WO1998017795A1 - Acide nucleique codant des proteines ds-cam et produits associes - Google Patents

Acide nucleique codant des proteines ds-cam et produits associes Download PDF

Info

Publication number
WO1998017795A1
WO1998017795A1 PCT/US1997/019547 US9719547W WO9817795A1 WO 1998017795 A1 WO1998017795 A1 WO 1998017795A1 US 9719547 W US9719547 W US 9719547W WO 9817795 A1 WO9817795 A1 WO 9817795A1
Authority
WO
WIPO (PCT)
Prior art keywords
ser
seq
cam
val
thr
Prior art date
Application number
PCT/US1997/019547
Other languages
English (en)
Inventor
Julie R. Korenberg
Original Assignee
Cedars-Sinai Medical Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cedars-Sinai Medical Center filed Critical Cedars-Sinai Medical Center
Priority to JP10519729A priority Critical patent/JP2001502906A/ja
Priority to EP97946341A priority patent/EP0934408A1/fr
Publication of WO1998017795A1 publication Critical patent/WO1998017795A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • the present invention relates to nucleic acids and proteins encoded thereby.
  • Invention nucleic acids encode a novel N-CAM member of the immunoglobulin superfamily of proteins.
  • the invention also relates to methods for making and using such nucleic acids and proteins.
  • CAMs Cell surface proteins, and especially the so-called Cellular Adhesion Molecules (“CAMs”) have correspondingly been the subject of pharmaceutical research and development having as its goal intervening in the processes of leukocyte extravasation to sites of inflammation and leukocyte movement to distinct target tissues.
  • VCAM-1 vascular adhesion molecule
  • PECAM-1 platelet endothelial cell adhesion molecule
  • U.S. Patents 5,525,487; 5,235,049; 5,272,263; 5,489,233; 5,264,554; 5,318,890; 5,389,520; 5,519,008; and the like.
  • N-CAM locus llq23.1
  • Rosenthal et al . (Nature Genet . 2:107-112, 1992) reported that mutations in CAM-LI (locus Xq28) cause X-linked hydrocephalus, and Jouet et al . , (Nature Genet.
  • isolated nucleic acids encoding novel mammalian N-CAM (neural-cell adhesion molecule) members of the immunoglobulin superfamily of proteins, referred to herein as Down Syndrome-Cell Adhesion Molecules (DS-CAMs) .
  • vectors containing invention nucleic acids, probes that hybridize thereto, host cells transformed therewith, antisense oligonucleotides thereto and related compositions are provided.
  • the nucleic acid molecules described herein can be incorporated into a variety of recombinant expression systems known to those of skill in the art to readily produce isolated DS-CAM proteins.
  • nucleic acid molecules of the present invention are useful as probes for assaying for the presence and/or amount of a DS-CAM gene or mRNA transcript in a given sample.
  • the nucleic acid molecules described herein, and oligonucleotide fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding DS-CAM proteins.
  • isolated mammalian DS-CAM proteins are useful, for example, in neural prosthetic devices used in entubulation methods of repairing (regenerating) damaged or severed peripheral nerves (see, e.g., U.S. Patent No. 4,955,892, incorporated herein by reference) .
  • these proteins, or fragments thereof are useful as immunogens for producing anti-DS-CAM antibodies, or in therapeutic compositions containing such proteins and/or antibodies.
  • Invention DS-CAM proteins are also useful in bioassays to identify agonists and antagonists thereto.
  • transgenic non-human mammals that express the invention protein.
  • Antibodies that are immunoreactive with invention DS-CAM proteins are also provided. These antibodies are useful in diagnostic assays to determine levels of DS-CAM proteins present in a given sample, e.g., tissue samples, Western blots, and the like. The antibodies can also be used to purify DS-CAM proteins from crude cell extracts and the like. Moreover, these antibodies are considered therapeutically useful to counteract or supplement the biological effect of DS-CAMs in vivo . Methods and diagnostic systems for determining the levels of DS-CAM protein in various tissue samples are also provided. These diagnostic methods can be used for monitoring the level of therapeutically administered DS-CAM protein or fragments thereof to facilitate the maintenance of therapeutically effective amounts. These diagnostic methods can also be used to diagnose physiological disorders that result from abnormal levels or abnormal structures of the DS-CAM protein.
  • Figure 1 shows a physical map of the localization of the DS-CAM gene to a region between D21S345 and D21S347 on chromosome 21.
  • the locations of BAC clones (starting with numbers) and PAC clones (starting with "P") are indicated by horizontal bars.
  • An arrow head indicates a gap in the BAC and PAC contig.
  • the location of the DS-CAM gene is indicated by a thick arrow.
  • Figure 2 shows the predicted amino acid sequence of the human DS-CAMl protein corresponding to SEQ ID NO: 2 and a schematic structure.
  • Figure 3 shows a partial genomic structure of DS-CAMl and a deletion contained in DS-CAM2 cDNA clones (clones pDS-CAM-18 and pDS-CAM-52) .
  • the deletion boundary sequence (GC-AG) suggests an unusual alternative splicing.
  • the horizontal bar represents genomic sequence containing exons of DS-CAM-42. Exons are indicated by open boxes. Exon-intron boundaries are defined by a comparison of the cDNA sequence of pDS-CAM-42 and genomic sequence determined from a BAC clone.
  • Figure 4 shows a schematic comparison of neuronal Ig superfamily members. Ig-like type C-2 domains, fibronectin type III domains and transmembrane domains are indicated.
  • MAG myelin-associated glycoprotein
  • N-CAM neural cell adhesion molecule
  • BIG-1 brain-derived immunoglobulin (Ig) superfamily molecule-1
  • DCC deleted in colorectal carcinoma.
  • DS-CAM refers to substantially pure native DS-CAM protein, or recombinantly produced proteins, including naturally occurring allelic variants thereof encoded by mRNA generated by alternative splicing of a primary transcript, such as DS-CAMl (SEQ ID NO: 2) and DS-CAM2 (SEQ ID NO: 11) disclosed herein, and further including fragments thereof which retain at least one native biological activity, such as immunogenicity .
  • invention DS-CAM proteins, such as DS-CAMl are cell-surface glycoproteins that are mobile in the plane of the membrane.
  • invention DS-CAMl proteins contain extra- and intra-cellular domains that transduce information from the outside of the cell to the cytoplasm and the nucleus, thereby determining cell function.
  • invention DS-CAM proteins such as DS- CAM2
  • DS-CAM proteins are further characterized as comprising at least 7 Immunoglobulin-like (Ig-like) domains homologous to the immunoglobulin superfamily and 6 type III fibronectin repeats (see, e.g., Edelman and Crossin, "CELL ADHESION MOLECULES: Implications for a Molecular Histology", Ann. Rev. Biochem. , 60:155-190, 1991; and Walsh and Doherty,
  • DS-CAM proteins are those proteins comprising at least 8, preferably at least 9 Ig-like domains, with at least 10 Ig-like domains being especially preferred.
  • Ig-like domains refers to the well known repeats that are common among Cell Adhesion Molecules (CAMs) (see, e.g., Figure 1A at p. 158 of Edelman and Crossin, supra , 1991; and Walsh and Doherty, supra. 1993; each of which is incorporated herein by reference in its entirety) .
  • CAMs Cell Adhesion Molecules
  • fibronectin repeats refers to the well known repeats that are common among Cell Adhesion Molecules (CAMs) (see, e.g., Figure 1A at p. 158 of Edelman and Crossin, supra , 1991; and Walsh and Doherty, supra , 1993; each of which is incorporated herein by reference in its entirety) .
  • CAMs Cell Adhesion Molecules
  • the invention DS-CAM proteins define a novel sub-class of the Ig (immunoglobulin) superfamily with highest homologies to the neural cell adhesion molecules including BIG-1 (Yoshihara et al . , Neuron 13:415-426,
  • DS-CAM proteins is unique within the neural immunoglobulin superfamily, and is distinctive due to the number of Ig-like type C2 and fibronectin III domains (10 and 6 respectively) and from the interruption of the fourth and fifth fibronectin domains by a 10th C2 domain, the functional significance of which may be of interest.
  • the novel structure of DS-CAM and its expression throughout the nervous system during differentiation suggest interesting roles for the neural CAM in neural development and function.
  • the location of DS-CAM in a region critical for DS neurocognitive phenotypes provides a human model in which to test the significance of these roles for cognitive function.
  • the neural Ig-superfamily members play critical roles in neural development and function and have been implicated in cell migration and sorting, axon guidance and fasciculation, formation of neural connections, and in synaptic plasticity (Edelman and Crossin, supra, 1991; Walsh and Doherty, supra . 1993; Tessier-Lavigne et al . , Science 274:1123-1133. 1996: Shuster et al . , Neuron
  • differentiated neurons express DS-CAM when they have finished migrating to their proper positions within the neuroepithelium, during neurite outgrowth.
  • Neural crest cells may express DS-CAM while they are migrating. At 15.5 and 16.5 days pc, most of the neural crest derived tissues have some expression, although not all have finished migration. The continued expression of DS-CAM in the myenteric plexus after 15.5- 16.5 dpc is due to the neural crest cells that have stopped dividing, although others are in the cell cycle. Approximately 50% of myenteric ganglia neurons arise after birth and DS-CAM may be expressed later in this subset. At later stages, the data suggest that DS-CAM is down regulated in the neural crest derivatives such as the myenteric ganglia and ganglia of the pancreas.
  • the DS-CAM expression in tissues derived from the neural crest is of interest with respect to the high level detected in the umbilical cord.
  • the tissue surrounding the umbilical artery and vein is derived from the neural crest and functions in coordinating the cardiovascular changes occurring at birth.
  • the expression detected in the fetal liver and branchial arches is also derived from neural crest related to the ductus venosus and ultimately the ductus arteriosus and cardiac outflow tracts, respectively.
  • DS-CAM expression continues post-natally, in the differentiating regions of the newborn brain, such as, the septum and inferior colliculus, and in the adult in regions associated with plasticity, such as, the olfactory bulb and hippocampus.
  • the continued expression supports a role for DS-CAM in remodeling, learning and memory.
  • the expression pattern and the role of dendritic connections in cell body maintenance indicate that an increase in DS-CAM expression in DS brain is responsible in part for the abnormalities of dendritic structure and decreased intersections seen at four months post-natal in DS individuals .
