WO1998013513A2 - Methods and compositions for identifying receptor effectors - Google Patents
Methods and compositions for identifying receptor effectors Download PDFInfo
- Publication number
- WO1998013513A2 WO1998013513A2 PCT/US1997/017159 US9717159W WO9813513A2 WO 1998013513 A2 WO1998013513 A2 WO 1998013513A2 US 9717159 W US9717159 W US 9717159W WO 9813513 A2 WO9813513 A2 WO 9813513A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- yeast
- assay
- receptor
- cell
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
Definitions
- In vitro testing is a preferred methodology in that it permits the design of high- throughput screens: small quantities of large numbers of compounds can be tested in a short period of time and at low expense. Optimally, animals are reserved for the latter stages of compound evaluation and are not used in the discovery phase; the use of whole animals is labor-intensive and extremely expensive.
- HM1 human muscarinic receptor
- HM1 human muscarinic receptor
- the rat VI b vasopressin receptor has been found to stimulate phosphotidylinositol hydrolysis and intracellular Ca2+ mobilization in Chinese hamster ovary cells upon agonist stimulation (Lolait et al. (1995) Proc Natl. Acad Sci. USA 92:6783-6787).
- Patent 5,482,835 reports expression of the human beta-2 adrenergic receptor ( ⁇ 2AR), a seven transmembrane receptor (STR), in yeast, under control of the GAL 1 promoter, with the ⁇ 2 AR gene modified by replacing the first 63 base pairs of coding sequence with 11 base pairs of noncoding and 42 base pairs of coding sequence from the STE2 gene. (STE2 encodes the yeast ⁇ -factor receptor).
- ⁇ 2AR human beta-2 adrenergic receptor
- STR seven transmembrane receptor
- U.S. Patent 5,482,835 describes co-expression of a rat G protein ⁇ -subunit in the same cells, yeast strain 8C, which lacks the cognate yeast protein. Ligand binding resulted in G protein-mediated signal transduction.
- U.S. Patent 5,482,835 teaches that these cells may be used in screening compounds for the ability to affect the rate of dissociation of G ⁇ from G ⁇ in a cell.
- the cell further contains a pheromone-responsive promoter (e.g. BAR1 or FUS1), linked to an indicator gene (e.g. HIS3 or LacZ).
- BAR1 or FUS1 pheromone-responsive promoter
- indicator gene e.g. HIS3 or LacZ
- the present invention relates to novel, rapid, reliable and effective assays for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of a cellular receptor or ion channel of a cell.
- the present invention provides for the use of any type of cell in the subject assays, whether prokaryotic or eukaryotic.
- the cells of the present invention are eukaryotic.
- the cells are mammalian cells.
- the cells are yeast cells, with cells from the genera Saccharomyces or Schi ⁇ osaccharomyces being more preferred.
- the host cells can be derived from primary cells, or transformed and/or immortalized cell lines.
- the subject assays provide a means for detecting the ability of compounds to modulate the signal transduction activity of the target receptor by scoring for up or down-regulation of a detection signal.
- Signal trasduction can be measured in a variety of ways. For example, endogenous yeast second messenger generation (e.g., GTP hydrolysis, calcium mobilization, or phospholipid hydrolysis) or increased transcription of an endogenous gene can be detected directly. Alternatively, the use of a reporter or indicator gene can provide a convenient readout. By whatever means measured, a change (e.g., a statistically significant change) in the detection signal can be used to facilitate isolation of those cells from the mixture which have received a signal via the target receptor, and thus can be used to identify novel compounds which function as receptor agonists or antagonists.
- a change e.g., a statistically significant change
- the reagent cells express the receptor of interest endogenously.
- the cells are engineered to express a heterlogous receptor protein.
- certain preferred embodiments in which a heterlogous receptor is provided utilize host cells in which the gene for the homologous receptor has been inactivated.
- other proteins involved in transducing signals from the target receptor can be inactivated, or complemented with an ortholog or paralog from another organism, e.g., yeast G protein subunits can be complemented by mammalian G protein subunits in yeast cells also engineered to express a mammalian G protein coupled receptor.
- MAP kinases or erk kinases include, for example, expression of heterologous MAP kinases or erk kinases, MEKs or MKKs (MAP kinase kinases), MEKKs (MEK kinases), ras, raf, STATs, JAKs and the like.
- the assay of the present invention can be used to screen compounds which are exogenously added to cells in order to identify potential receptor effector compounds.
- the subject assays enable rapid screening of large numbers of polypeptides in a library expressed in the cell in order to identify those polypeptides which agonize or antagonize receptor bioactivity, creating an autocrine system.
- the autocrine assay is characterized by the use of a library of recombinant cells, each cell of which includes a target receptor protein whose signal transduction activity can be modulated by interaction with an extracellular signal, the transduction activity being able to generate a detectable signal, and an expressible recombinant gene encoding an exogenous test polypeptide from a polypeptide library.
- the mixture of cells collectively express a population of test polypeptides.
- the polypeptide library includes at least IO 3 different polypeptides, though more preferably at least IO 5 , IO 6 , or IO 7 different (variegated) polypeptides.
- the polypeptide library can be generated as a random peptide library, as a semi-random peptide library (e.g., based on combinatorial mutagenesis of a known ligand), or as a cDNA library.
- the assay may be repeated and modified by the introduction of a step in which the cell is first contacted with a known activator of the target receptor to induce the signal transduction pathways from the receptor.
- a test compound can be assayed for its ability to antagonize, e.g., inhibit or block the activity of the activator.
- the assay can score for compounds which potentiate the induction response generated by treatment of the cell with a known activator.
- an "agonist” refers to agents which either induce activation of receptor signaling pathways, e.g., such as by mimicking a ligand for the receptor, as well as agents which potentiate the sensitivity of the receptor to a ligand, e.g., lower the concentrations of ligand required to induce a particular level of receptor-dependent signaling.
- the invention pertains to an assay for identifying a compound that modulates a heterologous receptor expressed by a yeast cell.
- the subject assays comprise the steps of : (i) providing a yeast cell in which a heterologous receptor is functionally integrated into an endogenous yeast signaling pathway; (ii) contacting the yeast cell with a test compound; and (iii) detecting an alteration in a signal produced by the endogenous yeast signaling pathway.
- the signaling pathway is a yeast pheromone system pathway.
- the step of detecting comprises measuring the transcription of a gene which encodes an endogenous yeast protein.
- the transcription of a gene can be measured directly or indirectly.
- the amount or activity of an endogenous yeast protein can be assayed.
- the compounds to be tested in the subject assays can be derived from a number of sources.
- the test compound is derived from a peptide library.
- the test compound is derived from a library of non-peptidic compounds.
- the endogenous yeast protein can be encoded by an endogenous yeast gene which is operatively linked to a promoter which is responsive to signals produced by a yeast pheromone system.
- the promoter is naturally occurring.
- the promoter is non-naturally occurring.
- Such non-naturally occurring promoters can be derived by modifying a naturally-occurring promoter, e.g., by mutating a naturally-occurring promoter.
- the promoter is a heterologous promoter operatively linked to the endogeneous yeast gene.
- the endogenous yeast gene to be assayed is the BAR1 gene.
- the promoter which regulates expression of the endogenous yeast gene is a pheromone responsive promoter.
- preferred pheromone-responsive promoters include the Fusl promoter and the Fus 2 promoter, which, in certain embodiments, are operatively linked to a heterologous endogenous gene.
- the subject assays utilize yeast cells which comprise a chimeric nucleic acid construct.
- This chimeric construct encodes a fusion protein that modulates the expression of an endogenous gene, wherein this expression is assayable.
- the chimeric constructs of the invention comprise a first segment derived from a first gene, which encodes a polypeptide that is activated by the yeast pheromone system pathway, and a second segment which encodes a polypeptide that binds a DNA sequence in the regulatory region of an endogenous gene of interest. Such constructs render the gene of interest responsive to activation by the yeast pheromone system pathway.
- the first segment of such a construct encodes Stel2.
- the second segment encodes Pho4 (or a DNA binding domain thereof).
- the endogenous yeast gene to be assayed is a Pho5 gene (which contains a Pho4 binding site within its regulatory region).
- the fusion protein binds to the Pho4 site in the Pho5 gene, thereby activating expression of the Pho5 gene.
- the Pho5 gene encodes an acid phosphatase whose expression is readily assayable.
- the first segment of the chimeric construct encodes a polypeptide comprising amino acids 1-688 of Ste 12.
- the second segment encodes a polypeptide comprising amino acids 227-312 of Pho4.
- the yeast cell to be used in the assay also comprises a mutation in its endogenous Pho4 gene.
- the detecting step of an assay of the present invention comprises detecting the activity of PHO5 acid phosphatase.
- the detecting step comprises detecting a change in the activity of an endogenous enzyme expressed by said yeast cell in response to a signal produced by the endogenous yeast signaling pathway.
- the endogenous yeast signaling pathway is a yeast pheromone system pathway.
- a change in the activity of an endogenous enzyme can be detected by, for example, measuring the enzymatic activity of the enzyme.
- the assay comprises detecting the activity of BARl protease.
- BARl protease can be detected in a variety of ways. For example, the cleavage of a substrate having a BARl peptide recognition sequence can be monitored.
- the BARl substrate comprises at least one detectable label.
- the substrate is naturally occurring. In yet another embodiment, the substrate is not naturally occurring.
- the substrate comprises the compound of SEQ ID NO:4. In yet another preferred embodiment the substrate comprises the compound of SEQ ID NO:5.
- the substrate is a chimeric substrate comprising a first polypeptide which, upon cleavage by BARl, exposes an amino terminal Lys; and a second polypeptide linked to the carboxy terminus of said first polypeptide.
- the step of detecting comprises measuring the stability of the chimeric substrate.
- BARl activity also can be detected by measuring the effect of the enzyme on the growth of a test yeast strain which does not express a functional BARl enzyme.
- medium from BARl -expressing cells that have been contacted with a test compound can be cultured with the test yeast strain to thereby detect the presence of BARl activity in the medium.
- the invention provides an assay for identifying a compound that modulates a receptor in a cell comprising the steps of (i) providing a cell which expresses a receptor which is functionally integrated into an endogenous signaling pathway of the cell; (ii) contacting the cell with a library of non-peptidic compounds; and (iii) detecting an alteration in a signal produced by the endogenous signaling pathway.
- the cell is a yeast cell.
- the signaling pathway is a yeast pheromone system pathway.
- the step of measuring can comprise, for example, measuring the transcription of an endogenous gene or the activity of an endogenous protein in the cell.
- the invention privides an assay for identifying a compound that modulates a receptor in a cell comprising the steps of (i) providing a cell which expresses a receptor which is functionally integrated into an endogenous signaling pathway of the cell; (ii) contacting the cell with a library of test polypeptides, wherein said library of test polypeptides is expressed by the cell; and (iii) detecting an alteration in a signal produced by the endogenous signaling pathway.
- the cell is a yeast cell.
- the signaling pathway is a yeast pheromone system pathway.
- the step of measuring can comprise, for example, measuring the transcription of an endogenous gene or the activity of an endogenous protein in the cell.
- the invention provides an assay for identifying a compound that modulates a pheromone system protein surrogate in a yeast cell comprising the steps of: (i) providing a yeast cell which comprises a pheromone system protein surrogate which is functionally integrated into an endogenous pheromone system signaling pathway of the yeast cell; (ii) contacting the cell with a library of non-peptidic compounds; and (iii) measuring an alteration in a signal produced by the endogenous pheromone signaling pathway of the yeast cell.
- the step of measuring comprises measuring the transcription of an endogenous gene or the activity of an endogenous protein in the cell.
- the pheromone system protein surrogate to be assayed is selected from the group consisting of G protein-coupled receptors, G proteins, proteases, kinases, farnesyltransferases, carboxymethyltransfcrases, ABC transporters and cyclins.
- the invention provides an assay for identifying a compound that modulates a pheromone system protein surrogate in a yeast cell comprising the steps of: (i) providing a yeast cell which comprises a pheromone system protein surrogate which is functionally integrated into an endogenous pheromone system signaling pathway of the yeast cell; (ii) contacting the cell with a library of test polypeptides, wherein said library of test polypeptides is expressed by the cell; and (iii) measuring an alteration in a signal produced by the endogenous pheromone signaling pathway of the yeast cell.
- the step of measuring comprises measuring the transcription of an endogenous gene or the activity of an endogenous protein in the cell.
- the pheromone system protein surrogate to be assayed is selected from the group consisting of G protein-coupled receptors, G proteins, proteases, kinases, farnesyltransferases, carboxymethyltransferases, ABC transporters and cyclins.
- the invention also provides substrates for a BARl enzyme.
- the substrate comprises the compound of SEQ ID NO: 4 or SEQ ID NO:5.
- the invention also provides a chimeric substrate for a BARl enzyme, the chimeric substrate comprising: a first polypeptide segment derived from mature yeast ⁇ - factor and a second polypeptide segment derived from a second, different polypeptide, wherein upon cleavage of said first polypeptide segment by BARl a change in the stability of said second polypeptide segment is detectable.
- the second polypeptide segment is derived from LacZ.
- the second polypeptide segment is derived from a protein which is essential for yeast cell growth.
- the second polypeptide segment is derived from a yeast repressor protein.
- the invention provides a chimeric nucleic acid construct comprising: a first segment comprising an nucleotide sequence encoding a polypeptide which is activated by a yeast pheromone system pathway; and a second segment comprising a nucleotide sequence encoding a Pho4 polypeptide.
- the first segment encodes a Stel2 polypeptide.
- the invention also provides a yeast cell which comprises a chimeric nucleic acid construct of the invention.
- Receptor proteins for use in the present invention can be any receptor or ion channel which interacts with an extracellular molecule (i.e. hormone, growth factor, peptide, ion) to modulate a signal in the cell.
- an extracellular molecule i.e. hormone, growth factor, peptide, ion
- the receptor can be a cell surface receptor, or in other embodiments can be an intracellular receptor.
- the receptor is a cell surface receptor, such as: a receptor tyrosine kinase, e.g., an EPH receptor; an ion channel; a cytokine receptor; an multisubunit immune recognition receptor, a chemokine receptor; a growth factor receptor, or a G-protein coupled receptor, such as a chemoattracttractant peptide receptor, a neuropeptide receptor, a light receptor, a neurotransmitter receptor, or a polypeptide hormone receptor.
- a receptor tyrosine kinase e.g., an EPH receptor
- an ion channel e.g., an EPH receptor
- a cytokine receptor e.g., an cytokine receptor
- an multisubunit immune recognition receptor e.g., a chemokine receptor
- a growth factor receptor e.g., a growth factor receptor
- G-protein coupled receptor such as a chemoattracttractant peptide receptor
- Preferred G protein coupled receptors include: ⁇ lA-adrenergic receptor, ⁇ lB- adrenergic receptor, ⁇ 2-adrenergic receptor, ⁇ 2B-adrenergic receptor, ⁇ l-adrenergic receptor, ⁇ 2-adrenergic receptor, ⁇ 3-adrenergic receptor, ml acetylcholine receptor (AChR), m2 AChR, m3 AChR, m4 AChR, m5 AChR, DI dopamine receptor, D2 dopamine receptor, D3 dopamine receptor, D4 dopamine receptor, D5 dopamine receptor, Al adenosine receptor, A2b adenosine receptor, 5-HTla receptor, 5-HTlb receptor, 5HTl-like receptor, 5-HTld receptor, 5HTld-like receptor, 5HTld beta receptor, substance K (neurokinin A) receptor, fMLP receptor, fMLP-like receptor, angioten
- Preferred EPH receptors include eph, elk, eck, sek, mek4, hek, hek2, eek, erk, tyroJ, tyro4, tyro5, tyro ⁇ , tyroIJ, cek4, cek5, cek ⁇ , cek7, cek8, cek9, ceklO, bsk, rtkl, rtk2, rtk3, mykl, myk2, ehkl, ehk2, pagliaccio, htk, erk and nuk receptors.
- the subject assay can be used to identifying ligands for an orphan receptor, i.e., a receptor with no known ligand, regardless of the class of receptors to which it belongs.
- the target receptor is a cell surface receptor
- the cell expresses a peptide library
- the host cell harbors a reporter construct containing a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transductin activity of the receptor protein.
- reporter genes include enzymes, such as luciferase, phosphatase, or ⁇ -galactosidase which can produce a spectrometrically active label, e.g., changes in color, fluorescence or luminescence, or a gene product which alters a cellular phenotype, e.g., cell growth, drug resistance or auxotrophy.
- the reporter gene encodes a gene product selected from the group consisting of chloramphenicol acetyl transferase, beta-galactosidase and secreted alkaline phosphatase.
- the reporter gene encodes a gene product which confers a growth signal.
- the reporter gene encodes a gene product for growth in media containing aminotriazole or canavanine or cycloheximide.
- Figure 1 is a sequence alignment of N-terminal regions of G ⁇ subunits and N- terminal sequences of GPA41-G ⁇ hybrid proteins.
