WO1995025126A1 - Antibodies to interleukin-8 receptors and methods of use - Google Patents

Abstract

Antibodies are raised against recombinant IL-8 receptors and receptor fragments and analogs. Such antibodies are useful in methods of detecting and isolating IL-8 receptors and receptor peptides, detecting neutrophils in biological samples, and in therapeutic compositions to treat inflammation.

Description

ANTIBODIES TO INTERLEUKIN-8 RECEPTORS AND METHODS OF USE Background of the Invention This invention relates to antibodies useful for treating inflammatory disorders, reducing inflammation, and for in vitro diagnostic assays.

Under normal circumstances, an orderly progression of host defenses (involving, e.g., T and B lymphocytes, macrophages, and leukocytes such as neutrophils) produces a well-controlled immune and inflammatory response that protects the host from offending antigens. However, regulatory dysfunction of any of the systems involved in the host defense can damage host tissue and produce clinically apparent disease. One such dysfunctional condition is inflammation, a pathologic process consisting of a complex set of cytologic and histologic reactions. These reactions occur in the affected blood vessels and adjacent tissues in response to an injury or abnormal stimulation caused by a physical, chemical, or biological agent. Inflammatory disorders include anaphylaxis, systemic necrotizing vasculitis, systemic lupus erythematosus, serum sickness syndromes, psoriasis, and rheumatoid arthritis, adult respiratory distress syndrome (ARDS) , asthma, other allergic responses, and reperfusion injury occurring after periods of ischemia, such as in myocardial infarction or shock. Inflammation may also play a role in homograft rejection.

Leukocytes, especially neutrophils, are cellular components of the blood which play a role in the inflammatory process. When activated (e.g., following infection of the host by a pathogen) , neutrophils produce substances that are cytotoxic and amplify the inflammatory response. During intense inflammation, release of neutrophil proteolytic enzymes and oxygen free radicals may cause digestion of cartilage mucopolysaccharide, oxidation of synovial tissue, and widespread damage to the lungs. In addition, chemotactic factors at the site of inflammation induce neutrophil aggregation and adherence to endothelium, causing, e.g., leukostasis in the pulmonary vasculature and cardiopulmonary dysfunction (Jandl, Blood, Little, Brown & Co. , Boston, 1987) .

Interleukin-8 (IL-8) is a 72 amino acid peptide which is produced by a variety of cell types upon activation with interleukin-1 and other stimulatory cytokines (Westwick et al., Immunology Today, 10:146. 1988) . IL-8 has previously been known as neutrophil activating peptide-l (NAP-l) , neutrophil activating factor (NAF) , and monocyte-derived neutrophil chemotactic factor (MDNCF) . The amino acid sequence of IL-8 has been determined (Lindley et al., P.N.A.S.. USA, 85:9199. 1988) . IL-8 promotes chemotaxis and degranulation of neutrophils (Djeu et al., J. Immunol.. 144:2205, 1990). IL-8 has been shown to be a potent chemoattractant for neutrophils in vitro and capable of producing a strong inflammatory effect in vivo (Colditz et al., Am. J. Pathol.. 134:755, 1989). In addition, IL-8 has been found to be present in significant quantities in naturally occurring inflammatory conditions such as psoriasis and rheumatoid arthritis. A recent study, Sekido et al., Nature, 365:654-657 (1993), also has demonstrated that IL-8 is an essential factor in the neutrophil infiltration and subsequent tissue damage occurring with lung ischemia and reperfusion.

IL-8 binds to two similar but distinct receptors on the surface of neutrophils. These neutrophil IL-8 receptors have been cloned and arbitrarily named human IL-8 receptor subtype A and subtype B. When first described, these two receptors were referred to as a high affinity IL-8 receptor, Holmes et al. , Science. 253:1278- 1280 (1991) (later called subtype A) , and as a low affinity IL-8 receptor, Murphy et al., Science. 253:1280- 1283 (1991) (later called subtype B) . Subsequently both receptors were found to bind IL-8 with high affinity when expressed in mammalian cells, LaRosa et al., J. Biol. Chem.. 267:25402-06 (1992); Lee et al., J. Biol. Chem.. 267:16283 (1992).

The predicted amino acid sequence of both IL-8 receptors suggest that they are members of the family of G protein-coupled receptors. These receptors all have a complex secondary structure imposed by seven transmembrane-spanning hydrophobic helices, which are connected by hydrophilic segments that form peptide loops exposed to the aqueous membrane surface.

This family of "seven spanner" receptors includes more than one hundred different receptors such as the alpha and beta-adrenergic receptors (Kobilka et al., Science. 238:650-656. 1987, and Yarden et al., P.N.A.S.. USA, 533:6795-6799, 1986), the muscarinic and cholinergic receptors (Peralta et al., EMBO J.. .6:3923-29, 1987, and Bonner et al., Science. 237:527-531. July 1987), various substance K and substance P receptors (Masu et al. , Nature, 329:836-838, 1987, and Gerard et al., J. Biol. Chem.. 265:20455-62, 1990), and the fMet-Leu-Phe receptor (Boulay et al., Biochem. Biophys. Res. Commun.. 168:1103- 1109, 1990).

Although a large number of such receptors are known, monoclonal antibodies have been created against only three receptors in this family to date: bovine rhodopsin (Adamus et al., Vision Res.. 3_1:17-31, 1991), human C5a receptor (Morgan et al., J. Immunol.. 151:377- 388, July 1, 1993), and human IL-8 receptor type A (Chuntharapai et al., J. Immunol., 152.:1783-1789, 1994). Receptor type A of human and rabbit neutrophils binds only IL-8 with high affinity, while receptor type B binds IL-8 with similar affinity as the type A receptor, but also binds melanoma growth-stimulatory activity (MGSA or Groα) with high affinity and neutrophil activating peptide-2 (NAP-2) with somewhat lesser affinity. Both receptor subtypes are capable of coupling to the same G protein α-subunits, and exhibit functional coupling to G _i2, Gα_i3, G ₁₄, Gα₁₅, and Ga₁₆ (Wu et al. , Science. 261:101-103, 1993).

Summary of the Invention The invention features IL-8 receptor-directed antibodies, e.g., monoclonal antibodies, that block, completely or partially, the binding of IL-8 to IL-8 receptor subtypes A or B (IL-8A or IL-8B) . In particular, the invention features monoclonal antibodies raised against the human IL-8B receptor, which block the binding of IL-8 to the IL-8B receptor, and inhibit neutrophil response, e.g., chemotaxis. These antibodies also block NAP-2 binding to the IL-8B receptor.

Such antibodies are useful for in vitro detection and purification of IL-8 receptors, in diagnostic compositions that can detect neutrophils in biological samples, and in therapeutic compositions that block one or both of the IL-8 receptor subtypes in neutrophil- mediated inflammatory disorders.

In general, the invention features a purified monoclonal antibody which preferentially binds to a recombinant IL-8 receptor polypeptide, or to a substantially isolated polypeptide which is a fragment or analog of an IL-8 receptor including a domain capable of binding IL-8. The IL-8 receptor can be of subtype A, e.g., having an amino acid sequence substantially identical to the amino acid sequence shown in Figs. 1A and B (SEQ ID NO: 1) . The receptor can also be of subtype B, e.g., having an amino acid sequence substantially identical to the amino acid sequence shown in Figs. 4A and B (SEQ ID NO: 4) , or in Figs. 3A and B (SEQ ID NO: 3) . The receptor can be derived from a mammal, e.g., a human or a rabbit. The antibody preferably neutralizes the biological activity .in vivo of the IL-8 receptor polypeptide.

The invention also features antibodies in which the IL-8 receptor polypeptide includes an amino-terminal portion of the IL-8B receptor, e.g., the amino acids Lys- Gly-Glu-Asp-Leu-Ser-Asn-Tyr-Ser-Tyr-Ser-Ser-Thr-Leu-Pro- Pro-Phe-Leu-Leu-Asp-Ala-Ala-Pro-Cys-Glu.

In addition, the invention features hybridoma cell lines deposited under accession numbers A.T.C.C. HB11623 and HB11624, and antibodies 4C1 and 1E3 produced by those hybridoma cell lines.

The invention further features a therapeutic composition for treating an inflammatory disorder including as an active ingredient an antibody of the invention formulated in a physiologically-acceptable carrier, and a method of treating an inflammatory disorder in a mammal, e.g., a human, by administering this therapeutic composition to the mammal in a dosage effective to inhibit IL-8 receptor function in the mammal, e.g., to prevent neutrophil chemotaxis and activation, or to block IL-8 binding to IL-8 receptors. This method can be used to treat inflammatory disorders such as anaphylaxis, systemic necrotizing vasculitis, systemic lupus erythematosus, a serum sickness syndrome, psoriasis, rheumatoid arthritis, adult respiratory distress syndrome (ARDS) , asthma, an allergic response, or a reperfusion injury occurring after periods of ischemia. Preferred therapeutics include antibodies which recognize and bind the N-terminal extracellular domain of IL-8 receptors. Once identified, an antibody- based therapeutic can be produced inexpensively in large quantities by using recombinant and molecular biological techniques. The invention also features a method of detecting the presence of neutrophils in a biological sample by obtaining a monoclonal antibody of the invention, obtaining a biological sample, contacting the sample with the antibody to allow the antibody to bind with any IL-8 receptors bound to neutrophils in the sample to form antibody/IL-8 receptor complexes, and detecting the complexes as an indication of the presence of neutrophils in the sample. In another method of detecting the presence of neutrophils in a biological sample, a monoclonal antibody is attached to a solid support as a capture antibody, the capture antibody is contacted with a biological sample and allowed to bind with any IL-8 receptors bound to neutrophils in the sample to bind these neutrophils to the support, any unbound neutrophils are removed from the support, neutrophils bound to the support are contacted with a labelled form of the antibody and allowed to form antibody/IL-8 receptor complexes, and these complexes are detected as an indication of the presence of neutrophils in the sample. The invention also features a method of isolating an IL-8 receptor from a liquid mixture by obtaining a monoclonal antibody of the invention, contacting the liquid mixture with the antibody to allow it to bind with any IL-8 receptors in the mixture to form antibody/IL-8 receptor complexes, separating the complexes from the mixture, and separating the IL-8 receptors from the complexes to isolate the receptors.

An "IL-8 receptor polypeptide" includes all or part of a cell surface protein which specifically binds IL-8 and signals the appropriate IL-8-mediated cascade of biological events. A "polypeptide" is any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation) . As used herein, a so-called "high affinity" IL-8 receptor is an IL-8A receptor, which has a K_d of 10 nM or less (and, preferably, having a K_d which is between 0.1 and 10 nM) , when the receptor is expressed on the surface of transfected mammalian cells. A "low affinity" IL-8 receptor is an IL-8B receptor, which has a K_d greater than 10 nM, when expressed on the surface of a Xenopus oocyte, and a K_d of 10 nM or less (and, preferably, having a K_d which is between 0.1 and 10 nM) , when expressed on the surface of transfected mammalian cells. In addition, the IL-8A receptor binds only to IL-8, whereas the IL-8B receptor binds to IL-8, as well as Groα and NAP-2.

A "substantially isolated polypeptide" is one which is substantially free of other proteins, carbohydrates, and lipids with which it is naturally associated. A "substantially identical" amino acid sequence is an amino acid sequence which differs from a second sequence only by conservative amino acid substitutions, for example, the substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative amino acid substitutions, deletions, or insertions located at positions of the amino acid sequence which do not impair the biological activity of the sequence. IL-8 receptors that are substantially identical to those described herein can be isolated by extraction from the tissues or cells of any animal which naturally produce such a receptor or which can be induced to do so, using the methods described below, or their equivalent; or can be isolated by chemical synthesis; or can be isolated by standard techniques of recombinant DNA technology, e.g., by isolation of cDNA or genomic DNA encoding such a receptor.