  • CAMs Alternatively spliced variants of CAMs have distinct roles in different parts of the brain, as demonstrated for closely related Ig-superfamily members, such as, NCAM (Cunningham et al . , Science 236:799-806,
  • RT-PCR The results of RT-PCR (Example 5) indicated that all RNAs tested from various human tissues expressed both the DS-CAMl and DS-CAM2 transcripts and that the PCR products generated the sequence and size predicted for the appropriate form.
  • the proximal and distal borders of the deletion are located within neighboring exons and reveal variant consensus splice site sequences (Jackson, Nuc . Acid Res . 19:3795-3798,
  • Example 4 From Northern analyses (Example 4) a minimum of three distinct transcripts are recognized by a probe for the transmembrane domain. From cDNA sequence analyses (Example 5) two forms of the DS-CAM protein are deduced, one that generates a transmembrane adhesion molecule and a second that is deleted for the transmembrane domain, thereby generating a molecule that is transported to the extracellular matrix. This mode of generating extracellular and membrane bound forms of CAMs is in surprising contrast to the GPI
  • glycosylphosphatidylinositol linkage used by most CAMs, and would provide a way of generating longer range homophilic interactions between cells and the extracellular matrix, which may be significant for cell migration.
  • the DS-CAM gene was isolated (as described in the Examples hereinafter) by using the BAC contig on 21q22.2-q22.3 covering the region between D21S55 and MX1 (Hubert et al . , Genomics 41:218-226, 1997).
  • the gene spans a minimum of 900 kb, estimated by summing the size of BACs and PACs that are non-overlapping and covered by the DS-CAM gene ( Figure 1) .
  • the DS-CAM gene covers a gap in all physical maps of this region.
  • a 5' intron is at least this size, similar to the first intron of the DCC gene (Cho et al., Genomics 19:525-531, 1994).
  • other alternative transcripts can contain exons located in this BAC.
  • the gene spans the boundary of bands 21q22.2 and q22.3, a Giemsa-dark and Giemsa-light band, respectively.
  • the location of the gene for PEP19, a small 634 bp gene with large introns within the same band 21q22.2 suggests a general structure of genes in G- bands having large introns.
  • nucleic acid molecules described herein are useful for producing invention DS-CAM proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art.
  • nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of a DS-CAM gene or mRNA transcript in a given sample.
  • the nucleic acid molecules described herein, and fragments thereof are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding the invention protein described herein.
  • nucleic acid encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers.
  • DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a gene encoding a DS-CAM protein.
  • cDNA complementary DNA
  • genomic DNA e.g. a gene encoding a DS-CAM protein.
  • One means of isolating a nucleic acid encoding a DS-CAM polypeptide is to probe a mammalian genomic library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the DS-CAM gene are particularly useful for this purpose.
  • DNA and cDNA molecules that encode DS-CAM polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from mammalian (e.g., human, mouse, rat, rabbit, pig, and the like), or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods described in more detail below.
  • Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding a DS-CAM polypeptide.
  • nucleic acids may include, but are not limited to, nucleic acids having substantially the same nucleotide sequence as set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO: 8, SEQ ID NO : 9 , SEQ ID NO: 10, or at least nucleotides 453-6185 set forth in SEQ ID NO:l, or nucleotides 453-5168 set forth in SEQ ID NO:10.
  • mammalian refers to the variety of species from which the invention DS-CAM protein is derived, e.g., human, rat, mouse, rabbit, monkey, baboon, bovine, porcine, ovine, canine, feline, and the like.
  • a preferred DS-CAM protein herein, is human DS-CAM.
  • cDNAs encoding the invention DS-CAM proteins disclosed herein include substantially the same nucleotide sequence as set forth in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, or SEQ ID NO: 10.
  • Preferred cDNA molecules encoding the invention proteins include the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID N0:1, or nucleotides 453-5168 set forth in SEQ ID NO: 10.
  • substantially the same nucleotide sequence refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions.
  • DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 , or a larger amino acid sequence including SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO: 8 or SEQ ID NO : 9.
  • DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60% identity with respect to the reference nucleotide sequence.
  • DNA having at least 70%, more preferably at least 90%, yet more preferably at least 95%, identity to the reference nucleotide sequence is preferred.
  • This invention also encompasses nucleic acids which differ from the nucleic acids shown in SEQ ID NO : 1 , SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10 but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as “functionally equivalent nucleic acids” . As used herein, the phrase “functionally equivalent nucleic acids” encompasses nucleic acids characterized by slight and non- consequential sequence variations that will function in substantially the same manner to produce the same protein product (s) as the nucleic acids disclosed herein.
  • nucleic acids encode polypeptides that are the same as those disclosed herein or that have conservative amino acid variations, or that encode larger polypeptides that includes SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO : 9.
  • conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue.
  • nucleic acids encoding DS-CAM polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions.
  • Preferred nucleic acids encoding the invention polypeptides are comprised of nucleotides that encode substantially the same amino acid sequences set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9.
  • an exemplary nucleic acid encoding an invention DS-CAM protein may be selected from:
  • Hybridization refers to the binding of complementary strands of nucleic acid (i.e., sense : antisense strands or probe : target -DNA) to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA.
  • Stringency levels used to hybridize a given probe with target -DNA can be readily varied by those of skill in the art.
  • the phrase "stringent hybridization” is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T m ) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.
  • moderately stringent hybridization refers to conditions that permit target-DNA to bind a complementary nucleic acid that has about 60% identity, preferably about 75% identity, more preferably about 85% identity to the target DNA; with greater than about 90% identity to target-DNA being especially preferred.
  • moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhardt ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 65°C.
  • high stringency hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65°C (i.e., if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein) .
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhardt ' s solution, 5X SSPE, 0.2% SDS at 42 °C, followed by washing in 0. IX SSPE, and 0.1% SDS at 65°C.
  • low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5X Denhardt ' s solution, 6X SSPE, 0.2% SDS at 42°C, followed by washing in IX SSPE, 0.2% SDS, at 50°C.
  • Denhardt ' s solution and SSPE are well known to those of skill in the art as are other suitable hybridization buffers .
  • the term “degenerate” refers to codons that differ in at least one nucleotide from a reference nucleic acid, e.g., SEQ ID NO : 1 , but encode the same amino acids as the reference nucleic acid.
  • codons specified by the triplets "UCU” , “UCC”, “UCA” , and “UCG” are degenerate with respect to each other since all four of these codons encode the amino acid serine.
  • Preferred nucleic acids encoding the invention polypeptide hybridize under moderately stringent, preferably high stringency, conditions to substantially the entire sequence, or in certain embodiments substantial portions (i.e., typically at least 15-30 nucleotides) of the nucleic acid sequence set forth in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
  • nucleic acids can be produced by a variety of methods well-known in the art, e.g., the methods described herein, employing PCR amplification using oligonucleotide primers from various regions of SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, and the like.
  • optionally labeled DS-CAM-encoding cDNAs, or fragments thereof can be employed to probe library (ies) (e.g., cDNA, genomic, and the like) for additional nucleic acid sequences encoding novel mammalian DS-CAM proteins.
  • libraries e.g., cDNA, genomic, and the like
  • construction of mammalian cDNA libraries preferably a human trisomy 21 fetal brain cDNA library, is well-known in the art. Screening of such a cDNA library is initially carried out under low-stringency conditions, which comprise a temperature of less than about 42°C, a formamide concentration of less than about 50%, and a moderate to low salt concentration.
  • Presently preferred probe-based screening conditions comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X standard saline citrate (SSC; 20X SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0) .
  • SSC standard saline citrate
  • Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology.
  • the phrase "substantial similarity" refers to sequences which share at least 50% homology.
  • hybridization conditions will be selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe.
  • nucleic acids having substantially the same nucleotide sequence as nucleotides 453-6185 set forth in SEQ ID NO : 1 , or nucleotides 453-5168 set forth in SEQ ID NO:10, SEQ ID NO : 7 , SEQ ID NO: 8, or SEQ ID NO : 9 are obtained.
  • a nucleic acid "probe” is single-stranded DNA or RNA, or analogs thereof, that has a sequence of nucleotides that includes at least 14, at least 20, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases that are the same as (or the complement of) any contiguous bases set forth in any of SEQ ID NO : 1 , SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10.
  • Preferred regions from which to construct probes include 5' and/or 3' coding regions of SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO: 8, SEQ ID NO : 9 or SEQ ID NO: 10.
  • the entire cDNA encoding region of an invention DS-CAM protein, or the entire sequence corresponding to SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10 may be used as a probe. Probes may be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits.