- Proliferation, differentiation and death of eukaryotic cells are controlled by a variety of extracellular signals, such as hormones, neurotransmitters, and polypeptide factors. These diffusible ligands allow cells to influence and be influenced by environmental cues. The study of receptor-ligand interaction has revealed a great deal of information about how cells respond to external stimuli, and this knowledge has led to the development of therapeutically important compounds.
- the present invention makes available a rapid, effective assay for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of a cellular receptor or ion channel.
- the subject assay enables rapid screening of large numbers of compounds (including, for example, polypeptides in an expression library) to identifying compounds which induce or antagonize receptor bioactivity.
- the assay is characterized by the use of a mixture of cells to sample a battery of compounds for receptor/channel agonists or antagonists.
- the reagent cells express a target receptor protein or ion channel capable of transducing a detectable signal in the reagent cell.
- the receptor/channel protein can be either endogenous or heterologous.
- a culture of the instant reagent cells will provide means for detecting agonists or antagonists of receptor function.
- a test compound is exogenously added, and its ability to modulate the activity of the target receptor or ion channel is scored in the assay.
- the cells are engineered to additionally express a test polypeptide which can be assayed for its ability to interact with the receptor or ion channel.
- the assay provides a population of cells which express a library peptides which include potential receptor/channel effectors, and those peptides of the library which either agonize or antagonize the receptor or channel function can be selected and identified by sequence.
- the assay of the present invention provides a convenient format for discovering drugs which can be useful to modulate cellular function, as well as to understand the pharmacology of compounds that specifically interact with cellular receptors or ion channels. Moreover, the subject assay is particularly amenable to identifying ligands, natural or artificial, for receptors and ion channels.
- heterologous DNA or “heterologous nucleic acid” includes DNA that does not occur naturally as part of the genome in which it is present or which is found in a location or locations in the genome that differs from that in which it occurs in nature.
- Heterologous DNA is not naturally occurring in that position or is not endogenous to the cell into which it is introduced, but has been obtained from another cell.
- such DNA encodes proteins that are not normally produced by the cell in which it is expressed.
- Heterologous DNA can be from the same species, although in preferred embodiments, it is from a different species. In particularly preferred embodiments, it is mammalian, e.g., human.
- Heterologous DNA may also be referred to as foreign DNA. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which is expressed is herein encompassed by the term heterologous DNA.
- heterologous DNA include, but are not limited to, DNA that encodes test polypeptides, receptors, reporter genes, transcriptional and translational regulatory sequences, or selectable or traceable marker proteins, such as a protein that confers drug resistance.
- heterologous protein refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. That is, the polypeptide is expressed from a heterologous nucleic acid.
- recombinant cells include any cells that have been modified by the introduction of heterologous DNA.
- Control cells include cells that are substantially identical to the recombinant cells, but do not express one or more of the proteins encoded by the heterologous DNA, e.g., do not include or express the reporter gene construct, heterologous receptor or test polypeptide.
- cell surface receptor refers to molecules that occur on the surface of cells, interact with the extracellular environment, and transmit or transduce the information regarding the environment intracellularly in a manner that may modulate intracellular second messenger activities or transcription of specific promoters, resulting in transcription of specific genes.
- a “heterologous receptor” is a specific embodiment of a “heterologous protein", wherein the heterologous receptor is encoded by heterologous DNA and, upon expression of this heterologous DNA in a recombinant cell, the heterologous receptor is expressed in the recombinant cell.
- extracellular signal is intended to encompass molecules and changes in the environment that are transduced intracellularly via cell surface proteins that interact, directly or indirectly, with the extracellular signal.
- An extracellular signal or effector molecule includes any compound or substance that in some manner alters the activity of a cell surface protein. Examples of such signals include, but are not limited to, molecules such as acetylcholine, growth factors and hormones, lipids, sugars and nucleotides that bind to cell surface and/or intracellular receptors and ion channels and modulate the activity of such receptors and channels.
- extracellular signal also includes as yet unidentified substances that modulate the activity of a cellular receptor, and thereby influence intracellular functions. Such extracellular signals are potential pharmacological agents that may be used to treat specific diseases by modulating the activity of specific cell surface receptors.
- signal transduction is intended to encompass the processing of physical or chemical signals from the extracellular environment through the cell membrane and into the cell, and may occur through one or more of several mechanisms, such as activation/inactivation of enzymes (such as proteases, or other enzymes which may alter phosphorylation patterns or other post-translational modifications), activation of ion channels or intracellular ion stores, effector enzyme activation via guanine nucleotide binding protein intermediates, formation of inositol phosphate, activation or inactivation of adenylyl cyclase, direct activation (or inhibition) of a transcriptional factor and/or activation.
- enzymes such as proteases, or other enzymes which may alter phosphorylation patterns or other post-translational modifications
- activation of ion channels or intracellular ion stores effector enzyme activation via guanine nucleotide binding protein intermediates, formation of inositol phosphate, activation or inactivation of adenylyl
- a “signaling pathway” refers to the components involved in “signal transduction” of a particular signal into a cell.
- the term “endogenous signaling pathway” indicates that some or all of the components of the signaling pathway are naturally-occurring components of the cell.
- An example of such a pathway is the endogenous pheromone system pathway of yeast.
- the term “functionally integrated” (as in a receptor that is “functionally integrated into a signaling pathway in a cell” or “functionally integrated into an endogenous yeast signaling pathway”) is intended to refer to the ability of the receptor to be expressed at the surface of the cell and the ability of the expressed receptor to bind to modulators (e.g., a ligand of the receptor) and transduce signals into the cell via components of a signaling pathway of the cell.
- modulators e.g., a ligand of the receptor
- GPCR G protein coupled receptor
- endogenous gene is intended to refer to a gene in a cell that is naturally part of the genome of the cell and which, most preferably, is present in its natural location in the genome (as opposed to “heterologous” DNA which has been introduced into the cell).
- endogenous protein is intended to include proteins of a cell that are encoded by endogenous genes of the cell.
- An endogenous gene may comprise the natural regulatory elements of the gene (e.g.,. the native promoter/enhancer elements that naturally regulate expression of the gene) or the endogenous gene can be "operatively linked to” (i.e., functionally coupled to) a “heterologous promoter” (or other heterologous regulatory elements).
- a heterologous promoter refers to a promoter that does not naturally regulate the gene to which the heterologous promoter is operatively linked.
- an endogenous yeast gene that is not normally pheromone-responsive can be operatively linked to a heterologous promoter that is responsive to signals produced by the yeast pheromone system to thereby confer pheromone responsiveness on the endogenous yeast gene (described in further detail below).
- detecting an alteration in a signal produced by an endogenous signaling pathway is intended to encompass the detection of alterations in endogenous second messengers produced upon activation of components of the endogenous signaling pathway, alterations in endogenous gene transcription induced upon activation of components of the endogenous signaling pathway, and/or alterations in the activity of an endogenous protein(s) upon activation of components of the endogenous signaling pathway.
- detecting an alteration in a signal produced by an endogenous signaling pathway is not, however, intended to encompass detecting alterations in the level of expression of an exogenous reporter gene that has been introduced into the cell or the activity of the reporter gene product.
- detecting an alteration in a signal produced by an endogenous signaling pathway is not intended to encompass assaying general, global changes to the cell such as changes in cell growth or cell morphology. Rather, this term indicates that a specific signal associated with the endogenous signaling pathway is assayed.
- modulation as in “modulation of a (heterologous) receptor” and “modulation of a signal transduction activity of a receptor protein” is intended to encompass, in its various grammatical forms, induction and/or potentiation, as well as inhibition and/or downregulation of receptor activity and/or one or more signal transduction pathways downstream of a receptor.
- the term "compound” as used herein is meant to include both exogenously added test compounds and peptides endogenously expressed from a peptide library.
- the reagent cell also produces the test compound which is being screened.
- the reagent cell can produce, e.g., a test polypeptide, a test nucleic acid and/or a test carbohydrate which is screened for its ability to modulate the receptor/channel activity.
- a culture of such reagent cells will collectively provide a library of potential effector molecules and those members of the library which either agonize or antagonize the receptor or ion channel function can be selected and identified.
- the reagent cell can be used to detect agents which transduce a signal via the receptor or channel of interest.
- test compound is exogenously added.
- test compound is contacted with the reagent cell.
- reagent cell Exemplary compounds which can be screened for activity include, but are not limited to, peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries, ln such embodiments, both compounds which agonize or antagonize the receptor- or channel-mediated signaling function can be selected and identified.
- non-peptidic compound is intended to encompass compounds that are comprised, at least in part, of molecular structures different from naturally -occurring L-amino acid residues linked by natural peptide bonds.
- non-peptidic compounds are intended to include compounds composed, in whole or in part, of peptidomimetic structures, such as D-amino acids, non-naturally-occurring L-amino acids, modified peptide backbones and the like, as well as compounds that are composed, in whole or in part, of molecular structures unrelated to naturally-occurring L-amino acid residues linked by natural peptide bonds.
- Non-peptidic compounds also are intended to include natural products.
- chimeric nucleic acid construct is intended to refer to a nucleic acid molecule, preferably DNA, composed of at least two discrete segments, a first segment derived from a first gene and a second segment derived from a second gene.
- the term "derived from” is intended to indicate that the first and second segments have the same or a substantially homologous nucleotide sequence as all or a part of the first and second genes, respectively.
- Each of the first and second segments encodes a functional polypeptide and are operatively linked such that upon expression of the construct, a fusion protein is produced, the fusion protein comprising a first polypeptide encoded by the first segment and a second polypeptide encoded by the second segment.
- the first segment of the chimeric construct encodes a yeast transcription factor that is responsive to signals transduced via the pheromone system pathway and the second segment encodes a DNA binding protein that binds to a DNA sequence in the regulatory region of an endogenous gene of interest.
- a “chimeric substrate” (as in a "chimeric substrate of a BARl enzyme) is intended to refer to a substrate composed of two distinct polypeptides, linked to each other, wherein at least one of the polypeptides is cleavable by BARl .
- the first polypeptide of the chimeric substrates exposes an N-terminal lysine residue upon cleavage by BARl and the second polypeptide is linked to the C-terminus of the first polypeptide.
- the first polypeptide is a yeast a-factor polypeptide.
- PSP surrogate pheromone system protein surrogate
- yeast cell which is functionally homologous to a yeast protein of the pheromone system pathway (i.e.,. the PSP surrogate is functionally integrated into the yeast pheromone system pathway).
- PSP surrogates examples include G protein-coupled receptors, G proteins, proteases, kinases, farnesyltransferases, carboxymethyltransferases, ABC transporters and cyclins.
- receptor effector is intended to include agonists and antagonists that modulate signal transduction via a receptor.
- Receptor effector molecules are capable of binding to the receptor, though not necessarily at the binding site of the natural ligand.
- Receptor effectors can modulate signal transduction when used alone, i.e. can be surrogate ligands, or can alter signal transduction in the presence of the natural ligand, either to enhance or inhibit signaling by the natural ligand.
- antagonists are molecules that block or decrease the signal transduction activity of receptor, e.g., they can competitively, noncompetitively, and/or allosterically inhibit signal transduction from the receptor, whereas “agonists” potentiate, induce or otherwise enhance the signal transduction activity of a receptor.
- receptor activator and “surrogate ligand” refer to an agonist which induces signal transduction from a receptor.
- Orphan receptors is a designation given to a receptors for which no specific natural ligand has been described and/or for which no function has been determined.
- indicator gene generically refers to an expressible (e.g., able to transcribed and (optionally) translated) DNA sequence which is expressed in response to a signal transduction pathway modulated by a target receptor or ion channel.
- exemplary indicator genes include unmodified endogenous genes of the host cell, modified endogenous genes, or a reporter gene of a heterologous construct, e.g., as part of a reporter gene construct.
- a reporter gene construct is a nucleic acid that includes a “reporter gene” operatively linked to at least one transcriptional regulatory sequence. Transcription of the reporter gene is controlled by these sequences to which they are linked. The activity of at least one or more of these control sequences is directly or indirectly regulated by the target receptor protein. Exemplary transcriptional control sequences are promoter sequences.
- a reporter gene is meant to include a promoter- reporter gene construct which is heterologously expressed in a cell.
- substantially homologous when used in connection with amino acid sequences, refers to sequences which are substantially identical to or similar in sequence, giving rise to a homology in conformation and thus to similar biological activity. The term is not intended to imply a common evolution of the sequences.
- substantially homologous sequences are at least 50%, more preferably at least 80%, identical in sequence, at least over any regions known to be involved in the desired activity. Most preferably, no more than five residues, other than at the termini, are different.
- the divergence in sequence, at least in the aforementioned regions, is in the form of "conservative modifications".
- autocrine cell refers to a cell which produces a substance which can stimulate a receptor located on or within the same cell as that which produces the substance.
- wild-type yeast MATa and MATa cells are not autocrine.
- a yeast cell which produces both a-factor and a-factor receptor, or both a-factor and a-factor receptor, in functional form is autocrine.
- autocrine cells cells which produce a peptide which is being screened for the ability to activate a receptor (e.g., by activating a G protein-coupled receptor) and also express the receptor are called "autocrine cells”.
- such cells can also be referred to as "putative autocrine cells" since some of the cells will express peptides from the library which will not activate the receptor which is expressed. In a library of such cells, in which a multitude of different peptides are produced, it is likely that one or more of the cells will be "autocrine" in the stricter sense of the term.
- the present invention relates to methods for identifying effectors of a receptor protein or complex thereof.
- the assay is characterized by the use of a test cell which includes a target receptor or ion channel protein whose signal transduction activity can be modulated by interaction with an extracellular signal, the transduction activity being able to generate a detectable signal.
- the cell also includes a detection means, such as a reporter gene or an indicator gene, for detecting signals produced by the receptor.
- a detection means such as a reporter gene or an indicator gene
- the ability of particular compounds to modulate a signal transduction activity of target receptor or channel can be scored for by detecting up or down-regulation of an endogenous detection signal.
- second messenger generation e.g. GTPase activity, phospholipid hydrolysis, or protein phosphorylation patterns as examples
- transcription of an endogenous gene or activity of an endogenous protein is used as a detectabel readout.
- an indicator gene can provide a convenient readout.
- a detection means consists of a reporter gene.
- a statistically significant change in the detection signal can be used to facilitate identification of compounds which modulate receptor or ion channel activities.
- the assay may be repeated and modified by the introduction of a step in which the reagent cell is first contacted with a known activator of the target receptor/channel to induce signal transduction, and the test compound can be assayed for its ability to inhibit the activated receptor/channel, e.g., to identify antagonists.
- batteries of compounds can be screened for agents which potentiate the response to a known activator of the receptor.
- a transcription based assay provides a rapid indication of whether a specific receptor or ion channel interacts with a test compound in any way that modulates intracellular transduction.
- Expression of the indicator gene thus, provides a valuable screening tool for the development of compounds that act as agonists or antagonists of a cell receptor or ion channel.
- Indicator or reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation.
- a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on receptor signaling.
- the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transduction activity of the target receptor, with the level of expression of the reporter gene providing the receptor-dependent detection signal.
- certain endogenous genes can provide a detectable signal in response to a signal transduction from a receptor or ion channel, i.e., act as indicator genes.
- the amount of transcription from the indicator gene may be measured using any method known to those of skill in the art to be suitable. For example, specific mRNA expression may be detected using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity.
- the gene product of the indicator or reporter gene is detected by an intrinsic activity associated with that product.
- the indicator gene may encode a gene product that, e.g., by enzymatic activity, gives rise to a detection signal based on, for example, color, fluorescence, or luminescence.
- the amount of expression from the indicator gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks the specific receptors.
- a control cell may be derived from the same cells from which the test cell was prepared but which had not been treated with the compound. Alternatively, it may be a cell in which the receptor of interest are removed. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the specific receptor or ion channel.
- the indicator gene provides a selection method such that cells in which activation (or inactivation) of one or more signal pathways of a receptor or ion channel provides a growth advantage to the treated cell.
- expression of the indicator gene could enhance cell viability, relieve a cell nutritional requirement, and/or provide resistance to a drug.
- changes in intracellular second messenger pathways can be detected biochemically rather than biologically.
- changes in intracellular Ca +2 changes in intracellular Ca +2 , phophorylation states of proteins, activities of intracellular enzymes, and the like can be detected.
- Still other detection techniques include micorphysiometric devices which permit detection of small changes in, e.g., ions or intracellular pi I.
- the receptor or ion channel it may be endogenously expressed by the host cell, or it may be expressed from a heterologous gene that has been introduced into the cell.
- Methods for introducing heterologous DNA into eukaryotic cells are well known in the art and any such method may be used.
- DNA encoding various receptor proteins is known to those of skill in the art or it may be cloned by any method known to those of skill in the art.
- it may be desirable to inactivate, such as by deletion, a homologous receptor present in the cell.
