WO1998020131A1 - Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques - Google Patents

Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques Download PDF

Info

Publication number
WO1998020131A1
WO1998020131A1 PCT/US1997/020702 US9720702W WO9820131A1 WO 1998020131 A1 WO1998020131 A1 WO 1998020131A1 US 9720702 W US9720702 W US 9720702W WO 9820131 A1 WO9820131 A1 WO 9820131A1
Authority
WO
WIPO (PCT)
Prior art keywords
glcia
gene
nucleic acid
protein
sequence
Prior art date
Application number
PCT/US1997/020702
Other languages
English (en)
Inventor
Edwin M. Stone
Val Sheffield
Wallace L. M. Alward
Original Assignee
University Of Iowa Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/748,479 external-priority patent/US5925748A/en
Priority claimed from US08/791,347 external-priority patent/US5885776A/en
Priority claimed from US08/822,999 external-priority patent/US6271026B1/en
Application filed by University Of Iowa Research Foundation filed Critical University Of Iowa Research Foundation
Priority to EP97948270A priority Critical patent/EP0942975A1/fr
Priority to AU54364/98A priority patent/AU5436498A/en
Priority to JP52188498A priority patent/JP2001503631A/ja
Priority to CA002271235A priority patent/CA2271235A1/fr
Publication of WO1998020131A1 publication Critical patent/WO1998020131A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A61P27/06—Antiglaucoma agents or miotics
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • glaucoma is the second leading cause of legal blindness overall and the leading cause of blindness in African- American individuals
  • Juvenile open angle glaucoma is a term used to refer to a subset of POAG which has an earlier age of onset and a highly penetrant autosomal dominant mode of inheritance (A.T. Johnson et al., (1993) Ophthalmology 100:524).
  • JOAG Juvenile open angle glaucoma
  • On clinical examination, patients with juvenile onset open angle glaucoma are identical to patients with later onset disease in that both exhibit elevated intraocular pressure and optic nerve cupping in the presence of a biomicroscopically normal trabecular meshwork. Isolation of genes involved in JOAG are needed to develop therapeutics and diagnostics for glaucoma.
  • the invention features isolated GLCIA nucleic acid molecules.
  • the disclosed molecules can be non-coding, (e.g. probe, antisense or ribozyme molecules) or can encode a functional polypeptide (e.g. a polypeptide which specifically modulates, e.g., by acting as either an agonist or antagonist, at least one bioactivity of the human GLCIA polypeptide).
  • the nucleic acid molecule is a GLCIA nucleic acid that is at least 70%, preferably 80%, more preferably 85%, and even more preferably at least 95% homologous in sequence to the nucleic acids shown as SEQ ID Nos: 1 or 2 or to the complement of the nucleic acids shown as SEQ ID Nos: 1 or 2.
  • the nucleic acid molecule encodes a polypeptide that is at least 92%) and more preferably at least 95% similar in sequence to the polypeptide shown in SEQ ID No: 3.
  • the invention also provides probes and primers comprising substantially purified oligonucleotides, which correspond to a region of nucleotide sequence which hybridizes to at least 6 consecutive nucleotides of the sequences set forth as SEQ ID Nos: 1 or 2 or complements of the sequences set forth as SEQ ID Nos: 1 or 2, or naturally occurring mutants thereof.
  • the probe/primer further includes a label group attached thereto, which is capable of being detected.
  • the subject GLCIA nucleic acids can include a transcriptional regulatory sequence, e.g. at least one of a transcriptional promoter (e.g., for constitutive expression or inducible expression) or transcriptional enhancer or suppressor sequence, which regulatory sequence is operably linked to the GLCIA gene sequence.
  • a transcriptional promoter e.g., for constitutive expression or inducible expression
  • transcriptional enhancer or suppressor sequence which regulatory sequence is operably linked to the GLCIA gene sequence.
  • Such regulatory sequences in conjunction with a GLCIA nucleic acid molecule can be useful vectors for gene expression.
  • This invention also describes host cells transfected with said expression vector whether prokaryotic or eukaryotic and in vitro (e.g. cell culture) and in vivo (e.g. transgenic) methods for producing GLCIA proteins by employing said expression vectors.
  • the invention features isolated GLCIA polypeptides, preferably substantially pure preparations e.g. of plasma purified or recombinantly produced GLCIA polypeptides.
  • the polypeptide is identical to or similar to a GLCIA protein represented in SEQ ID No: 3.
  • a GLCIA polypeptide has an amino acid sequence at least about 92% homologous and preferably at least about 95%, 96%, 97%, 98% or 99% homologous to the polypeptide represented in SEQ ID No: 3.
  • GLCIA proteins also include modified protein, which are resistant to post-translational modification, as for example, due to mutations which alter modification sites (such as tyrosine, threonine, serine or aspargine residues), or which prevent glycosylation of the protein, or which prevent interaction of the protein with intracellular proteins involved in signal transduction.
  • modified protein which are resistant to post-translational modification, as for example, due to mutations which alter modification sites (such as tyrosine, threonine, serine or aspargine residues), or which prevent glycosylation of the protein, or which prevent interaction of the protein with intracellular proteins involved in signal transduction.
  • the GLCIA polypeptide can comprise a full length protein, such as represented in SEQ ID No: 3, or it can comprise a fragment corresponding to one or more particular motifs/domains, or to arbitrary sizes, e.g., at least 5, 10, 25, 50, 100, 150, 175, 200, 225, 250,275, 300, 325, 350, 375, 400, 425, 450, 475, 480, 485, 490, 495, or
  • chimeric molecules comprised of a GLCIA protein.
  • the GLCIA protein can be provided as a recombinant fusion protein which includes a second polypeptide portion, e.g., a second polypeptide having an amino acid sequence unrelated (heterologous) to the GLCIA polypeptide (e.g. the second polypeptide portion is glutathione-S- transferase, an enzymatic activity such as alkaline phosphatase or an epitope tag).
  • an immunogen comprising a GLCIA polypeptide in an immunogenic preparation, the immunogen being capable of eliciting an immune response specific for a GLCIA polypeptide; e.g. a humoral response, an antibody response and/or cellular response.
  • the immunogen comprises an antigenic determinant, e.g. a unique determinant, from the protein represented in SEQ ID No: 3.
  • a still further aspect of the present invention features antibodies and antibody preparations specifically reactive with an epitope of the GLCIA protein.
  • the antibody specifically binds to at least one epitope represented in SEQ ID No: 3.
  • the invention also features transgenic non-human animals which include (and preferably express) a heterologous form of a GLCIA gene described herein, or which misexpress an endogenous GLCIA gene (e.g., an animal in which expression of one or more of the subject GLCIA proteins is disrupted).
  • a transgenic animal can serve as an animal model for studying cellular and tissue disorders comprising mutated or mis-expressed GLCIA alleles or for use in drug screening.
  • a transgenic animal can be useful for expressing recombinant GLCIA polypeptides.
  • the invention provides assays, e.g., for screening test compounds to identify inhibitors, or alternatively, potentiators, of an interaction between a GLCIA protein and, for example, a virus, an extracellular ligand of the GLCIA protein, or an intracellular protein which binds to the GLCIA protein.
  • An exemplary method includes the steps of (i) combining a GLCIA polypeptide or bioactive fragments thereof, a GLCIA target molecule (such as a GLCIA ligand or a GLCIA substrate), and a test compound, e.g., under conditions wherein, but for the test compound, the GLCIA protein and target molecule are able to interact; and (ii) detecting the formation of a complex which includes the GLCIA protein and the target polypeptide either by directly quantitating the complex, by measuring inductive effects of the GLCIA protein, or, in the instance of a substrate, measuring the conversion to product.
  • a statistically significant change, such as a decrease, in the interaction of the GLCIA and target molecule in the presence of a test compound (relative to what is detected in the absence of the test compound) is indicative of a modulation (e.g., inhibition or potentiation of the interaction between the GLCIA protein and the target molecule).
  • Yet another aspect of the present invention concerns a method for modulating GLCIA bioactivity, (e.g., by potentiating or disrupting a GLCIA bioactivity).
  • the method comprises treating the cell with an effective amount of a GLCIA therapeutic so as to alter, relative to the cell in the absence of treatment, a GLCIA bioactivity.
  • the method can be carried out with GLCIA therapeutics such as peptide and peptidomimetics or other molecules identified in the above-referenced drug screens which agonize or antagonize the effects of GLCIA (e.g., signalling from a GLCIA protein or ligand binding of a GLCIA protein).
  • Other GLCIA therapeutics include antisense constructs for inhibiting expression of GLCIA proteins, and dominant negative mutants of GLCIA proteins which competitively inhibit ligand interactions upstream and signal transduction downstream of the wild-type GLCIA protein.
  • a further aspect of the present invention provides a method of determining if a subject is at risk for glaucoma or other disorder resulting from a mutant GLCIA gene.
  • the method includes detecting, in a tissue of the subject, the presence or absence of a genetic lesion characterized by at least one of (i) a mutation of a gene encoding a GLCIA protein, e.g., a gene represented in one of SEQ ID Nos: 1 or 2 or a homolog thereof; or (ii) the mis-expression of a GLCIA gene.
  • detecting the genetic lesion includes ascertaining the existence of at least one of: a deletion of one or more nucleotides from a GLCIA gene; an addition of one or more nucleotides to the gene, a substitution of one or more nucleotides of the gene, a gross chromosomal rearrangement of the gene; an alteration in the level of a messenger RNA transcript of the gene (e.g., due to a promoter mutation); the presence of a non- wild type splicing pattern of a messenger RNA transcript of the gene; a non- wild type level of the protein; and/or an aberrant level of soluble GLCIA protein.
  • detecting the genetic lesion can include (i) providing a probe/primer comprised of an oligonucleotide which hybridizes to a sense or antisense sequence of a GLCIA gene or naturally occurring mutants thereof, or 5' or 3' flanking sequences naturally associated with the GLCIA gene; (ii) contacting the probe/primer to an appropriate nucleic acid containing sample; and (iii) detecting, by hybridization of the probe/primer to the nucleic acid, the presence or absence of the genetic lesion; e.g. wherein detecting the lesion comprises utilizing the probe/primer to determine the nucleotide sequence of the GLCIA gene and, optionally, of the flanking nucleic acid sequences.
  • the primer can be employed in a polymerase chain reaction (PCR) or in a ligation chain reaction (LCR).
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • the level of a GLCIA protein is detected in an immunoassay using an antibody which is specifically immunoreactive with the GLCIA protein.
  • Figure 1 is a DNA sequence of the human GLCIA gene.
  • the coding sequence, in conjunction with the 5' and 3' untranslated regions (UTRs) (SEQ. ID. No. 1) is provided.
  • Intron 1 is provided as SEQ ID No. 9
  • intron 2 is provided as SEQ ID No. 10, respectively.
  • DNA encoding protein and comprising the three exon sequences is provided as SEQ ID No. 2.
  • the encoded protein is presented as SEQ. ID. No. 3.
  • FIG. 2 shows the Yeast Artificial Chromosomes (YACS) comprising the minimum tiling path contigs. Solid circles indicate the position of markers (STSs), which were shown to be contained within each YAC. Disease intervals based on recombination within families and shared haplotypes between families are indicated with brackets.
  • YACS Yeast Artificial Chromosomes
  • Figure 3A and B shows two polymerase chain reaction (PCR) amplimers of the GLCIA gene found to harbor sequence changes in patients with glaucoma.
  • the wildtype amplimer shown in Figure 3A is provided as SEQ ID No. 1 1 and the mutation containing amplimer (CAC-TYR 430 His) is provided as SEQ ID No. 12.
  • the wildtype amplimer shown in Figure 3B is provided as SEQ ID No. 13 and the mutation containing amplimer (GTC-GLY357 VAL and TAG-GLN361 STOP) is provided as SEQ ID No. 14.
  • Figure 4 schematically depicts the segregation of the GLY364VAL mutation in a four generation family affected with open angle glaucoma.
  • Black symbols in the pedigree drawing indicate individuals with documented evidence of open angle glaucoma.
  • White symbols indicate spouses that are clinically unaffected.
  • a photograph of a silver-stained SSCP gel is shown below the pedigree drawing and is aligned so that each gel lane lies directly below the pedigree symbol of the family member whose DNA was analyzed in that lane. For simplicity, clinically unaffected family members were not included.
  • Figure 5 is a representative chromatogram generated by fluorescent dye- primer sequencing of cloned PCR amplification products from an affected individual reveals a C to T transition which would be expected to result in a premature stop at codon 368 (GLN368STOP). Sequences in the forward and reverse directions for both the mutant and normal genes are shown: (A) normal, forward (SEQ ID No 15); (B) mutant, forward (SEQ ID No 16); (C) normal, reverse (SEQ ID No 17); and (D) mutant, reverse (SEQ ID No 18).
  • a genetic locus associated with JOAG was identified on chromosome Iq21-q31 by genetic linkage analysis. Observed recombinations between the glaucoma phenotype and highly polymorphic genetic markers in two large JOAG kindreds allowed the interval containing GLCIA gene to be narrowed to a 3 cM region of chromosome lq between markers D1S3665 and D1S3664. Further evaluation of marker haplotypes revealed that each of three pairs of glaucoma families shared alleles of the same eight contiguous markers suggesting that the GLCIA gene lies within a narrower interval defined by Dl SI 619 and D1 S3664.
  • LAMC1 H.C. Watkins et. al., (1993) Hum. Mol. Genet. 2: 1084
  • NPRI D.G. Lowe et al., (1990)
  • Genomics 5:304 and CNR2 (S. Munro et al, (1993) Nature 5(55:61), were excluded from the candidate region by genetic linkage analysis using intragenic polymorphic markers.
  • Five additional candidate genes were determined to lie within the observed recombinant interval by YAC STS content mapping: selectin E (M.P. Bevilacqua et al., (1989) Science 243: ⁇ ⁇ 6 ) (GenBank accession no. M24736); selectin L (T.F. Tedder et al., (1989) J. Exp. Med. 170:123) (GenBank accession no. M25280); TXGP-1 (S. Miura et al., (1991) Mol. Cell Biol 11:1313) (GenBank accession no. MD90224; APT1LG1 (T. Takahashi et al., (1994) Int. Immunol. 6, 1567); and TIGR (Trabecular meshwork
  • the TIGR gene assay was initially used to screen affected members of four different lq-linked glaucoma families, and affected members of four smaller families implicated by haplotypic data. Amino-acid-altering mutations were detected in four of eight families. A tyrosine to histidine mutation in codon 437 (Figs. 3 A and 4) was detected in all 22 affected members of the original family (V.C. Sheffield et al.,
  • telomere shortening The prevalence of mutations in the two PCR amplimers that harbored these three changes was then estimated by screening four different populations: glaucoma patients with a family history of the disease; unselected primary open angle glaucoma probands seen in a single clinic; the general population (approximated by patients with heritable retinal disease and spouses from families who participated in prior linkage studies); and, unrelated volunteers over the age of 40 with normal intraocular pressures and no personal or family history of glaucoma.
  • PCR products determined to contain a sequence variation by SSCP were sequenced and compared to sequence generated from an unaffected individual as well as the normal chromosome in each affected individual.
  • the DNA sequence, including 5' and 3' untranslated regions and two intron sequences is shown in Figure 1. Importantly, this sequence differs substantially from the TIGR gene sequence reported in International Patent Application No. WO 96/14411 (GenBank accession nos. R95491 , R95447, R95443 and R947209). In fact, as reported, the TIGR gene sequence does not encode a functional protein.
  • a "T” is wrongly inserted between bp #560 and #561 of the GLCIA DNA coding sequence in the TIGR sequence. Errors 3 and 4 cause the TIGR sequence to incorrectly predict a serine amino acid at residue #187 instead of a glutamine.
  • a "T” is incorrectly inserted between bp #841 and #842 of the GLCIA DNA coding sequence in the TIGR sequence.
  • a "C” at bp #980 of the GLC 1 A DNA coding sequence is replaced with a "G" in the TIGR sequence.
  • Errors 8. and 9. cause the TIGR sequence to wrongly predict an arginine amino acid at residue #327 instead of an alanine.
  • the above 9 errors in the TIGR GLCIA sequence cause 42 incorrect amino acid predictions.
  • this disease gene increases the understanding of the pathophysiology of glaucoma, which in turn facilitates the development of assays for identifying molecules that modulate (e.g. agonize or antagonize) the bioactivity of a functional or mutant TIGR gene or protein.
  • a therapeutically effective amount of these molecules can be administered to a subject with glaucoma or at risk for developing glaucoma to prevent or reduce the severity of the condition.
  • agonist is meant to refer to an agent (e.g., a GLCIA therapeutic) that directly or indirectly enhances, supplements or potentiates a GLCIA bioactivity.
  • agent e.g. a benzylcholine
  • Cells “host cells” or “recombinant host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
  • a “chimeric protein” or “fusion protein” is a fusion of a first amino acid sequence encoding one of the subject polypeptides with a second amino acid sequence defining a domain (e.g. polypeptide portion) foreign to and not substantially homologous with any domain of one of the proteins.
  • a chimeric protein may present a foreign domain which is found (albeit in a different protein) in an organism which also expresses the first protein, or it may be an "interspecies", “intergenic”, etc. fusion of protein structures expressed by different kinds of organisms.
  • a fusion protein can be represented by the general formula X-GLC1 A-Y, wherein GLCIA represents a portion of the protein which is derived from one of the GLCIA proteins, and X and Y are independently absent or represent amino acid sequences which are not related to one of the GLCIA sequences in an organism, including naturally occurring mutants.