"Derived from" means encoded by the genome of that organism and present on the surface of a subset of that organism's cells. A "synthetic peptide" is one which is produced by chemical, e.g., peptide synthesis.

A "purified antibody" is one which is substantially free of other proteins, carbohydrates, and lipids with which it is naturally associated. Such an antibody "preferentially binds" to an IL-8 receptor (or fragment or analog, thereof), i.e., does not substantially recognize and bind to other antigenically- unrelated molecules. In a preferred embodiment, the antibody "preferentially binds" to the human IL-8B receptor, or a fragment or analog thereof, and in particular the N-terminus of the IL-8B receptor protein.

As used herein, the term "antibody" is meant to encompass monoclonal antibodies, whole, intact antibodies or antibody fragments having the immunological activity of the whole antibody. Also encompassed within the term "antibody" are chimeric antibodies having the variable and constant from different host species, or those wherein only the CDRs are replaced. Preferably, the antibody neutralizes the biological activity in vivo of the receptor protein to which it binds. The "biological activity," e.g., of an IL-8 receptor, is the ability to bind IL-8 and signal the appropriate cascade of biological events. The term "neutralize" means to partially or completely inhibit the biological activity of, e.g., an IL-8 receptor.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Brief Description of the Drawings Figs. 1A and B (SEQ ID NO: 1) are the nucleic acid sequence and deduced amino acid sequence of a "high affinity" IL-8 receptor subtype A derived from a rabbit source.

Figs. 2A and B (SEQ ID NO: 2) are a representation of the nucleic acid sequence and deduced amino acid sequence of a the IL-8A receptor subtype A derived from a human source.

Figs. 3A and B (SEQ ID NO: 3) are the nucleic acid sequence and deduced amino acid sequence of a "low affinity" IL-8 receptor subtype B derived from a rabbit source.

Figs. 4A and B (SEQ ID NO: 4) are the nucleic acid sequence and deduced amino acid sequence of a "low affinity" IL-8 receptor subtype B derived from a human source.

Fig. 5 is a schematic drawing illustrating the structure of a generic IL-8 receptor based on the IL-8 receptor subtype B derived from a human source.

Figs. 6A to 61 are graphs representing flow cytometry analysis of monoclonal antibody binding to transfected cells.

Figs. 7A to 7C are graphs representing flow cytometry analysis of monoclonal antibody binding to neutrophils. Fig. 8 is a graph showing ELISA analysis of a monoclonal antibody (4C1) binding to various synthetic IL-8 receptor peptides.

Fig. 9 is a graph showing binding inhibition of IL-8 to human IL-8B-expressing transfected cells vs. human IL-8A transfected cells.

Fig. 10 is a graph showing a monoclonal antibody (4C1) inhibiting IL-8 stimulated neutrophil chemotaxis vs. C5a stimulated chemotaxis. Fig. 11 is a graph showing how a monoclonal antibody (4C1) inhibits NAP-2 stimulated neutrophil chemotaxis.

Detailed Description The invention features IL-8 receptor-directed antibodies, e.g., monoclonal antibodies, that block the binding of IL-8 to IL-8 receptors, e.g., IL-8 A and/or IL-8B receptors. In particular, the invention features monoclonal antibodies raised against the human IL-8B receptor, which block the binding of IL-8 and NAP-2, to this receptor, and inhibit neutrophil chemotaxis. The antibodies should also block the binding of Groα, and can be used to detect the presence of neutrophils in biological samples.

IL-8 Receptor Polypeptides Polypeptides that can be used to produce the antibodies of the invention include the entire "high affinity" IL-8A receptor, as described in Figs. 1A and B, SEQ ID NO: 1 (rabbit) and Figs. 2A and B, SEQ ID NO: 2 (human) , and the entire "low affinity" IL-8B receptor as described in Figs. 3A and B, SEQ ID NO: 3 (rabbit) and

Figs. 4A and B, SEQ ID NO: 4 (human) . Such receptors can be derived from any source, but are preferably derived from a mammal, e.g., a human or a rabbit. Polypeptides of the invention also include any analog or fragment of the IL-8 receptors capable of interacting with IL-8 (e.g., those derived from the IL-8 receptor N-terminal extracellular domain) . Specific receptor analogs of interest include full-length or partial (see below) receptor proteins including an amino acid sequence which differs only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative amino acid substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the receptors' ability to bind IL-8 (as assayed below) . Specific receptor fragments of interest include any portions of the IL-8 receptor which are capable of interaction with IL-8, for example, all or part of the N- terminal extracellular domain. Such portions include transmembrane segments 1-7 and portions of the receptor deduced to be extracellular (Fig. 5) . Such extracellular fragments are useful as immunogens for producing antibodies which neutralize the activity of the IL-8 receptor in vivo, e.g., by interfering with the interaction between the receptor and IL-8, as described below. Extracellular regions are described below. Of particular interest are receptor fragments encompassing the extracellular amino-terminal domain (or an IL-8- binding fragment thereof) ; this domain includes approximately amino acids 1-37 of the IL-8A receptor isolated from a rabbit source, approximately amino acids 1-49 of the IL-8B receptor isolated from a rabbit source, and approximately amino acids 1-50 of the IL-8B receptor isolated from a human source. Also of interest are the IL-8 receptor extracellular loops; these include approximately amino acids 94-113, 186-202, and 268-285 of the IL-8A receptor isolated from rabbits; approximately amino acids 106-118, 183-210, and 272-298 of the IL-8B receptor isolated from rabbits; and approximately amino acids 107-120, 184-213, and 274-300 of the IL-8B receptor isolated from humans.

Such loops and extracellular N-terminal domain (as well as the full length IL-8 receptor) provide immunogens for producing anti-IL-8 receptor antibodies. For example, applicants have produced polyclonal antibodies to synthetic peptides corresponding to loop 2 and loop 3, and to the N-terminal extracellular domain of the high affinity receptor protein isolated from rabbits. Applicants have also produced monoclonal antibodies to the full human IL-8B receptor as described below. There now follows a description of the cloning and characterization of two IL-8 receptor-encoding cDNAs useful in the invention. These examples are provided for the purpose of illustrating the invention, and should not be construed as limiting. Cloning and Characterization of Rabbit IL-8A and B Receptors

The rabbit "high affinity" IL-8A receptor gene was isolated as follows.

Rabbit peritoneal neutrophils were isolated from rabbits by the method of Zigmond and Tranquillo, J. Biol. Chem.. 261:5283-88 (1986) and used as a source of poly(A)⁺ RNA. The RNA was prepared, transcribed into cDNA, and cDNA fragments inserted into the EcoRI site of λgtll (all by the methods of Maniatis et al., Molecular Cloning, Cold Spring Harbor Press, Cold Spring Harbor, New York, 1989) to produce a rabbit neutrophil cDNA library. 250,000 recombinant plagues were screened for those which hybridized to an antisense oligonucleotide of sequence: 3' TTG ATG AAG GAC GAC TCG GAC CGG ACI CGI CTG GAI TAG TAC 5' (SEQ ID NO: 5).

This probe was designed based on the sequence derived from the second transmembrane domain of G-protein-coupled receptors (see, e.g., Hartig et al., TIBS 10:64, 1989) .

This probe was 5'-end-labeled with [³²P]ATP (Du Pont-New England Nuclear, Boston, MA) and T4 kinase (New England Biolabs, Beverly, MA) by the methods of Maniatis et al., supra. The hybridization conditions were as follows: 6X SSPE, 1% SDS, 0.1% sodium pyrophosphate, IX Denhardt's, 100 μg/ml poly(A) , and 40 μg/ml denatured calf thymus DNA at 42°C for 12 h. Filters were washed with 2X SSC, 0.1% SDS at 50°C. After tertiary screening, six plaques were isolated. The insert of one of these plaques, termed F3R was of 2.5 kb in size. This insert was sequenced using Sequenase 2.0 (U.S. Biochemical Corp., Cleveland, OH) according to the method of Sanger et al., P.N.A.S.. USA. 7_4:5469 (1983). It displayed an open reading frame coding for a 354-amino acid protein (M_r = 40,528). The nucleic acid sequence and deduced amino acid sequences are shown in Figs. 1A and B. Putative N-liriked glycosylation sites are underlined in the sequence. Several structural features of the protein deduced from the F3R clone demonstrate that it belongs to the family of G-protein-coupled receptors. First, a hydropathy plot of the deduced protein sequence indicates the existence of seven putative transmembrane segments. Second, the primary structure of F3R shows a high degree of similarity to other G-protein-coupled receptors. In particular, the highest degree of homology is found to G- protein-coupled receptors that bind peptides such as the substance K and P receptors (Masu et al. , Nature, 329:836. 1987; Hershey and Krause, Science. 247:958. 1990) . Third, F3R exhibits several structural features attributed to G-protein-coupled receptors. For example, F3R contains two putative N-linked glycosylation sites in the N-terminus with no signal sequence. It also contains an aspartate at position 80 (i.e., in transmembrane segment II) which is conserved in all G-protein-coupled receptors, and the canonical Asp-Arg-Tyr tripeptide close to the putative transmembrane segment III. Like substance K and P receptors, F3R lacks Asp-113 in the putative transmembrane segment II which appears to be essential for binding of charged amines in adrenergic, muscarinic, dopaminergic, and serotonergic receptors (Dixon et al., Cold Spring Harbor Sy p. Quant. Biol. _r 53_:487, 1988); and like other G-protein-coupled receptors, F3R exhibits several critically-located serine and threonine residues which are potential substrates for protein kinases (Benovic et al., Ann. Rev. Cell Biol.. 4_.:405, 1988).

To further characterize expression of the F3R gene, the F3R cDNA was employed as a hybridization probe in Northern blot analysis of rabbit neutrophil RNA. RNA was isolated from neutrophils and other tissues by cesium chloride gradient centrifugation (Glisin et al., Biochemistry. 13_:2633, 1974), electrophoresed through 1% agarose formaldehyde gels, and blotted to GeneScreen membranes (Du Pont-New England Nuclear) by the method of Maniatis et al, supra. The blot was probed with a BawEI / EcoRI fragment of F3R (652 bases; nucleotides -27 to 625 of the rabbit IL-8 coding sequence) labeled with [³ P]dCTP by the random priming protocol of Pharmacia (Piscataway, NJ) . The hybridization solution contained 50% formamide, 5X SSPE, 5X Denhardt's, 0.1% sodium pyrophosphate, 1 mg/ml heparin, 100 μg/ml poly(A) , 1% SDS, and 200 ..g/ml denatured calf thy us DNA. The blot was hybridized at 42°C for 16 h, and then washed with 0.1X SSC and 0.1% SDS at 65°C.

The F3R probe hybridized specifically to a neutrophil RNA molecule of 2.6 kilobases. This confirmed that F3R was expressed in neutrophils and indicated that the F3R clone was nearly full-length. The F3R clone failed to hybridize to RNA isolated from rabbit uterine smooth muscle, skeletal muscle, lung, liver, or brain. It also failed to hybridize to poly(A)⁺ RNA from fibroblasts, epithelial, and endothelial cells.

Promyelocytic HL-60 cells exhibited very low levels of F3R mRNA; differentiated HL-60 cells expressed 20-fold higher levels of this RNA.

The F3R mRNA was translated in vitro in rabbit reticulocyte lysates by the method of Promega Corp.

(Madison, WI) . A protein of relative mass 30,000-32,000 Daltons was synthesized as determined by SDS- polyacrylamide gel electrophoresis (SDS-PAGE; carried out by standard techniques; see, e.g., Ausubel et al. , Current Protocols in Molecular Biology, Green Publishing Associates, New York, 1987) . The difference between the calculated M_r of 40,528 and the apparent M_r of about 31,000 was likely due to the fact that membrane proteins frequently exhibit increased mobility relative to soluble protein standards on SDS-PAGE (Bonitz et al., J. Biol. Chem. _P 255:11927. 1980; Rizzolo et al., Biochemistry. 15:3433, 1979).

