCAAACCCAGGTAGGCTTTATTCT 1470 CCTTAAACCCTTCATAAGAAAGAGAATCACAAAGGGAAGGTTGGGTGTGGTAGCCCACACCTCTAATCCC 1540 AGCTCTTGGGAGGCTGAGGCAGAGGGATTACCTGTGGCTATCCTGAACTACAAAGCAAGTACCTGTCTCA 1610 AAGGAAACAACACAGAAGCTGCCAGTCTCTTCTGACCACTCCTGAGTGCCACGGGAATCAGGCCATGCCC 1680 TTTGGCCGTTGCTGATTTCACTGCCCCCTCCCTAGCAGCTGGAGTGAGATTGCCTACCCTAGCAGACAGC 1750

1760 1770 1780 1790 1800 1810 1820

TTGCCTCCATGGACTGGGAAGGGTGCTGTCCTTGGCACACTGCATAGTGCAGTCCTGCTGTGTCACGTGA 1820 CTGTCGTTCCCAGCCTGGAAAXTCCCCACAGGAAGATGCAGGCTTGGGTCACTCTGTGTCCTTAATACTT 1890 AGCCTAGTTTCTGAACATGGAAATACTGGTGAAAGGATTAGCAAGAAGGCAGCCAATGTGTAAAGACATG 1960 GAAGAATGAAGGGCTCTAGGGCATCTCTCATGTCCGCAATGAAAAGGGCTGCATTGCAAGGCCCCCCTCC 2030 CCGCCCCCACTACCCTTTCTTTCACAGTTTCTCTTCACTCTTCTTTTTCCCCCCCCCCCCCCACCAGGGT 2100

2110 2120 2130 2140 2150 2160 2170

ATCAGCTGGGACGTAT 21 16 TABLE 3

MLPLLALLLL IGPSVCTTAG DREELAFGAE AESWVTVNLK GIPVPSIELK

10 20 30 40 50

LQELKRSRTRQFYGLMGKRV GGYQLGRIVQ DLLGTRGLSI EGTCRQAASQ

60 70 80 90 100

QRARPGAVTR ESLQSREEDE APLTTSNV

110 120 128

Substance Z peptide is shown in bold.

TABLE 4

References

All of the listed references are incorporated herein by reference.

1. Regoli, D. Bodon, A. And Fauchere J-L. (1994) Pharmacol ogi cal Revi ews v. 46, pp. 551-599.

2. Nakanishi, S., (1987), Physi ological Revi ews v. 117, p. 1142.

3. Harris Arch . (1989), Bi ochem. Biophys . v. 275, pp. 315-333.

4. Steiner et al . (1992), J. Biol . Chem. v. 267, pp. 23435-23438.

5. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Mol ecul ar Cl oning, A Labora tory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

6. Antibody Engineering: A Practical Guide, (1992), Borrebaek, Ed., W.H. Freeman & Company, N.Y.

7. Antibody Engineering, (1995), 2nd Ed., Borrebaek, Ed., Oxford University Press, Oxford.

8. Harlow and Lane, Antibodi es , a Labora tory Manual , (1988) Cold Spring Harbor Laboratory, New York.

9. Tami J.A., Parr, M.D., Brown, J.S., (1986), Am. J. Hosp . Pharm. , v. 43, p. 2816-25.

10. Gorman, S.D., Clark, M.R. (1990), Semin Immunol . , v. 2, pp. 457-466.

11. Halloran, M.M., Szekanecz, Z., Barquin, N., Haines, G.K., Koch, A. (1996), Arthri tis Rheum. , v. 39, pp. 81- 19.

12. Joosten, L.A.B., Nelsen, M.M.A., van de Loo, F.A.S., van den Berg, W.B., (1996), Arthri tis Rheum. , v. 39, pp. 797-809;

13. Jasin, H.E., Lightfoor, E., David. L.S., Rothlien, R., Foanes, R.B., Lipsky, P., (1992), Arthri tis Rheum, v. 35, pp. 541-549.

14. Geiler, T., Kriegsmann, J., Keyszer, G.M., Gay, R., Gay, S., (1994), v. 37, pp. 1664-1671.

15. Yoshina, S., Quattrochhi, E., Weiner, H.L., (1995), Arthri tis Rheum . , v . 38, pp. 1091-1096. 16. Caccesse, R.G., Zimmerman, J.L., Carlson, R.P., (1992), Mediators Inflamm. , v. 1, pp. 273-279.