  • Complementary sequences as used herein refer to sequences which have sufficient complementarity to be able to hybridize, forming a stable duplex.
  • a “delivery complex” shall mean a targeting means (e.g. a molecule that results in higher affinity binding of a gene, protein, polypeptide or peptide to a target cell surface and/or increased cellular uptake by a target cell).
  • targeting means include: sterols (e.g. cholesterol), lipids (e.g. a cationic lipid, virosome or liposome), viruses (e.g. adenovirus, adeno-associated virus, and retrovirus) or target cell specific binding agents (e.g. ligands recognized by target cell specific receptors).
  • Preferred complexes are sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell.
  • genes for a particular polypeptide may exist in single or multiple copies within the genome of an individual. Such duplicate genes may be identical or may have certain modifications, including nucleotide substitutions, additions or deletions, which all still code for polypeptides having substantially the same activity.
  • the term "DNA sequence encoding a gg polypeptide" may thus refer to one or more genes within a particular individual.
  • certain differences in nucleotide sequences may exist between individual organisms, which are called alleles. Such allelic differences may or may not result in differences in amino acid sequence of the encoded polypeptide yet still encode a protein with the same biological activity.
  • the term “gene” or “recombinant gene” refers to a nucleic acid molecule comprising an open reading frame encoding one of the polypeptides of the present invention, including both exon and (optionally) intron sequences.
  • a “recombinant gene” refers to nucleic acid encoding a GLCIA polypeptide and comprising GLC1A- encoding exon sequences, though it may optionally include intron sequences which are either derived from a chromosomal GLCIA gene or from an unrelated chromosomal gene. Exemplary recombinant genes encoding the subject GLCIA polypeptides are represented in the appended Sequence Listing.
  • the term “intron” refers to a DNA sequence present in a given GLCIA gene which is not translated into protein and is generally found between exons.
  • Homology refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or “non-homologous" sequence shares less than 40 % identity, though preferably less than 25 % identity, with one of the GLCIA sequences of the present invention.
  • interact as used herein is meant to include detectable interactions between molecules, such as can be detected using, for example, a yeast two hybrid assay.
  • interact is also meant to include "binding" interactions between molecules. Interactions may, for example, be protein-protein or protein-nucleic acid in nature.
  • an isolated nucleic acid encoding one of the subject GLCIA polypeptides preferably includes no more than 10 kilobases (kb) of nucleic acid sequence which naturally immediately flanks the GLCIA gene in genomic DNA, more preferably no more than 5kb of such naturally occurring flanking sequences, and most preferably less than 1.5kb of such naturally occurring flanking sequence.
  • kb kilobases
  • isolated also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • isolated nucleic acid is meant to include nucleic acid fragments which are not naturally occurring as fragments and would not be found in the natural state.
  • isolated is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
  • modulation refers to both upregulation, (i.e., activation or stimulation), for example by agonizing; and downregulation, (i.e. inhibition or suppression) for example by antagonizing or a GLCIA bioactivity.
  • non-human animals include mammalians such as rodents, non-human primates, sheep, dog, cow, chickens, amphibians, reptiles, etc.
  • Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens can also provide important tools for understanding and identifying agents which can affect, for example, embryogenesis and tissue formation.
  • transgenic amphibians such as members of the Xenopus genus
  • transgenic chickens can also provide important tools for understanding and identifying agents which can affect, for example, embryogenesis and tissue formation.
  • chimeric animal is used herein to refer to animals in which the recombinant gene is found, or in which the recombinant gene is expressed in some but not all cells of the animal.
  • tissue-specific chimeric animal indicates that one of the recombinant GLCIA genes is present and/or expressed or disrupted in some tissues but not others.
  • nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single
  • promoter means a DNA sequence that regulates expression of a selected DNA sequence operably linked to the promoter, and which effects expression of the selected DNA sequence in cells.
  • tissue specific i.e. promoters, which effect expression of the selected DNA sequence only in specific cells (e.g. cells of a specific tissue).
  • leaky so-called “leaky” promoters, which regulate expression of a selected DNA primarily in one tissue, but cause expression in other tissues as well.
  • the term also encompasses non-tissue specific promoters and promoters that constitutively express or that are inducible (i.e. expression levels can be controlled).
  • protein protein
  • polypeptide peptide
  • recombinant protein refers to a polypeptide of the present invention which is produced by recombinant DNA techniques, wherein generally, DNA encoding a GLCIA polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
  • the phrase "derived from”, with respect to a recombinant GLCIA gene is meant to include within the meaning of "recombinant protein” those proteins having an amino acid sequence of a native GLCIA protein, or an amino acid sequence similar thereto which is generated by mutations including substitutions and deletions (including truncation) of a naturally occurring form of the protein.
  • Small molecule as used herein, is meant to refer to a composition, which has a molecular weight of less than about 5kD and most preferably less than about 4kD.
  • Small molecules can be nucleic acids, peptides, polypeptides, peptidometics, carbohydrates, lipids or other organic carbon containing or inorganic molecules. Extensive libraries of chemical or biological (e.g., fungal, bacterial or algal extracts) mixtures are available for screening with the assays of the invention.
  • the term “specifically hybridizes” or “specifically detects” refers to the ability of a nucleic acid molecule of the invention to hybridize to at least approximately 6, 12, 20, 30, 50, 100, 150, 200, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1460, 1470, 1480, 1490 consecutive nucleotides of a vertebrate, preferably GLCIA gene, such as a GLCIA sequence designated in one of SEQ ID Nos: 1 or 2, or a sequence complementary thereto, or naturally occurring mutants thereof, such that it shows at least
  • Transcriptional regulatory sequence is a generic term used throughout the specification to refer to DNA sequences, such as initiation signals, enhancers, and promoters, which induce or control transcription of protein coding sequences with which they are operably linked.
  • transcription of one of the recombinant GLCIA genes is under the control of a promoter sequence (or other transcriptional regulatory sequence) which controls the expression of the recombinant gene in a cell-type in which expression is intended. It will also be understood that the recombinant gene can be under the control of transcriptional regulatory sequences which are the same or which are different from those sequences which control transcription of the naturally-occurring forms of GLC 1 A proteins .
  • the term “transfection” means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • "Transformation” refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a mammalian GLCIA polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally- occurring form of the GLCIA protein is disrupted.
  • transgene means a nucleic acid sequence (encoding, e.g., one of the mammalian GLCIA polypeptides, or pending an antisense transcript thereto), which is partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
  • a transgene can include one or more transcriptional regulatory sequences and any other nucleic acid, such as introns, that may be necessary for optimal expression of a selected nucleic acid.
  • a "transgenic animal” refers to any animal, preferably a non-human mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • the term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA.
  • transgenic animal In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of the GLCIA proteins, e.g. either agonistic or antagonistic forms.
  • transgenic animals in which the recombinant GLCIA gene is silent are also contemplated, as for example, the FLP or CRE recombinase dependent constructs described below.
  • transgenic animal also includes those recombinant animals in which gene disruption of one or more GLCIA genes is caused by human intervention, including both recombination and antisense techniques.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication.
  • Preferred vectors are those capable of autonomous replication and/expression of nucleic acids to which they are linked.
  • Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors”.
  • expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome.
  • plasmid and "vector” are used interchangeably as the plasmid is the most commonly used form of vector.
  • vector is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.
  • nucleic Acids of the Present Invention pertains to isolated nucleic acids comprising nucleotide sequences encoding GLC 1 A polypeptides, and/or equivalents of such nucleic acids.
  • the term equivalent is understood to include nucleotide sequences encoding functionally equivalent GLCIA polypeptides or functionally equivalent peptides having an activity of a vertebrate GLCIA protein such as described herein.
  • Equivalent nucleotide sequences will include sequences that differ by one or more nucleotide substitutions, additions or deletions, such as allelic variants; and will, therefore, include sequences that differ from the nucleotide sequence of the GLCIA gene shown in SEQ ID Nos: 1 or 2 due to the degeneracy of the genetic code.
  • Preferred nucleic acids are vertebrate GLCIA nucleic acids. Particularly preferred vertebrate GLCIA nucleic acids are mammalian. Regardless of species, particularly preferred GLCIA nucleic acids encode polypeptides that are at least 90%> similar to an amino acid sequence of human GLCIA. Preferred nucleic acids encode a GLCIA polypeptide comprising an amino acid sequence at least 90% homologous and more preferably 94% homologous with an amino acid sequence of a vertebrate GLC 1 A, e.g., such as a sequence shown in one of SEQ ID Nos: 1 or 2.
  • nucleic acids which encode polypeptides at least about 95%>, and even more preferably at least about 98-99%) similarity with an amino acid sequence represented in SEQ ID Nos.: 1 or 2 are also within the scope of the invention.
  • the nucleic acid of the present invention encodes an amino acid GLCIA sequence shown in one of SEQ ID No: 2.
  • the nucleic acid is a cDNA encoding a peptide having at least one bioactivity of the subject GLCIA polypeptide.
  • the nucleic acid includes all or a portion of the nucleotide sequence corresponding to the coding region of SEQ ID Nos: 1 or 2.
  • nucleic acids of the present invention encode a GLCIA polypeptide which includes a polypeptide sequence corresponding to all or a portion of amino acid residues of SEQ ID No: 2 e.g., at least 2, 5, 10, 25, 50, 100, 150 or 200 amino acid residues of that region.
  • preferred nucleic acid molecules for use as probes/primer or antisense molecules can comprise at least about 6, 12, 20, 30, 50, 100, 125, 150 or 200 base pairs in length, whereas coding nucleic acid molecules can comprise about 200, 250, 300, 350, 400, 410, 420, 430, 435 or 440 base pairs.
  • nucleic acid which hybridizes to a nucleic acid represented by one of SEQ ID Nos: 1 or 2
  • Appropriate stringency conditions which promote DNA hybridization for example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons,
  • the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50°C.
  • the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed.
  • a GLCIA nucleic acid of the present invention will bind to one of SEQ ID Nos 1 or 2 under moderately stringent conditions, for example at about 2.0 x SSC and about 40°C.
  • aGLCIA nucleic acid of the present invention will bind to one of SEQ ID Nos: 1, 3 or 4 under high stringency conditions, but will not bind to the nucleic acids shown in SEQ ID Nos: 6, 8, 9 or 11.
  • Preferred nucleic acids have a sequence at least 75% homologous and more preferably 80%) and even more preferably at least 85%> homologous with an amino acid sequence of a mammalian GLCIA, e.g., such as a sequence shown in one of SEQ ID Nos:
  • nucleic acids at least 90%>, more preferably 95%, and most preferably at least about 98-99%o homologous with a nucleic sequence represented in one of SEQ ID Nos: 1 and 2 are of course also within the scope of the invention.
  • the nucleic acid is a mammalian GLCIA gene and in particularly preferred embodiments, includes all or a portion of the nucleotide sequence corresponding to the coding region of one of SEQ ID Nos: 1 or 2
  • Nucleic acids having a sequence that differs from the nucleotide sequences shown in one of SEQ ID Nos: 1 or 2 due to degeneracy in the genetic code are also within the scope of the invention.
  • Such nucleic acids encode functionally equivalent peptides (i.e., a peptide having a biological activity of a GLCIA polypeptide) but differ in sequence from the sequence shown in the sequence listing due to degeneracy in the genetic code. For example, a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC each encode histidine) may result in "silent" mutations which do not affect the amino acid sequence of a GLCIA polypeptide.
  • DNA sequence polymorphisms that do lead to changes in the amino acid sequences of the subject GLCIA polypeptides will exist among mammalians.
  • these variations in one or more nucleotides (e.g., up to about 3-5% of the nucleotides) of the nucleic acids encoding polypeptides having an activity of a mammalian GLCIA polypeptide may exist among individuals of a given species due to natural allelic variation.
  • GLCIA protein-encoding nucleic acids can be obtained from mRNA present in any of a number of eukaryotic cells.
  • nucleic acids encoding mammalian GLCIA polypeptides of the present invention from genomic DNA from both adults and embryos.
  • a gene encoding a GLCIA protein can be cloned from either a cDNA or a genomic library in accordance with protocols described herein, as well as those generally known to persons skilled in the art.
  • tissues and/or libraries suitable for isolation of the subject nucleic acids include ocular tissue, among others.
  • a cDNA encoding a GLCIA protein can be obtained by isolating total mRNA from a cell, e.g. a vertebrate cell, a mammalian cell, or a human cell, including embryonic cells. Double stranded cDNAs can then be prepared from the total mRNA, and subsequently inserted into a suitable plasmid or bacteriophage vector using any one of a number of known techniques.
  • GLCIA protein can also be cloned using established polymerase chain reaction techniques in accordance with the nucleotide sequence information provided by the invention.
  • the nucleic acid of the invention can be DNA or RNA.
  • a preferred nucleic acid is a cDNA represented by a sequence selected from the group consisting of SEQ ID Nos: l and 2.
  • This invention also provides expression vectors containing a nucleic acid encoding a GLCIA polypeptide, operably linked to at least one transcriptional regulatory sequence.
  • "Operably linked” is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleotide sequence.
  • Regulatory sequences are art-recognized and are selected to direct expression of the subject mammalian GLCIA proteins. Accordingly, the term “transcriptional regulatory sequence” includes promoters, enhancers and other expression control elements. Such regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • the expression vector includes a recombinant gene encoding a peptide having an agonistic activity of a subject GLCIA polypeptide, or alternatively, encoding a peptide which is an antagonistic form of the GLCIA protein.
  • Such expression vectors can be used to transfect cells and thereby produce polypeptides, including fusion proteins, encoded by nucleic acids as described herein.
  • the gene constructs of the present invention can also be used as a part of a gene therapy protocol to deliver nucleic acids encoding either an agonistic or antagonistic form of one of the subject GLCIA proteins.
  • another aspect of the invention features expression vectors for in vivo or in vitro transfection and expression of a GLCIA polypeptide in particular cell types so as to reconstitute the function of, or alternatively, abrogate the function of GLC1 A-induced signaling in a tissue.
  • This could be desirable, for example, when the naturally-occurring form of the protein is misexpressed; or to deliver a form of the protein which alters differentiation of tissue.
  • Expression vectors may also be employed to inhibit neoplastic transformation.
  • non- viral methods can also be employed to cause expression of a subject GLCIA polypeptide in the tissue of an animal.
  • Most nonviral methods of gene transfer rely on normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules.
  • non-viral targeting means of the present invention rely on endocytic pathways for the uptake of the subject GLCIA polypeptide gene by the targeted cell.
  • Exemplary targeting means of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes.
  • nucleotide sequences determined from the cloning of GLC 1 A genes from mammalian organisms will further allow for the generation of probes and primers designed for use in identifying and/or cloning GLCIA homologs in other cell types, e.g. from other tissues, as well as GLCIA homologs from other mammalian organisms.
  • the present invention also provides a probe/primer comprising a substantially purified oligonucleotide, which oligonucleotide comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least approximately 12, preferably 25, more preferably 40, 50 or 75 consecutive nucleotides of sense or anti-sense sequence selected from the group consisting of SEQ ID No:l and 2, or naturally occurring mutants thereof.
  • primers based on the nucleic acid represented in SEQ ID Nos:l and 2 can be used in PCR reactions to clone GLCIA homologs.
  • Preferred primers of the invention are set forth as SEQ ID Nos. 4 and 5; and SEQ ID Nos. 5 and 6.
  • probes based on the subject GLCIA sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins.
  • the probe further comprises a label group attached thereto and able to be detected, e.g. the label group is selected from amongst radioisotopes, fluorescent compounds, enzymes, and enzyme co-factors.