Using the methods described above, a cDNA encoding the rabbit "low affinity" IL-8B receptor was also identified and isolated from the rabbit neutrophil library (described above) . This cDNA was subcloned into the EcoRI site of pUC19 to produce plasmid 5bla. Its nucleic acid sequence was determined by standard techniques and found to be similar, but not identical, to the high affinity receptor clone F3R. This nucleotide and deduced amino acid sequences are shown in Figs. 3A and B (SEQ ID NO: 3) .

Cloning of the Human IL-8B Receptor A human peripheral blood leukocyte λgtll cDNA library (5' stretch) obtained from Clontech (Palo Alto, CA) was screened with a 652 base pair EcoRl/BamHI fragment (including nucleotides -27 to 625) of the rabbit F3R clone. This probe was labeled with [³²P]dCTP by random priming as described above. Filters were hybridized with a solution containing 50% formamide, 200 μg/ml denatured calf thymus DNA, 5X SSPE, 1% SDS, 5X Denhardt's solution, and 0.1% sodium pyrophosphate, and incubated at 42°C for 16 hours. Filters were then washed with 0.1X SSC and 0.1% SDS at 65°C. After tertiary screening, several human clones which hybridized to the rabbit IL-8 probe were isolated. The insert of one such clone, termed 4AB, was found to be 4.0 kilobases in length; the insert was sequenced on both strands using Sequenase 2.0 (U.S. Biochemical Corp.) according to the method of Sanger et al. (supra) . The nucleic acid sequence and deduced amino acid sequence of the human IL- 8B receptor is shown in Figs. 4A and B (SEQ ID NO: 4) .

Alternatively, a human IL-8 receptor-encoding gene can be isolated by hybridization with the full-length F3R probe. This probe is labelled (e.g., radiolabelled) by standard techniques (see, e.g., Ausubel et al., Current Protocols in Molecular Biology, supra) and used to probe a human peripheral blood leukocyte library (e.g., the library described above) under low stringency conditions (e.g., hybridization in 50% formamide, 200 μg/ml denatured calf thymus DNA, 5X SSPE, 1% SDS, 5X Denhardt's solution, and 0.1% sodium pyrophosphate at an incubation temperature or 42°C for 16 hours) . Filters are washed initially under low stringency conditions (e.g., 2X SSC and 0.1% SDS and an incubation temperature of 50°C) and the stringency progressively increased, through four washes, to a final high stringency wash (e.g., 0.1X SSC and 0.1% SDS and an incubation temperature of 65°C) .

The human IL-8 receptor gene can also be isolated by PCR cloning using primer sequences based either on the sequence of clone 4AB, for example:

5' GAATATGGGGAATTTATTATGCAG 3' (SEQ ID NO: 6) and

5' AATGTGACTGTGAAGAGAAGGGAGG 3' (SEQ ID NO: 7) ; or based on sequences substantially shared by 4AB, 5bla, and F3R, for example:

5' GGGAAACTCCCTCGTGATGCTGG 3' (SEQ ID NO: 8) and

5' GTCTGCCAGCAGGACCAGGTTGTAGG 3' (SEQ ID NO: 9).

Primers are synthesized by standard cyanoethyl phosphora idite chemistry using, e.g., an Applied Biosystems DNA Synthesizer (Foster City, CA) .

Human neutrophils are isolated by standard techniques and used as a source of polyA⁺ RNA as described above. cDNA is synthesized, also as described above, and a neutrophil cDNA library created by insertion of the cDNA fragments into any standard cloning vector, e.g., λgtll. Alternatively, a human peripheral blood leukocyte λgtll cDNA library (5' stretch) can be purchased from Clontech (Palo Alto, CA) .

Approximately 100 ng of human neutrophil or human peripheral lymphocyte cDNA is combined with 1 μg of each of the synthetic primers and polymerase chain reaction is carried out by the directions of the manufacturer (Perkin-Elmer, Norwalk, CT) . The resultant PCR product is isolated by electrophoresis and cloned, e.g., into the vector SK+ (Stratagene, LaJolla CA) and amplified in Escherichia coli XL-1 blue (Stratagene) .

The human IL-8A receptor can be isolated and cloned in similar fashion. The nucleotide sequence encoding the human IL-8A receptor and the deduced amino acid sequence are shown in Figs. 2A and B (SEQ ID NO: 2) . Polypeptide Expression

IL-8 receptor polypeptides can be produced by transformation of a suitable host cell with all or part of an IL-8 receptor-encoding cDNA fragment (e.g., the cDNAs described above) in a suitable expression vehicle, e.g., a plasmid, and expression of the receptor.

Those skilled in the field of molecular biology understand that any of a wide variety of expression systems can be used to provide the recombinant receptor protein. The following host cells are suitable: COS-7, SP-2, NIH 3T3, and Chinese Hamster Ovary cells, and Chinese hamster lung fibroblast Dede cells. When expressing IL-8 receptor proteins for use as immunogens to raise monoclonal antibodies, specific cell lines are preferred, as described below. Such cells are available from a wide range of sources (e.g., the American Type Culture Collection, Rockville, MD) .

The method of transfection and the choice of expression vehicle will depend on the host system selected. Mammalian cell transfection methods are described, e.g., in Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989) ; expression vehicles can be chosen from those provided, e.g., in Cloning Vectors : A Laboratory Manual (P.H. Pouwels et al., 1985, Supp. 1987).

Production of IL-8B Receptor Expressing Cells BALB/c lymphoma 300.19 cells (Ault et al., Cell 27:381, 1981) were transfected by electroporation with a human IL-8B receptor expression plasmid, p4AB.NRDSH, to construct a stable cell line expressing a functional human IL-8B on the surface. The p4AB.NRDSH plasmid contains the 4AB cDNA clone of the human IL-8B receptor encoding nucleotides 13 to 1270 of SEQ ID NO: 4 described above, under the transcriptional control of a promoter active in host mammalian cells, e.g., the cytomegalovirus promoter and a 5' intron, along with a selectable marker, such as a neomycin resistance marker under the control of the herpes virus thymidine kinase promoter. The plasmid should include an E_-_ coli origin of replication. Other plasmids containing clones encoding an IL-8 receptor are also suitable. For example, commercially available plasmids, e.g., pRC/CMV (INVTTROGEN, San Diego, CA) , can be used with the amino acid sequence of the IL-8 receptor from the start ATG to the termination codon. Transfectants were selected with 1 mg/ml active G418 (Gibco) and single cell subcloned by limiting dilution. Resistant subclones were tested for IL-8 binding by radioligand binding assays or by flow cytometry analysis of biotinylated IL-8 binding, as described below. Subclone receptor cell line 300.19- 4AB.E3 was chosen for further analysis. Anti IL-8 Receptor Antibodies

Full length IL-8 A or B receptors (or immunogenic receptor fragments or analogs) can be used to raise antibodies useful in the invention. As described above, receptor fragments preferred for the production of antibodies are those fragments deduced or shown experimentally to be extracellular; such fragments include the extracellular N-terminus domain. Antibodies directed to IL-8 receptor peptides can be produced as follows. Peptides corresponding to all or part of the putative extracellular loops (approximately amino acids 94-113, 186-202, and 268-285 of the high affinity IL-8 receptor or approximately amino acids 107- 120, 184-213, and 274-300 of the low affinity IL-8 receptor) or to all or a portion of the extracellular N- ter inal domain (approximately amino acids 1-37 of the high affinity IL-8 receptor or approximately amino acids 1-50 of the low affinity IL-8 receptor) are produced using a peptide synthesizer, by standard techniques. The peptides are coupled to KLH with m-maleimide benzoic acid N-hydroxysuccinimide ester. The KLH-peptide is mixed with Freund's adjuvant and injected into animals, e.g. guinea pigs or goats. Antibodies are purified by peptide antigen affinity chromatography.

Using such a method, polyclonal antisera were raised against peptides which included the N-terminal extracellular domain and also to loops 2 and 3. In addition, monoclonal antibodies were raised against the full length human IL-8B receptor.

Once produced, antibodies are tested for specific IL-8 receptor recognition by Western blot or immunoprecipitation analysis (by the methods described in Ausubel et al., supra) . Antibodies which specifically recognize the IL-8 receptor are considered to be likely candidates for useful antagonists; such candidates are further tested for their ability to specifically interfere with the interaction between IL-8 and its receptor (as described below) . Antibodies which antagonize IL-8/IL-8 receptor binding or IL-8 receptor function are considered to be useful as antagonists in the invention.

Monoclonal Antibody Generation and Peptide ELISA Initial attempts to create monoclonal antibodies that not only bind to IL-8 receptors, but also block IL-8 binding and activation of the IL-8 receptors, were unsuccessful. Antibodies from hybridomas created by immunizing mice with intact human neutrophils were not specific for IL-8 receptor peptides or the full length receptors expressed on transfected cells. Antibodies raised against synthetic peptides corresponding to the four extracellular regions of both the human IL-8B receptor and the rabbit IL-8A receptor were not capable of binding to the full-length IL-8 receptor expressed on transfected cells, probably because of the receptors' complex secondary structure. Attempts to raise antibodies specific to approximately 9 x 10⁵ human IL-8B receptors expressed on COS or CHO cells were also unsuccessful. In spite of these difficulties, the following approach was successful in raising specific monoclonal antibodies that not only bind to the IL-8 receptor, but also inhibit its function. The key to this approach is to present the IL-8 receptor in an immunologically silent background such that the immune response can be focused on the receptor polypeptide. One way to achieve such a syngeneic background is to express the receptor in an animal cell line that is derived from the same animal strain, e.g., an in-bred mouse, that are immunized with these transfected cells. Examples of such cell lines and animal strains include the BALB/3T3 fibroblast cell line (ATCC No. CCL163) and BALB/c mice, 300.19 cells and BALB/c mice, and Y3-Agl.2.3 rat myeloma cell line (ATCC No. CRL1631) and Lou rats. In a particular example, 300.19-4AB.E3 cells provided a means of immunizing BALB/c mice with an IL-8 receptor presented in an immunologically silent background. BALB/c mice were immunized intraperitoneally with 6xl0⁶ 300.19-4AB.E3 cells and then boosted two weeks later with 5xl0⁶ cells. A second boost was given three weeks later with 7xl0⁶ cells. One month after the second boost, mice were injected with 5xl0⁶ cells. Sera of immunized mice were tested for antibody reactivity to several human IL-8B receptor amino terminal synthetic peptides, and spleens from those mice exhibiting titers to any of these peptides four days after the last booster were used in fusions to create hybridomas. Splenocytes were fused with SP2/0 cells according to a standard fusion protocol as described in Harlow and Lane, Antibodies: Laboratory Manual. Cold Spring Harbor Press (1988) .

Hybridoma wells were screened by testing supernatants by flow cytometry on 300.19 untransfected cells versus 300.19-4AB.E3 cells. Two hybridomas that produced antibodies, GQ1.4C1 (4C1) and GQ5.1E3 (1E3) , that bound only to the surface of the human IL-8B expressing (300.19-4AB.E3) cells. These hybridomas were subcloned and used for further studies. In addition, these two hybridomas, GQ1.4C1 and GQ5.1E3, were deposited on April 27, 1994, with the A.T.C.C. under Accession Nos. HB11623 and HB11624, respectively.

The hybridoma cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of this application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 USC 122. The deposits are available as required by foreign patent laws in countries wherein counterparts of this application, or its progeny, are filed.

Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposits, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures plus five years after the last request for a sample from the deposit. The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposits. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them.