17. Delafuente, J.C., Resman-Targoff, B.H., (1994), Annal s of Pharmacotherapy, v. 28, pp. 650-654.

18. Hogan et al . (1986) Manipulating the Mouse Embryo, Coldspring Harbour Laboratory Press, Coldspring Harbour, N.Y.

19. Thomas and Capecchi, Cell , (1987), v. 51, pp. 503- 512.

20. Sun Cell , (1994), v. 79, pp. 893-900.

21. Kita ura et al . Cell (1992), v. 69, pp. 823-831.

22. einstock et al . , J. Immunol . (1988), v. 141, pp. 961-966.

23. Saffran et al . , (1979) (use of trasylol protease inhibitor) ;

24. Lundin et al . (1986);

25. Vilhardt et al . , (17) (1986), Gen . Pharmacol . , v. 17, pp. 481-483.

26. Amidon et al . , (1994), Ann . Rev. Pharmacol . Toxi col . , v. 34, pp. 321-341.

27. Choi et al., (1990) ,. Pharm. Res . , v. 7, pp. 1099- 1106.

28. Remington's Pharmaceutical Sciences.

29. Bergman, Y., Stewart, S.J., Levy, S., and Levy, R. (1983) J. Immunol , v. 131, pp. 1876-1881.

30. Feinberg, A. P. and Vogelstein, B. (1983), Anal , Biochem. v. 192, pp. 6-13.

31. Liang, P. and Pardee, A.B. 1992) Science v. 257, pp. 967-970.

32. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc . Natl . Acad. Sci USA v. 74, pp. 5463-5467.

33. Barany and Merrifield, In the Peptides , Analysis , Synthesis, Biology, ed. by Gross and Meienhofer (1979), v. 2, pp. 1-284, Academic Press, New York.

34. Arnett F.C., Edworth, S.M., Bloch, D.A., (1988), Arthri tis Rheum, v. 31, pp. 315-324.

35. Steinberg, J., Tsuka oto, S., Sledge, C.B. (1979) Arth . Rheum . 36. Janusz, M.J., Hare, M. (1993) J. Immunol., v. 150(5), pp. 1922-1931.

37. Sauter, H. and Paige, C.J. (1987), Proc. Natl. Acad. Sci USA, v. 84, pp. 4989-4993.

38. Berger et al . J. Exp. Med. (1994), v. 180, pp. 471- 476.

39. Johnson A. R., Erdos, E.G., (1973), Proc. Soc. Exp. Biol. Med., v. 142, pp. 1252-1256.

40. Kluxen et al . Proc. Natl. Acad. Sci. USA, (1992), v. 89, pp. 4618-4622.

41. Rose et al. (1995), J. Biol. Chem. v. 270, pp. 22661- 22664.

42. Takebe et al . Mol. Cell Biol. (1988), v. 8, pp. 466- 472.

43. Kee, B., Cumano, A., Iscove, N., and Paige, C.J., (1994), Internat. Immunog, v. 6, pp. 401-407.

44. Ray, R.J., Furlonger, C, Williams, D.E., Paige, C.J., (1996), Eur. J. Immunol., v, 26, pp. 10-16.

45. Marshall, A.J., Wu, G.E., Paige, C.J., (1996), J. Immunol., v. 156, pp. 2077-284.

46. Lemback F., Holzer, P. (1979) Substance P as neurogenic mediator of antidromic vasodilation and neurogenic plasma extravasation. Naunyn Schmiedebergs Arch Pharmacol. 310: 175-183.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: THE ELLESLEY HOSPITAL FOUNDATION

(B) STREET: 160 WELLESLEY STREET EAST

(C) CITY: TORONTO

(D) STATE: ONTARIO

(E) COUNTRY: CANADA

(F) POSTAL CODE (ZIP) : M4Y 1J3

(G) TELEPHONE: 416 926 5110 (H) TELEFAX: 416 926 5109

(ii) TITLE OF INVENTION: LYMPHOCYTE TACHYKININ

(iii) NUMBER OF SEQUENCES: 4

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1249 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