- the subject assay is useful for identifying compounds that interact with any receptor protein whose activity ultimately induces a signal transduction cascade in the host cell which can be exploited to produce a detectable signal.
- the assays can be used to test functional ligand-receptor or ligand-ion channel interactions for cell surface-localized receptors and channels, and also for cytoplasmic and nuclear receptors.
- the subject assay can be used to identify effectors of, for example, G protein-coupled receptors, receptor tyrosine kinases, cytokine receptors, and ion channels, as well as steroid hormone, or other nuclear receptors.
- the method described herein is used for identifying ligands for "orphan receptors" for which no ligand is known.
- each of the peptides of the peptide library will be desirable for each of the peptides of the peptide library to include a signal sequence for secretion.
- the expression of such a signal sequence may ensure appropriate transport of the peptide to the endoplasmic reticulum, the golgi, and ultimately to the cell surface.
- the signal sequence will transport peptides to the periplasmic space, however, such transport may not be necessary to achieve autocrine stimulation. .
- Any transferable cell that can express the desired cell surface protein in a manner such the protein functions to intracellularly transduce an extracellular signal may be used.
- any cell surface protein that is known to those of skill in the art or that may be identified by those of skill in the art may used in the assay.
- the cell surface protein may endogenously expressed on the selected cell or it may be expressed from cloned DNA. ///.
- Suitable host cells for generating the subject assay include prokaryotes, yeast, or higher eukaryotic cells, including plant and animal cells, especially mammalian cells.
- Prokaryotes include gram negative or gram positive organisms.
- suitable mammalian host cell lines include the COS-7 line of monkey kidney cells (ATCC CRL 1651 ) (Gluzman (1981) Cell 23:175) CV-1 cells (ATCC CCL 70), L cells, C127, 3T3, Chinese hamster ovary (CHO), HeLa, HEK-293, SWISS 3T3, and BHK cell lines.
- yeast cells may be of any species which are cultivable and in which an exogenous receptor can be made to engage the appropriate signal transduction machinery of the host cell. Suitable species include Kluyverei lactis, Schizosaccharomyces pombe, and Ustilaqo maydis; Saccharomyces cerevisiae is preferred. Other yeast which can be used in practicing the present invention are Neurospora crassa, Aspergillus niger, Aspergillus nidulans, Pichia pastoris, Candida tropicalis, and Hansenula polymorpha.
- yeast includes not only yeast in a strictly taxonomic sense, i.e., unicellular organisms, but also yeast-like multicellular fungi or filamentous fungi.
- reporter constructs can provide a selectable or screenable trait upon transcriptional activation (or inactivation) in response to a signal transduction pathway coupled to the target receptor.
- the reporter gene may be an unmodified gene already in the host cell pathway, such as the genes responsible for growth arrest in yeast. It may be a host cell gene that has been operably linked to a "receptor-responsive" promoter. Alternatively, it may be a heterologous gene (e.g., a "reporter gene construct" that has been so linked. Suitable genes and promoters are discussed below.
- second messenger generation can be measured directly in the detection step, such as mobilization of intracellular calcium or phospholipid metabolism are quantitated.
- indicator genes can be used to detect receptor-mediated signaling.
- the host cell must have an appropriate phenotype.
- generating a pheromone-responsive chimeric HIS3 gene in a yeast that has a wild-type HIS3 gene would frustrate genetic selection.
- an auxotrophic strain is preferred.
- a variety of complementations for use in the subject assay can be constructed. Indeed, many yeast genetic complementation with mammalian signal transduction proteins have been described in the art. For example, Mosteller ct al. (1994) Mol Cell Biol 14:1104-12 demonstrates that human Ras proteins can complement loss of ras mutations in S. cerevisiae. Moreover, Toda et al. (1986) Princess Takamatsu Symp 17: 253-60 have shown that human ras proteins can complement the loss of RAS 1 and RAS2 proteins in yeast, and hence are functionally homologous. Both human and yeast RAS proteins can stimulate the magnesium and guanine nucleotide-dependent adenylate cyclase activity present in yeast membranes.
- Ballester et al. (1989) Cell 59: 681-6 describe a vector to express the mammalian GAP protein in the yeast S. cerevisiae. When expressed in yeast, GAP inhibits the function of the human ras protein, and complements the loss of IRA 1.
- IRAl is a yeast gene that encodes a protein with homology to GAP and acts upstream of RAS. Mammalian GAP can therefore function in yeast and interact with yeast RAS.
- Wei et al. (1994) Gene 151 : 279-84 describes that a human Ras-specific guanine nucleotide-exchange factor, Cdc25GEF, can complement the loss of CDC25 function in S. cerevisiae.
- Martegani et al. (1992) EMBO J 11 : 2151-7 describe the cloning by functional complementation of a mouse cDNA encoding a homolog of CDC25, a Saccharomyces cerevisiae RAS activator.
- Vojtek et al. (1993) J Cell Sci 105: 777-85 and Matviw et al. (1992) Mol Cell Biol 12: 5033-40 describe how a mouse CAP protein, e.g., an adenylyl cyclase associated protein associated with ras- mediated signal transduction, can complements defects in S. cerevisiae. Papasavvas et al.
- the Ca(2+)- and phospholipid-dependent Ser/Thr kinase PKC plays important roles in the transduction of cellular signals in mammalian cells. Marcus et al. (1995) PNAS 92: 6180-4 suggests the complementation of shkl null mutations in S. pombe by the either the structurally related S. cerevisiae Ste20 or mammalian p65PAK protein kinases.
- Inactivation with respect to genes of the host cell, means that production of a functional gene product is prevented or inhibited. Inactivation may be achieved by deletion of the gene, mutation of the promoter so that expression does not occur, or mutation of the coding sequence so that the gene product is inactive. Inactivation may be partial or total.
- “Complementation” with respect to genes of the host cell, means that at least partial function of inactivated gene of the host cell is supplied by an exogenous nucleic acid.
- yeast cells can be “mammalianized”, and even “humanized”, by complementation of receptor and signal transduction proteins with mammalian homologs.
- inactivation of a yeast Byr2/Stel 1 gene can be complemented by expression of a human MEKK gene.
- the vector be capable of replication in the host cell. It may be a DNA which is integrated into the host genome, and thereafter is replicated as a part of the chromosomal DNA, or it may be DNA which replicates autonomously, as in the case of a plasmid. In the latter case, the vector will include an origin of replication which is functional in the host. In the case of an integrating vector, the vector may include sequences which facilitate integration, e.g., sequences homologous to host sequences, or encoding integrases.
- Mammalian expression vectors may comprise non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a poly-adenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
- Preferred mammalian expression vectors contain both prokaryotic sequences, to facilitate the propagation of the vector in bacteria, and one or more eukaryotic transcription units that are expressed in eukaryotic cells.
- the pcDNAI/amp, pcDNAI/neo, pRc/CMV, pSV2gpt, pSV2neo, pSV2-dhfr, P Tk2, pRSVneo, pMSG, pS VT7, pko-neo and pHyg derived vectors are examples of mammalian expression vectors suitable for transfection of eukaryotic cells.
- vectors are modified with sequences from bacterial plasmids, such as pBR322, to facilitate replication and drug resistance selection in both prokaryotic and eukaryotic cells.
- derivatives of viruses such as the bovine papillomavirus (BPV-1), or Epstein-Barr virus (pHEBo, pREP-derived and p205) can be used for transient expression of proteins in eukaryotic cells.
- BBV-1 bovine papillomavirus
- pHEBo Epstein-Barr virus
- the various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art.
- suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures see Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) Chapters 16 and 17.
- Transcriptional and translational control sequences in expression vectors to be used in transforming mammalian cells may be provided by viral sources.
- viral sources for example, commonly used promoters and enhancers are derived from Polyoma, Adenovirus 2, Simian Virus 40 (SV40), and human cytomegalovirus.
- DNA sequences derived from the SV40 viral genome for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites may be used to provide the other genetic elements required for expression of a heterologous DNA sequence.
- the early and late promoters are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et al.(1978) Nature 273: 1 1 1 ) Smaller or larger SV40 fragments may also be used, provided the approximately 250 bp sequence extending from the Hind III site toward the Bgl I site located in the viral origin of replication is included.
- Exemplary vectors can be constructed as disclosed by Okaya a and Berg (1983, Mol. Cell Biol. 3:280).
- a useful system for stable high level expression of mammalian receptor cDNAs in C 127 murine mammary epithelial cells can be constructed substantially as described by Cosman et al (1986, Mol. Immunol. 23:935).
- Other expression vectors for use in mammalian host cells are derived from retroviruses.
- the use of viral transfection can provide stably integrated copies of the expression construct.
- the use of retroviral, adenoviral or adeno-associated viral vectors is contemplated as a means for providing a stably transfected cell line which expresses an exogenous receptor, and/or a polypeptide library.
- YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incorporated by reference herein).
- These vectors can replicate in E. coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid.
- drug resistance markers such as ampicillin can be used.
- yeast if yeast are used as a host cell, it will be understood that the expression of a gene in a yeast cell requires a promoter which is functional in yeast.
- suitable promoters include the promoters for metal lothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255, 2073 (1980) or other glycolytic enzymes (Hess et al., ./. Adv. Enzyme Req. 7, 149 (1968); and Holland et al.
- Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO Publn. No. 73,657.
- promoters which have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3-phosphate dehydrogenase, as well as enzymes responsible for maltose and galactose utilization.
- promoters that are active in only one of the two haploid mating types may be appropriate in certain circumstances.
- the pheromone promoters MFal and MF ⁇ l are of particular interest.
- recombinant polypeptides can be expressed by the use of a baculovirus expression system.
- baculovirus expression systems include pVL-derived vectors (such as pVL1392, pVL1393 and pVL941 ), pAcUW- derived vectors (such as pAcUWl), and pBlueBac -derived vectors (such as the ⁇ -gal containing pBlueBac III).
- the termination sequences associated with these genes, or with other genes which are efficiently expressed in yeast may also be ligated into the expression vector 3' of the heterologous coding sequences to provide polyadenylation and termination of the mRNA.
- yeast cells are used as the host cell and the compounds tested are endogenously expressed from a library
- the yeast cell is bounded by a lipid bilayer called the plasma membrane. Between this plasma membrane and the cell wall is the periplasmic space.
- Peptides secreted by yeast cells cross the plasma membrane through a variety of mechanisms and thereby enter the periplasmic space.
- the secreted peptides are then free to interact with other molecules that are present in the periplasm or displayed on the outer surface of the plasma membrane.
- the peptides then either undergo re-uptake into the cell, diffuse through the cell wall into the medium, or become degraded within the periplasmic space.
- the test polypeptide library may be secreted into the periplasm by any of a number of exemplary mechanisms, depending on the nature of the expression system to which they are linked.
- the peptide may be structurally linked to a yeast signal sequence, such as that present in the ⁇ -factor precursor, which directs secretion through the endoplasmic reticulum and Golgi apparatus. Since this is the same route that the receptor protein follows in its journey to the plasma membrane, opportunity exists in cells expressing both the receptor and the peptide library for a specific peptide to interact with the receptor during transit through the secretory pathway. This has been postulated to occur in mammalian cells exhibiting autocrine activation.
- Such interaction could yield activation of the response pathway during transit, which would still allow identification of those cells expressing a peptide agonist.
- this system would still be effective, since both the peptide antagonist and receptor would be delivered to the outside of the cell in concert.
- those cells producing an antagonist would be selectable, since the peptide antagonist would be properly and timely situated to prevent the receptor from being stimulated by the externally applied agonist.
- An alternative mechanism for delivering peptides to the periplasmic space is to use the ATP-dependent transporters of the STE6/MDR1 class.
- This transport pathway and the signals that direct a protein or peptide to this pathway are not as well characterized as is the endoplasmic reticulum-based secretory pathway. Nonetheless, these transporters apparently can efficiently export certain peptides directly across the plasma membrane, without the peptides having to transit the ER/Golgi pathway. It is anticipated that at least a subset of peptides can be secreted through this pathway by expressing the library in context of the a-factor prosequence and terminal tetrapeptide.
- the present invention does not require periplasmic secretion, or, if such secretion is provided, any particular secretion signal or transport pathway.
- the target receptor is a cytokine receptor.
- Cytokines are a family of soluble mediators of cell-to-cell communication that includes interleukins, interferons, and colony-stimulating factors. The characteristic features of cytokines lie in their functional redundancy and pleiotropy. Most of the cytokine receptors that constitute distinct superfamilies do not possess intrinsic protein tyrosine kinase domains, yet receptor stimulation usually invokes rapid tyrosine phosphorylation of intracellular proteins, including the receptors themselves. Many members of the cytokine receptor superfamily acitvate the Jak protein tyrosine kinase family, with resultant phosphorylation of the STAT transcriptional activator factors.
- IL-2, IL-7, IL-2 and Interferon ⁇ have all been shown to activate Jak kinases (Frank et al (1995) Proc Natl Acad Sci USA 92:7779-7783); Scharfe et al. (1995) Blood 86:2077-2085); (Bacon et al. (1995) Proc Natl Acad Sci USA 92:7307-731 1); and (Sakatsume et al (1995) J. Biol Chem 270:17528-17534). Events downstream of Jak phosphorylation have also been elucidated.
- STAT signal transducers and activators of transcription
- STATl ⁇ signal transducers and activators of transcription
- STAT2 ⁇ signal transducers and activators of transcription
- STAT3 two STAT-related proteins, p94 and p95.
- the STAT proteins were found to translocate to the nucleus and to bind to a specific DNA sequence, thus suggesting a mechanism by which IL-2 may activate specific genes involved in immune cell function (Frank et al. supra).
- Jak3 is associated with the gamma chain of the IL-2, IL-4, and IL-7 cytokine receptors (Fujii et al.
- Jak kinases have also been shown to be activated by numerous ligands that signal via cytokine receptors such as, growth hormone and erythropoietin and IL-6 (Kishimoto (1994) Stem cells Suppl 12:37-44).
- Signal transduction which may be detected in the instant assays, in addition to direct detection of second messengers, (e.g., by measuring changes in phosphorylation) includes reporter constructs or indicator genes which include transcriptional regulatory elements responsive to the STAT proteins. Described infra.
- MIRR Multisubunit Immune Recognition Receptor
- the receptor is a multisubunit receptor.
- Receptors can be comprised of multiple proteins referred to as subunits, one category of which is referred to as a multisubunit receptor is a multisubunit immune recognition receptor (MIRR).
- MIRRs include receptors having multiple noncovalently associated subunits and are capable of interacting with src-family tyrosine kinases.
- MIRRs can include, but are not limited to, B cell antigen receptors, T cell antigen receptors, Fc receptors and CD22.
- An MIRR is an antigen receptor on the surface of a B cell.
- the MIRR on the surface of a B cell comprises membrane-bound immunoglobulin (mlg) associated with the subunits Ig- ⁇ and Ig- ⁇ or Ig- ⁇ , which forms a complex capable of regulating B cell function when bound by antigen.
- An antigen receptor can be functionally linked to an amplifier molecule in a manner such that the amplifier molecule is capable of regulating gene transcription.
- Src-family tyrosine kinases are enzymes capable of phosphorylating tyrosine residues of a target molecule.
- a src-family tyrosine kinase contains one or more binding domains and a kinase domain.
- a binding domain of a src-family tyrosine kinase is capable of binding to a target molecule and a kinase domain is capable of phosphorylating a target molecule bound to the kinase.
- Members of the src family of tyrosine kinases are characterized by an N-terminal unique region followed by three regions that contain different degrees of homology among all the members of the family.
- src homology region 1 SHI
- SH2 src homology region 2
- SH3 src homology region 3
- SH2 and SH3 domains are believed to have protein association functions important for the formation of signal transduction complexes.
- the amino acid sequence of an N-terminal unique region varies between each src-family tyrosine kinase.
- An N-terminal unique region can be at least about the first 40 amino acid residues of the N-terminal of a src-family tyrosine kinase.
- Syk-family kinases are enzymes capable of phosphorylating tyrosine residues of a target molecule.
- a syk-family kinase contains one or more binding domains and a kinase domain.
- a binding domain of a syk-family tyrosine kinase is capable of binding to a target molecule and a kinase domain is capable of phosphorylating a target molecule bound to the kinase.
- Members of the syk- family of tyrosine kinases are characterized by two SH2 domains for protein association function and a tyrosine kinase domain.
- a primary target molecule is capable of further extending a signal transduction pathway by modifying a second messenger molecule.
- Primary target molecules can include, but are not limited to, phosphatidylinositol 3-kinase (PI-3K), P21 ras GAPase- activating protein and associated PI 90 and P62 protein, phospholipases such as PLC ⁇ l and PLC ⁇ 2, MAP kinase, She and VAV.
- PI-3K phosphatidylinositol 3-kinase
- P21 ras GAPase- activating protein and associated PI 90 and P62 protein phospholipases such as PLC ⁇ l and PLC ⁇ 2, MAP kinase, She and VAV.
- a primary target molecule is capable of producing second messenger molecule which is capable of further amplifying a transduced signal.