  • probes can also be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress a GLCIA protein, such as by measuring a level of a GLCIA -encoding nucleic acid in a sample of cells from a patient; e.g. detecting GLCIA mRNA levels or determining whether a genomic GLCIA gene has been mutated or deleted.
  • nucleotide probes can be generated from the subject GLCIA genes which facilitate histological screening of intact tissue and tissue samples for the presence (or absence) of GLClA-encoding transcripts.
  • the use of probes directed to GLCIA messages, or to genomic GLCIA sequences can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, neoplastic or hyperplastic disorders (e.g. unwanted cell growth) or abnormal differentiation of tissue.
  • the oligonucleotide probes can help facilitate the determination of the molecular basis for a developmental disorder which may involve some abnormality associated with expression (or lack thereof) of a GLCIA protein. For instance, variation in polypeptide synthesis can be differentiated from a mutation in a coding sequence.
  • antisense therapy refers to administration or in situ generation of oligonucleotide molecules or their derivatives which specifically hybridize (e.g. bind) under cellular conditions, with the cellular mRNA and/or genomic DNA encoding one or more of the subject GLCIA proteins so as to inhibit expression of that protein, e.g. by inhibiting transcription and/or translation.
  • the binding may be by conventional base pair complementarity, or, for example, in the case of binding to DNA duplexes, through specific interactions in the major groove of the double helix.
  • antisense refers to the range of techniques generally employed in the art, and includes any therapy which relies on specific binding to oligonucleotide sequences.
  • an antisense construct of the present invention can be delivered, for example, as an expression plasmid which, when transcribed in the cell, produces RNA which is complementary to at least a unique portion of the cellular mRNA which encodes a GLCIA protein.
  • the antisense construct is an oligonucleotide probe which is generated ex vivo and which, when introduced into the cell causes inhibition of expression by hybridizing with the mRNA and/or genomic sequences of a GLCIA gene.
  • Such oligonucleotide probes are preferably modified oligonucleotides which are resistant to endogenous nucleases, e.g. exonucleases and/or endonucleases, and are therefore stable in vivo.
  • nucleic acid molecules for use as antisense oligonucleotides are phosphoramidate, phosphothioate and methylphosphonate analogs of DNA (see also U.S. Patents 5,176,996; 5,264,564; and 5,256,775). Additionally, general approaches to constructing oligomers useful in antisense therapy have been reviewed, for example, by Van der Krol et al. (1988) Biotechniques 6:958-976; and Stein et al. (1988) Cancer Res 48:2659- 2668. With respect to antisense DNA, oligodeoxyribonucleotides derived from the translation initiation site, e.g , between the -10 and +10 regions of the GLC IA nucleotide sequence of interest, are preferred.
  • Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to GLCIA mRNA.
  • the antisense oligonucleotides will bind to the GLCIA mRNA transcripts and prevent translation.
  • Absolute complementarity although preferred, is not required, a sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
  • sequences complementary to the 3' untranslated sequences of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well. (Wagner, R. 1994. Nature 372:333). Therefore, oligonucleotides complementary to either the 5' or 3' untranslated, non-coding regions of a GLCIA gene could be used in an antisense approach to inhibit translation of endogenous GLCIA mRNA.
  • Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or coding region of GLCIA mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
  • the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, or at least 50 nucleotides.
  • in vitro studies are first performed to quantitate the ability of the antisense oligonucleotide to quantitate the ability of the antisense oligonucleotide to inhibit gene expression. It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also preferred that these studies compare levels of the target RNA or protein with that of an internal control RNA or protein.
  • results obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide.
  • the control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.
  • the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g.. for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al.,
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylque
  • the antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2- fluoroarabinose, xylulose, and hexose.
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense oligonucleotide is an -anomeric oligonucleotide.
  • An -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
  • Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al.
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc. While antisense nucleotides complementary to the GLCIA coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
  • antisense molecules should be delivered to cells which express the GLCIA in vivo.
  • a number of methods have been developed for delivering antisense DNA or RNA to cells; e& , antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g.. antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systematically.
  • a preferred approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter.
  • the use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous GLCIA transcripts and thereby prevent translation of the GLCIA mRNA.
  • a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
  • Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981 , Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-
  • any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site; e ⁇ ., the choroid plexus or hypothalamus.
  • viral vectors can be used which selectively infect the desired tissue; (e.g.. for brain, herpesvirus vectors may be used), in which case administration may be accomplished by another route (e.g.. systematically).
  • Ribozyme molecules designed to catalytically cleave GLCIA mRNA transcripts can also be used to prevent translation of GLC 1 A mRNA and expression of GLCIA.
  • ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy GLCIA mRNAs
  • the use of hammerhead ribozymes is preferred.
  • Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'.
  • the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach,
  • ribozyme cleavage sites within the nucleotide sequence of human GLCIA cDNA.
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the GLCIA mRNA; J , to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
  • the ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes”) such as the one which occurs naturally in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984,
  • the Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place.
  • the invention encompasses those
  • Cech-type ribozymes which target eight base-pair active site sequences that are present in GLCIA.
  • the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express the GLCIA in vivo e ⁇ , hypothalamus and/or the choroid plexus.
  • a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous GLCIA messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • Endogenous GLCIA gene expression can also be reduced by inactivating or "knocking out" the GLCIA gene or its promoter using targeted homologous recombination.
  • endogenous GLCIA gene expression can also be reduced by inactivating or "knocking out" the GLCIA gene or its promoter using targeted homologous recombination.
  • a mutant, non- functional GLCIA flanked by DNA homologous to the endogenous GLCIA gene (either the coding regions or regulatory regions of the GLCIA gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express GLCIA in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the GLCIA gene.
  • Such approaches are particularly suited in the agricultural field where modifications to ES (embryonic stem) cells can be used to generate animal offspring with an inactive GLCIA (e.g.. see Thomas & Capecchi 1987 and Thompson 1989, supra).
  • the recombinant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors, e ⁇ , herpes virus vectors for delivery to brain tissue; e.g.. the hypothalamus and/or choroid plexus.
  • appropriate viral vectors e ⁇ , herpes virus vectors for delivery to brain tissue; e.g.. the hypothalamus and/or choroid plexus.
  • endogenous GLCIA gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the GLCIA gene (i.e.. the GLCIA promoter and/or enhancers) to form triple helical structures that prevent transcription of the GLCIA gene in target cells in the body.
  • deoxyribonucleotide sequences complementary to the regulatory region of the GLCIA gene i.e.. the GLCIA promoter and/or enhancers
  • the antisense constructs of the present invention by antagonizing the normal biological activity of one of the GLCIA proteins, can be used in the manipulation of tissue, e.g. tissue differentiation, both in vivo and for ex vivo tissue cultures.
  • anti-sense techniques e.g. microinjection of antisense molecules, or transfection with plasmids whose transcripts are anti-sense with regard to a GLCIA mRNA or gene sequence
  • Such techniques can be utilized in cell culture, but can also be used in the creation of transgenic animals, as detailed below.
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
  • the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage.
  • the composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, see U.S. Pat. No. 5,093,246, which is incorporated by reference herein in its entirety.
  • engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences encoding
  • ribozyme cleavage sites within any potential RNA target are initially identified by scanning the molecule of interest for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features, such as secondary structure, that may render the oligonucleotide sequence unsuitable. The suitability of candidate sequences may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
  • Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription are preferably single stranded and composed of deoxyribonucleotides.
  • the base composition of these oligonucleotides should promote triple helix formation via Hoogsteen base pairing rules, which generally require sizable stretches of either purines or pyrimidines to be present on one strand of a duplex.
  • Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix.
  • the pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand.
  • nucleic acid molecules may be chosen that are purine- rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in CGC triplets across the three strands in the triplex.
  • the potential sequences that can be targeted for triple helix formation may be increased by creating a so called “switchback" nucleic acid molecule.
  • Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizable stretch of either purines or pyrimidines to be present on one strand of a duplex.
  • Antisense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and
  • RNA molecules are generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • nucleic acid molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone.
  • the present invention also makes available isolated GLCIA polypeptides which are isolated from, or otherwise substantially free of other cellular proteins, especially other signal transduction factors and/or transcription factors which may normally be associated with the GLCIA polypeptide.
  • isolated GLCIA polypeptides which are isolated from, or otherwise substantially free of other cellular proteins, especially other signal transduction factors and/or transcription factors which may normally be associated with the GLCIA polypeptide.
  • the term "substantially free of other cellular proteins" (also referred to herein as "contaminating proteins”) or “substantially pure or purified preparations” are defined as encompassing preparations of GLCIA polypeptides having less than about 20%> (by dry weight) contaminating protein, and preferably having less than about 5% contaminating protein.
  • Functional forms of the subject polypeptides can be prepared, for the first time, as purified preparations by using a cloned gene as described herein.
  • purified it is meant, when referring to a peptide or DNA or RNA sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules, such as other proteins.
  • the term “purified” as used herein preferably means at least 80%> by dry weight, more preferably in the range of 95-99% by weight, and most preferably at least 99.8% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 5000, can be present).
  • pure as used herein preferably has the same numerical limits as “purified” immediately above.
  • purified and purified do not encompass either natural materials in their native state or natural materials that have been separated into components (e.g., in an acrylamide gel) but not obtained either as pure (e.g. lacking contaminating proteins, or chromatography reagents such as denaturing agents and polymers, e.g. acrylamide or agarose) substances or solutions.
  • purified GLCIA preparations will lack any contaminating proteins from the same animal from which GLCIA is normally produced, as can be accomplished by recombinant expression of, for example, a human GLCIA protein in a non-human cell.
  • isolated GLCIA polypeptides can include all or a portion of an amino acid sequences corresponding to a GLCIA polypeptide represented in SEQ ID No. 3.
  • Isolated peptidyl portions of GLCIA proteins can be obtained by screening peptides recombinantly produced from the corresponding fragment of the nucleic acid encoding such peptides.
  • fragments can be chemically synthesized using techniques known in the art such as conventional Merrifield solid phase f-Moc or t-Boc chemistry.
  • a GLCIA polypeptide of the present invention may be arbitrarily divided into fragments of desired length with no overlap of the fragments, or preferably divided into overlapping fragments of a desired length.
  • the fragments can be produced (recombinantly or by chemical synthesis) and tested to identify those peptidyl fragments which can function as either agonists or antagonists of a wild-type (e.g., "authentic") GLCIA protein.
  • GLCIA proteins are at least 92%o homologous and more preferably 94 % homologous and most preferably 95%> homologous with an amino acid sequence represented by SEQ ID Nos: 3. Polypeptides which are at least about 98-99%> homologous with a sequence selected from the group consisting of SEQ ID No: 3 are also within the scope of the invention.
  • a GLCIA protein of the present invention is a GLCIA protein.
  • a GLCIA protein comprises the coding sequence of one of SEQ ID No.: 3.
  • a GLCIA protein has a GLCIA bioactivity.
  • the present invention further pertains to recombinant forms of one of the subject GLCIA polypeptides which are encoded by genes derived from a mammalian organism, and which have amino acid sequences evolutionarily related to the GLCIA proteins represented in SEQ ID Nos: 3.
  • Such recombinant GLCIA polypeptides preferably are capable of functioning in one of either role of an agonist or antagonist of at least one biological activity of a wild-type ("authentic") GLCIA protein of the appended sequence listing.
  • GLCIA proteins refers to both polypeptides having amino acid sequences which have arisen naturally, and also to mutational variants of GLCIA polypeptides which are derived, for example, by combinatorial mutagenesis.
  • Such evolutionarily derived GLCIA polypeptides preferred by the present invention have a GLCIA bioactivity and are at least 92% homologous and more preferably 94% homologous and most preferably 98-99%) homologous with the amino acid sequence set forth as SEQ ID Nos: 3.
  • a GLCIA protein comprises the amino acid coding sequence of SEQ ID No: 3.
  • polypeptides referred to herein as having an activity (e.g., are "bioactive") of a GLCIA protein are defined as polypeptides which include an amino acid sequence corresponding (e.g., identical or homologous) to all or a portion of the amino acid sequences of a GLCIA protein shown in SEQ ID No: 3 and which mimic or antagonize all or a portion of the biological/biochemical activities of a naturally occurring GLC 1 A protein.
  • the biochemical activities are related to gene expression, pituitary development, and abdominal development related to umbilical and vitelline artery expression.
  • a polypeptide has biological activity if it is a specific agonist or antagonist of a naturally-occurring form of a GLCIA protein.
  • the present invention further pertains to methods of producing the subject
  • GLCIA polypeptides For example, a host cell transfected with a nucleic acid vector directing expression of a nucleotide sequence encoding the subject polypeptides can be cultured under appropriate conditions to allow expression of the peptide to occur. The cells may be harvested, lysed and the protein isolated. A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art.
  • the recombinant GLCIA polypeptide can be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for such peptide.
  • the recombinant GLCIA polypeptide is a fusion protein containing a domain which facilitates its purification, such as GST fusion protein or poly(His) fusion protein.
  • a domain which facilitates its purification such as GST fusion protein or poly(His) fusion protein.
  • a homolog of limited function and with fewer side effects relative to treatment with agonists or antagonists which are directed to all of the biological activities of naturally occurring forms of GLCIA proteins.
  • Homologs of each of the subject GLCIA proteins can be generated by mutagenesis, such as by discrete point mutation(s), or by truncation. For instance, mutation can give rise to homologs which retain substantially the same, or merely a subset, of the biological activity of the GLCIA polypeptide from which it was derived.
  • antagonistic forms of the protein can be generated which are able to inhibit the function of the naturally occurring form of the protein, such as by competitively binding to a downstream or upstream member of the biochemical pathway, which includes the GLCIA protein.
  • agonistic forms of the protein may be generated which are constitutively active.
  • the human GLCIA protein and homologs thereof provided by the subject invention may be either positive or negative regulators of gene expression.
  • the recombinant GLCIA polypeptides of the present invention also include homologs of the authentic GLCIA proteins, such as versions of those protein which are resistant to proteolytic cleavage, as for example, due to mutations which alter ubiquitination or other enzymatic targeting associated with the protein.
  • GLCIA polypeptides may also be chemically modified to create GLCIA derivatives by forming covalent or aggregate conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and the like.