Stable cell lines were established in CHO cells which separately express about 900,000 or 250,000 human IL-8 receptor subtypes B or A, respectively. These cells were used to test for 4C1 or 1E3 binding by flow cytometry analysis (Figs 6A to 61) . The nine panels of Figs. 6A to 61 are as follows: untransfected CHO cells with a negative control antibody (A) , 4C1 (B) , and 1E3

(C) ; IL-8B receptor transfected CHO cells with a negative control antibody (D) , 4C1 (E) , and 1E3 (F) ; and IL-8A receptor transfected CHO cells with a negative control antibody (G) , 4C1 (H) , and 1E3 (I) . The X-axes indicate relative fluorescence intensity, and Y-axes indicate cell number.

Figs. 6A to 6F show that monoclonal antibodies 4C1 and 1E3 bound to CHO IL-8B receptor transfected cells vs. untransfected CHO cells. However, 4C1 and 1E3 exhibit little if any binding to human IL-8A as seen by flow cytometry analysis of human IL-8B-expressing versus untransfected CHQ cells (Figs. 6G to 6H, and 6A to 6C) . In addition, Figs. 7A to 7C show that monoclonal antibody 4C1 (7B) and 1E3 (7C) bound to human neutrophils vs. an isotype-matched negative control antibody (7A) .

Analysis of the binding of the GQ1.4C1 and GQ5.1E3 supernatant to peptides was performed using standard ELISA procedures (Harlow & Lane, supra) . The antibody epitope was approximated by ELISA analysis of peptide binding activity of antibodies 4C1 and 1E3. 4C1 was tested for binding to synthetic peptides representing the sequences of three of the four extracellular domains of the human IL-8B receptor: Glu to Ser₂ , and Lys₁₆ to Cys₃₉ of the amino-terminal region; Arg₁₈₅ to Arg₂₀₈ of the extracellular loop 2; and Ala₂₇₃ to Asp₂₉₇ of the extracellular loop 3 (Fig. 8) . Antibody 1E3 did not exhibit any appreciable binding to these synthetic peptides.

The ELISA assay is a so-called colorimetric assay, in which specific absorbance of a reaction mixture, that ranges from clear to a dark blue, is measured. A specific absorbance of 1.5 is a very high reading, and indicates a high amount of bound antibody. Fig. 8 shows the specific absorbance for antibody binding to peptides corresponding to different receptor types and residue numbers. For example, huIL8Rb2-27 is the Glu₂ to Ser₂₇ region in the human IL-8B receptor, and rabIL8Ral80-204 is the 185 to 204 region of the rabbit IL-8A receptor. The 4C1 hybridoma supernatant exhibited strong binding only to the amino-terminal Lys₁₆ to Cys₃₉ peptide of the human IL-8B receptor. If a high concentration (e.g., 8 μg/ml) of purified 4C1 is used, a moderate level of reactivity to the Arg₁₈₅ to Arg ₀₈ loop 2 peptide of the human IL-8B receptor can also be seen. There is little homology between these two peptides with the exception of an identical tripeptide (Tyr₂₅-Ser₂₆-Ser ₇ in the amino-terminal peptide) . This short stretch of identity may permit the weak binding of 4C1 to the loop 2 peptide. Synthetic peptides representing residues of regions of the other cloned IL-8 receptors were also tested. No binding was seen to two human IL-8A receptor amino-terminal peptides, and to rabbit IL-8A receptor amino-terminal and loop 2 peptides (Fig. 8) . However, moderate binding was seen to an amino-terminal peptide (rabIL8Rb21-46) of the putative rabbit IL-8B receptor, which is analogous to the Lyε₁₆ to Cys₃₉ peptide of the human IL-8B receptor. 1E3 exhibited no binding to any of these synthetic peptides. Construction of Chimeric IL-8 Receptors Complementary type A/type B chimeric receptors were constructed by digesting the expression vectors F3R- pSVL and 4AB-pSVL with Xhol and Celll, and exchanging a fragment encoding the amino terminus of one receptor for a fragment encoding the amino terminus of the other receptor. Specifically, a 271 bp Xhol-Celll fragment of F3R containing the first 58 codons of the rabbit IL-8A receptor (i.e., up to and including Ser₅₈ of Figs. 1A and B) was excised from F3R-pSVL and cloned into a Xhol-Celll ended 4AB-pSVL backbone. In a separate construction, a 283 bp Xhol-Celll fragment of 4AB containing the first 62 codons of the human IL-8B receptor (i.e., up to and including Ser₆₂ of Figs. 4A and B) was likewise excised from 4AB-pSVL and cloned into a Xhol-Celll ended F3R-pSVL backbone. A chimeric IL-8 receptor gene was thus created encoding the amino-terminal 58 amino acids of rabbit F3R fused to the 298 carboxy-terminal amino acids of human 4AB (termed F3R/4AB) , and the second encoding the amino- terminal 62 amino acids of human 4AB fused to the 297 carboxy-terminal amino acids of rabbit F3R (termed 4AB/F3R) .

Additional chimeric receptors exchanging shorter regions were constructed in a similar way and used to further localize the antibody binding sites. For example, chimeric receptor RH1 contains the region 70-360 of the human IL-8B receptor and the entire extracellular amino-terminal portion 1-65 of the rabbit IL-8A receptor. RH2 contains all residues after Glu₄₀ of the human IL-8B receptor, e.g., 41-360, and region 1-36 of the rabbit IL- 8A receptor. RH3 contains all residues after Leu₂₉ of the human IL-8B receptor, e.g., 30-360, and region 1-25 of the rabbit IL-8A receptor. COS cells were transiently transfected with each expression plasmid, and three days after transfection, cell membrane fragments were purified and 5 μg of total membrane protein was spotted onto a nitrocellulose filter membrane. The membrane protein spots were tested for binding of each antibody by standard Western blot methods for epitope mapping of the human IL-8B receptor (Table 1, below) .

TABLE 1

ES5.4E3 G01.4C1 G05.1E3 vector only - human IL-8A - - - human IL-8B + +

RH1 (huIL-8B 70-360) -

RH2 (huIL-8B 41-360) -

RH3 (huIL-8B 30-360) - + -

The results indicate that 4C1 binds the intact human IL-8B receptor, but not to the RH1 or RH2 chimerics, in agreement with the peptide ELISA data indicating that the amino-terminal region from Lys₁₆ to Glu₄₀ contains the antibody binding site. 4C1 binds to RH3 indicating that the region from Pro₃₁ to Glu₄₀ (Pro- Phe-Leu-Leu-Asp-Ala-Ala-Pro-Cys-Glu) is required for binding, and that residues amino-terminal to Pro₃₁ are not required. Thus, the binding site of 4C1 on the human IL- 8B receptor is a region approximately midway between the amino-terminus and the predicted start of the first transmembrane domain.

Antibody 1E3 exhibited binding only to the intact human IL-8B receptor, suggesting that it binds to an epitope formed at least in part by the 30 most proximal amino-terminal residues.

Modifying Monoclonal Antibodies for Use in Humans Since, for the most part, monoclonal antibodies are produced in species other than humans, they are often immunogenic to humans. Accordingly, it may be necessary to modify such monoclonal antibodies to make them compatible for use in humans. For example, a chimeric antibody molecule can be made wherein the portion of the polypeptide involved with ligand binding (the variable region) is derived from one species, and the portion involved with providing structural stability and other biological functions (the constant region) is derived from a human antibody. Methods for producing chimeric antibodies in which the variable domain is derived from one host and the constant domain is derived from a second host are well known to those skilled in the art. See, for example, Neuberger et al. , WO Publication No. 86/01533, Morrison et al., EP Publication No. 0,173,494, and Cabilly et al. , U.S. Patent No. 4,816,567.

An alternative method, in which an antibody is produced by replacing only the complementarily determining regions (CDRs) of the variable region with the CDRs from an immunoglobulin of the desired antigenic specificity, is described in Winter, U.S. Patent No. 5,225,539 (corresponding to GB Publication No. 2,188,638). For example, murine monoclonal antibodies can be made compatible with human therapeutic use by producing an antibody containing a human Fc portion as described in Morrison, Science. 229:1202-1207 (1985). Established procedures allow construction, expression, and purification of such a hybrid monoclonal antibody.

Testing of IL-8 Receptor Antibodies

Assays for IL-8 Receptor Binding and Function Useful antibodies are those which block the binding of IL-8 to the IL-8 receptors. Such a blocking interaction can be detected by an in vitro binding assay (see below) . The antibody can also be assayed to determine whether it neutralizes the IL-8 receptor, i.e., for its ability to inhibit the receptor's mobilization of Ca⁺⁺ (see below) . These assays include, as components, IL-8 and a recombinant IL-8 receptor (or a suitable fragment or analog) configured to permit detection of binding, and the antibody to be tested. IL-8 can be obtained from Genzyme (Cambridge, MA) .

Preferably, the IL-8 receptor component is produced by a cell that naturally presents substantially no receptor, e.g., by engineering such a cell to contain nucleic acid encoding the receptor component in an appropriate expression system. Suitable cells are, e.g., those discussed above with respect to the production of recombinant receptor, such as the myeloma cells, J558 or SP2. In vitro assays to determine the extent of IL-8 binding to the IL-8 receptor can be carried out using either whole cells or membrane fractions. A whole cell assay is preferably performed by fixing the cell expressing the IL-8 receptor component to a solid substrate (e.g., a test tube, a microtiter well, or a column) by means well known to those in the art (see, e.g., Ausubel et al., supra) . and presenting labelled IL- 8 (e.g., ¹²⁵I-labelled IL-8) . Binding is assayed by the detection label in association with the receptor component (and, therefore, in association with the solid substrate) .

The assay format can be any of a number of suitable formats for detecting specific binding, such as a radioimmunoassay format (see, e.g., Ausubel et al., supra) . Preferably, cells transiently or stably transfected with an IL-8 receptor expression vector (see above) are immobilized on a solid substrate (e.g., the well of a microtiter plate) and reacted with IL-8 which is detectably labelled, e.g., with a radiolabel or an enzyme which can be assayed, ^' e.g. , alkaline phosphatase or horseradish peroxidase.

In a typical experiment using isolated membranes, COS cells were transiently transfected with varying amounts of the rabbit IL-8 receptor-expressing clone F3R- pSVL (see above) . Membranes were harvested by standard techniques and used in an in vitro binding assay (see below) . ¹²⁵I-labelled IL-8 was bound to the membranes and assayed for specific activity; specific binding was determined by comparison with binding assays performed in the presence of excess unlabelled IL-8. The results are shown in Table 2 below.

TABLE 2

Transfected DNA Non-Specific Specific rug) Binding fcpm) Binding tcpm)

0 470 383

1 602 3837

2 589 6594

3 541 8620

4 601 8137

In another typical experiment using whole cells, COS cells were transiently transfected with 8 μg of the human IL-8-expressing clone 4AB-pSVL. Cells were harvested after three days and 2.5 nM ¹²⁵I-labelled IL-8 was added to approximately 1 X 10⁵ whole cells (in 200 μl PBS) . Cells were incubated with IL-8 for 45 minutes at 4°C, pelleted by centrifugation, rinsed with cold phosphate buffered saline, and the cell-bound radioactivity measured in a gamma counter. Specific binding was determined by comparison with binding assays performed in the presence of excess (i.e., 250 nM) unlabelled IL-8. The results are shown in Table 3 below. TABLE 3

Transfected DNA Non-Spec: Lfic Specific (8 ug) Binding (cpm) Binding (cpm) pSVL 385 0

F3R-pSVL 904 3663

4AB-pSVL 471 2521

4AB-pSVL 715 2393

Alternatively, IL-8 can be adhered to the solid substrate (e.g., to a microtiter plate using methods similar to those for adhering antigens for an ELISA assay; Ausubel et al., supra) and the ability of labelled IL-8 receptor-expressing cells to bind IL-8 (e.g., labelled with ³H-thymidine; Ausubel et al., supra) can be used to detect specific receptor binding to the immobilized IL-8.