  • label and "indicating means” in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer.
  • a fluorochrome a fluorochrome that is a useful immunofluorescent tracer.
  • the indicating group is an enzyme, such as horseradish peroxidase (HRP) , glucose oxidase, and the like.
  • HRP horseradish peroxidase
  • radioactive elements are employed labeling agents.
  • the linking of a label to a substrate, i.e., labeling of nucleic acid probes, antibodies, polypeptides, and proteins, is well known in the art.
  • an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al . , Meth. Enzymol . 73:3-46, 1981.
  • Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable. See, for example, Aurameas et al . , Scand. J. Immunol. 8(7): 7-23, 1978; Rodwell et al . , Biotech. 3:889-894, 1984; and U.S. Patent
  • isolated mammalian DS-CAM proteins preferably human
  • polypeptides preferably human
  • fragments thereof encoded by invention nucleic acid are provided.
  • DS-CAM proteins referred to herein are those polypeptides specifically recognized by an antibody that also specifically recognizes a DS-CAM protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or
  • SEQ ID NO: 9 Invention isolated DS-CAM proteins are free of cellular components and/or contaminants normally associated with a native in vivo environment.
  • the invention DS-CAM proteins are further characterized as being primarily expressed in fetal brain and not expressed in fetal lung or fetal liver.
  • Northern analysis (described in Example 4) using human fetal tissues showed that 8.5 kb and 7.6 kb transcripts are expressed only in fetal brain and not expressed in fetal lung, fetal liver and fetal kidney.
  • Northern blot analyses of adult tissues revealed differential expression of three alternative transcripts of 9.7 kb, 8.5 kb and 7.6 kb in different substructures of the brain.
  • the 9.7 kb transcript is highly expressed in the substantia nigra, moderately expressed in the amygdala and hippocampus, and less expressed in the whole brain.
  • a similar pattern is observed by using a PCR product spanning the 191 bp deletion found in DS-CAM-18 and DS-CAM-52.
  • the placenta shows faint bands, and the sizes are smaller than those in brain.
  • a faint band (6.5 kb) is detected.
  • RT-PCR demonstrated expression of human DS-CAM mRNA in fetal and adult brain, in fetal kidney, as well as in a breast carcinoma cell line mRNA.
  • splice variant cDNA transcripts encoding a DS-CAM family of proteins are clearly contemplated by the present invention.
  • DS-CAM is contemplated as the gene, which when defective, deleted or present as a duplication, is responsible for holoprosencephaly, agenesis of the corpus callosum and/or structural defects of the brain.
  • DS-CAM may also be responsible for several phenotypes of Down Syndrome including mental retardation as well as, more specifically, the abnormal dendritic structure observed in Down Syndrome.
  • Presently preferred DS-CAM proteins of the invention include amino acid sequences that are substantially the same as the protein sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9, as well as biologically active, modified forms thereof.
  • Those of skill in the art will recognize that numerous residues of the above-described sequences can be substituted with other, chemically, sterically and/or electronically similar residues without substantially altering the biological activity of the resulting receptor species.
  • polypeptide sequences containing substantially the same sequence as SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9 , therein (e.g., splice variants) are contemplated.
  • substantially the same amino acid sequence refers to amino acid sequences having at least about 50%, preferably at least about 60%, more preferably at least about 70% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence.
  • preferred invention proteins having "substantially the same amino acid sequence” will have at least about 80%, more preferably 90% amino acid identity with respect to the reference amino acid sequence; with greater than about 95% amino acid sequence identity being especially preferred.
  • polypeptides or nucleic acids referred to hereinbefore
  • DS-CAM protein(s) or polypeptide fragment thereof, refers to a polypeptide that exhibits functional characteristics similar to DS-CAM.
  • one biological activity of DS-CAM is the ability to act as an immunogen for the production of polyclonal and monoclonal antibodies that bind specifically to DS-CAM.
  • an invention nucleic acid encoding DS-CAM will encode a polypeptide specifically recognized by an antibody that also specifically recognizes the DS-CAM protein including the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9. Such activity may be assayed by any method known to those of skill in the art.
  • a test-polypeptide encoded by a DS-CAM cDNA can be used to produce antibodies, which are then assayed for their ability to bind to the protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO : 9. If the antibody binds to the test-polypeptide and the protein including the sequence set forth in SEQ ID NO : 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO: 7, SEQ ID NO : 8 or SEQ ID NO : 9 with substantially the same affinity, then the polypeptide possesses the requisite biological activity.
  • the invention DS-CAM proteins can be isolated by a variety of methods well-known in the art, e.g., the methods described herein, the recombinant expression systems described herein, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al . , Guide to Protein Purification: Methods in Enzymology 182 (Academic Press, 1990), which is incorporated herein by reference. Alternatively, the isolated polypeptides of the present invention can be obtained using well-known recombinant methods as described, for example, in Sambrook et al . , supra . ,
  • invention polypeptide (s) An example of the means for preparing the invention polypeptide (s) is to express nucleic acids encoding the DS-CAM in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known methods.
  • a suitable host cell such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte), or a mammalian cell.
  • invention polypeptides can be isolated directly from cells that have been transformed with expression vectors as described below herein.
  • the invention polypeptide, biologically active fragments, and functional equivalents thereof can also be produced by chemical synthesis.
  • synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, CA) employing the chemistry provided by
  • acceptable carrier encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents .
  • antisense oligonucleotides having a sequence capable of binding specifically with any portion of an mRNA that encodes DS-CAM polypeptides so as to prevent translation of the mRNA.
  • the antisense oligonucleotide may have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding DS-CAM polypeptides.
  • binding specifically encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs.
  • An example of an antisense oligonucleotide is an antisense oligonucleotide comprising chemical analogs of nucleotides.
  • compositions comprising an amount of the antisense oligonucleotide, described above, effective to reduce expression of DS-CAM polypeptides by passing through a cell membrane and binding specifically with mRNA encoding DS-CAM polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein.
  • Suitable hydrophobic carriers are described, for example, in U.S. Patent Nos. 5,334,761; 4,889,953;
  • the acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type.
  • the structure may be part of a protein known to bind to a cell-type specific receptor.
  • Antisense oligonucleotide compositions are useful to inhibit translation of mRNA encoding invention polypeptides.
  • Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding DS-CAM polypeptides and inhibit translation of mRNA and are useful as compositions to inhibit expression of DS-CAM associated genes in a tissue sample or in a subject.
  • kits for detecting mutations, duplications, deletions, rearrangements and aneuploidies in chromosome 21 at locus q22.2 comprising at least one invention probe or antisense nucleotide.
  • the present invention provides means to modulate levels of expression of DS-CAM polypeptides by employing synthetic antisense oligonucleotide compositions (hereinafter SAOC) which inhibit translation of mRNA encoding these polypeptides.
  • SAOC synthetic antisense oligonucleotide compositions
  • Synthetic oligonucleotides, or other antisense chemical structures designed to recognize and selectively bind to mRNA are constructed to be complementary to portions of the DS-CAM coding strand or nucleotide sequences shown in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or
  • the SAOC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions.
  • the SAOC is designed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SAOC which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SAOC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SAOC into the cell.
  • the SAOC can be designed for administration only to certain selected cell populations by targeting the SAOC to be recognized by specific cellular uptake mechanisms which bind and take up the SAOC only within select cell populations .
  • the SAOC may be designed to bind to a receptor found only in a certain cell type, as discussed supra .
  • the SAOC is also designed to recognize and selectively bind to target mRNA sequence, which may correspond to a sequence contained within the sequence shown in SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 ,
  • the SAOC is designed to inactivate target mRNA sequence by either binding thereto and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of mRNA target sequence by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA.
  • SAOCs have been shown to be capable of such properties when directed against mRNA targets (see Cohen et al . , TIBS 10:435, 1989 and
  • a method for the recombinant production of invention DS-CAM protein (s) by expressing the above-described nucleic acid sequences in suitable host cells by expressing the above-described nucleic acid sequences in suitable host cells.
  • Recombinant DNA expression systems that are suitable to produce DS-CAM proteins described herein are well-known in the art.
  • the above-described nucleotide sequences can be incorporated into vectors for further manipulation.
  • vector or plasmid refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.
  • Suitable expression vectors are well-known in the art, and include vectors capable of expressing DNA operatively linked to a regulatory sequence, such as a promoter region that is capable of regulating expression of such DNA.
  • an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the inserted DNA.
  • Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
  • a promoter region refers to a segment of DNA that controls transcription of DNA to which it is operatively linked.