- Second messenger molecules include, but are not limited to diacylglycerol and inositol 1 ,4,5-
- Second messenger molecules are capable of initiating physiological events which can lead to alterations in gene transcription. For example, production of IP3 can result in release of intracellular calcium, which can then lead to activation of calmodulin kinase II, which can then lead to serine phosphorylation of a DNA binding protein referred to as ets-1 proto-onco- protein.
- Diacylglycerol is capable of activating the signal transduction protein, protein kinase C which affects the activity of the API DNA binding protein complex.
- Signal transduction pathways can lead to transcriptional activation of genes such as c-fos, egr- 1 , and c-myc.
- An adapter molecule comprises a protein that enables two other proteins to form a complex (e.g., a three molecule complex). She protein enables a complex to form which includes Grb2 and SOS. She comprises an SH2 domain that is capable of associating with the SH2 domain of Grb2.
- Molecules of a signal transduction pathway can associate with one another using recognition sequences.
- Recognition sequences enable specific binding between two molecules. Recognition sequences can vary depending upon the structure of the molecules that are associating with one another. A molecule can have one or more recognition sequences, and as such can associate with one or more different molecules.
- MIRR-induced signal transduction pathways can regulate the biological functions of specific types of cells involved in particular responses by an animal, such as immune responses, inflammatory responses and allergic responses.
- Cells involved in an immune response can include, for example, B cells, T cells, macrophages, dendritic cells, natural killer cells and plasma cells.
- Cells involved in inflammatory responses can include, for example, basophils, mast cells, eosinophils, neutrophils and macrophages.
- Cells involved in allergic responses can include, for example mast cells, basophils, B cells, T cells and macrophages.
- signal transduction is measured by detection of second messengers, such as a phosphorylatcd src-like protein, includes reporter constructs or indicator genes which include transcriptional regulatory elements such as serum response clement (SRE), 12-O-tetradecanoyl-phorbol-13-acetate response element, cyclic AMP response element, c- fos promoter, or a CREB-responsive element.
- SRE serum response clement
- cyclic AMP response element cyclic AMP response element
- c- fos promoter or a CREB-responsive element.
- Nuclear Receptors nuclear Receptors.
- the target receptor is a nuclear receptor.
- the nuclear receptors may be viewed as ligand-dependent transcription factors. These receptors provide a direct link between extracellular signals, mainly hormones, and transcriptional responses. Their transcriptional activation function is regulated by endogenous small molecules, such as steroid hormones, vitamin D, ecdysone, retinoic acids and thyroid hormones, which pass readily through the plasma membrane and bind their receptors inside the cell (Laudet and Adelmant (1995) Current Biology 5:124). The majority of these receptors appear to contain three domains: a variable amino terminal domain; a highly conserved, DNA-binding domain and a moderately conserved, carboxyl-terminal ligand-binding domain (Power et al.
- steroid hormone receptors bind exclusively as homodimers to a palindrome of their hormone responsive element
- nuclear receptors bind as heterodimers.
- some o ⁇ han receptors bind as monomers to similar response elements and require for their function a specific motif that is rich in basic amino-acid residues and is located corboxy-terminal to the DNA- binding domain (Laudet and Adelmant supra.)
- the subject assay utilizes a hormone-dependent reporter construct for selection.
- glucocorticoid response elements GREs
- TREs thyroid receptor enhancer-like DNA sequences
- GRE's are enhancer-like DNA sequences that confer glucocorticoid responsiveness via interaction with the glucocorticoid receptor. See Payvar, et al. (1983) Cell 35:381 and Schiedereit et al. (1983) Nature 304:749.
- TRE's are similar to GRE's except that they confer thyroid hormone responsiveness via interaction with thyroid hormone receptor.
- a steroid or thyroid hormone enters cells by facilitated diffusion and binds to its specific receptor protein, initiating an allosteric alteration of the protein.
- the hormone/receptor complex is capable of binding to certain specific sites on transcriptional regulatory sequence with high affinity.
- MMTV LTR mouse mammary tumor virus 5'-long terminal repeat
- the transcriptional control units for mammalian growth hormone genes responsive to glucocorticoids, estrogens, and thyroid hormones
- the transcriptional control units for mammalian prolactin genes and progesterone receptor genes responsive to estrogens
- the transcriptional control units for avian ovalbumin genes responsive to progesterones
- mammalian metallothionein gene transcriptional control units responsive to glucocorticoids
- mammalian hepatic alpha 2u -globulin gene transcriptional control units responsive to androgens, estrogens, thyroid hormones and glucocorticoids.
- Such steroid hormone and thyroid hormone responsive transcriptional control units can be used to generate reporter constructs or indicator genes which are sensitive to agonists and antagonists of the steroid hormone and/or thyroid hormone receptors. See, for example, U.S. Patents 5,298,429 and 5,071,773, both to Evans, et. al. Moreover, the art describes the functional expression of such receptors in yeast. See also for example, Caplan et al. (1995) J Biol Chem 270:5251-7; and Baniahmad et al. (1995) Mol Endocrinol 9: 34-43.
- the target receptor is a receptor tyrosine kinase.
- the receptor tyrosine kinases can be divided into five subgroups on the basis of structural similarities in their extracellular domains and the organization of the tyrosine kinase catalytic region in their cytoplasmic domains. Sub-groups I (epidermal growth factor (EGF) receptor-like), II (insulin receptor-like) and the eph eck family contain cysteine- rich sequences (Hirai et al., (1987) Science 238:1717-1720 and Lindberg and Hunter, (1990) Mol. Cell. Biol. 10:6316-6324).
- the functional domains of the kinase region of these three classes of receptor tyrosine kinases are encoded as a contiguous sequence ( Hanks et al. (1988) Science 241 :42-52).
- Subgroups III platelet-derived growth factor (PDGF) receptor-like) and IV (the fibro-blast growth factor (FGF) receptors) are characterized as having immunoglobulin (Ig)-like folds in their extracellular domains, as well as having their kinase domains divided in two parts by a variable stretch of unrelated amino acids (Yanden and Ullrich (1988) supra and Hanks et al. (1988) supra).
- the family with by far the largest number of known members is the EPH family. Since the description of the prototype, the EPH receptor (Hirai et al. (1987) Science 238:1717-1720), sequences have been reported for at least ten members of this family, not counting apparently orthologous receptors found in more than one species. Additional partial sequences, and the rate at which new members are still being reported, suggest the family is even larger (Maisonpierre et al. (1993) Oncogene 8:3277-3288; Andres et al. (1994) Oncogene 9: 1461 -1467; Henkemeyer et al. (1994) Oncogene 9:1001-1014; Ruiz et al.
- the expression patterns determined for some of the EPH family receptors have implied important roles for these molecules in early vertebrate development.
- the timing and pattern of expression ofsek, mek4 and some of the other receptors during the phase of gastrulation and early organogenesis has suggested functions for these receptors in the important cellular interactions involved in patterning the embryo at this stage (Gilardi-Hebenrison et al. (1992) Oncogene 7:2499-2506; Nieto et al. (1992) Development 1 16:1 137-1 150; Henkemeyer et al., supra; Ruiz et al., supra; and Xu et al., supra).
- Sek shows a notable early expression in the two areas of the mouse embryo that show obvious segmentation, namely the somites in the mesoderm and the rhombomeres of the hindbrain; hence the name sek, for segmentally expressed kinase (Gilardi-Hebenrison et al., supra; Nieto et al., supra).
- these segmental structures of the mammalian embryo are implicated as important elements in establishing the body plan.
- the observation that Sek expression precedes the appearance of mo ⁇ hological segmentation suggests a role for sek in forming these segmental structures, or in determining segment-specific cell properties such as lineage compartmentation (Nieto et al., supra).
- EPH receptors have been implicated, by their pattern of expression, in the development and maintenance of nearly every tissue in the embryonic and adult body. For instance, EPH receptors have been detected throughout the nervous system, the testes, the cartilaginous model of the skeleton, tooth primordia, the infundibular component of the pituitary, various epithelia tissues, lung, pancreas, liver and kidney tissues. Observations such as this have been indicative of important and unique roles for EPH family kinases in development and physiology, but further progress in understanding their action has been severely limited by the lack of information on their ligands.
- EPH receptor or "EPH-type receptor” refer to a class of receptor tyrosine kinases, comprising at least eleven paralogous genes, though many more orthologs exist within this class, e.g. homologs from different species.
- EPH receptors in general, are a discrete group of receptors related by homology and easily recognizable, e.g., they are typically characterized by an extracellular domain containing a characteristic spacing of cysteine residues near the N-terminus and two fibronectin type III repeats (Hirai et al. (1987) Science 238:1717-1720; Lindberg et al. (1990) Mol Cell Biol 10:6316-6324; Chan et al.
- Oncogene 6 1057-1061 ; Maisonpierre et al. (1993) Oncogene 8:3277-3288; Andres et al. (1994) Oncogene 9: 1461 -1467; Henkemeyer et al. (1994) Oncogene 9:1001 -1014; Ruiz et al. (1994) Mech Dev 46:87- 100; Xu et al. (1994) Development 120:287-299; Zhou et al. (1994) J Neurosci Res 37:129-143; and references in Tuzi and Gullick (1994) Br J Cancer 69:417-421).
- EPH receptors include the eph, elk, eck, sek, mek4, hek, hek2, eek, erk, tyro I, tyro4, tyroS, tyro ⁇ , tyroll, cek4, cek5, cek ⁇ , cek7, cek8, cek9, ceklO, bsk, rtkl, rtk2, rtki, mykl, myk2, ehkl, ehk2,pagliaccio, htk, erk and nuk receptors.
- EPH receptor refers to the membrane form of the receptor protein, as well as soluble extracellular fragments which retain the ability to bind the ligand of the present invention.
- the detection signal is provided by detecting phosphorylation of intracellular proteins, e.g., MEKKs, MEKs, or Map kinases, or by the use of reporter constructs or indicator genes which include transcriptional regulatory elements responsive to c-fos and/or c-jun. Described infra.
- G proteins One family of signal transduction cascades found in eukaryotic cells utilizes heterotrimeric "G proteins." Many different G proteins are known to interact with receptors. G protein signaling systems include three components: the receptor itself, a GTP-binding protein (G protein), and an intracellular target protein. The cell membrane acts as a switchboard. Messages arriving through different receptors can produce a single effect if the receptors act on the same type of G protein. On the other hand, signals activating a single receptor can produce more than one effect if the receptor acts on different kinds of G proteins, or if the G proteins can act on different effectors.
- G protein signaling systems include three components: the receptor itself, a GTP-binding protein (G protein), and an intracellular target protein. The cell membrane acts as a switchboard. Messages arriving through different receptors can produce a single effect if the receptors act on the same type of G protein. On the other hand, signals activating a single receptor can produce more than one effect if the receptor acts on different kinds of G
- the G proteins which consist of alpha ( ⁇ ), beta ( ⁇ ) and gamma ( ⁇ ) subunits, are complexed with the nucleotide guanosine diphosphate (GDP) and are in contact with receptors.
- GDP nucleotide guanosine diphosphate
- the receptor changes conformation and this alters its interaction with the G protein. This spurs the ⁇ subunit to release GDP, and the more abundant nucleotide guanosine triphosphate (GTP), replaces it, activating the G protein.
- GTP nucleotide guanosine triphosphate
- the effector (which is often an enzyme) in turn converts an inactive precursor molecule into an active "second messenger," which may diffuse through the cytoplasm, triggering a metabolic cascade.
- the G ⁇ converts the GTP to GDP, thereby inactivating itself.
- the inactivated G ⁇ may then reassociate with the G ⁇ complex.
- G protein-coupled receptors are comprised of a single protein chain that is threaded through the plasma membrane seven times. Such receptors are often referred to as seven-transmembrane receptors (STRs). More than a hundred different STRs have been found, including many distinct receptors that bind the same ligand, and there are likely many more STRs awaiting discovery.
- STRs seven-transmembrane receptors
- STRs have been identified for which the natural ligands are unknown; these receptors are termed "o ⁇ han” G protein-coupled receptors, as described above. Examples include receptors cloned by Neote et al. (1993) Cell 72, 415; Kouba et al. FEBSLett. (1993) 321, 173; Birkenbach et al.(1993) J Virol. 67, 2209.
- the "exogenous receptors" of the present invention may be any G protein-coupled receptor, preferably exogenous to the cell, which is to be genetically engineered for the pu ⁇ ose of the present invention.
- This receptor may be a plant or animal cell receptor. Screening for binding to plant cell receptors may be useful in the development of, e.g., herbicides.
- an animal receptor it may be of invertebrate or vertebrate origin. If an invertebrate receptor, an insect receptor is preferred, and would facilitate development of insecticides.
- the receptor may also be a vertebrate, more preferably a mammalian, still more preferably a human, receptor.
- the exogenous receptor is also preferably a seven transmembrane segment receptor.
- ligands for G protein coupled receptors include: purines and nucleotides, such as adenosine, cAMP, ATP, UTP, ADP, melatonin and the like; biogenic amines (and related natural ligands), such as 5-hydroxytryptamine, acetylcholine, dopamine, adrenaline, adrenaline, adrenaline., histamine, noradrenaline, noradrenaline, noradrenaline., tyramine/octopamine and other related compounds; peptides such as adrenocorticotrophic hormone (acth), melanocyte stimulating hormone (msh), melanocortins, neurotensin (nt), bombesin and related peptides, endothelins, cholecystokinin, gastrin, neurokinin b (nk3), invertebrate tachykinin-like peptides, substance k (nk2), substance p
- G-protein coupled receptors include, but are not limited to, dopaminergic, muscarinic cholinergic, a-adrenergic, b-adrenergic, opioid (including delta and mu), cannabinoid, serotoninergic, and GABAergic receptors.
- Preferred receptors include the 5HT family of receptors, dopamine receptors,C5a receptor and FPRL-1 receptor, cyclo-histidyl-prolinc-diketoplperazine receptors, melanocyte stimulating hormone release inhibiting factor receptor, and receptors for neurotensin, thyrotropin releasing hormone, calcitonin, cholecytokinin-A, neurokinin-2, histamine-3, cannabinoid, melanocortin, or adrenomodulin, neuropeptide- Yl or galanin.
- GPCRs G protein coupled receptors
- G protein-coupled receptors like the yeast a- and ⁇ -factor receptors, contain seven hydrophobic amino acid-rich regions which are assumed to lie within the plasma membrane.
- Specific human G protein-coupled STRs for which genes have been isolated and for which expression vectors could be constructed include those listed herein and others known in the art.
- the gene would be operably linked to a promoter functional in the cell to be engineered and to a signal sequence that also functions in the cell.
- suitable promoters include Ste2, Ste3 and gal 10.
- suitable signal sequences include those of Ste2, Ste3 and of other genes which encode proteins secreted by yeast cells.
- the codons of the gene would be optimized for expression in yeast. See Hoekema et al.,(1987) Mol. Cell. Biol., 7:2914-24; Sha ⁇ , et al., (1986)14:5125-43.
- STRs The homology of STRs is discussed in Dohlman et al., Ann. Rev. Biochem., (1991) 60:653-88. When STRs are compared, a distinct spatial pattern of homology is discernible. The transmembrane domains are often the most similar, whereas the N- and C-terminal regions, and the cytoplasmic loop connecting transmembrane segments V and VI are more divergent.
- the wild-type exogenous G protein-coupled receptor may be mutated for this pu ⁇ ose.
- a comparison would be made of the amino acid sequences of the exogenous receptor and of the yeast receptors, and regions of high and low homology identified. Trial mutations would then be made to distinguish regions involved in ligand or G protein binding, from those necessary for functional integration in the membrane.
- the exogenous receptor would then be mutated in the latter region to more closely resemble the yeast receptor, until functional integration was achieved. If this were insufficient to achieve functionality, mutations would next be made in the regions involved in G protein binding.
- a compatible G protein can be provided.
- a compatable G proein for use in the instant assays can include a heterologous or chimeric G protein subunit (or subunits) such as those described in the art (see e.g., PCT PCT/US94/03143) and as discussed in more detail below.
- the yeast genome is modified so that it is unable to produce the yeast receptors which are homologous to the exogenous receptors in functional form.
- N-formyl peptide receptor a classic example of a calcium mobilizing GPCR expressed by neutrophils and other phagocytic cells of the mammalian immune system (Snyderman et al. (1988) In Inflammation: Basic Principles and Clinical Correlates, pp. 309-323).
- N-formyl peptides of bacterial origin bind to the receptor and engage a complex activation program that results in directed cell movement, release of inflammatory granule contents, and activation of a latent NADPH oxidase which is important for the production of metabolites of molecular oxygen.
- This pathway initiated by receptor-ligand interaction is critical in host protection from pyogenic infections. Similar signal transduction occurs in response to the inflammatory peptides C5a and IL-8.