In one particular example, a vector expressing the IL-8 receptor (or receptor fragment or analog) is transfected into myeloma cells (e.g., J558 or SP2 cells) by the DEAE dextran-chloroquine method (Ausubel et al., supra) . Expression of the receptor protein confers binding of detectably-labelled IL-8 to the cells. IL-8 does not bind -significantly to untransfected host cells or cells bearing the parent vector alone; these cells are used as a "control" against which the binding assays are measured. Tissue culture dishes (e.g., 10 cm. dishes) are seeded with IL-8 receptor-expressing myeloma cells (approximately 750,000 cells, dish) 12-18 hours post- transfection. Forty-eight hours later, triplicate dishes are incubated with 0.5nM radioiodinated IL-8 (200 Ci/mmol) and binding to the receptor-bearing cells is assayed (e.g., by harvesting the cells and assaying the amount of detectable label in association with the cells) . Cells which specifically bind labelled IL-8 are those which exhibit a level of binding (i.e., an amount of detectable label) which is greater than that of the control cells.

Alternatively, IL-8 receptor encoding RNA (prepared as described below) is injected into Xenopus laevis oocytes by standard methods. The RNA is translated in vivo in the oocytes, and the IL-8 receptor protein is inserted into the cell membrane. To test for IL-8 binding, oocyte membranes are prepared by sucrose gradient centrifugation (by the method of Colman, Transcription and Translation , IRL Press, Oxford, 1986) and ¹²⁵I-labelled IL-8 is added, and the membrane preparation subjected to vacuum filtration through Whatman GF/C filters (by the method of Williamson, Biochemistry. 27:5371, 1988). A recombinant receptor can also be assayed functionally for its ability to mediate IL-8-dependent mobilization of calcium. Cells, preferably myeloma cells, transfected with an IL-8 expression vector (as described above) are loaded with FURA-2 or INDO-1 by standard techniques. Mobilization of calcium induced by IL-8 is measured by fluorescence spectroscopy as previously described (Grynkiewicz et al., J. Biol. Chem.. 260:3440. 1985).

In another example, monocyte IL-8 was iodinated as previously described in Thomas et al., J. Biol. Chem.. 266:14839-41 (1991), or purchased from NEN-Dupont (Boston, MA). 300.19.4AB.E3 cell binding was performed using 1 to 2 x 10⁶ cells in 100 μ.1 PBS supplemented with 0.5%BSA (PBS/BSA) , containing 0.5 nM labeled IL-8 and increasing concentrations of unlabeled competitor or antibody, on ice for 90 minutes. Reactions were terminated by rapid filtration through GF/C filters that had been presoaked in 0.3% polyethanolamine. The filters were washed twice with 10 ml ice-cold PBS/BSA and the bound IL-8 was determined by gamma counting. In each case, background binding was determined using untransfected cells or by including 2 μ,M unlabeled IL-8 in the binding reaction. IL-8 and NAP-2 were expressed as nonfusion proteins in I _ coli and purified by ion- exchange and high-pressure liquid chromatography. Flow Cytometry

Neutrophils, untransfected, or transfected cells (1 to 5 x 10⁶) were incubated with hybridoma supernatant for 30 minutes at 4°C, washed with ice-cold PBS supplemented with 1% BSA, and stained for 30 minutes at 4°C with FITC-conjugated goat anti-mouse IgG (H+L) or FITC-conjugated streptavidin, as appropriate. The cells were washed as above, fixed with 2% paraformaldehyde, and analyzed on a Becton Dickinson FACScan with data analysis using LYSIS II software.

Assaying Antibody Blocking of IL-8 Binding One aspect of the invention features assaying the effectiveness of the antibodies to block the interaction between IL-8 and the IL-8 receptor, and neutralizing, i.e., preventing or reducing the cascade of events that are mediated by that interaction. The elements of the assay are IL-8 and recombinant IL-8 receptor (or a suitable receptor fragment or analog, as outlined above) configured to permit detection of binding. As described above, IL-8 can be purchased from Genzyme and a full- length rabbit or human IL-8 receptor (or an IL-8-binding fragment or analog) can be produced as described herein.

Binding of IL-8 to its receptor can be assayed by any of the methods described above. Preferably, cells expressing recombinant IL-8 receptor (or a suitable IL-8 receptor fragment or analog) are immobilized on a solid substrate (e.g., the well of a microtiter plate or a column) and reacted with detectably-labelled IL-8 (as described above) . Antibody binding is assayed by the detection label in association with the receptor component (and, therefore, in association with the solid substrate) . Binding of labelled IL-8 to receptor-bearing cells is used as a "control" against which antibody assays are measured. The antibody assays involve incubation of the IL-8 receptor-bearing cells with an appropriate amount of candidate antibody. To this mix, an equivalent amount of labelled IL-8 is added. An antibody useful in the invention specifically blocks labelled IL-8 binding to the immobilized receptor- expressing cells.

An antibody is then tested for its ability to interfere with IL-8 function, i.e., to specifically block labelled IL-8 binding to inhibit signal transduction normally mediated by the receptor. To test this using a functional assay, stably transfected cell lines containing the IL-8 receptor can be produced as described herein and reporter compounds such as the calcium binding agent, FURA-2, loaded into the cytoplasm by standard techniques. Stimulation of the heterologous IL-8 receptor with IL-8 or another agonist leads to intracellular calcium release and the concomitant fluorescence of the calcium-FURA-2 complex. This provides a convenient means for measuring antibody activity. Inclusion of potential antibodies along with IL-8 allows for the screening and identification of authentic receptor antibodies as those which effectively block IL-8 binding without producing fluorescence (i.e., without causing the mobilization of intracellular Ca⁺⁺) . Such an antibody can be expected to be a useful therapeutic agent for inflammatory disorders.

Uses of Anti-IL-8 Receptor Monoclonal Antibodies The monoclonal antibodies of the invention have various m vitro and in vivo uses. For example, they can be used in a diagnostic assay to screen for the presence of neutrophils in various biological samples, they can be used to detect and isolate IL-8 receptors, and they can be administered to patients for therapeutic uses, e.g., to inhibit binding of IL-8, NAP-2, or Groα to IL-8 receptors and to neutralize chemokine-mediated neutrophil chemotaxis.

Diagnostic Assays for Neutrophils

The antibodies of the invention can be used to screen various biological fluids for the abnormal presence of neutrophils as an indication of an inflammatory disorder, e.g., infection, presence of a pathogen, inflammation, or an allergic response associated with neutrophils, e.g., dermatitis and asthma. For example, the abnormal presence of neutrophils in the cerebrospinal fluid is an indication of meningitis, in the urine is an indication of a urinary tract infection, in the stool is an indication of an infectious intestinal disorder, in the sputum is an indication of bronchitis, in the bronchial/alveolar fluid is an indication of pneumonia, and in the peritoneal fluid is an indication of peritonitis.

Any standard assay format can be used. For example, in a competitive binding inhibition assay, the sample fluid, e.g., from a human patient, is exposed to antibodies bound to a solid substrate in the presence of a known amount of labeled IL-8 receptor or appropriate receptor peptide. A decrease in the amount of bound labelled IL-8 receptor indicates the presence of neutrophils, which bear native IL-8 receptors, in the sample. The presence of any IL-8 in the sample fluid may impair the assay results by binding to the IL-8 receptors. This IL-8 can be removed by selective centrifugation of the sample, or by the use of anti-IL8 antibodies, e.g., those described in Sekido et al., supra. prior to or during the assay.

The presence of neutrophils in bodily fluids can also be quantitated in a sandwich ELISA format. Antibodies 4C1 or 1E3 are attached to the wells of a 96- well ELISA plate to act as capture antibodies. Samples are added to the wells and after an appropriate incubation period to allow the fixed antibody to bind to the neutrophil surface IL-8B receptors, the sample is removed and bound neutrophils can be detected by measuring the subsequent binding of labelled (e.g., iodinated, fluorescein, peroxidase conjugated) 4C1 or 1E3 to other IL-8B receptors on the surface of the neutrophils not bound to the capture antibodies. The number of neutrophils present is quantified by comparison of the sample with a standard curve of known quantities of IL-8B receptor (either on intact neutrophils, transfected cells, or purified membranes from either) . Another way to measure neutrophils in fluid samples is to subject these samples to flow cytometry analysis (FACS) using either 4C1 or 1E3. The samples potentially containing neutrophils are prepared as described above for neutrophils in the subsection entitled "Flow Cytometry." In each of these methods, the use of the IL-8B receptor-directed antibodies provides specificity for neutrophil detection since this receptor is expressed at high levels exclusively on neutrophils. Different assays that use antibodies to other neutrophil-bound receptors, which are also found in detectable levels on other cell types, are thus much less specific.

Detection and Isolation of IL-8 Receptor Peptides

The antibodies of the invention also can be used to detect and isolate IL-8 receptor proteins and peptides, e.g., recombinant receptor proteins. To detect expression of an IL-8 receptor, or receptor fragment or analog, the antibody is preferably produced using, as an immunogen, an epitope^' included in the fragment or analog. Once the IL-8 receptor protein (or fragment or analog, thereof) , e.g. , a recombinant peptide, is expressed, it is isolated, e.g., using immunoaffinity chromatography. In one example, an anti-IL-8 receptor antibody (e.g., the IL-8 receptor antibody described above) can be attached to a column and used to isolate intact receptor or receptor fragments or analogs. Lysis and fractionation of receptor-harboring cells prior to affinity chromatography can be performed by standard methods (see, e.g., Ausubel et al., supra) . Once isolated, the recombinant protein can, if desired, be further purified, e.g., by high performance liquid chromatography (see, e.g. , Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, eds., Work and Burdon, Elsevier, 1980) .

Therapy

The antibodies of the invention are suitable for treating any inflammatory disorder in which neutrophils play a principal role, such as psoriasis, rheumatoid arthritis, and other chronic disorders, as well as acute inflammatory disorders such as reperfusion injury, septic shock, trauma shock, allergic responses involving neutrophils such as dermatitis and asthma, and pulmonary disorders such as adult respiratory distress syndrome (ARDS) and inflammatory airway disorders caused by bacterial infections, e.g., in cystic fibrosis patients, or an allergic response. The antibodies can be formulated in an appropriate buffer such as physiological saline for administration. In particular, the antibodies inhibit or reduce binding of IL-8, NAP-2, and Groα to IL-8B receptors, and IL-8 to IL-8A receptors, and neutralize chemokine- mediated chemotaxis of neutrophils, as demonstrated in the following assays. Both of these activities of the antibodies are useful to treat inflammatory disorders, e.g. , to reduce, inhibit, or prevent the increase of, neutrophil-associated inflammation.

Inhibition of IL-8B Receptor Binding of IL-8 Flow cytometry analysis of monoclonal antibody 4C1 binding to various transfected cells indicated that an excess of IL-8 interfered with 4C1 binding suggesting that the antibody binding site is in the proximity of the IL-8 binding site. 4C1 inhibition of IL-8 binding was directly tested in a radioligand binding assay using the human IL-8B receptor-expressing 300.19-4AB.E3 cell line as described above. The specific binding for each point was used to determine the percent inhibition shown in Fig. 9. Binding background was determined using 500 nM unlabeled IL-8 and was subtracted from the total binding. The nonspecific binding was approximately 3.0% of the total binding.

300.19 human IL-8A receptor-transfected cells (dashed line) and 300.19 human IL-8B receptor-transfected cells (2 x 10⁶) (solid line) were incubated with 0.5 nM ¹²⁵I-labeled IL-8 in the presence of increasing concentrations of the 4C1 antibody or an isotype-matched negative control (single diamond point) . Increasing concentrations of 4C1 blocked the binding of the labeled IL-8 in a dose-dependent manner, while the negative control antibody showed no inhibition. Fig. 9 shows that antibody 4C1 inhibits about 60% of the binding of IL-8 at an antibody concentration of 100 ug/ml.