  • the promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation.
  • the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated.
  • Exemplary promoters contemplated for use in the practice of the present invention include the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid- inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
  • CMV cytomegalovirus
  • MMTV mouse mammary tumor virus
  • MMLV Moloney murine leukemia virus
  • operatively linked refers to the functional relationship of DNA with regulatory and effector nucleotide sequences, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
  • operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • expression refers to the process well-known to those of skill in the art by which polynucleic acids are transcribed into mRNA and translated into peptides or proteins and, optionally thereafter, modified post-translationally . If the invention nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
  • Prokaryotic transformation vectors are well-known in the art and include pBluescript and phage Lambda ZAP vectors (STRATAGENE, San Diego, CA) , and the like. Other suitable vectors and promoters are disclosed in detail in U.S. Patent No. 4,798,885, issued January 17, 1989, the disclosure of which is incorporated herein by reference in its entirety.
  • Suitable vectors for transformation of E. coli cells include the pET expression vectors
  • T7 promoter T7 terminator
  • E. coli ompT secretion signal Another suitable vector is the pIN-IIIompA2 (see Duffaud et al . , Meth. in Enzymology, 153:492-507, 1987), which contains the lpp promoter, the lacUV5 promoter operator, the ompA secretion signal, and the lac repressor gene.
  • Exemplary, eukaryotic transformation vectors include the cloned bovine papilloma virus genome, the cloned genomes of the murine retroviruses, and eukaryotic cassettes, such as the pSV-2 gpt system (described by Mulligan and Berg, Nature 277:108-114, 1979) the
  • Particularly preferred base vectors which contain regulatory elements that can be linked to the invention DS-CAM-encoding DNAs for transfection of mammalian cells are cytomegalovirus (CMV) promoter-based vectors such as pcDNAl (Invitrogen, San Diego, CA) , MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ) , and SV40 promoter-based vectors such as pSV ⁇ (Clontech, Palo Alto, CA) .
  • CMV cytomegalovirus
  • pcDNAl Invitrogen, San Diego, CA
  • MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ)
  • SV40 promoter-based vectors such as pSV ⁇ (Clontech,
  • nucleic acid molecules i.e., DNA or mRNA
  • suitable host cells preferably bacterial cells, and more preferably E. coli cells, as well as methods applicable for culturing said cells containing a gene encoding a heterologous protein, are generally known in the art. See, for example, Sambrook et al . , supra , 1989.
  • Exemplary methods of transformation include, e.g., transformation employing plasmids, viral, or bacterial phage vectors, transfection, electroporation, lipofection, and the like.
  • the heterologous DNA can optionally include sequences which allow for its extrachromosomal maintenance, or said heterologous DNA can be caused to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host) .
  • Host organisms contemplated for use in the practice of the present invention include those organisms in which recombinant production of heterologous proteins has been carried out.
  • Exemplary cells for introducing DNA include cells of mammalian origin (e.g., COS cells, mouse L cells, Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK) cells, African green monkey cells and other such cells known to those of skill in the art) , amphibian cells (e.g., Xenopus laevis o ⁇ cytes) , yeast cells (e.g., Saccharomyces cerevisiae, Candida tropicalis, Hansenula polymorpha and P . pastoris; see, e.g., U.S. Patent Nos. 4,882,279, 4,837,148, 4,929,555 and 4,855,231), bacteria (e.g., E. coli ) , and the like.
  • mammalian origin e.g., COS cells, mouse L cells
  • nucleic acids encoding the invention DS-CAM proteins can be delivered into mammalian cells, either in vivo or in vitro using suitable viral vectors well-known in the art.
  • suitable viral vectors well-known in the art.
  • Suitable retroviral vectors, designed specifically for in vivo "gene therapy" methods are described, for example, in WIPO publications WO 9205266 and WO 9214829, which provide a description of methods for efficiently introducing nucleic acids into human cells in vivo .
  • the introduction of the antisense strand of the invention nucleic acid is contemplated.
  • anti-DS-CAM antibodies having specific reactivity with DS-CAM polypeptides of the present invention. Active fragments of antibodies are encompassed within the definition of "antibody” .
  • Invention antibodies can be produced by methods known in the art using invention polypeptides, proteins or portions thereof as antigens. For example, polyclonal and monoclonal antibodies can be produced by methods well known in the art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, 1988) , which is incorporated herein by reference. Invention polypeptides can be used as immunogens in generating such antibodies.
  • synthetic peptides can be prepared (using commercially available synthesizers) and used as immunogens .
  • Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode hydrophobic or hydrophilic domains of the corresponding polypeptide.
  • Altered antibodies such as chimeric, humanized, CDR-grafted or bifunctional antibodies can also be produced by methods well known in the art. Such antibodies can also be produced by hybridoma, chemical synthesis or recombinant methods described, for example, in Sambrook et al . , supra , 1989; and Harlow and Lane, supra, 1988. Both anti-peptide and anti-fusion protein antibodies can be used, (see, for example, Bahouth et al . , Trends Pharmacol. Sci. 12:338
  • Antibody so produced can be used, inter alia, in diagnostic methods and systems to detect the level of DS-CAM protein present in a mammalian, preferably human, body sample, such as tissue or vascular fluid. Such antibodies can also be used for the immunoaffinity or affinity chromatography purification of the invention DS-CAM protein.
  • methods are contemplated herein for detecting the presence of DS-CAM polypeptides on the surface of a cell comprising contacting the cell with an antibody that specifically binds to DS-CAM polypeptides, under conditions permitting binding of the antibody to the polypeptides, detecting the presence of the antibody bound to the cell, and thereby detecting the presence of invention polypeptides on the surface of the cell. With respect to the detection of such polypeptides, the antibodies can be used for in vitro diagnostic or in vivo imaging methods.
  • Immunological procedures useful for in vitro detection of target DS-CAM polypeptides in a sample include immunoassays that employ a detectable antibody.
  • immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures which are well known in the art.
  • An antibody can be made detectable by various means well known in the art.
  • a detectable marker can be directly or indirectly attached to the antibody.
  • Useful markers include, for example, radionucleotides, enzymes, fluorogens, chromogens and chemiluminescent labels.
  • compositions comprising a carrier and an amount of an antibody having specificity for DS-CAM polypeptides effective to block naturally occurring ligands or other DS-CAM-binding proteins from binding to invention DS-CAM polypeptides are contemplated herein.
  • a monoclonal antibody directed to an epitope of DS-CAM polypeptide molecules present on the surface of a cell and having an amino acid sequence substantially the same as an amino acid sequence for a cell surface epitope of a DS-CAM polypeptide including the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 11, or the DS-CAM coding region of SEQ ID NO : 7 , SEQ ID NO : 8 or SEQ ID NO: 9, can be useful for this purpose.
  • the present invention further provides transgenic non-human mammals that are capable of expressing exogenous nucleic acids encoding DS-CAM polypeptides.
  • exogenous nucleic acid refers to nucleic acid sequence which is not native to the host, or which is present in the host in other than its native environment (e.g., as part of a genetically engineered DNA construct) .
  • transgenic non-human mammals capable of expressing nucleic acids encoding DS-CAM polypeptides so mutated as to be incapable of normal activity, i.e., do not express native DS-CAM.
  • the present invention also provides transgenic non-human mammals having a genome comprising antisense nucleic acids complementary to nucleic acids encoding DS-CAM polypeptides, placed so as to be transcribed into antisense mRNA complementary to mRNA encoding DS-CAM polypeptides, which hybridizes to the mRNA and, thereby, reduces the translation thereof.
  • the nucleic acid may additionally comprise an inducible promoter and/or tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types.
  • nucleic acids are DNA or cDNA having a coding sequence substantially the same as the coding sequence shown in SEQ ID NO:l.
  • An example of a non-human transgenic mammal is a transgenic mouse.
  • tissue specificity- determining elements are the metallothionein promoter and the L7 promoter.
  • Animal model systems which elucidate the physiological and behavioral roles of DS-CAM polypeptides are also provided, and are produced by creating transgenic animals in which the expression of the DS-CAM polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding a DS-CAM polypeptide by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal. See, for example, Hogan et al . , Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, 1986) .
  • DS-CAM genes are used with the native gene locus in transgenic animals, to alter the regulation of expression or the structure of DS-CAM polypeptides (see, Capecchi et al . , Science 244:1288, 1989; Zimmer et al . , Nature 338:150,
  • Homologous recombination techniques are well known in the art. Homologous recombination replaces the native (endogenous) gene with a recombinant or mutated gene to produce an animal that cannot express native (endogenous) protein but can express, for example, a mutated protein which results in altered expression of DS-CAM polypeptides .
  • microinj ection adds genes to the host genome, without removing host genes.
  • Microinjection can produce a transgenic animal that is capable of expressing both endogenous and exogenous DS-CAM protein.
  • Inducible promoters can be linked to the coding region of nucleic acids to provide a means to regulate expression of the transgene.
  • Tissue specific regulatory elements can be linked to the coding region to permit tissue-specific expression of the transgene.