- FPRL formyl peptide receptor like
- FPRLl was found to be 69% identical in amino acid sequence to NFPR, it did not bind prototype N-formyl peptides ligands when expressed in heterologous cell types. This lead to the hypothesis of the existence of an as yet unidentified ligand for the FPRLl o ⁇ han receptor (Mu ⁇ hy et al. supra).
- the yeast cell In the case of an exogenous G-protein coupled receptor, the yeast cell must be able to produce a G protein which is activated by the exogenous receptor, and which can in turn activate the yeast effector(s).
- the endogenous yeast G ⁇ subunit e.g., GPA
- GPA endogenous yeast G ⁇ subunit
- the G ⁇ subunit of the yeast G protein may be replaced by the G ⁇ subunit natively associated with the exogenous receptor.
- the G ⁇ subunit may be modified to improve coupling. These modifications often will take the form of mutations which increase the resemblance of the G ⁇ subunit to the yeast G ⁇ while decreasing its resemblance to the receptor-associated G ⁇ . For example, a residue may be changed so as to become identical to the corresponding yeast G ⁇ residue, or to at least belong to the same exchange group of that residue. After modification, the modified G ⁇ subunit might or might not be "substantially homologous" to the foreign and/or the yeast G ⁇ subunit.
- the modifications are preferably concentrated in regions of the G ⁇ which are likely to be involved in G ⁇ binding.
- the modifications will take the form of replacing one or more segments of the receptor-associated G ⁇ with the corresponding yeast G ⁇ segment(s), thereby forming a chimeric G ⁇ subunit.
- point mutations may be sufficient.
- This chimeric G ⁇ subunit will interact with the exogenous receptor and the yeast G ⁇ complex, thereby permitting signal transduction. While use of the endogenous yeast G ⁇ is preferred, if a foreign or chimeric G ⁇ is capable of transducing the signal to the yeast effector, it may be used instead.
- G ⁇ structure is relevant to the design of modified G ⁇ subunits.
- the amino terminal 66 residues of GPA1 are aligned with the cognate domains of human Gas, Gai2, Gai3, Gal 6 and transducin.
- the amino terminal 41 residues (derived from GPA1) are identical, end with the sequence-LEKQRDKNE- and are underlined for emphasis. All residues following the glutamate (E) residue at position 41 are contributed by the human G ⁇ subunits, including the consensus nucleotide binding motif -GxGxxG-. Periods in the sequences indicate gaps that have been introduced to maximize alignments in this region. Codon bias is mammalian.
- GPAl G protein homolog of S. cerevisiae was cloned independently by Dietzel and Kurjan (supra) (SCG1) and by Nakafuku, et al. (1987 Proc Natl Acad Sci 84:2140-2144) (GPAl). Sequence analysis revealed a high degree of homology between the protein encoded by this gene and mammalian G ⁇ .
- GPAl encodes a protein of 472 amino acids, as compared with approximately 340-350 a.a. for most mammalian G ⁇ subunits in four described families, Gas, Gai, Gaq and G ⁇ l2/13. Nevertheless, GPAl shares overall sequence and structural homology with all G ⁇ proteins identified to date. The highest overall homology in GPAl is to the G ⁇ i family (48% identity, or 65% with conservative substitutions) and the lowest is to GQS (33% identity, or 51% with conservative substitutions) (Nakafuku, et al., supra).
- the regions of high sequence homology among G ⁇ subunits are dispersed throughout their primary sequences, with the regions sharing the highest degree of homology mapping to sequence that comprises the guanine nucleotide binding/GTPase domain.
- This domain is structurally similar to the ⁇ fold of ras proteins and the protein synthesis elongation factor EF-Tu.
- This highly conserved guanine nucleotide-binding domain consists of a six-stranded ⁇ sheet surrounded by a set of five ⁇ -helices. It is within these ⁇ sheets and ⁇ helices that the highest degree of conservation is observed among all G ⁇ proteins, including GPAl.
- G ⁇ subunits While the amino- and carboxy-termini of G ⁇ subunits do not share striking homology either at the primary, secondary, or tertiary levels, there are several generalizations that can be made about them.
- the amino termini of G ⁇ subunits have been implicated in the association of G ⁇ with G ⁇ complexes and in membrane association via N-terminal myristoylation.
- the carboxy-te ⁇ nini have been implicated in the association of G ⁇ heterotrimeric complexes with G protein-coupled receptors (Sullivan, et al. (1987) Nature 330:758-760); West, et al. (1985) J. Biol. Chem. 260:14428-14430); (Conklin, et al.
- Figure 1 shows the amino terminal 66 residues of GPAl aligned with the cognate domains of human Gas, Gai2, Gai3, Gal 6 and transducin.
- the amino terminal 41 residues (derived from GPAl) are identical, end with the sequence-LEKQRDKNE- (SEQ ID NO: 47). All residues following the glutamate (E) residue at position 41 are contributed by the human G ⁇ subunits, including the consensus nucleotide binding motif shown in the amino acid sequence -GxGxxG-. Periods in the sequences indicate gaps that have been introduced to maximize alignments in this region. Codon bias is mammalian.
- Mammalian G ⁇ subunits will be expressed using the native sequence of each subunit or, alternatively, as minimal gene fusions with sequences from the amino- terminus of GPAl replacing the homologous residues from the mammalian G ⁇ subunits.
- Mammalian G ⁇ subunits will be expressed from the GPAl promoter either on low copy plasmids or after integration into the yeast genome as a single copy gene.
- Endogenous G ⁇ subunits will be provided by the yeast STE4 and STE18 loci.
- random mutagenesis one can mutagenize an entire molecule or one can proceed by cassette mutagena ⁇ sis.
- the entire coding region of a molecule is mutagenized by one of several methods (chemical, PCR, doped oligonucleotide synthesis) and that collection of randomly mutated molecules is subjected to selection or screening procedures. Random mutagenesis can be applied in this way in cases where the molecule being studied is relatively small and there are powerful and stringent selections or screens available to discriminate between the different classes of mutant phenotypes that will inevitably arise.
- discrete regions of a protein corresponding either to defined structural (i.e.
- ⁇ -helices, ⁇ -sheets, turns, surface loops) or functional determinants are subjected to saturating or semi-random mutagenesis and these mutagenized cassettes are re-introduced into the context of the otherwise wild type allele.
- Cassette mutagenesis is most useful when there is experimental evidence available to suggest a particular function for a region of a molecule and there is a powerful selection and/or screening approach available to discriminate between interesting and uninteresting mutants.
- Cassette mutagenesis is also useful when the parent molecule is comparatively large and the desire is to map the functional domains of a molecule by mutagenizing the molecule in a step-wise fashion, i.e. mutating one linear cassette of residues at a time and then assaying for function.
- Random mutagenesis may be accomplished by many means, including:
- the random mutagenesis may be focused on regions suspected to be involved in G ⁇ -G ⁇ association as discussed in the next section. Random mutagenesis approaches are feasible for two reasons. First, in yeast one has the ability to construct stringent screens and facile selections (growth vs. death, transcription vs. lack of transcription) tha* are not readily available in mammalian systems. Second, when using yeast it is possible to screen efficiently through thousands of transformants rapidly. Cassette mutagenesis is immediately suggested by the observation (see infra) that the GPA4 ] hybrids couple to the pheromone response pathway. This relatively small region of G ⁇ subunits represents a reasonable target for this type of mutagenesis.
- Another region that may be amenable to cassette mutagenesis is that defining the surface of the switch region of G ⁇ subunits that is solvent-exposed in the crystal structures of G ⁇ i and transducin. From the data described below, this surface may contain residues that are in direct contact with yeast G ⁇ subunits, and may therefore be a reasonable target for mutagenesis.
- the first, and largest, class of hybrids are those that encode different lengths of the GPAl amino terminal domain in place of the homologous regions of the mammalian G ⁇ subunits.
- This class of hybrid molecules includes GPA ⁇ AMHl ⁇ > GPA4], GPAJIJ, and GPALW hybrids, described below.
- the rationale for constructing these hybrid G ⁇ proteins is based on results, described above, that bear on the importance of the amino terminal residues of G ⁇ in mediating interaction with G ⁇ .
- the yeast G ⁇ subunit is replaced by a chimeric G ⁇ subunit in which a portion, e.g., at least about 20, more preferably at least about 40, amino acids, which is substantially homologous with the corresponding residues of the amino terminus of the yeast G ⁇ , is fused to a sequence substantially homologous with the main body of a mammalian (or other exogenous) G ⁇ . While 40 amino acids is the suggested starting point, shorter or longer portions may be tested to determine the minimum length required for coupling to yeast G ⁇ and the maximum length compatible with retention of coupling to the exogenous receptor. It is presently believed that only the final 10 or 20 amino acids at the carboxy terminus of the G ⁇ subunit are required for interaction with the receptor.
- G ⁇ and G ⁇ subunits are known to interact via ⁇ - helical domains at their respective amino-termini (Pronin, et al. (1992) Proc. Natl. Acad. Sci. USA 89:6220- 6224); Garritsen, et al.1993).
- GPA41 hybrids that have been constructed and tested include Gas, Gai2, Gai3, Gaq, Gao a , G ⁇ o ⁇ and G ⁇ l6. Hybrids of Gas, Gai2, Gai3, and G ⁇ l 6 functionally complement the growth arrest phenotype of gpal strains, while GPA4 [ hybrids of G ⁇ o a and G ⁇ ot ⁇ do not. In addition to being tested in a growth arrest assay, these constructs have been assayed in the more sensitive transcriptional assay for activation of a fuslp-HIS3 gene.
- the GPA4j-G ⁇ s hybrid couples less well than the GP ⁇ 4j-i2, -i3, and -16 hybrids, while the GP ⁇ 4j -o a , and -0 ⁇ hyrids do not function in either assay.
- the prediction is that the structural repeat unit in the amino terminal domain up to the tetra-leucine motif is 7, and that swapping sequences in units of 7 will in effect amount to a swap of unit turns of turns of the helical structure that comprises this domain.
- a second group of "double crossover'" hybrids of this class are those that are aligned on the first putative heptad repeat beginning with residue GI 1 in GPAl .
- helical repeats are swapped from GPAl into a GaS backbone one heptad repeat unit at a time.
- the gap that is introduced between residues 9 and 10 in the GaS sequence is to preserve the alignment of the -LLLLGAGE- (amino acids 1-8 of SEQ ID NO: 46) sequence motif.
- This class of hybrids can be complemented by cassette mutagenesis of each heptad repeat followed by screening of these collections of "heptad” libraries in standard coupling assays.
- a third class of hybrids based on the prediction that the amino terminus forms a helical domain with a heptahelical repeat unit are those that effect the overall hydrophobic or hydrophilic character of the opposing sides of the predicted helical structure (See Lupas et al. supra).
- the ⁇ and d positions of the heptad repeat abcdefg are found to be conserved hydrophobic residues that define one face of the helix, while the e and g positions define the charged face of the helix.
- the sequence of the GaS parent is maintained except for specific substitutions at one or more of the following critical residues to render the different helical faces of GaS more "GPAl -like" K8Q +1-10 EIOG Q12E R13S N14D E15P E15F
- This collection of single mutations could be screened for coupling efficiency to yeast G ⁇ and then constructed in combinations (double and greater if necessary).
- a fourth class of hybrid molecules that span this region of GPAl -G ⁇ hybrids are those that have junctions between GPAl and G ⁇ subunits introduced by three primer PCR.
- the two outside primers are encoded by sequences at the initiator methionine of GPAl on the 5' side and at the tetraleucine motif of G ⁇ S (for example) on the 3' side.
- a series of junctional primers spanning different junctional points can be mixed with the outside primers to make a series of molecules each with different amounts of GPAl and G ⁇ S sequences, respectively.
- GPAjp and GPA ⁇ Ay hybrids The regions of high homology among G ⁇ subunits that have been identified by sequence alignment are interspersed throughout the molecule.
- the GI region containing the highly conserved -GSGESGDST- motif is followed immediately by a region of very low sequence consevation, the "il" or insert 1 region. Both sequence and length vary considerably among the il regions of the G ⁇ subunits.
- the GPATD hybrids encode the amino terminal 102 residues of GPAl (up to the sequence -QARKLGIQ-) fused in frame to mammalian G ⁇ subunits, while the GPALW hybrids encode the amino terminal 244 residues of GPAl (up to the sequence - LIHEDIAKA- in GPAl).
- the reason for constructing the GPAJD and GPALW hybrids was to test the hypothesis that the il region of GPAl is required for mediating the interaction of GPAl with yeast G ⁇ subunits, for the stable expression of the hybrid molecules, or for function of the hybrid molecules.
- the GPAJD hybrids contain the amino terminal domain of GPAl fused to the il domain of mammalian subunits, and therefore do not contain the GPAl il region, while the GPAL hybrids contain the amino terminal 244 residues of GPAl including the entire il region (as defined by sequence alignments).
- Hybrids of both GP ⁇ ir) and GPAL"VV classes were constructed for G ⁇ S, C- ⁇ i2, G ⁇ i3, G ⁇ o a , and G ⁇ l6; none of these hybrids complemented the gpal growth arrest phenotype.
- the crystal structures reveal that the ilregion defined by sequence alignment has a conserved structure that is comprised of six alpha helices in a rigid array, and that the junctions chosen for the construction of the GPAjj) and GPALW hybrids were not compatible with conservation of the structural features of the il region observed in the crystals.
- the junction chosen for the GPAJD hybrids falls in the center of the long ⁇ A helix; chimerization of this helix in all likelihood destabilizes it and the protein structure in general.
- the same is true of the junction chosen for the GPALW hybrids in which the crossover point between GPA 1 and the mammalian G ⁇ subunit falls at the end of the short ⁇ C helix and therefore may distort it and destabilize the protein.
- This hybrid contains the entire il insert of GPAl inte ⁇ osed into the G ⁇ S sequence.
- This hybrid contains the amino terminal 41 residues of GPAl in place of the 42 amino terminal residues of G ⁇ S found in Hybrid A.
- this mutation In addition to blocking the conformational change that occurs upon GTP binding, this mutation also prevents dissociation of GTP-liganded Gas from G ⁇ .
- crosslinking data reveals that a highly conserved cysteine residue in the ⁇ 2 helix (C215 in G ⁇ o, C210 in G ⁇ t) can be crosslinked to the carboxy terminal region of G ⁇ subunits.
- genetic evidence (Whiteway et al. (1993) Mol Cell Biol. 14:3233-3239) identifies an important single residue in GPAl (E307) in the ⁇ 2 sheet of the core structure that may be in direct contact with ⁇ .
- a mutation in the GPAl protein at this position suppresses the constitutive signalling phenotype of a variety of STE4 (G ⁇ ) dominant negative mutations that are also known to be defective in G ⁇ -G ⁇ association (as assessed in two-hybrid assay in yeast as well as by more conventional genetic tests).
- the role of the surface-exposed residues of this region may be crucial for effective coupling to yeast G ⁇ , and can be inco ⁇ orated into hybrid molecules as follows below.
- G ⁇ S-GPA-Switch G ⁇ S l-202/GPA298-350/G ⁇ S 253-394 This hybrid encodes the entire switch region of GPA 1 in the context of GaS.
- This hybrid encodes the v- helix of GPAl in the context of G ⁇ S.
- This hybrid encodes the 41 residue amino terminal domain of GPAl and the ⁇ 2 helix of GPAl in the context of G ⁇ S.
- hybrid G ⁇ subunits that couple to the yeast pheromone pathway has led to the following general observations.
- hybrids of yeast GPAl and a mammalian Gas have been described, it will be appreciated that hybrids may be made of other yeast G ⁇ subunits and/or other mammalian G ⁇ subunits, notably mammalian G ⁇ i subunits.
- hybrids are constructed from two parental proteins, hybrids of three or more parental proteins are also possible.
- chimeric G ⁇ subunits have been especially useful in coupling receptors to G ⁇ i species.
- Kang et al. supra reported that several classes of native mammalian G ⁇ subunits were able to interact functionally with yeast ⁇ subunits when expression of G ⁇ was driven from a constitutively active, strong promoter (PGK) or from a strong inducible promoter (CUP). These authors reported that rat G ⁇ S, G ⁇ i2 or G ⁇ o expressed at high level coupled to yeast ⁇ . High level expression of mammalian G ⁇ (i.e. non-stoichiometric with respect to yeast ⁇ ) is not desirable for uses like those described in this application. Reconstruction of G protein- coupled receptor signal transduction in yeast requires the signalling component of the heterotrimeric complex (G ⁇ ) to be present stoichiometrically with G ⁇ subunits.
- G ⁇ heterotrimeric complex
- G ⁇ subunits An excess of G ⁇ subunits (as was required for coupling of mammalian G ⁇ i2 and G ⁇ o to yeast G ⁇ in Kang et al.) would dampen the signal in systems where G ⁇ subunits transduce the signal. An excess of G ⁇ subunits raises the background level of signaling in the system to unacceptably high levels. Preferably, levels of G ⁇ and G ⁇ subunits are balanced.