In addition, there was no inhibition of IL-8 binding to 300.19 cells expressing the human IL-8A receptor, again confirming the flow cytometry data indicating that the 4C1 antibody is specific for the B subtype.

Neutralization of Chemokine- Mediated Neutrophil Chemotaxis

One of the primary activities of IL-8 is neutrophil chemotaxis. It is believed that local production of IL-8 establishes a chemotactic gradient recognized by neutrophils resulting in their transendothelial migration to sites of inflammation. The ability of the 4C1 antibody to inhibit this chemotactic activity of IL-8 was tested by performing standard neutrophil chemotaxis assays in the presence of increasing concentrations of either the 4C1 or an isotype-matched negative control antibody.

The chemotaxis assay used was the 48-well micro- chemotaxis assay described in Falk et al., J. Immunol. Methods. 3_3:239-247 (1980). After a 30 minute incubation period at 37°C, the upper chamber was removed and cells on the filter from the upper chamber were scraped away. The filter was fixed with 100% ethanol and stained with a solution of 0.5% toluidine blue in 3.7% formaldehyde. Excess stain was removed with distilled water. Migrated cells were quantitated by counting three high power fields at 400x magnification per well.

As shown in Fig. 10, human neutrophils were tested for chemotaxis to 100 nM IL-8 (dark stippled) or C5a (light stippled) in the presence of increasing concentrations of 4C1 or 100 μg/ml of an isotype-matched negative control (ES5) or an anti-CDllb antibody. The chemotaxis induced by 100 nM IL-8 (« EC₈₀) was inhibited by about 65% with 50 μg/ml 4C1 (« 342 nM) , while the negative control antibody showed no inhibition. This extent of inhibition was maximum with greater concentrations of antibody producing no further inhibition. This inhibition of chemotaxis is specific to the IL-8 receptor-mediated response, because no concentration of 4C1 exhibited inhibition of C5a- meditated chemotaxis. The positive control CDllb- directed antibody blocked migration induced by both chemotactins (Fig. 10) .

In addition to IL-8, other members of the α- chemokine family, Groα, NAP-2, and ENA-78, are chemotactic for neutrophils. It has been shown that Groα and NAP-2 bind with high affinity only to the IL-8B receptor (LaRosa et al., supra) . and therefore presumably induce chemotaxis through this receptor. The extent of 4C1 inhibition of NAP-2 chemotaxis was also examined and the results are shown in Fig. 11.

Human neutrophils were tested for chemotaxis to 100 nM NAP-2 with the presence of increasing concentrations of 4C1 or 100 μg/ml of an isotype-matched negative control (ES5) or an anti-CDllb antibody. 4C1 exhibited a dose-dependent inhibition of NAP-2 mediated chemotaxis and this inhibition was found to approach 100% (Fig. 11) . The inhibition again plateaued between 50 to 75 μg/ml of the antibody (90% to 95% inhibition) . This greater degree of inhibition seen with NAP-2-directed chemotaxis compared to IL-8-directed chemotaxis is due to the specificity of NAP-2 to the IL-8B receptor. Thus, there is essentially no IL-8A receptor background, i.e., 4Cl-independent, activity. The control antibody ES5 showed no inhibition.

These results confirm that the activity of both the IL-8A and IL-8B receptors is not required for the chemotactic response to the human IL-8B receptor-specific chemokines (Groα and NAP-2) in which it appears that the B receptor alone is sufficient for the response. Administration Therapeutic preparations containing the antibodies are administered in accordance with the disorder to be treated. Ordinarily, they will be administered intravenously, at a dosage that provides effective inhibition of binding of IL-8 or other che okine, or neutrophil chemotaxis. Alternatively, it can be convenient to administer the therapeutic preparations orally, nasally, or topically, e.g., as a liquid or a spray. Effective systemic dosages can be achieved by an injection of about 10 μg to 10 mg/kg, and more preferably 0.1 to 1.0 mg/kg. Treatment can be repeated as necessary for alleviation of disease symptoms. Antibodies can also be administered to prevent inflammation.

The proper dosage naturally depends on clinical indications and severity of the inflammatory disorder, and on characteristics of the patient such as weight, and can be determined by a physician of ordinary skill in this field based on the guidelines provided above. The methods of the invention can be used to inhibit or reduce inflammatory responses in any mammal, for example, humans, domestic pets, or livestock. Where a non-human mammal is treated, the IL-8 receptor antibody employed is preferably specific for that species.

The therapeutic effects of the anti-IL-8 receptor antibodies of the invention can be tested in known animal models. For example, Sekido et al., supra. describes a rabbit model of lung reperfusion injury. In this model, antibodies 4C1 and/or 1E3 can be administered at a dosage of 0.1 to 1 mg/kg to rabbits that have regional lung ischemia. These antibodies should inhibit the chemotaxis of circulating neutrophils to IL-8 and thus their migration to the ischemic tissue upon reperfusion. This inhibition or decrease of the neutrophil migration should therefore result in decreased tissue injury that is usually associated with the reperfusion of ischemic tissue. In another example, Simpson et al., Circulation. 81:226 (1990), describes a canine model of myocardial infarction. The antibodies 4C1 and/or 1E3 can be administered at a dosage of about 1.0 mg/kg during coronary artery occlusion, and/or at a dosage of 0.5 to 1 mg/kg at short intervals after removal of the occlusion. Inhibiting the ability of circulating neutrophils to chemotactically respond to IL-8 should also inhibit their migration to the infarcted tissue, thereby reducing the injury and infarct size.

Other Embodiments It is to be understood that while the invention has been described in conjunction with the detailed description thereof, that the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Repligen Corporation the Trustees of Boston University

(ii) TITLE OF INVENTION: ANTIBODIES TO INTERLEUKIN-8

RECEPTORS AND METHODS OF USE

(iii) NUMBER OF SEQUENCES: 9

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Fish & Richardson

(B) STREET: 225 Franklin Street

(C) CITY: Boston

(D) STATE: Massachusetts

(E) COUNTRY: U.S.A.

(F) ZIP: 02110-2804

(V) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5" Diskette, 1.44 Mb

(B) COMPUTER: IBM PS/2 Model 50Z or 55SX

(C) OPERATING SYSTEM: IBM P.C. DOS (Version 3.30)

(D) SOFTWARE: WordPerfect (Version 5.0)

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/237,937

(B) FILING DATE: 02-MAY-94

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/210,250

(B) FILING DATE: 15-MAR-94

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/803,842

(B) FILING DATE: 09-DEC-91

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/726,606

(B) FILING DATE: 09-JUL-91

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/685,101

(B) FILING DATE: 10-APR-91 (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Fasse, J. Peter

(B) REGISTRATION NUMBER: 32,983

(C) REFERENCE/DOCKET NUMBER: 04766/015WO1

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (617) 542-5070

(B) TELEFAX: (617) 542-8906

(C) TELEX: 200154

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 1 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1200

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 1

CCGGCNTCNG AGCAGCTGAA GCTTGCATGC CTGCAGGTCG ACTCTAGAGG ATCCCCGGGT 60

ACCGAGCTCG AATTCAGCTC CGATCTTAAG GTGAAACTGT GGCCGTA ATG GAA GTA 116

Met Glu Val

1

AAC GTA TGG AAT ATG ACT GAT CTG TGG ACG TGG TTT GAG GAT GAG TTT 164 Asn Val Trp Asn Met Thr Asp Leu Trp Thr Trp Phe Glu Asp Glu Phe 5 10 15

GCA AAT GCT ACT GGT ATG CCT CCT GTA GAA AAA GAT TAT AGC CCC TGT 212 Ala Asn Ala Thr Gly Met Pro Pro Val Glu Lys Asp Tyr Ser Pro Cys 20 25 30 35

CTG GTA GTC ACC CAG ACA CTT AAC AAA TAT GTT GTG GTC GTC ATC TAT 260 Leu Val Val Thr Gin Thr Leu Asn Lys Tyr Val Val Val Val lie Tyr 40 45 50

GCC CTG GTC TTC CTG CTG AGC CTG CTG GGC AAC TCC CTG GTG ATG CTG 308 Ala Leu Val Phe Leu Leu Ser Leu Leu Gly Asn Ser Leu Val Met Leu 55 60 65

GTC ATA CTG TAC AGC CGG AGC AAC CGT TCG GTC ACC GAC GTC TAC CTG 356 Val lie Leu Tyr Ser Arg Ser Asn Arg Ser Val Thr Asp Val Tyr Leu 70 75 80

CTG AAC CTG GCC ATG GCC GAC CTG CTT TTT GCC CTG ACC ATG CCT ATC 404 Leu Asn Leu Ala Met Ala Asp Leu Leu Phe Ala Leu Thr Met Pro lie 85 90 95

TGG GCC GTC TCC AAG GAA AAA GGC TGG ATT TTC GGC ACG CCC CTG TGC 452 Trp Ala Val Ser Lys Glu Lys Gly Trp lie Phe Gly Thr Pro Leu Cys 100 105 110 115

AAG GTG GTC TCG CTT GTG AAG GAA GTC AAC TTC TAC AGT GGA ATC CTG 500 Lys Val Val Ser Leu Val Lys Glu Val Asn Phe Tyr Ser Gly lie Leu 120 125 130 CTC CTG GCC TGC ATC AGT GTG GAC CGC TAC CTG GCC ATT GTC CAT GCT 548 Leu Leu Ala Cys lie Ser Val Asp Arg Tyr Leu Ala lie Val His Ala 135 140 145

ACT CGC ACA CTG ACC CAG AAG CGC CAC TTG GTC AAG TTC ATA TGT CTG 596 Thr Arg Thr Leu Thr Gin Lys Arg His Leu Val Lys Phe lie Cys Leu 150 155 160

GGC ATC TGG GCG CTG TCT CTG ATT TTG TCC CTG CCC TTC TTC CTC TTC 644 Gly lie Trp Ala Leu Ser Leu He Leu Ser Leu Pro Phe Phe Leu Phe 165 170 175

CGC CAA GTC TTT TCT CCA AAC AAT TCC AGC CCG GTC TGC TAT GAG GAC 692 Arg Gin Val Phe Ser Pro Asn Asn Ser Ser Pro Val Cys Tyr Glu Asp 180 185 190 195

CTG GGT CAC AAC ACA GCG AAA TGG CGC ATG GTG CTG CGG ATC CTG CCA 740 Leu Gly His Asn Thr Ala Lys Trp Arg Met Val Leu Arg He Leu Pro 200 205 210

CAC ACT TTC GGC TTC ATC CTG CCG CTG CTG GTC ATG CTG TTT TGC TAT 788 His Thr Phe Gly Phe He Leu Pro Leu Leu Val Met Leu Phe Cys Tyr 215 220 225

GGG TTC ACC CTG CGC ACG CTG TTC CAG GCC CAC ATG GGG CAG AAG CAC 836 Gly Phe Thr Leu Arg Thr Leu Phe Gin Ala His Met Gly Gin Lys His 230 235 240

CGG GCC ATG CGG GTC ATC TTC GCC GTC GTG CTC ATC TTC CTT CTC TGC 884 Arg Ala Met Arg Val He Phe Ala Val Val Leu He Phe Leu Leu Cys 245 250 255

TGG CTG CCC TAC AAC CTG GTC CTG CTC GCA GAC ACC CTC ATG AGG ACC 932 Trp Leu Pro Tyr Asn Leu Val Leu Leu Ala Asp Thr Leu Met Arg Thr 260 265 270 275