  • Covalent derivatives of GLCIA proteins can be prepared by linking the chemical moieties to functional groups on amino acid sidechains of the protein or at the N-terminus or at the C-terminus of the polypeptide.
  • Modification of the structure of the subject GLCIA polypeptides can be for such purposes as enhancing therapeutic or prophylactic efficacy, stability (e.g.. ex vivo shelf life and resistance to proteolytic degradation in vivo), or post-translational modifications (e.g., to alter phosphorylation pattern of protein).
  • Such modified peptides when designed to retain at least one activity of the naturally-occurring form of the protein, or to produce specific antagonists thereof, are considered functional equivalents of the GLCIA polypeptides described in more detail herein.
  • Such modified peptides can be produced, for instance, by amino acid substitution, deletion, or addition.
  • Whether a change in the amino acid sequence of a peptide results in a functional GLCIA homolog can be readily determined by assessing the ability of the variant peptide to produce a response in cells in a fashion similar to the wild-type protein, or competitively inhibit such a response.
  • Polypeptides in which more than one replacement has taken place can readily be tested in the same manner.
  • This invention further contemplates a method for generating sets of combinatorial mutants of the subject GLCIA proteins as well as truncation mutants, and is especially useful for identifying potential variant sequences (e.g. homologs) that are functional in modulating gene expression.
  • the purpose of screening such combinatorial libraries is to generate, for example, novel GLCIA homologs which can act as either agonists or antagonist, or alternatively, possess novel activities all together.
  • GLCIA homologs can be generated by the present combinatorial approach to selectively inhibit gene expression. For instance, mutagenesis can provide
  • GLCIA homologs which are able to bind other signal pathway proteins (or DNA) yet prevent propagation of the signal, e.g. the homologs can be dominant negative mutants.
  • manipulation of certain domains of GLCIA by the present method can provide domains more suitable for use in fusion proteins.
  • the variegated library of GLCIA variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library.
  • a mixture of synthetic oligonucleotides can be enzymatically ligated into gene sequences such that the degenerate set of potential GLCIA sequences are expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins
  • a library of coding sequence fragments can be provided for a GLCIA clone in order to generate a variegated population of GLCIA fragments for screening and subsequent selection of bioactive fragments.
  • a variety of techniques are known in the art for generating such libraries, including chemical synthesis.
  • a library of coding sequence fragments can be generated by (i) treating a double stranded PCR fragment of a GLCIA coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule; (ii) denaturing the double stranded DNA; (iii) renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products; (iv) removing single stranded portions from reformed duplexes by treatment with SI nuclease; and (v) ligating the resulting fragment library into an expression vector.
  • an expression library can be derived which codes for N-terminal, C-terminal and internal fragments of various sizes.
  • a wide range of techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a certain property. Such techniques will be generally adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of GLCIA homologs.
  • the most widely used techniques for screening large gene libraries typically comprises cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates relatively easy isolation of the vector encoding the gene whose product was detected.
  • Each of the illustrative assays described below are amenable to high through-put analysis as necessary to screen large numbers of degenerate GLCIA sequences created by combinatorial mutagenesis techniques.
  • Combinatorial mutagenesis has a potential to generate very large libraries of mutant proteins, e.g., in the order of 10 ⁇ 6 molecules. Combinatorial libraries of this size may be technically challenging to screen even with high throughput screening assays.
  • recrusive ensemble mutagenesis REM
  • REM recrusive ensemble mutagenesis
  • REM is an algorithm which enhances the frequency of functional mutants in a library when an appropriate selection or screening method is employed (Arkin and Yourvan, 1992, PNAS USA 89:7811-7815; Yourvan et al., 1992, Parallel Problem Solving from Nature, 2., In Maenner and Manderick, eds., Elsevir Publishing Co., Amsterdam, pp. 401-410; Delgrave et al., 1993, Protein Engineering 6(3):327-331).
  • the invention also provides for reduction of the GLCIA proteins to generate mimetics, e.g. peptide or non-peptide agents, which are able to disrupt binding of a mammalian GLCIA polypeptide of the present invention with either upstream or downstream components.
  • mimetics e.g. peptide or non-peptide agents
  • Such mutagenic techniques as described above are also useful to map the determinants of the GLCIA proteins which participate in protein-protein interactions involved in, for example, binding of the subject GLCIA polypeptide to proteins which may function upstream (including both activators and repressors of its activity) or to proteins or nucleic acids which may function downstream of the GLCIA polypeptide, whether they are positively or negatively regulated by it.
  • the critical residues of a subject GLCIA polypeptide which are involved in molecular recognition of a component upstream or downstream of a GLCIA can be determined and used to generate GLClA-derived peptidomimetics which competitively inhibit binding of the authentic GLCIA protein with that moiety.
  • GLClA-derived peptidomimetics which competitively inhibit binding of the authentic GLCIA protein with that moiety.
  • peptidomimetic compounds can be generated which mimic those residues of the GLCIA protein which facilitate the interaction. Such mimetics may then be used to interfere with the normal function of a GLCIA protein.
  • non-hydrolyzable peptide analogs of such residues can be generated using benzodiazepine (e.g., see Freidinger et al. in Peptides: Chemistry and Biology, G.R. Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), azepine (e.g., see Huffman et al. in Peptides:
  • This invention also pertains to a host cell transfected to express a recombinant form of the subject GLCIA polypeptides.
  • the host cell may be any prokaryotic or eukaryotic cell.
  • a nucleotide sequence derived from the cloning of GLCIA proteins, encoding all or a selected portion of the full-length protein can be used to produce a recombinant form of a GLCIA polypeptide via microbial or eukaryotic cellular processes.
  • Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial) cells, are standard procedures used in producing other well-known proteins, e.g. MAP kinase, pg. 53, WT1, PTP phosphotases, SRC, and the like. Similar procedures, or modifications thereof, can be employed to prepare recombinant GLCIA polypeptides by microbial means or tissue-culture technology in accord with the subject invention.
  • the recombinant GLCIA genes can be produced by ligating nucleic acid encoding a GLCIA protein, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells, or both.
  • Expression vectors for production of recombinant forms of the subject GLCIA polypeptides include plasmids and other vectors.
  • suitable vectors for the expression of a GLCIA polypeptide include plasmids of the types: pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli.
  • YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incorporated by reference herein).
  • These vectors can replicate in E. coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid.
  • drug resistance markers such as ampicillin can be used.
  • a GLCIA polypeptide is produced recombinantly utilizing an expression vector generated by sub-cloning the coding sequence of one of the GLCIA genes represented in SEQ ID Nos: 1 and 2.
  • the preferred mammalian expression vectors contain both prokaryotic sequences, to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells.
  • the pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, P Tk2, pRSVneo, pMSG, pSVT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells.
  • vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells.
  • derivatives of viruses such as the bovine papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells.
  • BBV-1 bovine papillomavirus
  • pHEBo Epstein-Barr virus
  • the various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art.
  • suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures see Molecular Cloning A
  • baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941), pAcUW-derived vectors (such as pAcUWl), and pBlueBac-derived vectors (such as the ⁇ -gal containing pBlueBac III).
  • a GLCIA protein such as a form lacking a portion of the N-terminus, i.e. a truncation mutant which lacks the signal peptide
  • AGT start codon
  • a methionine at the N-terminal position can be enzymatically cleaved by the use of the enzyme methionine aminopeptidase (MAP).
  • MAP has been cloned from E. coli (Ben- Bassat et al. (1987) J Bacteriol.
  • transgenic animals described in more detail below could be used to produce recombinant proteins.
  • the coding sequences for the polypeptide can be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide.
  • This type of expression system can be useful under conditions where it is desirable to produce an immunogenic fragment of a GLCIA protein.
  • the VP6 capsid protein of rotavirus can be used as an immunologic carrier protein for portions of the GLCIA polypeptide, either in the monomeric form or in the form of a viral particle.
  • nucleic acid sequences corresponding to the portion of a subject GLCIA protein to which antibodies are to be raised can be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising GLCIA epitopes as part of the virion. It has been demonstrated with the use of immunogenic fusion proteins utilizing the Hepatitis B surface antigen fusion proteins that recombinant Hepatitis B virions can be utilized in this role as well.
  • chimeric constructs coding for fusion proteins containing a portion of a GLCIA protein and the poliovirus capsid protein can be created to enhance immunogenicity of the set of polypeptide antigens (see, for example, EP Publication No: 0259149; and Evans et al. (1989) Nature 339:385; Huang et al. (1988) J. Virol. 62:3855; and Schlienger et al. (1992) J. Virol. 66:2).
  • the Multiple Antigen Peptide system for peptide-based immunization can also be utilized to generate an immunogen, wherein a desired portion of a GLCIA polypeptide is obtained directly from organo-chemical synthesis of the peptide onto an oligomeric branching lysine core (see, for example, Posnett et al. (1988) JBC 263 : 1719 and
  • GLCIA polypeptides can be generated as glutathione-S-transferase (GST-fusion) proteins.
  • GST-fusion proteins can enable easy purification of the
  • GLC 1 A polypeptide, as for example by the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. (N.Y.: John Wiley & Sons, 1991)).
  • a fusion gene coding for a purification leader sequence such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, can allow purification of the expressed fusion protein by affinity chromatography using a Ni 2+ metal resin.
  • the purification leader sequence can then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al. (1987) J. Chromatography 411 : 177; and Janknecht et al. PNAS 88:8972).
  • fusion genes are known to those skilled in the art. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
  • Another aspect of the invention pertains to an antibody specifically reactive with a GLCIA protein.
  • immunogens derived from a GLCIA protein e.g. based on the cDNA sequences
  • anti-protein/anti-peptide antisera or monoclonal antibodies can be made by standard protocols (See, for example, Antibodies: A Laboratory Manual ed. by Harlow and Lane (Cold Spring Harbor Press: 1988)).
  • a mammal such as a mouse, a hamster or rabbit can be immunized with an immunogenic form of the peptide (e.g., a GLCIA polypeptide or an antigenic fragment which is capable of eliciting an antibody response, or a fusion protein as described above).
  • an immunogenic portion of a GLCIA protein can be administered in the presence of adjuvant.
  • the progress of immunization can be monitored by detection of antibody titers in plasma or serum.
  • Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibodies.
  • the subject antibodies are immunospecific for antigenic determinants of a GLCIA protein of a mammal, e.g. antigenic determinants of a protein represented by SEQ ID No: 2 or closely related homologs (e.g. at least 92%> homologous, and more preferably at least 94% homologous).
  • anti-GLCIA antisera can be obtained and, if desired, polyclonal anti-GLCIA antibodies isolated from the serum.
  • antibody-producing cells lymphocytes
  • immortalizing cells such as myeloma cells to yield hybridoma cells.
  • Such techniques are well known in the art, and include, for example, the hybridoma technique (originally developed by Kohler and Milstein, (1975) Nature, 256: 495-497), the human B cell hybridoma technique (Kozbar et al., (1983) Immunology Today, 4: 72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., (1985) Monoclonal Antibodies and Cancer
  • Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with a GLCIA polypeptide of the present invention and monoclonal antibodies isolated from a culture comprising such hybridoma cells.
  • antibody as used herein is intended to include fragments thereof which are also specifically reactive with one of the subject mammalian GLCIA polypeptides.
  • Antibodies can be fragmented using conventional techniques and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab)2 fragments can be generated by treating antibody with pepsin. The resulting F(ab)2 fragment can be treated to reduce disulfide bridges to produce Fab fragments.
  • the antibody of the present invention is further intended to include bispecific and chimeric molecules having affinity for a GLCIA protein conferred by at least one CDR region of the antibody.
  • Antibodies which specifically bind GLCIA epitopes can also be used in immunohistochemical staining of tissue samples in order to evaluate the abundance and pattern of expression of each of the subject GLCIA polypeptides.
  • Anti-GLCIA antibodies can be used diagnostically in immuno-precipitation and immuno-blotting to detect and evaluate GLCIA protein levels in tissue as part of a clinical testing procedure. For instance, such measurements can be useful in predictive valuations of the onset or progression of proliferative disorders.
  • the ability to monitor GLCIA protein levels in an individual can allow determination of the efficacy of a given treatment regimen for an individual afflicted with such a disorder.
  • the level of GLCIA polypeptides may be measured from cells in bodily fluid, such as in samples of cerebral spinal fluid or amniotic fluid, or can be measured in tissue, such as produced by biopsy.
  • Diagnostic assays using anti-GLCIA antibodies can include, for example, immunoassays designed to aid in early diagnosis of a degenerative disorder, particularly ones which are manifest at birth.
  • Diagnostic assays using anti-GLCIA polypeptide antibodies can also include immunoassays designed to aid in early diagnosis and phenotyping neoplastic or hyperplastic disorders.
  • anti-GLCIA antibodies of the present invention is in the immunological screening of cDNA libraries constructed in expression vectors such as gtl 1, gtl 8-23, ZAP, and ORF8.
  • Messenger libraries of this type having coding sequences inserted in the correct reading frame and orientation, can produce fusion proteins.
  • gtl 1 will produce fusion proteins whose amino termini consist of ⁇ -galactosidase amino acid sequences and whose carboxy termini consist of a foreign polypeptide.
  • Antigenic epitopes of a GLCIA protein e.g. other orthologs of a particular GLCIA protein or other paralogs from the same species, can then be detected with antibodies, as, for example, reacting nitrocellulose filters lifted from infected plates with anti-GLCIA antibodies. Positive phage detected by this assay can then be isolated from the infected plate.
  • GLCIA homologs can be detected and cloned from other animals, as can alternate isoforms (including splicing variants) from humans.
  • GLCIA therapeutics of the present invention can be used in treatment.
  • pathological conditions for which GLCIA therapeutics of the present invention can be used in treatment.
  • pathological conditions for which GLCIA therapeutics of the present invention can be used in treatment.
  • pathological conditions for which GLCIA therapeutics of the present invention can be used in treatment.
  • One clear example is various forms of glaucoma.
  • a "GLCIA therapeutic,” whether an antagonist or agonist of wild type GLCIA, can be, as appropriate, any of the preparations described above, including isolated polypeptides, gene therapy constructs, antisense molecules, peptidomimetics, small molecules, non-nucleic acid, non-peptidic or agents identified in the drug assays provided herein.
  • genes may be upregulated in a disease state and in other cases may be downregulated, it will be desirable to activate and/or potentiate or suppress and/or downmodulate GLCIA bioactivity depending on the condition to be treated using the techniques compounds and methods described herein.
  • Some genes may be underexpressed in certain disease states.
  • the activity of GLCIA gene products may be in some way impaired, leading to the development of disease symptoms.
  • Such down- regulation of GLCIA gene expression or decrease in the activity of a GLCIA protein may have a causative or exacerbating effect on the disease state.
  • Compounds that compete with a GLCIA protein for binding to upstream or downstream elements in a signaling cascade will antagonize a GLCIA protein , thereby inducing a therapeutic effect.
  • suitable compounds include the antagonists or homologues described in detail above.
  • the increased expression or bioactivity of a GLCIA protein may be desirable and may be accomplished by, for example the use of the GLCIA agonists or mimetics or by gene replacement therapy, as described herein.
  • Compounds identified as increasing or decreasing GLCIA gene expression or protein activity can be administered to a subject at therapeutically effective dose to treat or ameliorate symptoms associated with glaucoma.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g. , for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50%) of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
  • Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e.. the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC50 i.e. the concentration of the test compound which achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
  • the compounds and their physiologically acceptable salts and solvates may be formulated for administration by, for example, injection, inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
  • the oligomers of the invention can be formulated for a variety of loads of administration, including systemic and topical or localized administration. Techniques and formulations generally may be found in Remmington's Pharmaceutical Sciences, Meade Publishing Co., Easton, PA. For systemic administration, injection is preferred, including intramuscular, intravenous, intraperitoneal, and subcutaneous.
  • the oligomers of the invention can be formulated in liquid solutions, preferably in physiologically compatible buffers such as Hank's solution or
  • oligomers may be formulated in solid form and redissolved or suspended immediately prior to use. Lyophilized forms are also included.
  • the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate).
  • binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc or silica
  • disintegrants e.g., potato starch
  • Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid).
  • the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
  • compositions for oral administration may be suitably formulated to give controlled release of the active compound.
  • compositions for buccal administration may take the form of tablets or lozenges formulated in conventional manner.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art, and include, for example, for transmucosal administration bile salts and fusidic acid derivatives.
  • detergents may be used to facilitate permeation.
  • Transmucosal administration may be through nasal sprays or using suppositories.
  • the oligomers of the invention are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the gene delivery systems for the therapeutic GLCIA gene can be introduced into a patient by any of a number of methods, each of which is familiar in the art.
  • a pharmaceutical preparation of the gene delivery system can be introduced systemically, e.g. by intravenous injection, and specific transduction of the protein in the target cells occurs predominantly from specificity of transfection provided by the gene delivery vehicle, cell-type or tissue-type expression due to the transcriptional regulatory sequences controlling expression of the receptor gene, or a combination thereof.
  • initial delivery of the recombinant gene is more limited with introduction into the animal being quite localized.
  • the gene delivery vehicle can be introduced by catheter (see U.S. Patent 5,328,470) or by stereotactic injection (e.g.
  • a GLCIA gene such as any one of the sequences represented in the group consisting of SEQ ID NO: 1 or 2, or a sequence homologous thereto can be delivered in a gene therapy construct by electroporation using techniques described, for example, by Dev et al. ((1994) Cancer Treat Rev 20:105-115).
  • Gene therapy vectors comprised of viruses that provide specific effective and highly localized treatment of eye diseases are described in Published International Patent Application No. WO 95/34580 to U. Eriksson et al.
  • the pharmaceutical preparation of the gene therapy construct can consist essentially of the gene delivery system in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can comprise one or more cells which produce the gene delivery system.
  • the compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the present invention provides for the use of nucleic acids comprising at least a portion of the nucleic acid sequence shown in SEQ ID Nos: 1 or 2 or polypeptides comprising at least a portion of the amino acid sequence shown in SEQ ID No: 3.
  • the present method provides a method for determining if a subject is at risk for glaucoma.
  • the methods can be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of (i) an alteration affecting the integrity of a gene encoding a GLCl A-protein, or (ii) the mis-expression of the GLCIA gene.
  • such genetic lesions can be detected by ascertaining the existence of at least one of (i) a deletion of one or more nucleotides from a GLCIA gene, (ii) an addition of one or more nucleotides to a GLCIA gene, (iii) a substitution of one or more nucleotides of a GLCIA gene, (iv) a gross chromosomal rearrangement of a GLCIA gene, (v) a gross alteration in the level of a messenger RNA transcript of a GLCIA gene, (vii) aberrant modification of a GLCIA gene, such as of the methylation pattern of the genomic DNA, (vii) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a GLCIA gene, (viii) a non- wild type level of a GLCl A-protein, (ix) allelic loss of a GLCIA gene, and (x) inappropriate post-translational modification of a GLCl A-protein
  • a nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of a GLCIA gene, such as represented by any of SEQ ID Nos: 1 and 2, or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject GLCIA genes or naturally occurring mutants thereof.
  • the nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected.
  • Such techniques can be used to detect lesions at either the genomic or mRNA level, including deletions, substitutions, etc., as well as to determine mRNA transcript levels.
  • one aspect of the present invention relates to diagnostic assays for determining, in the context of cells isolated from a patient, if mutations have arisen in one or more GLCIA of the sample cells.
  • the present method provides a method for determining if a subject is at risk for a disorder characterized by aberrant cell proliferation and/or differentiation.
  • the method can be generally characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by an alteration affecting the integrity of a gene encoding a GLCIA.
  • such genetic lesions can be detected by ascertaining the existence of at least one of (i) a deletion of one or more nucleotides from a GLClA-gene, (ii) an addition of one or more nucleotides to a GLClA-gene, (iii) a substitution of one or more nucleotides of a GLClA-gene, and (iv) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a GLClA-gene.
  • the present invention provides a large number of assay techniques for detecting lesions in GLCIA genes, and importantly, provides the ability to discern between different molecular causes underlying GLClA-dependent aberrant cell growth, proliferation and/or differentiation.
  • detection of the lesion comprises utilizing the probe/primer in a polymerase chain reaction (PCR) (see, e.g. U.S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241 :1077-1080; and Nakazawa et al. (1994) PNAS 91 : 360-364), the latter of which can be particularly useful for detecting point mutations in the GLClA-gene (see Abravaya et al. (1995) Nuc Acid Res 23:675-682).
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • the method includes the steps of (i) collecting a sample of cells from a patient, (ii) isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, (iii) contacting the nucleic acid sample with one or more primers which specifically hybridize to a GLCIA gene under conditions such that hybridization and amplification of the GLClA-gene (if present) occurs, and (iv) detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
  • nucleic acid e.g., genomic, mRNA or both
  • Alternative amplification methods include: self sustained sequence replication (Guatelli, J.C. et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al., 1989, Proc. Natl. Acad. Sci. USA 86:1 173-1177), Q-Beta Replicase (Lizardi, P.M. et al., 1988, Bio/Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
  • mutations in a GLCIA gene from a sample cell are identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis.
  • sequence specific ribozymes see, for example, U.S.
  • Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • any of a variety of sequencing reactions known in the art can be used to directly sequence the GLCIA gene and detect mutations by comparing the sequence of the sample GLCIA with the corresponding wild-type (control) sequence.
  • Exemplary sequencing reactions include those based on techniques developed by Maxim and Gilbert (Proc. Natl Acad Sci USA (1977) 74:560) or Sanger (Sanger et al
  • protection from cleavage agents can be used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers, et al. (1985) Science
  • RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with S 1 nuclease to enzymatically digesting the mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al (1992) Methods Enzymod. 217:286-295.
  • the control DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in GLCIA cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662).
  • a probe based on a GLCIA sequence e.g., a wild- type GLC 1 A sequence, is hybridized to a cDNA or other DNA product from a test cell(s).
  • duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Patent No. 5,459,039.
  • alterations in electrophoretic mobility is used to identify mutations in GLCIA genes.
  • SSCP single strand conformation polymorphism
  • Single-stranded DNA fragments of sample and control GLC 1 A nucleic acids will be denatured and allowed to renature.
  • the secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labelled or detected with labelled probes.
  • the sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).
  • the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al (1985) Nature 313:495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high- melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing agent gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:12753).
  • oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al (1989) Proc. Natl Acad. Sci USA 86:6230).
  • Such allele specific oligonucleotide hybridization techniques may be used to test one mutation per reaction when oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labelled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al ( 1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11 :238.
  • RNA is initially isolated from available tissue and reverse-transcribed, and the segment of interest is amplified by PCR.
  • the products of reverse transcription PCR are then used as a template for nested PCR amplification with a primer that contains an RNA polymerase promoter and a sequence for initiating eukaryotic translation.
  • the unique motifs incorporated into the primer permit sequential in vitro transcription and translation of the PCR products.
  • sodium dodecyl sulfate- polyacrylamide gel electrophoresis of translation products the appearance of truncated polypeptides signals the presence of a mutation that causes premature termination of translation.
  • DNA as opposed to RNA is used as a PCR template when the target region of interest is derived from a single exon.
  • nucleic acid composition comprising a (purified) oligonucleotide probe including a region of nucleotide sequence which is capable of hybridizing to a sense or antisense sequence of a GLClA- gene, or naturally occurring mutants thereof, or 5' or 3' flanking sequences or intronic sequences naturally associated with the subject GLClA-genes or naturally occurring mutants thereof.
  • the nucleic acid of a cell is rendered accessible for hybridization, the probe is exposed to nucleic acid of the sample, and the hybridization of the probe to the sample nucleic acid is detected.
  • Such techniques can be used to detect lesions at either the genomic or mRNA level, including deletions, substitutions, etc., as well as to determine mRNA transcript levels.
  • Such oligonucleotide probes can be used for both predictive and therapeutic evaluation of allelic mutations which might be manifest in, for example, neoplastic or hyperplastic disorders (e.g. aberrant cell growth).
  • the methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving a GLCIA gene.
  • any cell type or tissue preferably monocytes, endothelial cells, or smooth muscle cells, in which the GLCIA is expressed may be utilized in the diagnostics described below.
  • a subject's bodily fluid e.g. blood
  • nucleic acid tests can be performed on dry samples (e.g. hair or skin).
  • Fetal nucleic acid samples can be obtained from maternal blood as described in International Patent Application No. WO 91/07660 to Bianchi.
  • amniocytes or chorionic villi may be obtained for performing prenatal testing.
  • Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary.
  • Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G. J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, NY).
  • Fingerprint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
  • Antibodies directed against wild type or mutant GLCIA proteins may also be used in disease diagnostics and prognostics. Such diagnostic methods, may be used to detect abnormalities in the level of GLCIA protein expression, or abnormalities in the structure and/or tissue, cellular, or subcellular location of GLCIA protein. Structural differences may include, for example, differences in the size, electronegativity, or antigenicity of the mutant GLCIA protein relative to the normal GLCIA protein. Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques which are well known to one of skill in the art, including but not limited to western blot analysis.
  • the antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofiuorescence or imrnunoelectron microscopy, for in situ detection of GLCIA proteins.
  • In situ detection may be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody of the present invention.
  • the antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample.
  • a solid phase support or carrier is used as a support capable of binding an antigen or an antibody.
  • supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
  • the nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention.
  • the support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody.
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
  • the surface may be flat such as a sheet, test strip, etc.
  • Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
  • EIA enzyme immunoassay
  • Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha- glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • the detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
  • Detection may also be accomplished using any of a variety of other immunoassays.
  • a radioimmunoassay RIA
  • the radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
  • the antibody can also be labeled with a fluorescent compound.
  • fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • the antibody can also be detectably labeled using fluorescence emitting metals such as 152 Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid
  • DTP A ethylenediaminetetraacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • the antibody also can be detectably labeled by coupling it to a chemiluminescent compound.
  • the presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction.
  • chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • Bioluminescence is a type of chemiluminescence found in biological systems in, which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin.
  • any of the above methods for detecting alterations in a GLCIA gene or gene product can be used to monitor the course of treatment or therapy.
  • identification of the precise phenotype associated with these mutations can be used to identify functionally important regions of the protein.
  • These specific mutations can then be used in other experiments which will include overexpression in cell lines and the creation of transgenic animals. Ideally, one could identify mutations which reproducibly cause glaucoma at very different times in the person's life and then be able to show that these mutations had similar differences of effect in a cellular expression system or a transgenic animal.
  • GLC 1 A likely causes glaucoma through its actions within the trabucular meshwork or ciliary body, it will be important to characterize the expression of this gene throughout the eye and indeed throughout the body to make sure that an important part of the pathogenesis of GLClA-linked glaucoma is not caused by an indirect mechanism. Therefor identifying tissue distribution and the developmental time course of gene expression (at both protein and DNA levels) using standard procedures will be important.
  • proteins that interact with the GLCI A gene product and genes encoding the proteins can performed, since proteins that interact with GLCIA gene product will be important targets for involvement in the pathogenesis of various types of glaucoma.
  • the precise location and sequence of the introns within the GLCIA gene can be identified so that improved PCR-based screening assays can be developed to fully assay the coding sequences of the GLCIA in patients with glaucoma.
  • sequences that participate in the regulation of the GLCIA gene will be important to characterize. For example, some glaucoma- causing mutations in the GLCIA gene exist in upstream sequences which alter the expression of the gene either positively or negatively. Further, classes of genes that are similarly regulated may be important in glaucoma (for example genes that share upstream regulatory sequences with the GLCIA gene).
  • the compound of interest is contacted with proteins which may function upstream (including both activators and repressors of its activity) or to proteins or nucleic acids which may function downstream of the GLCIA polypeptide, whether they are positively or negatively regulated by it.
  • proteins which may function upstream including both activators and repressors of its activity
  • proteins or nucleic acids which may function downstream of the GLCIA polypeptide, whether they are positively or negatively regulated by it.
  • To the mixture of the compound and the upstream or downstream element is then added a composition containing a GLCIA polypeptide. Detection and quantification of complexes of GLCIA with it's upstream or downstream elements provide a means for determining a compound's efficacy at inhibiting (or potentiating) complex formation between GLCIA and a GLClA-binding element.
  • the efficacy of the compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound.
  • a control assay can also be performed to provide a baseline for comparison.
  • isolated and purified GLCl A polypeptide is added to a composition containing the GLCl A- binding element, and the formation of a complex is quantitated in the absence of the test compound.
  • Complex formation between the GLC 1 A polypeptide and a GLC 1 A binding element may be detected by a variety of techniques.
  • Modulation of the formation of complexes can be quantitated using, for example, detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled GLCIA polypeptides, by immunoassay, or by chromatographic detection.
  • detectably labeled proteins such as radiolabeled, fluorescently labeled, or enzymatically labeled GLCIA polypeptides
  • immunoassay or by chromatographic detection.
  • GLCIA GLCIA