- heterologous G ⁇ subunits may be expressed from a low copy (CEN ARS) vector containing the endogenous yeast GPAl promoter and the GPAl 3' untranslated region.
- heterologous G ⁇ subunit The minimum criterion, applied to a heterologous G ⁇ subunit with respect to its ability to couple functionally to the yeast pheromone pathway, is that it complement a gpal genotype when expressed from the GPAl promoter on low copy plasmids or from an integrated, single copy gene.
- all heterologous G ⁇ subunits have been assayed in two biological systems.
- heterologous G ⁇ subunits are tested for an ability to functionally complement the growth arrest phenotype of gpal strains.
- the transcription of a fusl-HIS3 reporter gene is used to measure the extent to which the pheromone response pathway is activated, and hence the extent to which the heterologous G ⁇ subunit sequesters the endogenous yeast G ⁇ complex.
- Mammalian Gas, Gai2, Gai3, Gaq, Gal 1 , Gal6, Gao a , G ⁇ ot ⁇ , and G ⁇ z from rat, murine or human origins were expressed from a low copy, CEN ARS vector containing the GPAl promoter. Functional complementation of gpal strains was not observed in either assay system with any of these full-length G ⁇ constructs with the exception of rat and human G ⁇ S.
- the yeast Ste4p G ⁇ subunit can be targetedwith cassette mutagenesis.
- the region of Ste4p that encodes several of the dominant negative, signaling-defective mutations would be an excellent target for cassette mutagenesis when looking for coupling of yeast G ⁇ to specific mammalian G ⁇ subunits.
- a recent trend in medicinal chemistry includes the production of mixtures of compounds, referred to as libraries. While the use of libraries of peptides is well established in the art, new techniques have been developed which have allowed the production of mixtures of other compounds, such as benzodiazepines (Bunin et al. 1992. J. Am. Chem. Soc. 1 14:10987; DeWitt et al. 1993. Proc. Natl. Acad. Sci. USA 90:6909) peptoids (Zuckermann. 1994. J. Med. Chem. 37:2678) oligocarbamates (Cho et al. 1993. Science. 261 :1303), and hydantoins (DeWitt et al. supra).
- the compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the 'one-bead one-compound' library method, and synthetic library methods using affinity chromatography selection.
- biological libraries include biological libraries; spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the 'one-bead one-compound' library method, and synthetic library methods using affinity chromatography selection.
- the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K.S. Anticancer Drug Des. 1997. 12:145).
- test compound is a peptide or peptidomimetic.
- compounds are small, organic non-peptidic compounds.
- the test compounds are exogenously added to the yeast cells expressing a recombinant receptor and compounds that modulate signal transduction via the receptor are selected.
- the yeast cells express the compounds to be tested.
- a culture of the subject yeast cells can be further modified to collectively express a peptide library as described in more detail in PCT Publication WO 94/23025 the contents of which is expressly inco ⁇ orated herein by this reference.
- combinatorial polypeptide libraries may also be expressed, see, for example, U.S. Patents 5,270,181 and 5,292,646; and PCT publication WO94/ 02502).
- the combinatorial polypeptides are produced from a cD ⁇ A library.
- Exemplary compounds which can be screened for activity include, but are not limited to, peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries. In such embodiments, both compounds which agonize or antagonize the receptor- or channel-mediated signaling function can be selected and identified.
- yeast cells can be engineered to produce the compounds to be tested.
- This assay system has the advantage of increasing the effective concentration of the compound to be tested.
- a method such as that described in WO 94/23025 can be utilized.
- peptide libraries are systems which simultaneously display, in a form which permits interaction with a target, a highly diverse and numerous collection of peptides. These peptides may be presented in solution (Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull et al.
- the screening is for binding in vitro to an artificially presented target, not for activation or inhibition of a cellular signal transduction pathway in a living cell. While a cell surface receptor may be used as a target, the screening will not reveal whether the binding of the peptide caused an allosteric change in the conformation of the receptor.
- the Ladner et al. patent, USSN 5,096,815, describes a method of identifying novel proteins or polypeptides with a desired DNA binding activity.
- Semi-random (“variegated") DNA encoding a large number of different potential binding proteins is introduced, in expressible form, into suitable yeast cells.
- the target DNA sequence is inco ⁇ orated into a genetically engineered operon such that the binding of the protein or polypeptide will prevent expression of a gene product that is deleterious to the gene under selective conditions. Cells which survive the selective conditions are thus cells which express a protein which binds the target DNA. While it is taught that yeast cells may be used for testing, bacterial cells are preferred.
- the compounds tested are in the form of peptides from a peptide library.
- the peptide library of the present invention takes the form of a cell culture, in which essentially each cell expresses one, and usually only one, peptide of the library. While the diversity of the library is maximized if each cell produces a peptide of a different sequence, it is usually prudent to construct the library so there is some redundancy.
- the combinatorial peptides of the library can be expressed as is, or can be inco ⁇ orated into larger fusion proteins.
- the fusion protein can provide, for example, stability against degradation or denaturation, as well as a secretion signal if secreted.
- the polypeptide library is expressed as thioredoxin fusion proteins (see, for example, U.S. Patents 5,270,181 and 5,292,646; and PCT publication WO94/ 02502).
- the combinatorial peptide can be attached one the terminus of the thioredoxin protein, or, for short peptide libraries, inserted into the so-called active loop.
- the peptide library is derived to express a combinatorial library of polypeptides which are not based on any known sequence, nor derived from cDNA. That is, the sequences of the library are largely random.
- the combinatorial polypeptides are in the range of 3-100 amino acids in length, more preferably at least 5-50, and even more preferably at least 10, 13, 15, 20 or 25 amino acid residues in length.
- the polypeptides of the library are of uniform length. It will be understood that the length of the combinatorial peptide does not reflect any extraneous sequences which may be present in order to facilitate expression, e.g., such as signal sequences or invariant portions of a fusion protein.
- the peptide library is derived to express a combinatorial library of polypeptides which are based at least in part on a known polypeptide sequence or a portion thereof (not a cDNA library). That is, the sequences of the library is semi- random, being derived by combinatorial mutagenesis of a known sequence.
- sequences of the library is semi- random, being derived by combinatorial mutagenesis of a known sequence. See, for example, Ladner et al. PCT publication WO 90/02909; Garrard et al., PCT publication WO 92/09690; Marks et al. (1992) J. Biol. Chem. 267:16007-16010; Griffths et al. (1993) EMBO J 12:725-734; Clackson et al.
- polypeptide(s) which are known ligands for a target receptor can be mutagenized by standard techniques to derive a variegated library of polypeptide sequences which can further be screened for agonists and/or antagonists.
- the surrogate ligand identified for FPRL-1 e.g., the Ser-Leu- Leu-T ⁇ -Leu-Thr-Cys-Arg-Pro-T ⁇ -Glu-Ala-Met peptide
- This library can be expressed in a reagent cell of the present invention, and other receptor activators can be isolated from the library. This may permit the identification of even more potent FPRL-1 surrogate ligands.
- the library can be expressed under conditions wherein the cells are in contact with the original tridecapeptide, e.g., the FPRL-1 receptor is being induced by that surrogate ligand.
- Peptides from an expressed library can be isolated based on their ability to potentiate the induction, or to inhibit the induction, caused by the surrogate ligand. The latter of course will identify potential antagonists of chemoattractant receptors.
- the surrogate ligand can be used to screen exogenous compound libraries (peptide and non-peptide) which, by modulating the activity of the identified surrogate, will presumably also similarly effect the native ligand's effect on the target receptor.
- the surrogate ligand can be applied to the cells, though is preferably produced by the reagent cell, thereby providing an autocrine cell.
- the combinatorial polypeptides are produced from a cDNA library.
- the yeast cells collectively produce a "peptide library", preferably including at least I O 3 to IO 7 different peptides, so that diverse peptides may be simultaneously assayed for the ability to interact with the exogenous receptor.
- a "peptide library” preferably including at least I O 3 to IO 7 different peptides, so that diverse peptides may be simultaneously assayed for the ability to interact with the exogenous receptor.
- at least some peptides of the peptide library are secreted into the periplasm, where they may interact with the "extracellular" binding site(s) of an exogenous receptor. They thus mimic more closely the clinical interaction of drugs with cellular receptors.
- This embodiment optionally may be further improved (in assays not requiring pheromone secretion) by preventing pheromone secretion, and thereby avoiding competition between the peptide and the pheromone for signal peptidase and other components of the secretion system.
- the peptides of the library are encoded by a mixture of DNA molecules of different sequence.
- Each peptide-encoding DNA molecule is ligated with a vector DNA molecule and the resulting recombinant DNA molecule is introduced into a yeast cell. Since it is a matter of chance which peptide encoding DNA molecule is introduced into a particular cell, it is not predictable which peptide that cell will produce. However, based on a knowledge of the manner in which the mixture was prepared, one may make certain statistical predictions about the mixture of peptides in the peptide library.
- the peptides of the library can be composed of constant and variable residues. If the nth residue is the same for all peptides of the library, it is said to be constant. If the nth residue varies, depending on the peptide in question, the residue is a variable one.
- the peptides of the library will have at least one, and usually more than one, variable residue.
- a variable residue may vary among any of two to all twenty of the genetically encoded amino acids; the variable residues of the peptide may vary in the same or dif- ferent manner.
- the frequency of occurrence of the allowed amino acids at a particular residue position may be the same or different.
- the peptide may also have one or more constant residues.
- the DNAs are synthesized a base at a time.
- a suitable mixture of nucleotides is reacted with the nascent DNA, rather than the pure nucleotide reagent of conventional polynucleotide synthesis.
- the second method provides more exact control over the amino acid variation.
- trinucleotide reagents are prepared, each trinucleotide being a codon of one (and only one) of the amino acids to be featured in the peptide library.
- a mixture is made of the appropriate trinucleotides and reacted with the nascent DNA.
- Yeast cells are bounded by a lipid bilayer called the plasma membrane. Between this plasma membrane and the cell wall is the periplasmic space. Peptides secreted by yeast cells cross the plasma membrane through a variety of mechanisms and thereby enter the periplasmic space. The secreted peptides are then free to interact with other molecules that are present in the periplasm or displayed on the outer surface of the plasma membrane. The peptides then either undergo re-uptake into the cell, diffuse through the cell wall into the medium, or become degraded within the periplasmic space.
- the test polypeptide library may be secreted into the periplasm by any of a number of exemplary mechanisms, depending on the nature of the expression system to which they are linked.
- the peptide may be structurally linked to a yeast signal sequence, such as that present in the ⁇ -factor precursor, which directs secretion through the endoplasmic reticulum and Golgi apparatus. Since this is the same route that the receptor protein follows in its journey to the plasma membrane, opportunity exists in cells expressing both the receptor and the peptide library for a specific peptide to interact with the receptor during transit through the secretory pathway. This has been postulated to occur in mammalian cells exhibiting autocrine activation.
- Such interaction could yield activation of the response pathway during transit, which would still allow identification of those cells expressing a peptide agonist.
- this system would still be effective, since both the peptide antagonist and receptor would be delivered to the outside of the cell in concert.
- those cells producing an antagonist would be selectable, since the peptide antagonist would be properly and timely situated to prevent the receptor from being stimulated by the externally applied agonist.
- An alternative mechanism for delivering peptides to the periplasmic space is to use the ATP-dependent transporters of the STE6/MDR1 class.
- This transport pathway and the signals that direct a protein or peptide to this pathway are not as well characterized as is the endoplasmic reticulum-based secretory pathway. Nonetheless, these transporters apparently can efficiently export certain peptides directly across the plasma membrane, without the peptides having to transit the ER/Golgi pathway. It is anticipated that at least a subset of peptides can be secreted through this pathway by expressing the library in context of the a-factor prosequence and terminal tetrapeptide.
- this system is that the receptor and peptide do not come into contact until both are delivered to the external surface of the cell. Thus, this system strictly mimics the situation of an agonist or antagonist that is normally delivered from outside the cell. Use of either of the described pathways is within the scope of the invention.
- the present invention does not require periplasmic secretion, or, if such secretion is provided, any particular secretion signal or transport pathway.
- test compounds to modulate a signal transduction activity of the receptor of interest can be scored for by detecting up or down-regulation of a detection signal.
- alterations in the endogenous yeast second messenger generation e.g. GTPase activity, phospholipid hydrolysis, or protein phosphorylation patterns or enzyme activity
- an indicator gene or a heterologous reporter gene can provide a convenient readout.
- a change in the detection signal can be used to facilitate identification of compounds which modulate signaling via the receptor.
- changes in intracellular second messenger pathways can be detected biochemically, i.e., by measuring changes in second messengers produced by the modulation of an endogenous yeast signaling pathway.
- changes in intracellular Ca +2 , phophorylation states of proteins, activities of intracellular enzymes, and the like can be detected.
- Still other detection techniques include mico ⁇ hysiometric devices which permit detection of small changes in, e.g., ions or intracellular pH.
- modulation of, e.g., adenylyl cyclase, cyclic GMP, phosphodiesterases, phosphoinositidases, phosphoinositol kinases, and phospholipases, as well as a variety of ions can be assayed.
- the GTPase enzymatic activity by G proteins can be measured in plasma membrane preparations by determining the breakdown of ⁇ 2p GTP using techniques that are known in the art (For example, see Signal Transduction: A Practical Approach. G. Milligan, Ed. Oxford University Press, Oxford England). When receptors that modulate cAMP are tested, it will be possible to use standard techniques for cAMP detection, such as competitive assays which quantitate [ ⁇ HjcAMP in the presence of unlabelled cAMP.
- Inositol lipids can be extracted and analyzed using standard lipid extraction techniques. DAG can also be measured using thin-layer chromatography. Water soluble derivatives of all three inositol lipids (IP1, IP2, IP3) can also be quantitated using radiolabelling techniques or HPLC.
- DAG can also be produced from phosphatidyl choline.
- the breakdown of this phospholipid in response to receptor- mediated signaling can also be measured using a variety of radiolabelling techniques.
- the activation of phospholipase A2 can easily be quantitated using known techniques, including, for example, the generation of arachadonate in the cell.
- phosphorylation in other embodiments, e.g., in the case of certain receptors and ion channels, it may be desirable to screen for changes in cellular phosphorylation.
- Such assay formats may be useful when the receptor of interest is a receptor kinase or phosphatase.
- immunoblotting (Lyons and Nelson (1984) Proc. Natl. Acad. Sci. USA 81 .7426-7430) using anti-phosphotyrosine, anti-phosphoserine or anti-phosphothreonine antibodies.
- tests for phosphorylation could be also useful when the receptor itself may not be a kinase, but activates protein kinases or phosphatase that function downstream in the signal transduction pathway.
- MAP kinase pathway that appears to mediate both mitogenic, differentiation and stress responses in different cell types. Stimulation of growth factor receptors results in Ras activation followed by the sequential activation of c-Raf, MEK, and p44 and p42 MAP kinases (ERKl and ERK2). Activated MAP kinase then phosphorylates many key regulatory proteins, including p90RSK and Elk-1 that are phosphorylated when MAP kinase translocates to the nucleus. Homologous pathways exist in mammalian and yeast cells. For instance, an essential part of the S.
- cerevisiae pheromone signaling pathway is comprised of a protein kinase cascade composed of the products of the STE1 1, STE7, and FUS3/KSS1 senes (the latter pair are distinct and functionally redundant). Accordingly, phosphorylation and/or activation of members of this kinase cascade can be detected and used to quantitate receptor engagement.
- Phosphotyrosine specific antibodies are available to measure increases in tyrosine phosphorylation and phospho-specific antibodies are commercially available (New England Biolabs, Beverly, MA).
- the detectable signal can be produced by use of enzymes or chromogenic/fluorescent probes whose activities are dependent on the concentration of a second messenger, e.g., such as calcium, hydrolysis products of inositol phosphate, cAMP, etc.
- a second messenger e.g., such as calcium, hydrolysis products of inositol phosphate, cAMP, etc.
- the mobilization of intracellular calcium or the influx of calcium from outside the cell can be measured using standard techniques.
- the choice of the appropriate calcium indicator, fluorescent, bioluminescent, metallochromic, or Ca++-sensitive microelectrodes depends on the cell type and the magnitude and time constant of the event under study (Borle (1990) Environ Health Perspect 84:45-56).
- Ca++ detection cells could be loaded with the Ca++sensitive fluorescent dye fura-2 or indo-1 , using standard methods, and any change in Ca++ measured using a fluorometer.
- the signal transduction activity of a receptor can be measured by detection of a transcription product, e.g., by detecting receptor/channel-mediated transcriptional activation (or repression) of an endogenous gene(s).
- Detection of the transcription product includes detecting the gene transcript, detecting the product directly (e.g., by immunoassay) or detecting an activity of the protein (e.g., such as an enzymatic activity or chromogenic/fluorogenic activity); each of which is generally referred to herein as a means for detecting expression of the indicator gene.
- the indicator gene may be an unmodified endogenous gene of the yeast cell or a modified endogenous gene.