CAC GTG ATC CAG GAG ACG TGT CAG CGT CGC AAT GAC ATT GAC CGG GCC 980 His Val He Gin Glu Thr Cys Gin Arg Arg Asn Asp He Asp Arg Ala 280 285 290

CTG GAC GCC ACC GAG ATT CTG GGC TTC CTG CAC AGC TGC CTC AAC CCC 1028 Leu Asp Ala Thr Glu He Leu Gly Phe Leu His Ser Cys Leu Asn Pro 295 300 305

ATC ATC TAC GCC TTC ATT GGC CAA AAC TTT CGC AAT GGA TTC CTC AAG 1076 He He Tyr Ala Phe He Gly Gin Asn Phe Arg Asn Gly Phe Leu Lys 310 315 320

ATG CTT GCG GCC CGC GGC CTT ATT AGC AAG GAG TTC CTG ACA CGA CAT 1124 Met Leu Ala Ala Arg Gly Leu He Ser Lys Glu Phe Leu Thr Arg His 325 330 335

CGG GTC ACC TCT TAT ACT TCT TCC TCT ACC AAC GTG CCT TCA AAT CTC 1172 Arg Val Thr Ser Tyr Thr Ser Ser Ser Thr Asn Val Pro Ser Asn Leu 340 345 350 355

TAAAGCCATC TGTGAAAGAC TGCCTCCC 1200 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 2 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1176

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 2

GATCAAACCA TTGCTGAAAC TGAAGAGGAC ATG TCA AAT ATT ACA GAT CCA CAG 54

Met Ser Asn He Thr Asp Pro Gin 1 5

ATG TGG GAT TTT GAT GAT CTA AAT TTC ACT GGC ATG CCA CCT GCA GAT 102 Met Trp Asp Phe Asp Asp Leu Asn Phe Thr Gly Met Pro Pro Ala Asp 10 15 20

GAA GAT TAC AGC CCC TGT ATG CTA GAA ACT GAG ACA CTC AAC AAG TAT 150 Glu Asp Tyr Ser Pro Cys Met Leu Glu Thr Glu Thr Leu Asn Lys Tyr 25 30 35 40

GTT GTG ATC ATC GCC TAT GCC CTA GTG TTC CTG CTG AGC CTG CTG GGA 198 Val Val He He Ala Tyr Ala Leu Val Phe Leu Leu Ser Leu Leu Gly 45 50 55

AAC TCC CTG GTG ATG CTG GTC ATC TTA TAC AGC AGG GTC GGC CGC TCC 246 Asn Ser Leu Val Met Leu Val He Leu Tyr Ser Arg Val Gly Arg Ser 60 65 70

GTC ACT GAT GTC TAC CTG CTG AAC CTG GCC TTG GCC GAC CTA CTC TTT 294 Val Thr Asp Val Tyr Leu Leu Asn Leu Ala Leu Ala Asp Leu Leu Phe 75 80 85

GCC CTG ACC TTG CCC ATC TGG GCC GCC TCC AAG GTG AAT GGC TGG ATT 342 Ala Leu Thr Leu Pro He Trp Ala Ala Ser Lys Val Asn Gly Trp He 90 95 100

TTT GGC ACA TTC CTG TGC AAG GTG GTC TCA CTC CTG AAG GAA GTC AAC 390 Phe Gly Thr Phe Leu Cys Lys Val Val Ser Leu Leu Lys Glu Val Asn 105 110 115 120

TTC TAC AGT GGC ATC CTG CTG TTG GCC TGC ATC AGT GTG GAC CGT TAC 438 Phe Tyr Ser Gly He Leu Leu Leu Ala Cys He Ser Val Asp Arg Tyr 125 130 135

CTG GCC ATT GTC CAT GCC ACA CGC ACA CTG ACC CAG AAG CGT CAC TTG 486 Leu Ala He Val His Ala Thr Arg Thr Leu Thr Gin Lys Arg His Leu 140 145 150

GTC AAG TTT GTT TGT CTT GGC TGC TGG GGA CTG TCT ATG AAT CTG TCC 534 Val Lys Phe Val Cys Leu Gly Cys Trp Gly Leu Ser Met Asn Leu Ser 155 160 165

CTG CCC TTC TTC CTT TTC CGC CAG GCT TAC CAT CCA AAC AAT TCC AGT 582 Leu Pro Phe Phe Leu Phe Arg Gin Ala Tyr His Pro Asn Asn Ser Ser 170 175 180

CCA GTT TGC TAT GAG GTC CTG GGA AAT GAC ACA GCA AAA TGG CGG ATG 630 Pro Val Cys Tyr Glu Val Leu Gly Asn Asp Thr Ala Lys Trp Arg Met 185 190 195 200 GTG TTG CGG ATC CTG CCT CAC ACC TTT GGC TTC ATC GTG CCG CTG TTT 678 Val Leu Arg He Leu Pro His Thr Phe Gly Phe He Val Pro Leu Phe 205 210 215

GTC ATG CTG TTC TGC TAT GGA TTC ACC CTG CGT ACA CTG TTT AAG GCC 726 Val Met Leu Phe Cys Tyr Gly Phe Thr Leu Arg Thr Leu Phe Lys Ala 220 225 230

CAC ATG GGG CAG AAG CAC CGA GCC ATG AGG GTC ATC TTT GCT GTC GTC 774 His Met Gly Gin Lys His Arg Ala Met Arg Val He Phe Ala Val Val 235 240 245

CTC ATC TTC CTG CTT TGC TGG CTG CCC TAC AAC CTG GTC CTG CTG GCA 822 Leu He Phe Leu Leu Cys Trp Leu Pro Tyr Asn Leu Val Leu Leu Ala 250 255 260

GAC ACC CTC ATG AGG ACC CAG GTG ATC CAG GAG ACC TGT GAG CGC CGC 870 Asp Thr Leu Met Arg Thr Gin Val He Gin Glu Thr Cys Glu Arg Arg 265 270 275 280

AAC AAC ATC GGC CGG GCC CTG GAT GCC ACT GAG ATT CTG GGA TTT CTC 918 Asn Asn He Gly Arg Ala Leu Asp Ala Thr Glu He Leu Gly Phe Leu 285 290 295

CAT AGC TGC CTC AAC CCC ATC ATC TAC GCC TTC ATC GGC CAA AAT TTT 966 His Ser Cys Leu Asn Pro He He Tyr Ala Phe He Gly Gin Asn Phe 300 305 310

CGC CAT GGA TTC CTC AAG ATC CTG GCT ATG CAT GGC CTG GTC AGC AAG 1014 Arg His Gly Phe Leu Lys He Leu Ala Met His Gly Leu Val Ser Lys 315 320 325

GAG TTC TTG GCA CGT CAT CGT GTT ACC TCC TAC ACT TCT TCG TCT GTC 1062 Glu Phe Leu Ala Arg His Arg Val Thr Ser Tyr Thr Ser Ser Ser Val 330 335 340

AAT GTC TCT TCC AAC CTC TGA AAACCATCGA TGAAGGAATA TCTCTTCTCA 1113 Asn Val Ser Ser Asn Leu 345 350

GAAGGAATAA CCAACACCCT GAGGTTGTGT GTGGAAGGTG ATCTGGCTCT GGACAGGCAC 1173

TAT 1176

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 3 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1373

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 3

GGGAATTCCG CCAGCCCGCT CACAGGCAGT GGCTGTCGCA GCAACAGCAG GATTTAAGAC 60

TATCTCAGAA 70

ATG CAA GAG TTT ACC TGG GAG AAT TAC AGC TAT GAA GAT TTT TTC GGC 118 Met Gin Glu Phe Thr Trp Glu Asn Tyr Ser Tyr Glu Asp Phe Phe Gly 5 10 15 GAT TTC AGC AAT TAC AGT TAC AGC ACT GAC CTA CCC CCT ACC CTG CTA 166 Asp Phe Ser Asn Tyr Ser Tyr Ser Thr Asp Leu Pro Pro Thr Leu Leu 20 25 30

GAC TCT GCT CCG TGC CGG TCA GAA TCT CTG GAA ACC AAC AGC TAT GTT 214 Asp Ser Ala Pro Cys Arg Ser Gly Ser Leu Glu Thr Asn Ser Tyr Val 35 40 45

GTG CTC ATC ACC TAT ATC CTG GTC TTC CTG CTG AGC CTG CTG GGC AAC 262 Val Leu He Thr Tyr He Leu Val Phe Leu Leu Ser Leu Leu Gly Asn 50 55 60

TCC CTG GTG ATG CTG GTC ATC CTG TAC AGC CGG AGC ACC TGC TCG GTC 310 Ser Leu Val Met Leu Val He Leu Tyr Ser Arg Ser Thr Cys Ser Val 65 70 75 80

ACC GAC GTC TAC CTG CTG AAC CTG GCC ATC GCC GAC CTG CTC TTT GCC 358 Thr Thr Leu Pro He Trp Ala Ala Ser Lys Val His Gly Trp Thr Phe 85 90 95

ACC ACC TTG CCC ATC TGG GCC GCC TCC AAG GTG CAC GGC TGG ACT TTC 406 Thr Thr Leu Pro He Trp Ala Ala Ser Lys Val His Gly Trp Thr Phe 100 105 110

GGC ACG CCC CTG TGT AAG GTG GTC TCG CTT GTG AAG GAA GTC AAC TTC 454 Gly Thr Pro Leu Cys Lys Val Val Ser Leu Val Lys Glu Val Asn Phe 115 120 125

TAC AGC GGA ATC CTG CTC CTG GCC TGC ATC AGT GTG GAC CGC TAC CTG 502 Tyr Ser Gly He Leu Leu Leu Ala Cys He Ser Val Asp Arg Tyr Leu 130 135 140

GCC ATC GTC CAT GCC ACA CGC ACG ATG ATC CAG AAG CGC CAC TTG GTC 550 Ala He Val His Ala Thr Arg Thr Mat He Gin Lys Arg His Leu Val 145 150 155 160

AAG TTC ATA TGC TTA AGC ATG TGG GGA GTG TCT TTG ATC CTG TCT CTG 598 Lys Phe He Cys Leu Ser Met Trp Gly Val Ser Leu He Leu Ser Leu 165 170 175

CCC ATC TTA CTG TTC CGT AAT GCC ATC TTC CCA CCC AAT TCC AGC CCG 646 Pro He Leu Leu Phe Arg Asn Ala He Phe Pro Pro Asn Ser Ser Pro 180 185 190

GTC TGC TAT GAG GAC ATG GGG AAC AGC ACT GCG AAA TGG CGC ATG GTG 694 Val Cys Tyr Glu Asp Met Gly Asn Ser Thr Ala Lys Trp Arg Met Val 195 200 205

CTG CGG ATC CTG CCT CAG ACT TTC GGC TTC ATC CTG CCG CTG CTG GTC 742 Leu Arg He Leu Pro Gin Thr Phe Gly Phe He Leu Pro Leu Leu Val 210 215 220

ATG CTG TTT TGC TAT GTG TTC ACC CTG CGC ACG CTG TTC CAG GCC CAC 790 Mat Leu Phe Cys Tyr Val Phe Thr Leu Arg Thr Leu Phe Gin Ala His 225 230 235 240

ATG GGG CAG AAG CAC CGG GCC ATG CGG GTC ATC TTC GCC GTC GTG CTC 838 Met Gly Gin Lys His Arg Ala Met Arg Val He Phe Ala Val Val Leu 245 250 255

ATC TTC CTT CTC TGT TGG CTG CCC TAC AAC CTG GTT CTG CTC ACA GAC 886 He Phe Leu Leu Cys Trp Leu Pro Tyr Asn Leu Val Leu Leu Thr Asp 260 265 270 ACC CTC ATG AGG ACC CAC GTG ATC CAG GAG ACG TGT GAG CGC CGC AAT 934 Thr Leu Met Arg Thr His Val He Gin Glu Thr Cys Glu Arg Arg Asn 275 280 285