GGAGAGGCTG TCCCATGAAG CAGTGCAAAG GTGGGGTGAG GCATAGGAAG GAAGCAGAGA 60

GTCTAGGACA CATCTCAGCC ACATACAAGT GGCCCCGTGG GGACCGGAGC CTGCTGGAGG 120

AGGTGGCATC AGGCTGAGTG GGGCTCCCTG GACAGAGAGG CACCTGCTCA CCATGTTGCC 180

TCTCCTTGCC CTGCTTCTCC TGATCGGGCC ATCAGTGTGC ACTACAGCAG GAGACAGAGA 240

GGAACTGGCT TTTGGTGCAG AGGCAGAGTC CTGGGTGACC GTGAACCTGA AGGGAATCCC 300

CGTCCCCAGC ATTGAACTTA AGCTTCAGGA GTTGAAGAGA AGCAGGACTC GCCAGTTCTA 360

TGGTCTGATG GGGAAGCGGG TGGGAGGGTA TCAGCTGGGA CGTATAGTGC AGGATCTCCT 420

TGGCACGAGA GGTTTGTCCA TAGAAGGGAC CTGCAGACAG GCGGCGAGTC AACAGAGGGC 480

ACGACCCGGA GCAGTGACCA GAGAAAGCCT CCAGAGTCGA GAGGAAGATG AGGCTCCCCT 540

AACCACCAGC AACGTGTAGC ACTCTGCCAC CCATCTCTCC CCAGAACATC ACAGCTGAGG 600

AGCCTCAGCC AACAGTCCTG TCTTTTGTCC TCAACTTGGG TATTTCCTGC CAGGCCCTCG 660

TCACACTCTG CATTTTCTCC CAGGACTCAC TCTTGGCATC TGGTAGCAAC GACACACAAA 720

GCACGGCTGC CTCCTCACAA GCTGGACTGA CCCAGCTCTC CCTTGTCCCT ACAGCAAAGC 780

TTCACACTCT GTATCCCAGG CCTAGCACAC AGTAGGGCTC AATCAACGAC GAGTTAGCAG 840 TAATAGGTAG CTTCCTCAGC CATGCAGGGT AGAGGGTGGG ATGTCAGAAA AGCAGAGACC 900

AACATTACAC AGCCCAGGTC TAATGTCTAA TCCTTGGGTG GGAAGAGAGC TTGGGGCCTG 960

GCTAAAACGG CAATAGAAAC AAGAAAAAGA CCCTGGTGGA GAAGACGCTG CATGTATTGT 1020

ATTTGGGGGC GGGGTCAGGA GCCTTCTTCC CTTTAGATTC CTGATGTTGC TACCAACAGA 1080

CATCTCCCTC TGTCGTGAGG CTATGGCTCA GTGGGCTAAG GCGATTGTGG CCAAGCCTGA 1140

CAACTTGAGT TCAATCCCCA GGACCCACAA AGTGGAAGAA AAAAATTGTC CTTTTACCTC 1200

TGCATGTGTC ATGGCATATG TTACACAAAA TAAAAAGACA GTTTGGAAA 1249 (2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 128 amino acids

(B) TYPE: protein

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Met Leu Pro Leu Leu Ala Leu Leu Leu Leu lie Gly Pro Ser Val Cys 1 5 10 15

Thr Thr Ala Gly Asp Arg Glu Glu Leu Ala Phe Gly Ala Glu Ala Glu 20 25 30

Ser Trp Val Thr Val Asn Leu Lys Gly He Pro Val Pro Ser He Glu 35 40 45

Leu Lys Leu Gin Glu Leu Lys Arg Ser Arg Thr Arg Gin Phe Tyr Gly 50 55 60

Leu Met Gly Lys Arg Val Gly Gly Tyr Gin Leu Gly Arg He Val Gin 65 70 75 80

Asp Leu Leu Gly Thr Arg Gly Leu Ser He Glu Gly Thr Cys Arg Gin 85 90 95

Ala Ala Ser Gin Gin Arg Ala Arg Pro Gly Ala Val Thr Arg Glu Ser 100 105 110

Leu Gin Ser Arg Glu Glu Asp Glu Ala Pro Leu Thr Thr Ser Asn Val 115 120 125

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 amino acids

(B) TYPE: peptide

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

Arg Ser Arg Thr Arg Gin Phe Tyr Gly Leu Met 1 5 10 (2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 amino acids

(B) TYPE: peptide

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Ser Arg Thr Arg Gin Phe Tyr Gly Leu Met 1 5 10

Claims

CLAIMS We claim:

1. An isolated nucleic acid comprising a nucleotide sequence encoding a mammalian preprotachykinin-C protein or a functional fragment or analogue thereof.

2. The nucleic acid of claim 1 comprising a nucleotide sequence encoding a mouse preprotachykinin-C protein or a functional fragment or analogue thereof.