- the indicator gene is an unmodified endogenous gene.
- the instant method can rely on detecting the transcriptional level of such pheromone system pathway responsive endogenous genes as the Bar I or Fusl, Fus 2, mating factor, Ste3 Ste 3, Kexl, Ste2, Ste ⁇ , Ste7, sSst2, or Chsl . (Appletauer and Zchstetter. 1989. Eur. J. Biochem. 181 :243)
- the sensitivity of an endogenous indicator gene can be enhanced by manipulating the promoter sequence at the natural locus for the indicator gene. Such manipulation may range from point mutations to the endogenous regulatory elements to gross replacement of all or substantial portions of the regulatory elements.
- the promoter of the gene can be modified to enhance the transcription of Barl upon activation of the yeast pheromone system pathway.
- Barl gene transcription is iactivated upon exposure of yeast cells to mating factor.
- the sequence of the Barl gene is known in the art (see e.g., U.S. patent 4,613,572).
- sequences required for ⁇ -factor-enhanced expression of the Barl , and other pheromone responsive genes have been identified. (Appeltauer and Achstetter 1989. Eur. J. Biochem. 181 :243; Hagen et al. 1991. Mol. Cell. Biol. 1 1 :2952).
- the yeast Barl promoter can be engineered by mutagenesis to be more responsive, e.g., to more strongly promoter gene transcription, upon stimulation of the yeast pheromone pathway. Standard techniques for mutagenizing the promoter can be used. In such embodiments, it is desirable that the conserved oligonucleotide motif described by Appeltaure et al. be conserved.
- the endogenous Barl promoter of a yeast cell can be replaced, e.g., by homologous recombination, with a Barl promoter engineered to cause higher levels of expression oi Barl upon pheromone stimulation.
- the promoter (or other transcriptional regulatory sequences) of the endogenous gene can be "switched out" with a heterologous promoter sequence, e.g., to form a chimeric gene at the indicator endogenous gene locus.
- the regulatory sequence can be so altered at the genomic locus of the indicator gene.
- the Barl promoter can be replaced, at the Barl locus, with the promoter for the fusl (o ⁇ fus2) gene.
- the fusl promoter has a higher responsiveness to stimulation by pheromone induction than the Barl promoter and, accordingly can increase the signal-to-noise and dynamic range of the indicator gene.
- ⁇ iefusl and fusl have been substituted for promoters at other loci, such as for the canl promotor. These strains become canavanine sensitive upon expression of the canl gene.
- a similar approach was used to introduce the fusl and fus2 promoter upstream of the ura3 gene in place of the ura3 promoter, thus conferring uracil prototrophy in a manner dependent on activation of the yeast pheromone signal pathway.
- the fus I and w ⁇ -2 promoter regions can be introduced upstream of other genes in order to control their expresion: gall (confering deoxygalactose sensitivity or galactose sensitivity due to the concomitant loss of the gal 10 gene); ⁇ -D-glucanase (exgl: an easily assayed extracellular enzyme); chitinase (ctsl); asparaginase (ast3: hydrolyzes asparagine to ammonia and aspartate); and invertase (suc2); secreted acid phosphatase (pho3 o ⁇ phoS).
- the transcriptional activation ability of the signal pathway can be amplified by the overexpression of one or more of the proteins involved in the intracellular signal cascade, particularly enzymes involved in the pathway. For example, increased expression of Jun kinases (JNKs) can potentiate the level of transcriptional activation by a signal in an MEKK/JNKK pathway.
- JNKs Jun kinases
- overexpression of one or more signal transduction proteins in the yeast pheromone pathway can increase the level of Fus 1 , Fus 2 and/or Barl expression.
- This approach can also be used to potentiate the level of transcription of a heterologous reporter gene (described below) as well.
- the activity of endogenous yeast proteins can be assayed.
- the signal transduction pathway of the receptor upregulates expression or otherwise activates an enzyme which is capable of modifying a substrate which can be added to the cell.
- the signal can be detected by using a detectable substrate, in which case loss of the substrate signal is monitored, or alternatively, by using a substrate which produces a detectable product.
- the substrate is naturally occurring. Alternatively, the substrate can be non-naturally occurring.
- the enzyme which cleaves the substrate peptide is the product of the BARl gene, the expression of which is upregulated by stimulation of the yeast pheromone pathway.
- yeast cells which have been generated to exploit the pheromone signal pathway for detection can be contacted with a suitable detection means, i.e., a substrate peptide which can be cleaved by BARl to release a detectable fragment, e.g. a detectably labeled fragment, and the level of BARl activity thus determined.
- Alterations in enzyme activity mediated by the interaction of a test compound and a receptor can be detected by a number of means.
- the conversion of the substrate is measured using a semi-quantitative plate assay to measure BARl p activity as described in Example 2.
- cells which lack endogenous BARl referred to as a "test yeast strain” can be grown in an appropriate medium. The overnight cultures can then be poured onto medium containing ⁇ -factor, allowed to stand a few minutes and poured off. This results in the formation of a confluent and even lawn of test cells. Since the plated lawn of cells lacks the BARl gene, it is super-sensitive to ⁇ -factor causing its growth to be arrested on the ⁇ -factor plate.
- the conversion of the substrate to product by the enzyme produces a detectable change in optical characteristics of the test cell, e.g., the substrate and/or product is chromogenically or fluorogenically active.
- the signal transduction pathway causes a change in the activity of a proteolytic enzyme, altering the rate at which it cleaves a substrate peptide (or simply activates the enzyme towards the substrate).
- the substrate peptide can include a fluorogenic donor radical, e.g., a fluorescence emitting radical, and an acceptor radical, e.g., an aromatic radical which absorbs the fluorescence energy of the fluorogenic donor radical when the acceptor radical and the fluorogenic donor radical are covalently held in close proximity.
- the substrate peptide has a fluorescence donor group such as 1-aminobenzoic acid (anthranilic acid or ABZ) or aminomethylcoumarin (AMC) located at one position on the peptide and a fluorescence quencher group, such as lucifer yellow, methyl red or nitrobenzo-2-oxo-l,3-diazolc (NBD), at a different position near the distal end of the peptide.
- a fluorescence donor group such as 1-aminobenzoic acid (anthranilic acid or ABZ) or aminomethylcoumarin (AMC) located at one position on the peptide and a fluorescence quencher group, such as lucifer yellow, methyl red or nitrobenzo-2-oxo-l,3-diazolc (NBD), at a different position near the distal end of the peptide.
- a cleavage site for the activated enzyme will be disposed between each of the sites for the donor and acceptor groups.
- the intramolecular resonance energy transfer from the fluorescence donor molecule to the quencher will quench the fluorescence of the donor molecule when the two are sufficiently proximate in space, e.g., when the peptide is intact.
- the quencher is separated from the donor group, leaving behind a fluorescent fragment.
- activation of the enzyme results in cleavage of the detection peptide, and dequenching of the fluorescent group.
- the substrate used to assay for BARl activity is conjugated to a fluorescent donor, such as, 5- (2-aminoethyl)amino]naphthalene-l -sulfonic acid (EDANS), and a quenching acceptor, such as 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL).
- a fluorescent donor such as, 5- (2-aminoethyl)amino]naphthalene-l -sulfonic acid (EDANS)
- a quenching acceptor such as 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL).
- the substrate consists of an peptide containing the BARlp recognition sequence with a (EDANS), and (DABCYL), attached at the COOH- and NH2-termini, respectively.
- the substrate further comprises a GABA group between the EDANS group and the first amino acid at the COOH terminus (e.g., the
- the intrinsic fluorescence of EDANS is expected to be dramatically reduced in this substrate because of intramolecular fluorescence resonance energy transfer (FRET) to the DABCYL group. Since FRET becomes insignificant beyond distances of 100 A, the fluorescence of EDANS is restored after cleavage of the substrate (Matayoshi et al, Science, 1990 247:954). Thus, proteolytic activity can be continuously monitored by recording the increase in fluorescence intensity with time.
- FRET intramolecular fluorescence resonance energy transfer
- a benzamidine, benzyloxycarbonyl (Cbz) group can be attached at the N-terminus of the substrate and a Rhodamine group at the C terminus of the substrate.
- Free Rhodamine or mono-substituted Rhodamine exists primarily as a highly fluorescent quinone.
- bis-substituted Rhodamine exists as a virtually non- fluorescent lactone (McGrath et al, Virology, 1 96 217:131).
- the bis-substituted BARlp substrate has very little fluorescence.
- the peptides on the substrate arc protected from cleavage by aminopeptidases.
- Rhodamine-attached peptide renders the residual Rhodamine-attached peptide susceptible to aminopeptidase cleavage.
- Aminopeptidase removal of the peptide from Rhodamine will result in production of highly fluorescent mono-substituted and free Rhodamine molecules.
- the substrate to be assayed is naturally occurring yeast ⁇ - factor.
- a substrate comprises the compound:
- a preferred substrate comprises the compound:
- Barl activity can be measured by detecting the activation of an enzyme precursor to an active enzyme.
- Zymogens are enzyme precursors which become active upon specific, limited proteolytic treatment.
- a Barl sensitive site e.g. the sequence of approx. 9-10 amino acids from yeast alpha factor including the Leu- Lys sequence
- a Barl sensitive site is introduced between the precursor pro-region of a zymogen and the mature (active) protein sequence by standard genetic engineering techniques. Treatment of the zymogen with Barlp then releases active enzyme from the zymogen.
- yeast cells, or supernatants from yeast cells, which have been stimulated by a compound to produce Barl can be tested by measuring the conversion of zymogen to active enzyme, e.g., by detecting cleavage of a substrate which is sensitive to cleavage by the active enzyme.
- zymogens which may be useful in such assays include trypsinogen, plasminogen, prothrombin, pepsinogen, fibrinogen and yeast carboxypeptidase Y and methods of assaying for the activity of the active enzymes derived from these zymogens are well known in the art.
- the above system can also be adapted for intracellular zymogen processing.
- the Barl protease may be expressed cytoplasmically by excision of the sequences necessary for secretion from the gene resulting in intracellular expression of the mature Barl protein. Cells expressing this intracellular Barlp are then engineered to coexpress an intracellular zymogen with a Barlp sensitive cleavage and activation site as described above.
- the bacterial Lac alpha fragment can be fused with a large peptide or a protein. Such a fusion renders Lac alpha incapable of complementation with the Lac omega fragment. (This complementation is the basis of the blue-white discrimination of in frame insertion clones in Lac alpha vectors).
- a Barl sensitive site is included proximal to the Lac alpha-peptide fusion junction, treatment with Barlp will release the functional Lac alpha peptide which is now capable of Lac alpha-omega complementation.
- Barl activity can be read out as a color change in the cell.
- Beta galactosidase enzyme activity can be detected and measured by any of a wealth of commonly used methods, the most preferred being a chromogenic assay based on indigo dye formation on treatment of the X-gal substrate.
- this system may be inco ⁇ orated into the zymogen embodiment above, allowing both beta-galactosidase and zymogen readouts.
- an enzyme substrate may be modified such that cleavage by the enzyme results in destabilization of the substrate (an example of which is described further in Example 5).
- proteins with Lys at their N-terminus are unstable in yeast (Bachmair and Varshavsky. 1989. Cell. 56:1019).
- an enzyme substrate which will be cleaved to expose an N-terminal Lys can be fused to an easily assayed detection protein.
- the BARl substrate, ⁇ -factor can be fused to a detectable gene, e.g. a lacZ gene.
- the detection protein is an essential protein, thus providing negative selection for BARl expression or activity.
- a repressor protein can be used as the detection protein, thereby providing a positive readout.
- chimeric constructs can be used confer pheromone- responsiveness on endogenous yeast genes that are not normally pheromone-responsive as described in Example 6.
- Such constructs comprise a segment of a gene encoding a pheromone inducible transcription factor, such as the Stel2p transcription factor.
- a pheromone inducible transcription factor such as the Stel2p transcription factor.
- the chimericconstructs further comprise a second segment, encoding a DNA binding domain that binds a DNA sequence in the promoter of the endogenous gene on which pheromone responsiveness is to be conferred.
- the gene from which the second segment is derived will be selected based on the desired readout. For example, if the assay is to be constructed using gene A as the readout (because of the ease of assaying for the product of gene A), then the second segment of the chimeric construct encodes a DNA binding domain which binds to the gene A promoter and induces expression of gene A which is to be assayed. For example, in a preferred embodiment, the second segment of the construct encodes the DNA binding domain of Pho4p. Wild-type Pho4p binds and activates the promoter of the PH05, a secreted alkaline phosphatase gene.
- the modulation of a receptor by a test compound will result in a change in the transcription of a gene, which is not normally pheromone responsive.
- the gene is easily detectable.
- the subject assay can be used to measure Pho5, a secreted acid phosphatase.
- Acid phosphatase activity can be measured using standard techniques.
- the overlay assay of Toh-e ct al J. Bacteriol, 1973
- cells are patched onto the appropriate medium and allowed to grow overnight.
- a mixture of 2 ml of molten 1% agarose in 50 mM NaAc pH 4.0, 700 ⁇ l H2O, and 300 ⁇ l ⁇ -napthyl acid phosphate (50 mg/ml) is prepared and applied to the plate.
- 1ml of D-dianisidine fast blue salt B (50mg/ml in 50 mM NaAc pH 4.0) is poured onto the plate.
- the degree of color development is a measure of the level of acid phosphatase produced by the patch of cells. Such color development is indicative of the modulation of a receptor by a test compound.
- such chimeric constructs will further comprise a nuclear localization sequence.
- the DNA binding domain of the construct i.e., encoded by the second segment of the construct from the PH04 DNA binding domain.
- the sequence of the PHO4 DNA binding domain is known in the art.
- the construct can comprise a segment of the naturally occurring PHO4 gene, or can comprise a segment which is derived from the naturally occurring PHO4 gene, but which has been altered, e.g., by mutation.
- the second gene segment encodes amino acids 227-312 of the PH04 DNA binding domain.
- the pheromone-inducible transcription factor (i.e.. encoded by the first gene segment of the construct) is derived from the Stel2 gene. Any of a number of Stel2 fragments can be used in the subject constructs.
- the sequence of Stel2 is known in the art. There arc several sources of information regarding the sequence of Stel2 that the skilled artisan can refer to when selecting the segment of Stel2 to inco ⁇ orate into the chimeric construct. For example, fusions have been made between the Gal4 DNA binding domain and different regions of Stel2 (Song et al Genes & Development, 1991).
- deletion and insertion mutants of Stel2 have been constructed and tested for their ability to restore mating and transcriptional activity to a steI2A strain (Kirkman-Correia et al Mol Cell Biol, 1993). Such experiments provide guidance as to portions of Stel2 which can be inco ⁇ orated into the constructs and which portions are likely to be amenable to mutation.
- the chimeric constructs of the instant invention can comprise a segment derived from a naturally DNA sequence, or the subject constructs can comprise a segment which is homologous to a naturally occurring gene, but which has been altered, e.g., by mutation. Any of the standard methods of making mutations which are known in the art or discussed herein can be used for this pu ⁇ ose.
- the first gene segment which is inco ⁇ orated into the construct comprises a nucleotide sequence which encodes amino acids 1-473 of the naturally occurring Stel2.
- the construct comprises a nucleotide sequence which encodes amino acids 214-473 of naturally occurring SteI2.
- the construct comprises a nucleotide sequence encoding amino acids 214-688 of naturally occurring Ste 12.
- the construct comprises a nucleotide sequence encoding amino acids 1-688 of naturally occurring Stel2.
- the segment of the construct derived from the Ste 12 gene can comprise a mutation.
- a mutation can result in the insertion of one or more amino acids, e.g., the insertion of Lys-Leu between amino acids 85 and 86 of Ste 12.
- such a mutation can result in an insertion of Ser-Leu between amino acids 103 and 104.
- one or more amino acids can be deleted, for example, amino acids 253-305, 572-669, or 588-669.
- the endogenous yeast gene which corresponds to a gene present in the construct is disrupted.
- yeast cells bearing a Stel2-PHO4 construct can be engineered such that the PH04 gene of the host yeast cell can be disrupted.
- the PH03 gene which also encodes a secreted acid phosphatase, but which is induced under high-phosphate conditions and is further increased by thiamine starvation, can be disrupted.
- a heterologous gene construct can be used to detect the modulation of a receptor.
- transcriptional regulatory sequences that are responsive to the transduced intracellular signals and operatively linking the selected promoters to reporter genes, whose transcription or translation is readily detectable and measurable
- a transcription based assay provides a rapid indication of whether a specific receptor interacts with a test compound in any way that modulates intracellular transduction. Expression of the reporter gene, thus, provides a valuable screening tool for the development of compounds that act as agonists or antagonists of such a receptor.
- Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation.
- a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on receptor signaling.
- the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transduction activity of the target receptor, with the level of expression of the reporter gene providing the receptor-dependent detection signal.
- the amount of transcription from the indicator gene may be measured using any method known to those of skill in the art to be suitable.