  • binding protein can be accomplished in any vessel suitable for containing the reactants. Examples include micro titre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • glutathione-S-transferase/GLCIA (GST/GLC1 AA) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
  • the cell lysates e.g. an 35s_ ⁇ a b e ⁇ ec i 5 an d the test compound, and the mixture incubated under conditions conducive to complex formation, e.g. at physiological conditions for salt and pH, though slightly more stringent conditions may be desired.
  • the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g. beads placed in scintilant), or in the supernatant after the complexes are subsequently dissociated.
  • the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of GLCl A-binding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques such as described in the appended examples.
  • GLCIA GLCIA
  • streptavidin a binding protein
  • GLCIA molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, IL), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • biotinylation kit Pierce Chemicals, Rockford, IL
  • antibodies reactive with GLCIA but which do not interfere with binding of upstream or downstream elements can be derivatized to the wells of the plate, and GLCIA trapped in the wells by antibody conjugation.
  • preparations of a GLCl A-binding protein and a test compound are incubated in the GLCl A-presenting wells of the plate, and the amount of complex trapped in the well can be quantitated.
  • Exemplary methods for detecting such complexes include immunodetection of complexes using antibodies reactive with the
  • the enzyme can be chemically conjugated or provided as a fusion protein with the GLCl A-BP.
  • the GLCl A-BP can be chemically cross-linked or genetically fused with horseradish peroxidase, and the amount of polypeptide trapped in the complex can be assessed with a chromogenic substrate of the enzyme, e.g. 3,3'- diamino-benzadine terahydrochloride or 4-chloro-l-napthol.
  • fusion protein comprising the polypeptide and glutathione-S-transferase can be provided, and complex formation quantitated by detecting the GST activity using l -chloro-2,4-dinitrobenzene (Habig et al (1974) J Biol Chem 249:7130).
  • the protein to be detected in the complex can be "epitope tagged" in the form of a fusion protein which includes, in addition to the GLCIA sequence, a second polypeptide for which antibodies are readily available (e.g. from commercial sources).
  • the GST fusion proteins described above can also be used for quantification of binding using antibodies against the GST moiety.
  • Other useful epitope tags include myc-epitopes (e.g., see Ellison et al.
  • the readily available source of mutant and functional GLCIA nucleic acids and proteins provided by the present invention also facilitates the generation of cell-based assays for identifying small molecule agonists/antagonists and the like.
  • cells can be caused to overexpress a recombinant GLCIA protein in the presence and absence of a test agent of interest, with the assay scoring for modulation in GLCIA responses by the target cell mediated by the test agent.
  • agents which produce a statistically significant change in GLCIA -dependent responses can be identified.
  • the expression or activity of a GLCIA is modulated in cells and the effects of compounds of interest on the readout of interest (such as tissue differentiation, proliferation, tumorigenesis) are measured.
  • compounds of interest such as tissue differentiation, proliferation, tumorigenesis
  • the expression of genes which are up- or down-regulated in response to a GLClA-dependent signal cascade can be assayed.
  • the regulatory regions of such genes e.g., the 5' flanking promoter and enhancer regions, are operably linked to a detectable marker (such as luciferase) which encodes a gene product that can be readily detected.
  • Exemplary cells or cell lines may be derived from ocular tissue (e.g. trabecular meshwork or ciliary body epithelia); as well as generic mammalian cell lines such as HeLa cells and COS cells, e.g., COS-7 (ATCC# CRL-1651).
  • the transgenic animals discussed herein may be used to generate cell lines containing one or more cell types involved in glaucoma, that can be used as cell culture models for this disorder. While primary cultures derived from the glaucomatous transgenic animals of the invention may be utilized, the generation of continuous cell lines is preferred. For examples of techniques which may be used to derive a continuous cell line from the transgenic animals, see Small et al., 1985, Mol. Cell Biol. 5:642-648.
  • test compound used for a variety of end points to test cell proliferation, migration, phagocytosis, adherence and/or biosynthesis (e.g. of extracellular matrix components).
  • the cells can then be examined for phenotypes associated with glaucoma, including, but not limited to changes in cellular morphology, cell proliferation, cell migration, and cell adhesion.
  • a transcriptional based assay could be used, for example, in which a GLCIA responsive regulatory sequence is operably linked to a detectable marker gene.
  • Monitoring the influence of compounds on cells may be applied not only in basic drug screening, but also in clinical trials. In such clinical trials, the expression of a panel of genes may be used as a "read out" of a particular drug's therapeutic effect.
  • the subject GLCIA polypeptides can be used to generate a "two hybrid" assay (see, for example, U.S. Patent No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J Biol Chem 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693- 1696; and Brent WO94/10300), for isolating coding sequences for other cellular proteins which bind to or interact with GLCIA ("GLCl A-binding proteins" or "GLClA-bp.
  • the two hybrid assay relies on reconstituting in vivo a functional transcriptional activator protein from two separate fusion proteins.
  • the method makes use of chimeric genes which express hybrid proteins.
  • a first hybrid gene comprises the coding sequence for a DNA-binding domain of a transcriptional activator fused in frame to the coding sequence for a GLCIA polypeptide.
  • the second hybrid protein encodes a transcriptional activation domain fused in frame to a sample gene from a cDNA library. If the bait and sample hybrid proteins are able to interact, e.g., form a GLClA-dependent complex, they bring into close proximity the two domains of the transcriptional activator. This proximity is sufficient to cause transcription of a reporter gene which is operably linked to a transcriptional regulatory site responsive to the transcriptional activator, and expression of the reporter gene can be detected and used to score for the interaction of the GLCIA and sample proteins.
  • transgenic animals which are comprised of cells (of that animal) which contain a transgene of the present invention and which preferably (though optionally) express an exogenous GLCIA protein in one or more cells in the animal.
  • a GLCl A transgene can encode the wild-type form of the protein, or can encode homologs thereof, including both agonists and antagonists, as well as antisense constructs.
  • the expression of the transgene is restricted to specific subsets of cells, tissues or developmental stages utilizing, for example, cis-acting sequences that control expression in the desired pattern.
  • such mosaic expression of a GLCl A protein can be essential for many forms of lineage analysis and can additionally provide a means to assess the effects of, for example, lack of GLCIA expression which might grossly alter development in small patches of tissue within an otherwise normal embryo.
  • tissue-specific regulatory sequences and conditional regulatory sequences can be used to control expression of the transgene in certain spatial patterns.
  • temporal patterns of expression can be provided by, for example, conditional recombination systems or prokaryotic transcriptional regulatory sequences.
  • target sequence refers to a nucleotide sequence that is genetically recombined by a recombinase.
  • the target sequence is flanked by recombinase recognition sequences and is generally either excised or inverted in cells expressing recombinase activity.
  • Recombinase catalyzed recombination events can be designed such that recombination of the target sequence results in either the activation or repression of expression of one of the subject GLCIA proteins.
  • excision of a target sequence which interferes with the expression of a recombinant GLCIA gene such as one which encodes an antagonistic homolog or an antisense transcript, can be designed to activate expression of that gene.
  • This interference with expression of the protein can result from a variety of mechanisms, such as spatial separation of the GLC 1 A gene from the promoter element or an internal stop codon.
  • the transgene can be made wherein the coding sequence of the gene is flanked by recombinase recognition sequences and is initially transfected into cells in a 3' to 5' orientation with respect to the promoter element.
  • inversion of the target sequence will reorient the subject gene by placing the 5' end of the coding sequence in an orientation with respect to the promoter element which allow for promoter driven transcriptional activation.
  • the transgenic animals of the present invention all include within a plurality of their cells a transgene of the present invention, which transgene alters the phenotype of the "host cell” with respect to regulation of cell growth, death and/or differentiation. Since it is possible to produce transgenic organisms of the invention utilizing one or more of the transgene constructs described herein, a general description will be given of the production of transgenic organisms by referring generally to exogenous genetic material. This general description can be adapted by those skilled in the art in order to incorporate specific transgene sequences into organisms utilizing the methods and materials described below. In an illustrative embodiment, either the crelloxP recombinase system of bacteriophage PI (Lakso et al.
  • loxP sequences are 34 base pair nucleotide repeat sequences to which the Cre recombinase binds and are required for Cre recombinase mediated genetic recombination.
  • the orientation of loxP sequences determines whether the intervening target sequence is excised or inverted when Cre recombinase is present (Abremski et al. (1984) J Biol. Chem.
  • genetic recombination of the target sequence is dependent on expression of the Cre recombinase.
  • Expression of the recombinase can be regulated by promoter elements which are subject to regulatory control, e.g., tissue-specific, developmental stage-specific, inducible or repressible by externally added agents. This regulated control will result in genetic recombination of the target sequence only in cells where recombinase expression is mediated by the promoter element.
  • the activation expression of a recombinant GLCIA protein can be regulated via control of recombinase expression.
  • crelloxP recombinase system to regulate expression of a recombinant GLCIA protein requires the construction of a transgenic animal containing transgenes encoding both the Cre recombinase and the subject protein. Animals containing both the Cre recombinase and a recombinant GLCIA gene can be provided through the construction of "double" transgenic animals. A convenient method for providing such animals is to mate two transgenic animals each containing a transgene, e.g., a GLCIA gene and recombinase gene.
  • transgenic animals containing a GLCIA transgene in a recombinase-mediated expressible format derives from the likelihood that the subject protein, whether agonistic or antagonistic, can be deleterious upon expression in the transgenic animal.
  • a founder population in which the subject transgene is silent in all tissues, can be propagated and maintained. Individuals of this founder population can be crossed with animals expressing the recombinase in, for example, one or more tissues and/or a desired temporal pattern.
  • a founder population in which, for example, an antagonistic GLCIA transgene is silent will allow the study of progeny from that founder in which disruption of GLCIA mediated induction in a particular tissue or at certain developmental stages would result in, for example, a lethal phenotype.
  • prokaryotic promoter sequences which require prokaryotic proteins to be simultaneous expressed in order to facilitate expression of the GLCIA transgene.
  • Exemplary promoters and the corresponding trans-activating prokaryotic proteins are given in U.S. Patent No. 4,833,080.
  • conditional transgenes can be induced by gene therapy-like methods wherein a gene encoding the trans-activating protein, e.g. a recombinase or a prokaryotic protein, is delivered to the tissue and caused to be expressed, such as in a cell-type specific manner.
  • a GLC1AA transgene could remain silent into adulthood until "turned on” by the introduction of the trans-activator.
  • the "transgenic non-human animals" of the invention are produced by introducing transgenes into the germline of the non-human animal.
  • Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell.
  • the specific line(s) of any animal used to practice this invention are selected for general good health, good embryo yields, good pronuclear visibility in the embryo, and good reproductive fitness.
  • the haplotype is a significant factor. For example, when transgenic mice are to be produced, strains such as C57BL/6 or FVB lines are often used (Jackson Laboratory, Bar Harbor, ME). Preferred strains are those with H-2 ⁇ ,
  • H-2 ⁇ or H-21 haplotypes such as C57BL/6 or DBA/1.
  • the line(s) used to practice this invention may themselves be transgenics, and/or may be knockouts (i.e., obtained from animals which have one or more genes partially or completely suppressed) .
  • the transgene construct is introduced into a single stage embryo. The zygote is the best target for micro-injection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of l-2pl of DNA solution.
  • zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host gene before the first cleavage (Brinster et al. (1985) PNAS 82:4438-4442). As a consequence, all cells of the transgenic animal will carry the incorporated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene.
  • the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus as described below. In some species such as mice, the male pronucleus is preferred. It is most preferred that the exogenous genetic material be added to the male DNA complement of the zygote prior to its being processed by the ovum nucleus or the zygote female pronucleus.
  • ovum nucleus or female pronucleus release molecules which affect the male DNA complement, perhaps by replacing the protamines of the male DNA with histones, thereby facilitating the combination of the female and male DNA complements to form the diploid zygote.
  • the exogenous genetic material be added to the male complement of DNA or any other complement of DNA prior to its being affected by the female pronucleus.
  • the exogenous genetic material is added to the early male pronucleus, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane.
  • the exogenous genetic material could be added to the nucleus of the sperm after it has been induced to undergo decondensation.
  • Sperm containing the exogenous genetic material can then be added to the ovum or the decondensed sperm could be added to the ovum with the transgene constructs being added as soon as possible thereafter.
  • transgene nucleotide sequence into the embryo may be accomplished by any means known in the art such as, for example, microinjection, electroporation, or lipofection.
  • the embryo may be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. In vitro incubation to maturity is within the scope of this invention.
  • a zygote is essentially the formation of a diploid cell which is capable of developing into a complete organism.
  • the zygote will be comprised of an egg containing a nucleus formed, either naturally or artificially, by the fusion of two haploid nuclei from a gamete or gametes.
  • the gamete nuclei must be ones which are naturally compatible, i.e., ones which result in a viable zygote capable of undergoing differentiation and developing into a functioning organism.
  • a euploid zygote is preferred. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one with respect to the euploid number of the organism from which either gamete originated.
  • the biological limit of the number and variety of DNA sequences will vary depending upon the particular zygote and functions of the exogenous genetic material and will be readily apparent to one skilled in the art, because the genetic material, including the exogenous genetic material, of the resulting zygote must be biologically capable of initiating and maintaining the differentiation and development of the zygote into a functional organism.
  • the number of copies of the transgene constructs which are added to the zygote is dependent upon the total amount of exogenous genetic material added and will be the amount which enables the genetic transformation to occur. Theoretically only one copy is required; however, generally, numerous copies are utilized, for example, 1 ,000-20,000 copies of the transgene construct, in order to insure that one copy is functional. As regards the present invention, there will often be an advantage to having more than one functioning copy of each of the inserted exogenous DNA sequences to enhance the phenotypic expression of the exogenous DNA sequences.
  • exogenous genetic material is preferentially inserted into the nucleic genetic material by microinjection. Microinjection of cells and cellular structures is known and is used in the art.
  • Reimplantation is accomplished using standard methods. Usually, the surrogate host is anesthetized, and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary by species, but will usually be comparable to the number of off spring the species naturally produces.
  • Transgenic offspring of the surrogate host may be screened for the presence and/or expression of the transgene by any suitable method. Screening is often accomplished by Southern blot or Northern blot analysis, using a probe that is complementary to at least a portion of the transgene. Western blot analysis using an antibody against the protein encoded by the transgene may be employed as an alternative or additional method for screening for the presence of the transgene product.
  • DNA is prepared from tail tissue and analyzed by Southern analysis or PCR for the transgene.
  • the tissues or cells believed to express the transgene at the highest levels are tested for the presence and expression of the transgene using Southern analysis or PCR, although any tissues or cell types may be used for this analysis.
  • transgenic animals include, without limitation, suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like. Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents. Progeny of the transgenic animals may be obtained by mating the transgenic animal with a suitable partner, or by in vitro fertilization of eggs and/or sperm obtained from the transgenic animal.