  • Transgenic animal model systems are useful for in vivo screening of compounds for identification of specific ligands, i.e., agonists and antagonists, which activate or inhibit protein responses.
  • Invention nucleic acids, oligonucleotides (including antisense) , vectors containing same, transformed host cells, polypeptides and combinations thereof, as well as antibodies of the present invention can be used to screen compounds in vitro to determine whether a compound functions as a potential agonist or antagonist to invention polypeptides.
  • These in vitro screening assays provide information regarding the function and activity of invention polypeptides, which can lead to the identification and design of compounds that are capable of specific interaction with one or more types of polypeptides, peptides or proteins.
  • a method for identifying compounds which bind to DS-CAM polypeptides may be employed in a competitive binding assay.
  • Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to DS-CAM proteins. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention proteins .
  • test samples e.g., biological fluids
  • test samples e.g., biological fluids
  • serum from a patient displaying symptoms thought to be related to over- or under-production of DS-CAM can be assayed to determine if the observed symptoms are indeed caused by over- or under-production of DS-CAM.
  • invention polypeptides are contacted with an "unknown” or test substance (in the presence of a reporter gene construct when antagonist activity is tested) , the activity of the polypeptide is monitored subsequent to the contact with the "unknown” or test substance, and those substances which cause the reporter gene construct to be expressed are identified as functional ligands for DS-CAM polypeptides.
  • transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect (s) thereof can then be evaluated by comparing the DS-CAM-mediated response (e.g., via reporter gene expression) in the presence and absence of test compound, or by comparing the response of test cells or control cells (i.e., cells that do not express DS-CAM polypeptides), to the presence of the compound.
  • a compound or a signal that "modulates the activity" of invention polypeptides refers to a compound or a signal that alters the activity of DS-CAM polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal .
  • such compounds or signals include agonists and antagonists.
  • An agonist encompasses a compound or a signal that activates DS-CAM protein expression.
  • an antagonist includes a compound or signal that interferes with DS-CAM protein expression.
  • the effect of an antagonist is observed as a blocking of agonist-induced protein activation.
  • Antagonists include competitive and non-competitive antagonists.
  • a competitive antagonist interacts with or near the site specific for agonist binding.
  • a non-competitive antagonist or blocker inactivates the function of the polypeptide by interacting with a site other than the agonist interaction site.
  • assay methods for identifying compounds that modulate DS-CAM activity generally require comparison to a control.
  • One type of a "control” is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound.
  • control is a cell or culture that is identical to the transfected cells, with the exception that the "control" cell or culture do not express native proteins.
  • the response of the transfected cell to compound is compared to the response (or lack thereof) of the "control" cell or culture to the same compound under the same reaction conditions.
  • invention DS-CAM proteins interact with extracellular ligands.
  • invention DS-CAM proteins act specifically in concert or in competition with other
  • the present invention contemplates various bioassays for identifying ligands for invention DS-CAM proteins.
  • the present invention contemplates an assay measuring the effect of co-expressing during development either normal or defective invention DS-CAMs with other CAMs known in the art to assess the resulting phenotype.
  • a bioassay for evaluating whether test compounds are capable of acting as agonists comprises: (a) culturing cells containing:
  • the bioassay for evaluating whether test compounds are capable of acting as antagonists for DS-CAM protein (s) of the invention, or functional modified forms of said DS-CAM protein (s), comprises:
  • step (a) of the above-described antagonist bioassay culturing may also be carried out in the presence of : fixed concentrations of at least one compound whose ability to inhibit signal transduction activity of DS-CAM protein (s) is sought to be determined, and an increasing concentration of at least one agonist for DS-CAM protein (s) , or functional modified forms thereof .
  • the bioassay for evaluating whether test compounds are capable of acting as agonists or antagonists comprises: (a) culturing cells containing:
  • Methods well-known in the art that measure intracellular levels of cAMP, or measure cyclase activity can be employed in binding assays described herein to identify agonists and antagonists of the DS-CAM. For example, because activation of some CAMs results in decreases or increases in cAMP, assays that measure intracellular cAMP levels can be used to evaluate recombinant DS-CAMs expressed in mammalian host cells.
  • ability to modulate signal transduction activity of DS-CAM protein refers to a compound that has the ability to either induce (agonist) or inhibit (antagonist) signal transduction activity of the DS-CAM protein.
  • Each of the invention bioassays can be conducted as competitive assays by co-expressing one or more members of the CAM immunoglobulin superfamily of proteins known in the art, such as N-CAMs, along with invention DS-CAMs.
  • one or more members of the CAM immunoglobulin superfamily of proteins known in the art can be co-expressed with invention DS-CAMs to evaluate the agonistic or antagonistic effect on signal transduction of the non-DS-CAM members acting in concert with invention DS-CAMS.
  • the activation of DS-CAM polypeptides can be modulated by contacting the polypeptides with an effective amount of at least one compound identified by the above-described bioassays.
  • N-CAM N-CAM superfamily of immunoglobulins
  • various alterations of N-CAM levels have been seen in degenerative disease, developmental defects, and toxic conditions.
  • Increases in the levels of N-CAM in the cerebrospinal fluid of patients with multiple sclerosis have been observed to parallel their clinical improvement (Massaro et al . , Ital. J. Neurol . Sci. Suppl . 6:85-88, 1987).
  • Levels of N-CAM were reported to be elevated in the amniotic fluid of mothers carrying fetuses with neural tube defects (Ibsen et al . , J. Neurochem. 41:363-366, 1983).
  • E-A conversion itself has been found to be delayed in the mouse mutant staggerer (Edelman and Chuong, Proc. Natl. Acad. Sci. USA, 79:7036-7042, 1982) in conjunction with the connectivity changes associated with the mutation.
  • DS-CAM Down Syndrome
  • the Ts65Dn mouse model of DS contains the region of MMU16 (Pgkl-psl to MXl/2) that includes
  • HCR Hirschsprung ' s disease
  • the DS-CAM gene maps within this small region.
  • the expression of DS-CAM in the neural crest derived enteric plexus of the gut was detected by mouse tissue in situ hybridization (Example 7) .
  • the function of the DS- CAM protein as a neural cell adhesion molecule and the association of this region of chromosome 21 with HSCR, indicate that DS-CAM can play a role in the migration of the cranial neural crest that populate this region.
  • DS-CAM overexpression is responsible for the chromosome 21 association in non-DS HSCR and for the HSCR seen in DS .
  • the perturbation of development by the aneuploid expression of CAM-LI supports a role for the aneuploid expression of DS-CAM in the causation of developmental and neurological abnormalities.
  • DS-CAM associated disease such as mental retardation, holoprosencephaly, agenesis of the corpus callosum, or schizencephaly
  • said method comprising: detecting, in said subject, a genomic or transcribed mRNA sequence including SEQ ID NO : 1 or SEQ ID NO: 10, or fragments thereof.
  • the DS-CAM nucleic acids detected in accordance with the invention diagnostic methods are either mutated in one form or another (such as point mutations, deletions, and the like), or are overexpressed relative to levels of DS-CAM expression in healthy non-diseased individuals.
  • diagnostic systems preferably in kit form, comprising at least one invention nucleic acid in a suitable packaging material .
  • the diagnostic nucleic acids are derived from the DS-CAM-encoding nucleic acids described herein.
  • the diagnostic nucleic acids are derived from SEQ ID NO : 1 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9 or SEQ ID NO: 10.
  • Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding DS-CAM in either genomic DNA or in transcribed nucleic acid (such as mRNA or cDNA) encoding DS-CAM.
  • a suitable diagnostic system includes at least one invention nucleic acid, preferably two or more invention nucleic acids, as a separately packaged chemical reagent (s) in an amount sufficient for at least one assay. Instructions for use of the packaged reagent are also typically included. Those of skill in the art can readily incorporate invention nucleic probes and/or primers into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.
  • packaging material refers to one or more physical structures used to house the contents of the kit, such as invention nucleic acid probes or primers, and the like.
  • the packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment.
  • the packaging material has a label which indicates that the invention nucleic acids can be used for detecting a particular sequence encoding DS-CAM including the nucleotide sequence set forth in SEQ ID NO:l, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 or SEQ ID NO: 10, thereby diagnosing the presence of, or a predisposition for, holoprosencephaly, agenesis of the corpus callosum, or for several phenotypes of Down Syndrome including mental retardation, and the like.
  • packaging material contains instructions indicating how the materials within the kit are employed both to detect a particular sequence and diagnose the presence of, or a predisposition for, holoprosencephaly, agenesis of the corpus callosum, or for several phenotypes of Down syndrome including mental retardation, and the like.
  • packaging materials employed herein in relation to diagnostic systems are those customarily utilized in nucleic acid-based diagnostic systems.
  • the term "package” refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits an isolated nucleic acid, oligonucleotide, or primer of the present invention.
  • a package can be a glass vial used to contain milligram quantities of a contemplated nucleic acid, oligonucleotide or primer, or it can be a microtiter plate well to which microgram quantities of a contemplated nucleic acid probe have been operatively affixed.
  • Instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
  • BAC library construction of Bacterial Artificial Chromosome (BAC) library was performed as described in Shizuya et al . , Proc. Natl. Acad. Sci. USA 89:8794-8797, 1992; and Hubert et al . , Genomics 41:218-226, 1997.
  • Yeast artificial chromosome (YAC) clones were obtained from the CEPH mega-YAC library and grown under standard conditions (Cohen et al . , Nature 366:689-701 1993).
  • PI artificial chromosome (PAC) library construction A 3X human PAC library, designated RPCI-1
  • the library was arrayed in 384 well dishes. Subsequently, STSs generated by sequencing of clones using vector primers were used as hybridization probes to gridded colony filters of the PAC library.
  • YAC DNA preparation YAC clones were grown in selective media, pelleted and resuspended in 3 ml 0.9 M sorbitol, 0. IM EDTA pH 7.5, then incubated with 100 U of lytocase (Sigma, St. Louis, MO) at 37°C for 1 hour. After centrifugation for 5 minutes at 5,000 rpm pellets were resuspended in 3 ml 50 mM Tris pH 7.45, 20 mM EDTA 0.3ml 10% SDS was added and the mixture was incubated at 65°C for 30 minutes. One ml of 5 M potassium acetate was added and tubes were left on ice for 1 hour, then centrifuged at 10,000 rpm for 10 minutes. Supernatant was precipitated in 2 volumes of ethanol and pelleted at 6,000 rpm for 15 minutes. Pellets were resuspended in TE, treated with RNase and reextracted with phenol -chloroform.
  • FISH Fluorescence in situ hybridization
  • PAC or BAC clones were biotinylated by nicktranslation in the presence of biotin-14-dATP using the BioNick Labeling Kit (Gibco-BRL) .
  • FISH was performed essentially as described (Korenberg et al . , Cytogenet . Cell Genet. 69:196-200, 1995). Briefly, 400 ng of probe
  • DNA was mixed with 8 ng of human Cot 1 DNA (Gibco-BRL) and 2 ⁇ g of sonicated salmon sperm DNA in order to suppress possible background produced from repetitive human sequences as well as yeast sequences in the probe.
  • the probes were denatured at 75°C, preannealed at 37°C for one hour, and applied to denatured chromosome slides prepared from normal male lymphocytes (Korenberg et al . , supra , 1995) . Post-hybridization washes were performed at 40°C in 2X SSC/50% formamide followed by washes in IX SSC at 50°C.
  • Hybridized DNAs were detected with avidin-conjugated fluorescent isothiocyanate (Vector Laboratories) .
  • One amplification was performed by using biotinylated anti-avidin.
  • a reverse banding technique was used, which was achieved by chromomycin A3 and distamycin A double staining (Korenberg et al . , supra , 1995) .
  • the color images were captured by using a Photometries Cooled-CCD camera and BDS image analysis software (Oncor Imaging, Inc . ) .
  • DNA was carried out on 0.8% agarose gels in IX TBE . Transfer of nucleic acids to Nybond N+ nylon membrane
  • Probes were labeled using RadPrime Labeling System (BRL) . Hybridization was carried out at 42°C for 16 hours in 50% formamide, 5X SSPE, 5X Denhardt ' s 0.1% SDS, 100 mg/ml denatured salmon sperm DNA. The filters were washed once in lx SSC, 0.1% SDS at room temperature for 20 minutes, and twice in 0. IX SSC, 0.1% SDS for 20 minutes at 65°C. The blots were exposed onto X-ray film (Kodak, X-OMAT-AR) .
  • PAC and BAC endcl ones were inoculated into 500 ml of LB/kanamycin and grown overnight.
  • BAC clones were inoculated into 500 ml of LB/chloramphenicol and grown overnight .
  • DNAs were isolated using QIAGEN columns according to the vendors protocol with one additional phenol/chloroform/isoamylalcohol extraction followed by one additional chloroform/isoamylalcohol extraction. Clones were sequenced using the Gibco-BRL cycle sequencing kit with standard T7 and SP6 primers .
  • BACs Bacterial Artificial Chromosomes
  • PACs PI Artificial Chromosomes
  • the minimal contig sizes as determined by counting only non-overlapping clones are: 1100 kb, 900 kb, 510 kb, 380 kb and 270 kb .
  • Insert size of BAC clones was measured by running pulse-field gel electrophoresis after digesting DNA with NotI.
  • BAC-423A5 BAC-430F1, BAC-628H2, BAC-371H8 and PAC-31P10
  • Figure 1 Yamakawa et al . , Cytogenet . Cell Genet. 74:140-145, 1996) was applied to BAC-423A5, BAC-430F1, BAC-628H2, BAC-371H8 and PAC-31P10 ( Figure 1) by using cDNA from trisomy 21 human fetal brain, and the selected fragments were then subcloned into a plasmid vector.
  • Total RNA was isolated from 14 week trisomy 21 fetal brain using TRI regionTM (Molecular Research Center, Inc.) .
  • Poly (A) + RNA was isolated using Poly (A) Quick mRNA isolation kit (STRATAGENE) .
  • Double stranded cDNA was synthesized using SuperscriptTM Choice System (GIBCO BRL) from 5 ⁇ g trisomy 21 fetal brain poly (A) + RNA using 1 ⁇ g oligo (dT) 15 or 0.1 ⁇ g random hexamer.
  • the entire synthesis reaction was purified by Gene Clean II kit (BIO101, Inc.) and then kinased. Sau3AI linker was attached to the cDNA which was subsequently digested with Sau3AI .
  • the reaction was purified using Gene Clean.
  • Mbol linker was attached to the cDNA and the reaction purified by Gene Clean (Morgan et al . , supra, 1992) .
  • the synthesized product was amplified by PCR using one strand of Mbol linker ( 5 ' CCTGATGCTCGAGTGAATTC3 ' ) (SEQ ID NO : 4 ) as a primer.
  • PCR cycling conditions were 40 cycles of 94°C/15 seconds, 60°C/23 seconds, 72°C/2 minutes in a 100 ⁇ l of lx PCR buffer (Promega) , 3 mM MgCl 2 , 5.0 units of Taq polymerase (Promega), 2 ⁇ M primer and 0.2 mM dNTPs .
  • BAC DNAs total 2.5 ⁇ g
  • 2 PAC DNAs between the region ETS2 and MX1 were prepared using QIAGEN plasmid kit and were biotinylated using Nick Translation Kit and biotin-16-dUTP (Boehringer Manneheim) .
  • 3 ⁇ g of heat denatured PCR amplified cDNA was annealed with 3 ⁇ g of heat denatured COTl DNA (BRL) in lOO ⁇ l hybridization buffer (750 mM NaCl, 50 mM NaP0 4 (pH7.2) , 5 mM EDTA, 5X Denhardt' s, 0.05% SDS and 50% formamide) at 42°C for two hours.
  • cDNA-BAC DNA hybrids were precipitated with EtOH and dissolved in 60 ⁇ l of 10 mM Tris-HCl (pH 8.0), 1 mM EDTA. After addition of 40 ⁇ l 5 M NaCl, the DNA was incubated with magnetic beads (Dynabeads M-280, Dynal) at 25°C for 1 hour with gentle rotating to allow attachment of the DNA to the magnetic beads.
  • the beads were then washed twice by pipetting in 400 ⁇ l of 2X SSC, setting in magnet holder (MPC-E TM , Dynal) for 30 seconds and removing the supernatant. Four additional washes were performed in 0.2X SSC at 68°C for 10 minutes each with transfer of the beads to new tubes at each wash.
  • cDNAs were eluted in lOO ⁇ l of distilled water for 10 minutes at 80°C with occasional mixing.
  • the eluted cDNAs were amplified by PCR as described above. After twice repeating the selection procedure using magnetic beads, amplified cDNAs were digested with EcoRI and subcloned into pBlueScript KS+ (STRATAGENE) . Insert DNAs were isolated from the subclones, and were analyzed by Southern hybridization and DNA sequencing.
  • the direct cDNA selection procedure using 19 BACs and 2 PACs between ETS2 and MXl generated a total of 145 unique cDNA fragments.
  • a cDNA library from a trisomy 21 fetal brain at 14 weeks gestation was screened using one of these unique cDNA fragments labeled "E51" (SEQ ID NO: 3) .
  • a trisomy 21 human fetal brain (14 weeks of age) cDNA library was constructed using ZAP-cDNA ® synthesis kit (STRATAGENE) which generates a unidirectional cDNA library. Briefly, double- stranded cDNA was synthesized from 5 ⁇ g trisomy 21 fetal brain poly (A) + RNA using a hybrid oligo (dT) -Xhol linker primer with 5-methyl dCTP . An EcoRI linker was attached to the cDNA which was subsequently digested with EcoRI and Xhol, and then cloned into UNI -ZAP XR vector (STRATAGENE) . The library was packaged using Gigapack ® II Gold packaging extract. The titer of the original library was 1.1 x 10 s p. f . u. /package . The library was amplified once. A blue-white color assay indicated that 99% of the clones had inserts.
  • DS-CAM-42 revealed a 6110 bp DNA sequence which contained a large ORF (5687 bp) as well as 3 ' -UTR sequence (423 bp) , but the 5 ' UTR and start codon were not located in clone DS-CAM-42.
  • DS-CAM-18 of 6.5 kb
  • DS-CAM-52 of 6.6 kb were characterized. Sequence analyses of these clones close to the 5 ' end overlap with sequence at the 5' end of DS-CAM-42. However, DS-CAM-18 extends 416 bp farther 5', and DS-CAM-52 extends 494 bp farther 5' than DS-CAM-42.
  • the extra 494 bp sequence extends the ORF by 43 bp at the 5' end and contains a start codon. Two stop codons occur 330 bp and 427 bp upstream of the start codon.
  • the 494 bp of additional 5' sequence found in DS-CAM-52 combined with DS-CAM-42 (6604 bp) yield a consensus cDNA that encodes one isoform of the invention protein labeled DS-CAMl.
  • the DS-CAMl cDNA contains an open reading frame of 5730 bp (SEQ ID NO:l) coding for a 1910 amino acid protein (SEQ ID NO : 2 ; approximately 211 kilodaltons), flanked by 452 bp of 5 ' -UTR and 422 bp of 3' -UTR.
  • the 5 ' -UTR is highly GC rich (81% GC over 452 bp) and contains 13 Mspl sites, as well as 72 CG and 93 GC dinucleotide pairs.
  • the DS-CAMl protein contains an extracellular component at the N-terminus consisting of nine tandemly repeated Ig-like C2 type domains and a tenth Ig-like C2 domain located between domains four and five of an array of six repeated fibronectin type III domains ( Figure 2) .
  • Each Ig-like C2 domain consists of approximately 100 amino acids with a pair of conserved cysteines separated by 49-56 residues.
  • a single transmembrane domain of 22 amino acids was defined by using the TMBASE program (Hoffmann and Stoffel, Biol. Chem. Hoppe-Seyler 374:166,
  • the putative protein contains 16 potential N-glycosylation sites.
  • Ig immunoglobulin
  • Homology searches with sequences of Ig type-C2 domains and fibronectin type-Ill domains of the most highly related Ig-superfamily members (CAM-LI, DCC, and axonin-1) were conducted by using the FASTA program (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444-2448, 1988).
  • DS-CAM2 a splice variant cDNA sequence encoding a non-membrane bound isoform of DS-CAMl, referred to herein as DS-CAM2, is provided herein.
  • Two human DS-CAM cDNA clones (DS-CAM-18 and DS-CAM-52) were found to contain identical deletions of 191 bp that occur in neighboring exons and that delete bp 5133 to 5323 of the SEQ ID NO : 1 cDNA sequence encoding DS-CAMl ( Figure
  • the resulting splice variant transcript encoding DS- CAM2 (SEQ ID NO: 10) is deleted for the entire transmembrane domain that is encoded by the more 3 ' of these exons. Further, the deletion changes the reading frame and creates a stop codon 36 bp downstream of the deletion resulting in a soluble extracellular protein of 1571 amino acids (SEQ ID NO: 11) .
  • the distal border of the resulting deletion contains the canonical AG of the RNA splicing consensus acceptor site.