3. The nucleic acid of claim 2 comprising a nucleotide sequence encoding the amino acid sequence of Sequence ID NO : 2 or a nucleotide sequence capable of hybridising to a sequence complementary to said sequence under stringent hybridisation conditions.

4. The nucleic acid of claim 3 comprising the nucleotide sequence of Sequence ID NO : 1.

5. An isolated nucleotide sequence comprising at least 10 consecutive nucleotides from the nucleotide sequence of Sequence ID NO : 1 or from a sequence complementary to said sequence.

6. A recombinant vector comprising a nucleotide sequence of any of claims 1 to 5.

7. A host cell comprising a vector of claim 6.

8. A substantially pure mammalian preprotachykinin-C protein.

9. The protein of claim 8 comprising a mouse preprotachykinin-C protein.

10. The protein of claim 9 comprising the amino acid sequence of Sequence ID NO : 2.

11. A substantially pure preparation of a mammalian Substance Z tachykinin peptide or a functional fragment or analogue thereof.

12. The peptide of claim 11 comprising the amino acid sequence RSRTRQFYGLM or a functional fragment or analogue thereof.

13. The peptide of claim 11 wherein the functional fragment comprises the amino acid sequence SRTRQFYGLM or a functional fragment or analogue thereof .

14. A peptide comprising the amino acid sequence RSRTRQFYGLM.

15. A pharmaceutical composition comprising an effective amount of a peptide of any of claims 11 to 14 and a pharmaceutically acceptable carrier.

16. An antibody which selectively binds to an antigenic determinant of a protein or peptide of any of claims 8 to 14.

17. A cell line producing an antibody of claim 16,

18. A transgenic animal comprising a nucleic acid encoding a mammalian preprotachykinin-C protein.

19. A transgenic animal comprising a nucleic acid having the nucleotide sequence of Sequence ID NO: 1.

20. A method for screening a candidate compound for effectiveness as an antagonist of Substance Z comprising :

(a) providing an assay method for determining a biological activity of Substance Z; and (b) determining the biological activity of

Substance Z in the presence or absence of the candidate compound, wherein a reduced biological activity in the presence of the candidate compound indicates antagonist activity of the compound.

21. The method of claim 20 wherein the assay method of step (a) comprises culturing synovial fibroblasts in the presence of Substance Z with a cartilage disc and determining cartilage degradation .

22. A method for treating in a mammal a disorder associated with an undesired biological activity of Substance Z comprising administering to the mammal an effective amount of a substance selected from the group consisting of;

(a) a Substance Z antagonist;

(b) an antibody which binds specifically to Substance Z;

(c) an antisense strand comprising a nucleic acid sequence complementary to the sequence or fragment of the nucleic sequence encoding Substance Z and capable of hybridizing to the nucleic acid sequence encoding Substance Z; and (d) an agent which down regulates the expression of the PPT-C gene encoding for Substance Z.

23. The method of claim 22 wherein the disorder is selected from the group consisting of cancer, rheumatoid arthritis, inflammation and acute allergy.

24. The method of claim 22 wherein the disorder is the presence of a tumour whose growth is responsive to Substance Z.

25. A method for suppressing in a mammal proliferation of a cell which is stimulatable to proliferate by Substance Z, the method comprising administering to the mammal an effective amount of a Substance Z antagonist or an antibody which binds specifically to Substance Z.

26. The method of claim 25 wherein the cell is a cancer . cell .

27. The method of claim 26 wherein the cancer cell is a leukemia cell.

28. The method of claim 25 wherein the cell is a mast cell.

29. A method for reducing pain in a mammal associated with over-expression of a preprotachykinin-C gene and overproduction of Substance Z, comprising administering to the mammal an effective amount of a Substance Z antagonist or an antibody which binds specifically to Substance Z.

30. A method for producing vasodilation in a mammal in need of such treatment comprising administering to the mammal an effective amount of (a) an isolated nucleic acid encoding Substance Z;

(b) a Substance Z peptide;

(c) an active analogue or active fragment of Substance Z peptide; and (d) a mimetic of Substance Z.

31. A method for detecting in a mammal a disorder associated with overproduction or underproduction of Substance Z comprising (a) obtaining a biological sample from the hematopoeitec mammal;

(b) determining the level of Substance Z in the sample by a suitable method; and

(c) comparing the determined Substance Z level with the Substance Z levels of similar samples from a control group of mammals, to determine overproduction or underproduction of Substance Z in the mammal .

32. A method as claimed in claim 31, wherein the biological sample comprises a hemapoietic tissue or cell ( s ) .