GAC ATT GAC CGG GCC CTG GAC GCC ACC GAG ATT CTG GGC TTC CTG CAC 982 Asp He Asp Arg Ala Leu Asp Ala Thr Glu He Leu Gly Phe Leu His 290 295 300

AGC TGC CTC AAC CCC ATC ATC TAC GCC TTC ATT GGG CAA AAG TTT CGC 1030 Ser Cys Leu Asn Pro He He Tyr Ala Phe He Gly Gin Lys Phe Arg 305 310 315 320

TAT GGC CTG CTC AAG ATC CTG GCG GCC CAC GGC CTG ATC AGC AAG GAG 1078 Tyr Gly Leu Leu Lys He Leu Ala Ala His Gly Leu Ha Ser Lys Glu 325 330 335

TTC CTG GCC AAG GAG AGC AGG CCT TCC TTT GTC GCC TCG TCT TCA GGG 1126 Phe Leu Ala Lys Glu Ser Arg Pro Ser Phe Val Ala Ser Ser Ser Gly 340 345 350

AAC ACC TCT ACC ACC CTC 1144

Asn Thr Ser Thr Thr Leu 355

TAAGACGCCT ATGTGGGCTG CAGTCTCTCG GGCTTCCTCC CTCCCTTGGA CATCTCATCC 1204

CAAGNCTCAT ATCCTGGTCC CGGAGTCAAC ACAGTCCTCA CTGTGGTTAT AGAAAAGAGC 1264

GGNGGGCACT TCCTCAGTAG GTCCCCAGTG TACAGNTTAG AAAGNCTGAT CCGGNCCCTG 1324

TCACTTCCCA TAATTACTCT NTCAACTACG GGAATCTTCT CATTTCTAC 1373

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1106

(B) TYPE: nucleic acid

(C) STRANDEDNESS! single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 4

TTTACCTCAA AA 12

ATG GAA GAT TTT AAC ATG GAG AGT GAC AGC TTT GAA GAT TTC TGG AAA 60 Met Glu Asp Phe Asn Met Glu Ser Asp Ser Phe Glu Asp Phe Trp Lys 1 5 10 15

GGT GAA GAT CTT AGT AAT TAC AGT TAC AGC TCT ACC CTG CCC CCT TTT 108 Gly Glu Asp Leu Ser Asn Tyr Ser Tyr Ser Ser Thr Leu Pro Pro Phe 20 25 30

CTA CTA GAT GCC GCC CCA TGT GAA CCA GAA TCC CTG GAA ATC AAC AAG 156 Leu Leu Asp Ala Ala Pro Cys Glu Pro Glu Ser Leu Glu He Asn Lys 35 40 45

TAT TTT GTG GTC ATT ATC TAT GCC CTG GTA TTC CTG CTG AGC CTG CTG 204 Tyr Phe Val Val He He Tyr Ala Leu Val Phe Leu Leu Ser Leu Leu 50 55 60 GGA AAC TCC CTC GTG ATG CTG GTC ATC TTA TAC AGC AGG GTC GGC CGC 252 Gly Asn Ser Leu Val Met Leu Val He Leu Tyr Ser Arg Val Gly Arg 65 70 75 80

TCC GTC ACT GAT GTC TAC CTG CTG AAC CTA GCC TTG GCC GAC CTA CTC 300 Ser Val Thr Asp Val Tyr Leu Leu Asn Leu Ala Leu Ala Asp Leu Leu 85 90 95

TTT GCC CTG ACC TTG CCC ATC TGG GCC GCC TCC AAG GTG AAT GCC TGG 348 Phe Ala Leu Thr Leu Pro He Trp Ala Ala Ser Lys Val Asn Gly Trp 100 105 110

ATT TTT GGC ACA TTC CTG TGC AAG GTG GTC TCA CTC CTG AAG GAA GTC 396 He Phe Gly Thr Phe Leu Cys Lys Val Val Ser Leu Leu Lys Glu Val 115 120 125

AAC TTC TAT AGT GGC ATC CTG CTA CTG GCC TGC ATC AGT GTG GAC CGT 444 Asn Phe Tyr Ser Gly He Leu Leu Leu Ala Cys He Ser Val Asp Arg 130 135 140

TAC CTG GCC ATT GTC CAT GCC ACA CGC ACA CTG ACC CAG AAG GCG TAC 492 Tyr Leu Ala He Val His Ala Thr Arg Thr Leu Thr Gin Lys Arg Tyr 145 150 155 160

TTG GTC AAA TTC ATA TGT CTC AGC ATC TGG GTT CTG TCC TTG CTC CTG 540 Leu Val Lys Phe He Cys Leu Ser He Trp Gly Leu Ser Leu Leu Leu 165 170 175

GCC CTG CCT GTC TTA CTT TTC GCA AGG ACC GTC TAC TCA TCC AAT GTT 588 Ala Leu Pro Val Leu Leu Phe Arg Arg Thr Val Tyr Ser Ser Asn Val 180 185 190

AGC CCA GCC TGC TAT GAG GAC ATG GGC AAC AAT ACA GCA AAC TGG GCC 636 Ser Pro Ala Cys Tyr Glu Asp Met Gly Asn Asn Thr. Ala Asn Trp Arg 195 200 205

ATG CTG TTA GCC ATC CTG CCC CAG TCC TTT GGC TTC ATC GTG CCA CTG 684 Met Leu Leu Arg He Leu Pro Gin Ser Phe Gly Phe He Val Pro Leu 210 215 220

CTG ATC ATG CTG TTC TGC TAC GGA TTC ACC CTG CGT ACG CTG TTT AAG 732 Leu He Met Leu Phe Cys Tyr Gly Phe Thr Leu Arg Thr Leu Phe Lys 225 230 235 240

GCC CAC ATG GGG CAG AAG CAC CGG GCC ATG CGG GTC ATC TTT GCT GTC 780 Ala His Met Gly Gin Lys His Arg Ala Met Arg Val He Phe Ala Val 245 250 255 260

GTC CTC ATC TTC CTG CTT TGC TGG CTG CCC TAC AAC CTG GTC CTG CTG 828 Val Leu He Phe Leu Leu Cys Trp Leu Pro Tyr Asn Leu Val Leu Leu 265 270 275

GCA GAC ACC CTC ATG AGG ACC CAG GTG ATC CAG GAG ACC TGT GAG CGC 876 Ala Asp Thr Leu Met Arg Thr Gin Val He Gin Glu Thr Cys Glu Arg 280 285 290

CGC AAT CAC ATC GAC CGG GCT CTG GAT GCC ACC GAG ATT CTG GGC ATC 924 Arg Asn His He Asp Arg Ala Leu Asp Ala Thr Glu He Leu Gly He 295 300 305

CTT CAC AGC TGC CTC AAC CCC CTC ATC TAC GCC TTC ATT GGC CAG AAG 972 Leu His Ser Cys Leu Asn Pro Leu He Tyr Ala Phe He Gly Gin Lys 310 315 320 325 TTT CGC CAT GGA CTC CTC AAG ATT CTA GCT ATA CAT GGC TTG ATC AGC 1020 Phe Arg His Gly Leu Leu Lys He Leu Ala He His Gly Leu He Ser 330 335 340

AAG GAC TCC CTG CCC AAA GAC AGC AGG CCT TCC TTT GTT GGC TCT TCT 1068 Lys Asp Ser Leu Pro Lys Asp Ser Arg Pro Ser Phe Val Gly Ser Ser 345 350 355

TCA GGG CAC ACT TCC ACT ACT CTC 1092

Ser Gly His Thr Ser Thr Thr Leu 360 365

TAAGACCTCC TGCC 1106

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 5 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 42

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 5

CATGATNAGG TCNGCNCAGG CCAGGCTCAG CAGGAAGTAG TT 42

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 6 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 6

GAATATGGGG AATTTATTAT GCAG 24

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 7 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 7

AATGTGACTG TGAAGAGAAG GGAGG 25

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 8 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 8 GGGAAACTCC CTCGTGATGC TGG 23

(2) INFORMATION FOR SEQUENCE IDENTIFICATION NUMBER: 9 (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO. 9 GTCTGCCAGC AGGACCAGGT TGTAGG . 26

Claims

Claims 1. A purified monoclonal antibody which preferentially binds to a recombinant IL-8 receptor polypeptide.

2. An antibody of claim 1, wherein said IL-8 receptor is subtype A.

3. An antibody of claim 2, wherein said IL-8 receptor polypeptide comprises an amino acid sequence substantially identical to the amino acid sequence shown in Figs. 1A and B (SEQ ID NO: 1) .

4. An antibody of claim 1 , wherein said IL-8 receptor is subtype B.

5. An antibody of claim A , wherein said IL-8 receptor polypeptide comprises an amino acid sequence substantially identical to the amino acid sequence shown in Figs. 4A and B (SEQ ID NO: 4).

6. An antibody of claim 4, wherein said IL-8 receptor polypeptide comprises an amino acid sequence substantially identical to the amino acid sequence shown in Figs. 3A and B (SEQ ID NO: 3) .

7. An antibody of claim 4, wherein said IL-8 receptor polypeptide comprises an amino-terminal portion of the IL-8B receptor.

8. An antibody of claim 7, wherein said IL-8 receptor polypeptide consists of amino acids Lys-Gly-Glu- Asp-Leu-Ser-Asn-Tyr-Ser-Tyr-Ser-Ser-Thr-Leu-Pro-Pro-Phe- Leu-Leu-Asp-Ala-Ala-Pro-Cys-Glu.

9. A hybridoma cell line deposited under accession number A.T.C.C. HB11623.

10. Antibody 4C1 produced by the hybridoma cell line of claim 9.

11. A hybridoma cell line deposited under accession number A.T.C.C. HB11624.

12. Antibody 1E3 produced by the hybridoma cell line of claim 11.

13. An antibody of claim 1, wherein said IL-8 receptor is derived from a mammal.

14. An antibody of claim 13, wherein said mammal is a human.

15. An antibody of claim 13, wherein said mammal is a rabbit.

16. A purified antibody which binds preferentially to a substantially isolated polypeptide which is a fragment or analog of an IL-8 receptor comprising a domain capable of binding IL-8.

17. An antibody of claim 1, wherein said antibody neutralizes the biological activity m vivo of said IL-8 receptor polypeptide.

18. A therapeutic composition for treating an inflammatory disorder comprising as an active ingredient an antibody of claim 1, said active ingredient being formulated in a physiologically-acceptable carrier.

19. A method of detecting the presence of neutrophils in a biological sample comprising the steps of obtaining a monoclonal antibody of claim 1, contacting said sample with said antibody to allow said antibody to bind with any IL-8 receptors bound to neutrophils in said sample to form antibody/IL-8 receptor complexes, and detecting said complexes as an indication of the presence of neutrophils in said sample.

20. A method of detecting the presence of neutrophils in a biological sample comprising the steps of attaching a monoclonal antibody of claim 1 to a solid support as a capture antibody, contacting said capture antibody with a biological sample and allowing said antibody to bind with any IL-8 receptors bound to neutrophils in said sample to bind said neutrophils to said support, removing any unbound neutrophils from said support, contacting neutrophils bound to said support with a labelled form of said antibody and allowing said labelled antibody to form antibody/IL-8 receptor complexes, and detecting said complexes as an indication of the presence of neutrophils in said sample.

21. A method of isolating an IL-8 receptor from a liquid mixture comprising the steps of obtaining a monoclonal antibody of claim 1, contacting said liquid mixture with said antibody to allow said antibody to bind with any IL-8 receptors in said mixture to form antibody/IL-8 receptor complexes, separating said complexes from said mixture, and separating said IL-8 receptors from said complexes te said receptors.