  • suitable biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like.
  • Analysis of the blood may also be useful to detect the presence of the transgene product in the blood, as well as to evaluate the effect of the transgene on the levels of various types of blood cells and other blood constituents.
  • Progeny of the transgenic animals may be obtained by mating the trans
  • the partner may or may not be transgenic and/or a knockout; where it is transgenic, it may contain the same or a different transgene, or both.
  • the partner may be a parental line.
  • in vitro fertilization the fertilized embryo may be implanted into a surrogate host or incubated in vitro, or both. Using either method, the progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods.
  • the transgenic animals produced in accordance with the present invention will include exogenous genetic material.
  • the exogenous genetic material will, in certain embodiments, be a DNA sequence which results in the production of a GLCIA protein (either agonistic or antagonistic), and antisense transcript, or a GLCIA mutant.
  • the sequence will be attached to a transcriptional control element, e.g., a promoter, which preferably allows the expression of the transgene product in a specific type of cell.
  • Retroviral infection can also be used to introduce transgene into a non-human animal.
  • the developing non-human embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) PNAS 73:1260-1264). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986).
  • the viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al. (1985) PNAS 82:6927-6931 ; Van der Putten et al. (1985) PNAS 82:6148-6152).
  • Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner et al. (1982) Nature
  • transgenes are mosaic for the transgene since incorporation occurs only in a subset of the cells which formed the transgenic non-human animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germ line by intrauterine retroviral infection of the midgestation embryo (Jahner et al. (1982) supra).
  • ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (Evans et al. (1981) Nature 292:154-156; Bradley et al. (1984) Nature 309:255-258; Gossler et al. (1986) PNAS 83: 9065-9069; and Robertson et al. (1986) Nature 322:445-448).
  • Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retrovirus-mediated transduction.
  • Such transformed ES cells can thereafter be combined with blastocysts from a non-human animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • Jaenisch, R. (1988) Science 240:1468-1474 For review see Jaenisch, R. (1988) Science 240:1468-1474.
  • gene targeting which is a method of using homologous recombination to modify an animal's genome, can be used to introduce changes into cultured embryonic stem cells.
  • a GLCIA gene of interest in ES cells By targeting a GLCIA gene of interest in ES cells, these changes can be introduced into the germlines of animals to generate chimeras.
  • the gene targeting procedure is accomplished by introducing into tissue culture cells a DNA targeting construct that includes a segment homologous to a target GLCIA locus, and which also includes an intended sequence modification to the GLCIA genomic sequence (e.g., insertion, deletion, point mutation). The treated cells are then screened for accurate targeting to identify and isolate those which have been properly targeted.
  • Gene targeting in embryonic stem cells is in fact a scheme contemplated by the present invention as a means for disrupting a GLCIA gene function through the use of a targeting transgene construct designed to undergo homologous recombination with one or more GLCIA genomic sequences.
  • the targeting construct can be arranged so that, upon recombination with an element of a GLCIA gene, a positive selection marker is inserted into (or replaces) coding sequences of the gene.
  • the inserted sequence functionally disrupts the GLCIA gene, while also providing a positive selection trait.
  • Exemplary GLCIA targeting constructs are described in more detail below.
  • the embryonic stem cells (ES cells ) used to produce the knockout animals will be of the same species as the knockout animal to be generated. Thus for example, mouse embryonic stem cells will usually be used for generation of knockout mice.
  • Embryonic stem cells are generated and maintained using methods well known to the skilled artisan such as those described by Doetschman et al. (1985) J. Embryol. Exp. MoGLClAhol. 87:27-45). Any line of ES cells can be used, however, the line chosen is typically selected for the ability of the cells to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the knockout construct. Thus, any ES cell line that is believed to have this capability is suitable for use herein.
  • One mouse strain that is typically used for production of ES cells is the 129J strain.
  • Another ES cell line is murine cell line D3 (American Type Culture Collection, catalog no.
  • Still another preferred ES cell line is the WW6 cell line (Ioffe et al. (1995) PNAS 92:7357-7361).
  • the cells are cultured and prepared for knockout construct insertion using methods well known to the skilled artisan, such as those set forth by Robertson in:
  • Insertion of the knockout construct into the ES cells can be accomplished using a variety of methods well known in the art including for example, electroporation, microinjection, and calcium phosphate treatment.
  • a preferred method of insertion is electroporation .
  • Each knockout construct to be inserted into the cell must first be in the linear form. Therefore, if the knockout construct has been inserted into a vector (described infra), linearization is accomplished by digesting the DNA with a suitable restriction endonuclease selected to cut only within the vector sequence and not within the knockout construct sequence.
  • the knockout construct is added to the ES cells under appropriate conditions for the insertion method chosen, as is known to the skilled artisan. Where more than one construct is to be introduced into the ES cell, each knockout construct can be introduced simultaneously or one at a time.
  • the ES cells and knockout construct DNA are exposed to an electric pulse using an electroporation machine and following the manufacturer's guidelines for use. After electroporation, the ES cells are typically allowed to recover under suitable incubation conditions. The cells are then screened for the presence of the knockout construct .
  • the marker gene is an antibiotic resistance gene
  • the ES cells may be cultured in the presence of an otherwise lethal concentration of antibiotic. Those ES cells that survive have presumably integrated the knockout construct.
  • the marker gene is other than an antibiotic resistance gene
  • a Southern blot of the ES cell genomic DNA can be probed with a sequence of DNA designed to hybridize only to the marker sequence Alternatively, PCR can be used.
  • the marker gene is a gene that encodes an enzyme whose activity can be detected (e.g., b-galactosidase)
  • the enzyme substrate can be added to the cells under suitable conditions, and the enzymatic activity can be analyzed.
  • the knockout construct may integrate into several locations in the ES cell genome, and may integrate into a different location in each ES cell's genome due to the occurrence of random insertion events.
  • the desired location of insertion is in a complementary position to the DNA sequence to be knocked out, e.g., the GLCIA coding sequence, transcriptional regulatory sequence, etc.
  • the GLCIA coding sequence e.g., the GLCIA coding sequence, transcriptional regulatory sequence, etc.
  • less than about 1-5 % of the ES cells that take up the knockout construct will actually integrate the knockout construct in the desired location.
  • total DNA can be extracted from the ES cells using standard methods.
  • the DNA can then be probed on a Southern blot with a probe or probes designed to hybridize in a specific pattern to genomic DNA digested with particular restriction enzyme(s).
  • the genomic DNA can be amplified by PCR with probes specifically designed to amplify DNA fragments of a particular size and sequence (i.e., only those cells containing the knockout construct in the proper position will generate DNA fragments of the proper size).
  • the cells can be inserted into an embryo. Insertion may be accomplished in a variety of ways known to the skilled artisan, however a preferred method is by microinjection. For microinjection, about 10-30 cells are collected into a micropipet and injected into embryos that are at the proper stage of development to permit integration of the foreign ES cell containing the knockout construct into the developing embryo. For instance, as the appended Examples describe, the transformed ES cells can be microinjected into blastocytes.
  • the suitable stage of development for the embryo used for insertion of ES cells is very species dependent, however for mice it is about 3.5 days.
  • the embryos are obtained by perfusing the uterus of pregnant females. Suitable methods for accomplishing this are known to the skilled artisan, and are set forth by, e.g., Bradley et al. (supra).
  • preferred embryos are male.
  • the preferred embryos also have genes coding for a coat color that is different from the coat color encoded by the ES cell genes.
  • the offspring can be screened easily for the presence of the knockout construct by looking for mosaic coat color (indicating that the ES cell was incorporated into the developing embryo).
  • the embryo selected will carry genes for black or brown fur.
  • the embryo may be implanted into the uterus of a pseudopregnant foster mother for gestation. While any foster mother may be used, the foster mother is typically selected for her ability to breed and reproduce well, and for her ability to care for the young. Such foster mothers are typically prepared by mating with vasectomized males of the same species.
  • the stage of the pseudopregnant foster mother is important for successful implantation, and it is species dependent. For mice, this stage is about 2-3 days pseudopregnant.
  • Offspring that are born to the foster mother may be screened initially for mosaic coat color where the coat color selection strategy (as described above, and in the appended examples) has been employed.
  • DNA from tail tissue of the offspring may be screened for the presence of the knockout construct using Southern blots and/or PCR as described above. Offspring that appear to be mosaics may then be crossed to each other, if they are believed to carry the knockout construct in their germ line, in order to generate homozygous knockout animals. Homozygotes may be identified by Southern blotting of equivalent amounts of genomic DNA from mice that are the product of this cross, as well as mice that are known heterozygotes and wild type mice.
  • Northern blots can be used to probe the mRNA for the presence or absence of transcripts encoding either the gene knocked out, the marker gene, or both.
  • Western blots can be used to assess the level of expression of the GLCIA gene knocked out in various tissues of the offspring by probing the Western blot with an antibody against the particular GLCIA protein, or an antibody against the marker gene product, where this gene is expressed.
  • in situ analysis such as fixing the cells and labeling with antibody
  • FACS fluorescence activated cell sorting
  • knock-out or disruption transgenic animals are also generally known. See, for example, Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Recombinase dependent knockouts can also be generated, e.g. by homologous recombination to insert target sequences, such that tissue specific and/or temporal control of inactivation of a GLClA-gene can be controlled by recombinase sequences (described infra).
  • Animals containing more than one knockout construct and/or more than one transgene expression construct are prepared in any of several ways.
  • the preferred manner of preparation is to generate a series of mammals, each containing one of the desired transgenic phenotypes. Such animals are bred together through a series of crosses, backcrosses and selections, to ultimately generate a single animal containing all desired knockout constructs and/or expression constructs, where the animal is otherwise congenic (genetically identical) to the wild type except for the presence of the knockout construct(s) and/or transgene(s) .
  • a family in which five consecutive generations have been affected with juvenile-onset, open-angle glaucoma without iridocorneal angle abnormalities was identified.
  • the family comprised descendants of a woman who emigrated from Germany to the midwestern United States in the late 1800s.
  • the disease state in affected family members included onset during the first 3 decades of life, normal anterior chamber angles, high intraocular pressures, lack of systemic or other ocular abnormalities, and need for surgery to control the glaucoma in affected individuals.
  • Affected family members are characterized by an early age of diagnosis, a normal appearing trabecular meshwork, very high intraocular pressures (often above 50 mm Hg), and relatively pressure-resistant optic nerves.
  • Amplification of each STRP was performed with 50 ng. of each patient's DNA in a 8.35 1 PCR containing each of the following: 1.25 1 10 X buffer (lOOmM Tris-HCl pH 8.8, 500 mM KC1, 15 mM MgCl 2 , 0.01% w/v gelatin), 300 M each of dCTP, dGTP and dTTP, 37M dATP, 50pmoles each primer, 0.25 1 - 35 S-dATP (Amersham,>1000 Ci mmol" 1 ), and 0.25 U Taq polymerase (Perkin-Elmer/Cetus). Samples were incubated in a DNA thermocycler (Perkin-
  • Genotypic data from the autoradiographs were entered into a Macintosh computer.
  • a Hypercard-based program (Nichols, BE et al., Am J Hum Genet 51 A369 (1992)) was used to store and retrieve marker data as well as to export it to a DOS- compatible machine for analysis with the computer program LINKAGE (version 5.1) (Lathrop, GM and LaLouel, JM 359, 794-801 (1992)). Allele frequencies were assumed to be equal for each marker.
  • the MLINK routine was used for pairwise analysis. The relative odds of all possible orders of the disease and two markers (D1S191 and D 1 S 194) was performed under the ILINK program. Significance of linkage was evaluated using the standard criterion (Z max >3.0).
  • the next step in identifying any disease gene by positional cloning is the narrowing of the candidate locus to the smallest possible genetic region.
  • the initial study described in Example 5.1 demonstrated that a primary open angle glaucoma gene lies within an approximately 20 cM region flanked by markers D1S194 and D1S191 on chromosome lq. Additional markers and families were obtained and used to refine the genetic locus to a 2.5 cM region using two of these families. The third family should allow the interval to be further narrowed.
  • polymorphic DNA markers and genetic maps were used to refine the lq glaucoma locus.
  • STRPs the genotype of each family member was determined. Amplification of each STRP was performed using the following protocol:
  • CEPH mega- YAC library Forty-four percent of the clones in the CEPH mega- YAC library have an average size of 560 kb, an additional 21% have an average size of 800 kb. and 35% have an average size of 120 kb.
  • This library is available in a gridded micro-titer plate format such that only 50-200 PCR reactions need to be performed using a specific sequence tagged site (STS) to identify a unique YAC containing the STS.
  • STS sequence tagged site
  • the YAC contigs identified by CEPH have been used to begin constructing a contig across the lq candidate region (see Figure 3).
  • YAC contigs using YAC ends can be constructed to identify additional YACs.
  • YAC ends can be rescued using anchored PCR (Riley, J.
  • the ends can then be sequenced and the sequence can be used to develop a sequence tagged site (STS).
  • STS can be used to rescreen the YAC library to obtain an overlapping adjacent YAC.
  • YACs have been shown to be chimeric or to contain deletions or rearrangements, particularly those from the mega YAC library, the correctness of each YAC contig should be verified by constructing a pulse field map of the region.
  • chimeric YACs are minimized by ensuring that the YAC maps to a single chromosome by fluorescent in situ hybridization (FISH) or that the two YAC ends map to the same chromosome using monochromosomal somatic cell hybrids (NIGMs Panel 2).
  • FISH fluorescent in situ hybridization
  • NIGMs Panel 2 monochromosomal somatic cell hybrids
  • the YAC chimera problem can be minimized by not relying on any single YAC to span a given chromosome segment, but rather by obtaining at least two overlapping independent YACs to ensure coverage of a given region.
  • this reagent can be used to generate additional genetic markers for potentially finer genetic mapping.
  • the YACs can be used to make higher resolution physical mapping reagents such as region specific lambda and cosmid clones. Lambda and cosmid clones can be used for isolation of candidate genes.
  • a modification of "exon trapping" Duyk, G.M. (1990) Proc Natl Acad Sci USA 87:8995-8999) known as exon amplification (Buckler, A.J. (1991) Proc Natl Acad Sci USA 88:4005-4009) can be used to identify exons from genes within the region.
  • Exons trapped from the candidate region can be used as probes to screen eye cDNA libraries to isolate cDNAs.
  • other strategies can be utilized to identify genes in genomic DNA including screening cDNA libraries with YAC fragments subcloned into cosmids, zoo blot analysis, coincidence cloning strategies such as direct selection of cDNAs with biotin-streptavidin tagged cosmid clones (Morgan, J.G. et al (1992) Nucleic Acid Res 20 (19):5173-5179), and HTF island analysis (Bird, A. P. (1987) Trends Genet 3:342-247).
  • Promising genes will be further evaluated by searching for mutations using GC-clamped denaturing gradient gel electrophoresis (Sheffield, V.C. et al (1989) Genomics 16:325-332), single strand conformational gel polymorphism (SSCP) analysis (Orita, M. et al (1989) Proc Natl Acad Sci USA 86:2766-2770) and direct DNA sequencing.
  • GC-clamped denaturing gradient gel electrophoresis Sheffield, V.C. et al (1989) Genomics 16:325-332
  • SSCP single strand conformational gel polymorphism
  • Primer 1 forward - ATACTGCCTAGGCCACTGGA (SEQ ID NO: 1
  • TIGR Trabecular Meshwork Induced Glucocorticoid
  • MOLECULE TYPE DNA (genomic)
  • AAGACCCTGA CCATCCCATT CAAGAACCGC TATAAGTACA GCAGCATGAT TGACTACAAC 1620
  • TCACAT 2166 INFORMATION FOR SEQ ID NO: 2:
  • ATC CCA TTC AAG AAC CGC TAT AAG TAC AGC AGC ATG ATT GAC TAC AAC 1440 lie Pro Phe Lys Asn Arg Tyr Lys Tyr Ser Ser Met lie Asp Tyr Asn 465 470 475 480
  • Ser Arg lie Leu Lys Glu Ser Pro Ser Gly Tyr Leu Arg Ser Gly Glu 225 230 235 240
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE other nucleic acid
  • MOLECULE TYPE DNA (genomic)
  • ANAAAGTTGT CAATTGTCCC TTTTGAAAAA CTATCCTTTTTT TTGAACCTTT GCTCAGATTG 360
  • MOLECULE TYPE DNA (genomic)