  • the proximal border contains a variant of the donor splice site consensus sequence (Jackson, Nucl . Acids Res . 19:3795-
  • BACs 816F6, 116E8, 720G4, 619H8 were only positive for DS-CAM-18 and DS-CAM-52 but negative for DS-CAM-42. All other BACs shown in Figure 1 were negative. These results indicate that the DS-CAM gene spans 900 kb-1200 kb genomic DNA and covers a gap in this BAC and PAC contig indicated by an arrowhead as well as in the available YAC contigs (Korenberg et al . , Genome Res. 5:427-443, 1995; Gardiner et al., Somat . Cell Mol. Genet. 21:399-414, 1995).
  • DS-CAM cDNA sequences were confirmed to originate from these BACs and PACs by direct sequencing of the BACs and PACs as templates using cDNA sequence-specific primers.
  • the map position of DS-CAM on chromosome 21q22.2-22.3 was confirmed by using clone DS-CAM-42 as a probe for fluorescence in-situ hybridization. Two independent experiments were performed and over 100 metaphase cells were evaluated. Signals were clearly seen on two chromatids of at least one chromosome in 85% of cells. There were no other double signal sites seen in greater than 1% of cells.
  • Inserts containing DS-CAM cDNA were excised from the base vector by digestion with Xhol and EcoRI. After labeling using the random priming method (RadPrime Labeling System; GIBCO BRL) , followed by purification using G-50 Sephadex columns (Quick Spin Column; Boehringer Mannheim) , the fragments were used a probes for Northern hybridization using Multiple Tissue Northern Blot (Clontech) .
  • a Northern blot assay was conducted using DS-CAM cDNA as a probe in various fetal and adult tissues including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. Northern hybridization was performed by following the manufacturer's instructions.
  • the hybridized membrane was washed at a final stringency of 0. IX SSC and 0. IX SDS at 50°C.
  • the filter was exposed to X-ray film (Kodak X-OMAT AR) at -70°C for 1-5 days.
  • the 9.7 kb transcript is highly expressed in the substantia nigra, moderately expressed in amygdala and hippocampus, and less expressed in the whole brain.
  • a similar pattern is obtained using a PCR product which spans the 191 bp deletion found in clones DS-CAM-18 and DS-CAM-52 encoding the splice variant sequence corresponding to DS-CAM2.
  • splice variant cDNA transcripts encoding a DS-CAM family of proteins are clearly contemplated by the present invention.
  • RT-PCR Reverse-transcriptase polymerase chain reaction
  • the cDNAs from 13 independent human fetal and adult sources were analyzed by PCR using primer pairs that flanked the alternatively spliced region that results in a 191 base pair deletion of nucleotides 5133- 5323 of the DS-CAMl cDNA set forth in SEQ ID NO : 1.
  • the primers were designed to generate products of different sizes for each of the two alternatively spliced transcripts: 536 bp corresponding to the non-deleted DS-CAM-1 transcript and 345 bp corresponding to the deleted DS-CAM2 transcripts.
  • the analyses included adult samples from amygdala (24 years) , skeletal muscle (36 years) and three independent lymphoblastoid cell lines.
  • Fetal samples included whole brain of a trisomy 21 fetus (14 weeks), four from whole brain (4.5-13 weeks), one from temporal lobe (28 weeks) and two from heart (4.5 and 13 weeks) .
  • the results indicate that all fetal and adult samples produced two bands corresponding to PCR products of the predicted sizes which indicates the expression of two alternatively spliced transcripts.
  • a mouse brain cDNA library was prepared from 19 week old female C57 Black/6 mice in the Uni-ZAP XR Vector (STRATAGENE) .
  • the cDNAs were oligo-dT primed and cloned unidirectionally into the EcoRI and Xhol sites of the vector.
  • the average insert size is 1.0 kb.
  • the library was screened using a human DS-CAM cDNA clone as a probe. Two partial mouse DS-CAM cDNA clones were isolated and sequenced.
  • the combined nucleotide sequences of these clones are set forth in SEQ ID NO : 7 , SEQ ID NO : 8 and SEQ ID NO: 9, and were found to represent the 5', middle and 3' portions, respectively, of cDNA encoding a mouse DS-CAM.
  • Embryos were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) overnight, dehydrated and infiltrated with paraffin.
  • PBS phosphate buffered saline
  • Five to seven micron serial sections were mounted on gelatinized slides. Two sections were mounted/slide, deparaffinized in xylene, rehydrated and post-fixed. The sections were digested with proteinase K, post-fixed, treated with tri-ethanolamine/acetic anhydride, washed and dehydrated.
  • cRNA probes were prepared from DS-CAM-M-14. The plasmid was linearized with Xbal and T7 polymerase was used to generate the antisense cRNA.
  • the plasmid was linearized with Kpnl and T3 polymerase was used to generate the sense control cRNA.
  • the cRNA transcripts were synthesized according to manufacturer's conditions (STRATAGENE) and labeled with 35 S-UTP (>1000 Ci/mmol;
  • cRNA transcripts larger than 100 nucleotides were subjected to alkali hydrolysis to give a mean size of 70 bases for efficient hybridization.
  • Sections were hybridized overnight at 52°C in 50% deionized formamide, 0.3M NaCl, 20 mM Tris-HCl pH 7.4, 5 mM EDTA, 10 mM NaP04 , 10% dextran sulfate, lx Denhardt 's, 50 ⁇ g/ml total yeast RNA, and 50-75,000 cpm/ ⁇ l 35 S-labeled cRNA probe.
  • the tissue was subjected to stringent washing at 65°C in 50% formamide, 2X SSC, 10 mM DTT and washed in PBS before treatment with 20 ⁇ g/ml
  • Tissue in situ hybridization analysis was performed using a mouse cDNA as a probe on sections of normal mouse embryos from days 8.5-17.5 post coitum (pc) as well as in newborn, two weeks and adult brains as described above. The results indicate that there is no detectable expression of DS-CAM at 8.5 days pc . At 9.5 days pc, expression was detected in the neuroepithelium. Low levels of expression were detected within the branchial arches, suggestive of migrating neural crest cells. At 10.5 days pc, the trigeminal ganglia (neural crest derived) begin to express the transcript and expression within the branchial arches was more evident.
  • Expression at 11.5 days pc was abundant throughout the brain.
  • the transcript was found within the regions of the nervous system that differentiate earliest during development (Altman and Bayer, supra , 1995) . In the brain, this includes the ventral-most regions, such as the thalamus and medulla. Some expression was detected within the olfactory epithelium. Expression within the neural tube begins in two areas: the ventrolateral (corresponding to the areas in which the motor neurons differentiate) and the lateral gray columns (that later form commissural neurons) (Leber et al . , J Neurosci . 15:1236-1248, 1990). The dorsal root ganglia (neural crest derived) expressed the transcript at 11.5 days pc .
  • the trigeminal ganglia show higher levels at 11.5 days pc than they did at 10.5 days.
  • Migrating neural crest can be seen within the maxilla, the mandibular arch, and in the developing gut. Signal was observed within the mesenchyme surrounding the umbilical vein and artery.
  • the gonad exhibits signal both in the granule cells and within the tufted mitral cells.
  • the olfactory bulb exhibits signal both in the granule cells and within the tufted mitral cells.
  • the transcript was expressed most extensively within the differentiating regions such as the septal area, olfactory bulb, inferior colliculus and hippocampus.
  • the gene was expressed in many areas including amygdala, cortex, hippocampus and thalamus.
  • the transcripts were detected in the Purkinje cell layer and in the deep cerebellar nuclei.
  • SEQ ID N0:1 is the nucleic acid sequence (and the deduced amino acid sequence) of cDNA encoding a novel human DS-CAMl protein of the present invention.
  • SEQ ID NO : 2 is the deduced amino acid sequence of a human DS-CAMl protein of the present invention.
  • SEQ ID NO: 3 is the cDNA probe (labeled "E51") used to isolate cDNA encoding human DS-CAM.
  • SEQ ID NO: 4 is an Mbol linker sequence.
  • SEQ ID NO: 5 is a primer labeled B9-131F used in the RT-PCR assay described in Example 5.
  • SEQ ID NO: 6 is a primer labeled B9-131R used in the RT-PCR assay described in Example 5.
  • SEQ ID NO : 7 is the 5' region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
  • SEQ ID NO: 8 is the middle region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
  • SEQ ID NO:9 is the 3' region of a partial mouse-derived cDNA clone encoding an invention DS-CAM protein.
  • SEQ ID NO: 10 is the nucleic acid sequence (and the deduced amino acid sequence) of cDNA encoding a novel human DS-CAM2 protein of the present invention.
  • SEQ ID NO: 11 is the deduced amino acid sequence of a human DS-CAM2 protein of the present invention, which is a splice variant of DS-CAMl (SEQ ID NO: 2) .
  • GAG GCG TAC ATC ACT GTC GTC TCA TGG GAG AAA GAC ACT GTT TCA CTT 953 Glu Ala Tyr He Thr Val Val Ser Trp Glu Lys Asp Thr Val Ser Leu 155 160 165
  • GAC CAT CGC AAA GCC ATG GCT GGG CAG CGT GTG GAG CTG CCT TGC AAA 1193 Asp His Arg Lys Ala Met Ala Gly Gin Arg Val Glu Leu Pro Cys Lys 235 240 245
  • AAG AGC GAG CCC AGC AAC GAG CTC ACC ATC ACG GCG GAC GAG GCA GCT 3401 Lys Ser Glu Pro Ser Asn Glu Leu Thr He Thr Ala Asp Glu Ala Ala 970 975 980
  • AAG TTC ACA CTG ACA GCC CAA AAT GGA GTG GGC CCA GGG CGC ATA AGT 4841 Lys Phe Thr Leu Thr Ala Gin Asn Gly Val Gly Pro Gly Pro Gly Arg He Ser 1450 1455 1460 GAA ATC ATA GAA GCA AAG ACC TTA GGA AAA GAG CCC CAG TTC TCA AAG 4889 Glu He He Glu Ala Lys Thr Leu Gly Lys Glu Pro Gin Phe Ser Lys 1465 1470 1475
  • GAG TAC AGG CCC TTT GGG ACC ACA GTT TGG ACC ACA GCT CAG AGG ACC 5033 Glu Tyr Arg Pro Phe Gly Thr Thr Val Trp Thr Thr Ala Gin Arg Thr 1515 1520 1525
  • GCC AAG GCT GGG CCC ACA GCG AGA AAC CGC TAT GCC AGC CAG TGG ACC 5705 Ala Lys Ala Gly Pro Thr Ala Arg Asn Arg Tyr Ala Ser Gin Trp Thr 1740 1745 1750
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • AATTGATAGC ATGGCAGGAG AAGAAACCGG AATCTTCTCT CACTGTTGGC AAAATCTGCA 660
  • GAGTAGGTCC CGGGCGCATA AGTGAAATCA TAGAAGCCAA AACCCTGGGG AAAGAACCCC 480
  • CCCATCCTAC CATCTCTGCA CACACCCTCA CCACAGAATG AGACTGCTAC ACCAGGCTAC 1380
  • CTGCTCCATA CCTACGATGG ATTCTTGTTA AACCGGGCGC ACCAGGCACC AGCAGGACTG 1800
  • GAG GCG TAC ATC ACT GTC GTC TCA TGG GAG AAA GAC ACT GTT TCA CTT 953 Glu Ala Tyr He Thr Val Val Ser Trp Glu Lys Asp Thr Val Ser Leu 155 160 165
  • GAC CAT CGC AAA GCC ATG GCT GGG CAG CGT GTG GAG CTG CCT TGC AAA 1193 Asp His Arg Lys Ala Met Ala Gly Gin Arg Val Glu Leu Pro Cys Lys 235 240 245
  • CAC CAA AGC CAG TTG ATT GTC AGA GTT CCT CCC AAG TTT GTG GTT CAG 2537 His Gin Ser Gin Leu He Val Arg Val Pro Pro Lys Phe Val Val Gin 680 685 690 695
  • AAG AGC GAG CCC AGC AAC GAG CTC ACC ATC ACG GCG GAC GAG GCA GCT 3401 Lys Ser Glu Pro Ser Asn Glu Leu Thr He Thr Ala Asp Glu Ala Ala 970 975 980
  • GAG TAC AGG CCC TTT GGG ACC ACA GTT TGG ACC ACA GCT CAG AGG ACC 5033 Glu Tyr Arg Pro Phe Gly Thr Thr Val Trp Thr Thr Ala Gin Arg Thr 1515 1520 1525