Abstract

Agents utilisés pour le diagnostic du glaucome, ledit diagnostique étant fondé sur la détection de gènes ou de protéines GLC1A de type non sauvage chez un sujet; agents thérapeutiques pour lutter contre le glaucome; procédés de criblage pour identifier des agents qui modulent l'activité de GLC1A et sont donc utiles pour traiter ou prévenir le glaucome.
PCT/US1997/020702 1996-11-08 1997-11-07 Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques WO1998020131A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP97948270A EP0942975A1 (fr) 1996-11-08 1997-11-07 Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques
AU54364/98A AU5436498A (en) 1996-11-08 1997-11-07 Glaucoma-associated protein and corresponding nucleic acid and their therapeut ic and diagnostic uses
JP52188498A JP2001503631A (ja) 1996-11-08 1997-11-07 緑内障に関連するタンパク質ならびに対応する核酸とそれらの治療および診断への利用
CA002271235A CA2271235A1 (fr) 1996-11-08 1997-11-07 Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US08/748,479 US5925748A (en) 1994-04-28 1996-11-08 DNA diagnostics for glaucoma
US08/791,347 US5885776A (en) 1997-01-30 1997-01-30 Glaucoma compositions and therapeutic and diagnositic uses therefor
US08/822,999 1997-03-21
US08/822,999 US6271026B1 (en) 1997-03-21 1997-03-21 Glaucoma compositions
US08/748,479 1997-03-21
US08/791,347 1997-03-21

Publications (1)

Publication Number Publication Date
WO1998020131A1 true WO1998020131A1 (fr) 1998-05-14

Family

ID=27419366

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/020702 WO1998020131A1 (fr) 1996-11-08 1997-11-07 Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques

Country Status (5)

Country Link
EP (1) EP0942975A1 (fr)
JP (1) JP2001503631A (fr)
AU (1) AU5436498A (fr)
CA (1) CA2271235A1 (fr)
WO (1) WO1998020131A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999051779A2 (fr) * 1998-04-07 1999-10-14 The University Of Iowa Research Foundation Traitement et diagnostic du glaucome
US6150161A (en) * 1994-11-03 2000-11-21 The Regents Of The University Of California Methods for the diagnosis of glaucoma
US6171788B1 (en) 1997-01-28 2001-01-09 The Regents Of The University Of California Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
WO2001027272A1 (fr) * 1999-10-08 2001-04-19 Hamilton Brook Smith & Reynold Oculomedine et glaucome
US6475724B1 (en) 1997-01-28 2002-11-05 The Regents Of The University Of California Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6956103B2 (en) 1994-04-28 2005-10-18 The University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics
US7138511B1 (en) 1997-01-28 2006-11-21 The Regents Of The University Of California Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1685055A (zh) * 2001-10-31 2005-10-19 爱尔康公司 骨形态发生蛋白(bmp)、bmp受体和bmp结合蛋白及它们在诊断和治疗青光眼中的用途
US7071211B2 (en) * 2002-09-27 2006-07-04 Bausch & Lomb Inc. Small organic molecules that increase the activity of gelatinase a in ocular cells

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014411A1 (fr) * 1994-11-03 1996-05-17 The Regents Of The University Of California Procedes de diagnostic du glaucome

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996014411A1 (fr) * 1994-11-03 1996-05-17 The Regents Of The University Of California Procedes de diagnostic du glaucome

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
EMBL Database entry HSU85257; Accession number U85257; 02 March 1997; Nguyen and Polansky: 'Human trabecular meshwork inducible glucocorticoid response protein (TIGR) mRNA, complete cds.' *
ESCRIBANO J ET AL: "ISOLATION AND CHARACTERIZATION OF CELL-SPECIFIC CDNA CLONES FROM A SUBTRACTIVE LIBRARY OF THE OCULAR CILIARY BODY OF A SINGLE NORMAL HUMAN DONOR: TRANSCRIPTION AND SYNTHESIS OF PLASMA PROTEINS", JOURNAL OF BIOCHEMISTRY, vol. 118, no. 5, November 1995 (1995-11-01), pages 921 - 931, XP002049425 *
ORTEGO J ET AL: "CLONING AND CHARACTERIZATION OF SUBTRACTED CDNAS FROM A HUMAN CILIARY BODY LIBRARY ENCODING TIGR, A PROTEIN INVOLVED IN JUVENILE OPEN ANGLE GLAUCOMA WITH HOMOLOGY TO MYOSIN AND OLFACTOMEDIN", FEBS LETTERS, vol. 413, no. 2, 18 August 1997 (1997-08-18), pages 349 - 353, XP002049426 *
STONE E.M. ET AL.: "Identification of a gene that causes primary open angle glaucoma.", SCIENCE, vol. 275, 31 January 1997 (1997-01-31), pages 668 - 670, XP002049424 *
SUNDEN S L F ET AL: "FINE MAPPING OF THE AUTOSOMAL DOMINANT JUVENILE OPEN ANGLE GLAUCOMA (GLC1A) REGION AND EVALUATION OF CANDIDATE GENES", GENOME RESEARCH, vol. 6, no. 9, September 1996 (1996-09-01), pages 862 - 869, XP002039329 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6956103B2 (en) 1994-04-28 2005-10-18 The University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics
US6150161A (en) * 1994-11-03 2000-11-21 The Regents Of The University Of California Methods for the diagnosis of glaucoma
US6171788B1 (en) 1997-01-28 2001-01-09 The Regents Of The University Of California Methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6475724B1 (en) 1997-01-28 2002-11-05 The Regents Of The University Of California Nucleic acids, kits, and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US7138511B1 (en) 1997-01-28 2006-11-21 The Regents Of The University Of California Nucleic acids, kits and methods for the diagnosis, prognosis and treatment of glaucoma and related disorders
US6403307B1 (en) 1997-03-21 2002-06-11 University Of Iowa Research Foundation Glaucoma therapeutics and diagnostics
WO1999051779A2 (fr) * 1998-04-07 1999-10-14 The University Of Iowa Research Foundation Traitement et diagnostic du glaucome
WO1999051779A3 (fr) * 1998-04-07 1999-12-29 Univ Iowa Res Found Traitement et diagnostic du glaucome
WO2001027272A1 (fr) * 1999-10-08 2001-04-19 Hamilton Brook Smith & Reynold Oculomedine et glaucome

Also Published As

Publication number Publication date
CA2271235A1 (fr) 1998-05-14
EP0942975A1 (fr) 1999-09-22
JP2001503631A (ja) 2001-03-21
AU5436498A (en) 1998-05-29

Similar Documents

Publication Publication Date Title
US5800998A (en) Assays for diagnosing type II diabetes in a subject
US5885776A (en) Glaucoma compositions and therapeutic and diagnositic uses therefor
AU6952498A (en) Novel human delta3 compositions and therapeutic and diagnostic uses therefor
US6031076A (en) Conservin compositions
US6143491A (en) Therapeutic compositions and methods and diagnostic assays for type II diabetes involving HNF-1
US6399760B1 (en) RP compositions and therapeutic and diagnostic uses therefor
US6833239B1 (en) Methods to identify modulators of FKHL7 DNA-binding activity
US6593104B1 (en) Macular degeneration diagnostics and therapeutics
US6403307B1 (en) Glaucoma therapeutics and diagnostics
WO1998020131A1 (fr) Proteine associee au glaucome, acide nucleique correspondant et leurs utilisations diagnostiques et therapeutiques
US7141543B2 (en) RIEG compositions and therapeutic and diagnostic uses therefor
WO1998046748A1 (fr) Compositions therapeutiques et dosages de diagnostic pour des affections liees a la trbp
US6271026B1 (en) Glaucoma compositions
AU766890B2 (en) Glaucoma therapeutics and diagnostics based on a novel human transcription factor
US6956103B2 (en) Glaucoma therapeutics and diagnostics
WO1998021363A1 (fr) Compositions et therapies utilisables contre le diabete de type ii lie au hnf-4
US6306586B1 (en) Methods and compositions for the diagnosis and treatment of cataracts
AU3556402A (en) Glaucoma-associated protein and corresponding nucleic acid and their therapeutic and diagnostic uses
US20050123960A1 (en) Glaucoma therapeutics and diagnostics
WO1998040495A1 (fr) Doublin, gene participant au developpement neuronal et utilisations de ce gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2271235

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 54364/98

Country of ref document: AU

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 521884

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997948270

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997948270

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997948270

Country of ref document: EP