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Cette invention se rapporte à de nouvelles molécules protéiques d'adhérence cellulaire du syndrome de Down (DS-CAM). L'invention se rapporte également à des séquences d'acide nucléique codant de telles protéines et à des analyses faisant usage de ces protéines. Ces protéines DS-CAM peuvent être utilisées de diverses manières, par exemple, en vue de la production d'anticorps dirigés contre des protéines DS-CAM, et dans des compositions et procédés thérapeutiques faisant usage de telles protéines et/ou anticorps. Ces protéines DS-CAM s'avèrent également utiles dans des analyses biologiques visant à identifier des agonistes et antagonistes de ces protéines.
PCT/US1997/019547 1996-10-25 1997-10-23 Acide nucleique codant des proteines ds-cam et produits associes WO1998017795A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP10519729A JP2001502906A (ja) 1996-10-25 1997-10-23 Ｄｓ―ｃａｍタンパク質をコードする核酸およびそれに関連する産物
EP97946341A EP0934408A1 (fr) 1996-10-25 1997-10-23 Acide nucleique codant des proteines ds-cam et produits associes

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US2932296P 1996-10-25 1996-10-25
US60/029,322 1996-10-25

Publications (1)

Publication Number Publication Date
WO1998017795A1 true WO1998017795A1 (fr) 1998-04-30

Family

ID=21848445

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/019547 WO1998017795A1 (fr) 1996-10-25 1997-10-23 Acide nucleique codant des proteines ds-cam et produits associes

Country Status (3)

Country Link
EP (1) EP0934408A1 (fr)
JP (1) JP2001502906A (fr)
WO (1) WO1998017795A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2001017028A (ja) * 1999-05-06 2001-01-23 Mitsubishi Chemicals Corp アポｅヒト化哺乳動物
EP1100869A1 (fr) * 1998-07-30 2001-05-23 Human Genome Sciences, Inc. 98 proteines humaines secretees
US6395872B1 (en) * 1996-11-19 2002-05-28 Millennium Pharmaceuticals, Inc. Secreted neural adhesion proteins

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL, EMEST5 Entry Hs326306, Accession number N80326; 4 April 1996 (1996-04-04), XP002057708 *
DATABASE EMBL, EMEST9 Entry Hsczwh041, Accession number Z45894; 6 November 1994 (1994-11-06), XP002057707 *
DATABASE EMBL, EMEST9 Entry Hsczwh042, Accession number Z41519; 5 November 1994 (1994-11-05), XP002057709 *
DATABASE EMBL, EMHUM1 Entry Hsmc18b12, Accession number X88325; 18 July 1996 (1996-07-18), XP002057710 *
J.R. KORENBERG ET AL.: "A high-fidelity physical map of human chromosome 21q in yeast artificial chromosome", GENOME RESEARCH, vol. 5, 1995, pages 427 - 443, XP002057705 *
M. MURPHY ET AL.: "Overexpression of LFA-1 and ICAM-1 in Down Syndrome thymus", THE JOURNAL OF IMMUNOLOGY, vol. 150, 1993, pages 5696 - 5703, XP002057706 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6395872B1 (en) * 1996-11-19 2002-05-28 Millennium Pharmaceuticals, Inc. Secreted neural adhesion proteins
EP1100869A1 (fr) * 1998-07-30 2001-05-23 Human Genome Sciences, Inc. 98 proteines humaines secretees
EP1100869A4 (fr) * 1998-07-30 2005-04-27 Human Genome Sciences Inc 98 proteines humaines secretees
JP2001017028A (ja) * 1999-05-06 2001-01-23 Mitsubishi Chemicals Corp アポｅヒト化哺乳動物

Also Published As

Publication number Publication date
EP0934408A1 (fr) 1999-08-11
JP2001502906A (ja) 2001-03-06

Similar Documents

Publication Publication Date Title
US5773268A (en) Chromosome 21 gene marker, compositions and methods using same
US6287788B1 (en) DNA encoding galanin GALR3 receptors and uses thereof
WO1997042314A1 (fr) Acide nucleique codant pour l'heredo-ataxie cerebelleuse du type 2 et produits connexes
WO1998021333A2 (fr) Acide nucleique codant des proteines de fixation de la schwannomine et produits associes
US8975018B2 (en) Method of detecting expanded CAG repeat region in spinocerebellar ataxia-2 gene
US6194171B1 (en) Nucleic acids encoding ataxin-2 binding proteins
JP4810036B2 (ja) 神経栄養因子受容体
EP0934408A1 (fr) Acide nucleique codant des proteines ds-cam et produits associes
US6960656B1 (en) Nucleic acid encoding DS-CAM proteins and products related thereto
US6844431B1 (en) Nucleic acid encoding spinocerebellar ataxia-2 and products related thereto
US6040429A (en) Congenital heart disease proteins and products related thereto
US6475752B1 (en) Mammalian imidazoline receptor
US20030054446A1 (en) Novel retina-specific human proteins C7orf9, C12orf7, MPP4 and F379
US20040248247A1 (en) Bhlh-pas proteins, genes thereof and utilization of the same
CA2403547A1 (fr) Acides nucleiques et poypeptides purifies et isoles cotransporteurs de chlorure de potassium
US20030157649A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
WO1997017437A2 (fr) Acide nucleique derive du chromosome 21 codant une nouvelle proteine, compositions et procede utilisant cet acide
US20030022208A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
US20030180887A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
US20020028773A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
CA2422508A1 (fr) Proteine de cassette de liaison a l'atp
US20020146767A1 (en) Human EMR1-like G protein-coupled receptor
US20030166183A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins and uses thereof
US20030219747A1 (en) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
WO2002062835A1 (fr) Acides nucleiques et polypeptides destines a reguler la consommation de nourriture et/ou la prise de poids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 519729

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997946341

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997946341

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1997946341

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997946341

Country of ref document: EP