- the product of the reporter gene is detected by an intrinsic activity associated with that product.
- the indicator gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on, for example, color, fluorescence, or luminescence.
- the amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks the specific receptors.
- a control cell may be derived from the same cells from which the test cell was prepared but which had not been treated with the compound. Alternatively, it may be a cell in which the receptor of interest is not present. Any change in the amount of transcription (e.g., a statistically significant change) indicates that the test compound has in some manner altered the activity of the specific receptor or ion channel.
- the reporter gene provides a selection method such that cells in which activation (or inactivation) of one or more signal pathways of a receptor or ion channel provides a growth advantage to the treated cell.
- expression of the indicator gene could enhance cell viability, relieve a cell nutritional requirement, and/or provide resistance to a drug.
- reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferasc) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other enzyme detection systems, such as beta- galactosidase; firefly luciferase (deWet et al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase (Engebrecht and Silverman (1984), PNAS 1 : 4154-4158; Baldwin et al.
- CAT chloramphenicol acetyl transferasc
- Transcriptional control elements for use in the reporter gene constructs, or for modifying the genomic locus of an indicator gene include, but are not limited to, promoters, enhancers, and repressor and activator binding sites.
- Suitable transcriptional regulatory elements may be derived from the transcriptional regulatory regions of genes whose expression is rapidly induced, generally within minutes, of contact between the cell surface protein and the effector protein that modulates the activity of the cell surface protein. Examples of such genes include, but are not limited to, the immediate early genes (see, Sheng et al. (1990) Neuron 4: 477-485), such as c-fos.
- Immediate early genes are genes that are rapidly induced upon binding of a ligand to a cell surface protein.
- the transcriptional control elements that are preferred for use in the gene constructs include transcriptional control elements from immediate early genes, elements derived from other genes that exhibit some or all of the characteristics of the immediate early genes, or synthetic elements that are constructed such that genes in operative linkage therewith exhibit such characteristics.
- the characteristics of preferred genes from which the transcriptional control elements are derived include, but are not limited to, low or undetectable expression in quiescent cells, rapid induction at the transcriptional level within minutes of extracellular simulation, induction that is transient and independent of new protein synthesis, subsequent shut-off of transcription requires new protein synthesis, and mRNAs transcribed from these genes have a short half-life. It is not necessary for all of these properties to be present.
- VIP vasoactive intestinal peptide
- somatostatin cAMP responsive; Montminy et al. (1986), Proc. Natl. Acad. Sci. 8.3:6682-6686
- proenkephalin promoter responsive to cAMP, nicotinic agonists, and phorbol esters; Comb et al.
- a transcriptional based readout can be constructed using the cyclic AMP response element binding protein, CREB, which is a transcription factor whose activity is regulated by phosphorylation at a particular serine (SI 33).
- CREB cyclic AMP response element binding protein
- SI 33 serine
- CREB binds to a recognition sequence known as a CRE (cAMP Responsive Element) found to the 5' of promotors known to be responsive to elevated cAMP levels.
- CRE cAMP Responsive Element
- Phosphorylation of CREB is seen in response to both increased cAMP levels and increased intracellular Ca levels. Increased cAMP levels result in activation of PKA, which in turn phosphorylates CREB and leads to binding to CRE and transcriptional activation. Increased intracellular calcium levels results in activation of calcium/calmodulin responsive kinase II (CaM kinase II). Phosphorylation of CREB by CaM kinase II is effectively the same as phosphorylation of CREB by PKA, and results in transcriptional activation of CRE containing promotors.
- CaM kinase II calcium/calmodulin responsive kinase II
- a transcriptionally-based readout can be constructed in cells containing a reporter gene whose expression is driven by a basal promoter containing one or more CRE. Changes in the intracellular concentration of Ca ++ (a result of alterations in the activity of the receptor upon engagement with a ligand) will result in changes in the level of expression of the reporter gene if: a) CREB is also co-expressed in the cell, and b) either an endogenous or heterologous CaM kinase phosphorylates CREB in response to increases in calcium or if an exogenously expressed CaM kinase II is present in the same cell.
- stimulation of PLC activity may result in phosphorylation of CREB and increased transcription from the CRE-construct, while inhibition of PLC activity may result in decreased transcription from the CRE-responsive construct.
- a reporter construct for use in the present invention for detecting signal transduction through STAT proteins can be generated by using -71 to +109 of the mouse c-fos gene fused to the bacterial chloramphcnicol acetyltransferase gene (-71fosCAT) or other detectable reporter gene.
- Induction by a cytokine receptor induces the tyrosine phosphorylation of STAT and STAT-related proteins, with subsequent translocation and binding of these proteins to the STAT-RE. This then leads to activation of transcription of genes containing this DNA element within their promoters.
- the reporter gene is a gene whose expression causes a phenotypic change which is screenable or selectable. If the change is selectable, the phenotypic change creates a difference in the growth or survival rate between cells which express the reporter gene and those which do not. If the change is screenable, the phenotype change creates a difference in some detectable characteristic of the cells, by which the cells which express the reporter may be distinguished from those which do not. Selection is preferable to screening in that it can provide a means for amplifying from the cell culture those cells which express a test polypeptide which is a receptor effector.
- the reporter gene is coupled to the receptor signaling pathway so that expression of the reporter gene is dependent on activation of the receptor. This coupling may be achieved by operably linking the reporter gene to a receptor-responsive promoter.
- receptor-responsive promoter indicates a promoter which is regulated by some product of the receptor's signal transduction pathway.
- the promoter may be one which is repressed by the receptor pathway, thereby preventing expression of a product which is deleterious to the cell.
- a receptor repressed promoter one screens for agonists by linking the promoter to a deleterious gene, and for antagonists, by linking it to a beneficial gene.
- Repression may be achieved by operably linking a receptor- induced promoter to a gene encoding mRNA which is antisense to at least a portion of the mRNA encoded by the reporter gene (whether in the coding or flanking regions), so as to inhibit translation of that mRNA.
- Repression may also be obtained by linking a receptor-induced promoter to a gene encoding a DNA binding repressor protein, and inco ⁇ orating a suitable operator site into the promoter or other suitable region of the reporter gene.
- suitable positively selectable (beneficial) genes include the following: URA3, LYS2, HIS3, LEU2, TRPI; ADEI, 2,3, ,5, 7,8; ARGl, 3, 4, 5, 6, 8; HIS I, 4, 5; ILV1, 2, 5; TIIRI, 4; TRP2, 3, 4, 5; LEU1, 4; MET2,3,4,8,9,14,16, 19; URA1.2, 4,5,10; H0M3.6; ASP3; CHOI; ARO 2, 7; CYS3; OLEI; INOI.2,4; PR01.3
- Countless other genes are potential selective markers. The above are involved in well-characterized biosynthetic pathways.
- the imidazoleglycerol phosphate dehydratase (IGP dehydratase) gene (HIS3) is preferred because it is both quite sensitive and can be selected over a broad range of expression levels.
- the cell is auxotrophic for histidine (requires histidine for growth) in the absence of activation. Activation leads to synthesis of the enzyme and the cell becomes prototrophic for histidine (does not require histidine). Thus the selection is for growth in the absence of histidine. Since only a few molecules per cell of IGP dehydratase are required for histidine prototrophy, the assay is very sensitive.
- cells can be selected for resistance to aminotriazole (AT), a drug that inhibits the activity of IGP dehydratase.
- AT aminotriazole
- Cells with low, fixed level of expression of HIS3 are sensitive to the drug, while cells with higher levels are resistant.
- the amount of AT can be selected to inhibit cells with a basal level of HIS3 expression (whatever that level is) but allow growth of cells with an induced level of expression. In this case selection is for growth in the absence of histidine and in the presence of a suitable level of AT.
- Suitable genes include: URA3 (orotidine-5'-phosphate decarboxylase; inhibits growth on 5-fluoroorotic acid), LYS2 (2-aminoadipate reductase; inhibits growth on ⁇ -aminoadipate as sole nitrogen source), CYH2 (encodes ribosomal protein L29; cycloheximide-sensitive allele is dominant to resistant allele), CAN 1 (encodes arginine permease; null allele confers resistance to the arginine analog canavanin), and other recessive drug-resistant markers.
- the reporter gene effects yeast cell growth.
- the natural response to signal transduction via the yeast pheromone system response pathway is for cells to undergo growth arrest. This is the preferred way to select for antagonists to a ligand/receptor pair that induces the pathway.
- An autocrine peptide antagonist would inhibit the activation of the pathway; hence, the cell would be able to grow.
- the FAR1 gene may be considered an endogenous counterselectable marker.
- the FAR1 gene is preferably inactivated when screening for agonist activity.
- the reporter gene may also be a screenable gene.
- the screened characteristic may be a change in cell mo ⁇ hology, metabolism or other screenable features.
- Suitable markers include beta-galactosidase (Xgal, C12FDG, Salmon-gal. Magenta-Gal (latter two from Biosynth Ag)), alkaline phosphatase, horseradish peroxidase, exo-glucanase (product of yeast exbl gene; nonessential, secreted); luciferase; bacterial green fluorescent protein; (human placental) secreted alkaline phosphatase (SEAP); and chloramphenicol transferase (CAT).
- beta-galactosidase Xgal, C12FDG, Salmon-gal. Magenta-Gal (latter two from Biosynth Ag)
- alkaline phosphatase horseradish peroxidase
- exo-glucanase product of yeast exbl gene; noness
- a preferred screenable reporter gene is beta-galactosidase; yeast cells expressing the enzyme convert the colorless substrate Xgal into a blue pigment.
- the promoter may be receptor-induced or receptor-inhibited.
- the consequences of activation of the pheromone signal pathway in wild-type yeast is growth arrest. If one is testing for an antagonist of a G protein-coupled receptor, this normal response of growth arrest can be used to select cells in which the pheromone response pathway is inhibited. That is, cells exposed to a test compound will be growth arrested if the compound is an agonist, but will grow normally if the compound is neutral or an antagonist. Thus, the growth arrest response can be used to advantage to discover compounds that function as agonists or antagonists. Moreover, the effect of growth arrest can provide a selective advantage in the presence of an agent which is cytotoxic to mitotic cells.
- the cytotoxic agent is added to the culture.
- Cells which proceed through the cell-cycle e.g., which are not growth arrested, will be killed.
- the cytotoxic agent it can be washed from the culture, and surviving cells permitted to proceed with proliferation.
- Cells which were arrested by the test compound will be enriched in the surviving population.
- the growth arrest consequent to activation of the pheromone response pathway is an undesirable effect since cells that bind agonists stop growing while surrounding cells that fail to bind peptides will continue to grow. The cells of interest, then, will be overgrown or their detection obscured by the background cells, confounding identification of the compound of interest.
- the present invention teaches engineering the cell such that: 1) growth arrest does not occur as a result of exogenous signal pathway activation (e.g., by inactivating the FAR1 gene); and/or 2) a selective growth advantage is conferred by activating the pathway (e.g., by transforming an auxotrophic mutant with a HIS3 gene under the control of a pheromone-responsive promoter, and applying selective conditions).
- the exogenous receptor be exposed on a continuing basis to the peptides.
- this is likely to result in desensitization of the pheromone pathway to the stimulus.
- the mating signal transduction pathway is known to become desensitized by several mechanisms including pheromone degradation and modification of the function of the receptor, G proteins and/or downstream elements of the pheromone signal transduction by the products of the SST2, STE50, AFR1 (Konopka, J.B. (1993) Mol. Cell. Biol. 13:6876-6888) and SGV1 , MSG5, and SIG1 genes.
- Selected mutations in these genes can lead to hypersensitivity to pheromone and an inability to adapt to the presence of pheromone.
- introduction of mutations that interfere with function into strains expressing heterologous G protein- coupled receptors constitutes a significant improvement on wild type strains and enables the development of extremely sensitive bioassays for compounds that interact with the receptors.
- Other mutations e.g. STE50, sgvl ,BarI, Ste2,ste3,pikl,msg5, sigl , and aftl , have the similar effect of increasing the sensitivity of the bioassay.
- desensitization may be avoided by mutating (which may include deleting) the SST2 gene so that it no longer produces a functional protein, or by mutating one of the other genes listed above.
- the assay may be repeated and modified by the introduction of a step in which the reagent cell is first contactcd with a known activator of the target receptor/channel to induce signal transduction, and the test compound can be assayed for its ability to inhibit the activated receptor/channel, e.g., to identify antagonists.
- batteries of compounds can be screened for agents which potentiate the response to a known activator of the receptor.
- HIS3 imidazoleglycerol phosphate dehydratase gene has been used as a selective marker in yeast. See Sikorski and Heiter, (1989) Genetics, 122:19; Struhl, et al., P.N.A.S. (1979) 76: 1035; and, for FUS 1-HIS3 fusions, see Stevenson, et al., (1992) Genes Dev. , 6: 1293.
- agents identified in the subject assay can be formulated in pharmaceutical preparations for in vivo administration to an animal, preferably a human.
- the compounds selected in the subject assay, or a pharmaceutically acceptable salt thereof may accordingly be formulated for administration with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof.
- a biologically acceptable medium such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof.
- a biologically acceptable medium includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. The use of such media for pharmaceutically active substances is known in the art.
- Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable "deposit formulations". Based on the above, such pharmaceutical formulations include, although not exclusively, solutions or freeze-dried powders of the compound in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered media at a suitable pH and isosmotic with physiological fluids. In preferred embodiment, the compound can be disposed in a sterile preparation for topical and/or systemic administration.
- excipients such as, but not exclusively, mannitol or glycine may be used and appropriate buffered solutions of the desired volume will be provided so as to obtain adequate isotonic buffered solutions of the desired pH.
- Similar solutions may also be used for the pharmaceutical compositions of compounds in isotonic solutions of the desired volume and include, but not exclusively, the use of buffered saline solutions with phosphate or citrate at suitable concentrations so as to obtain at all times isotonic pharmaceutical preparations of the desired pH, (for example, neutral pH).
- This example describes the development of assays to facilitate the use of the Barl protease as a readout for induction of the pheromone-response pathway in S. cerevisiae.
- the S. cerevisiae BARl gene encodes a protease that recognizes and cleaves the yeast ⁇ -factor peptide pheromone.
- Barlp cleaves the mature 13 amino acid ⁇ -factor peptide between residues 6 and 7 (Leu-Lys), rendering the pheromone inactive.
- Barlp has three features that make it potentially useful as a readout system: (1.)
- the BARl gene was cloned into two yeast expression plasmids. One, a low copy number vector in which the gene is under its own promoter and the other, a high copy number vector in which the gene is driven by the strong constitutive S. cerevisiae PGK promoter. Both plasmids contain the S. cerevisiae LEU2 gene to maintain selection in yeast.
- the amplified product bears an Xhol site at its 5 1 end, a BamHI site at its 3' end, and contains the complete Barl open reading frame as well as all of the promoter elements known to influence -9-4./?/ expression (Kronstad et al. Cell. 1987).
- the product was digested with Xhol and BamHI and subcloned into a yeast expression vector (pRS415, referred to herein as Cadus 1014; see e.g., Sikorski and Hieter. 1989. Genetics. 122: 19) that had been digested with Xhol and BamHI .
- the resulting plasmid was designated Cadus 3974.
- primer #2 To create the PGK-BAR1 expression plasmid, primer #2 and primer
- Cadus 1014, 3974, 1651, and 3975 were introduced into Cadus 579 (MATa Barl::hisG::URA3 trpl leu2 ura3 his3 FUS1::H1S3 stel4::TRPl), a yeast st ⁇ a that lacks its own copy of the BARl gene.
- a semi-quantitative plate assay was used to measure Barlp activity. Although Barlp from any source can be used in this assay, in this example Barlp produced by CY 11362 (Cadus 579 containing Cadus 397) was used. CY 1 1362 cells were grown to stauration overnight in SD LEU- medium. The cells were removed from the culture by filtration. The activity of Barlp in the conditioned media was measured by spotting 2 ⁇ l onto a Barl assay plate (described below). To determine the sensitivity of the assay, eight two-fold serial dilutions of the conditioned medium were made and 5 ⁇ l of each dilution was applied to the assay plate.
- Assay plates were prepared as follows. CY 579 cells were grown overnight in YEPD medium. The overnight cultures were diluted to OD ⁇ oO 0-1 and allowed to grow a few hours (to OD600 0- 4 )- The cells were then diluted to OD600 0.1 in H2O and 5 ml were poured onto a YEPD + ⁇ -factor plate (I ⁇ g ⁇ -factor spread evenly on the surface of a YEPD plate just prior to use), allowed to stand a few minutes and poured off. This results in the formation of a confluent and even lawn of cells on the YEPD + ⁇ -factor plate. The conditioned media was then applied to the assay plate and the plate was incubated at 30°C for 1-2 days.
- CY 579 lacks the BARl gene, it is super-sensitive to ⁇ -factor causing its growth to be arrested on the YEPD + ⁇ -factor plate. If the conditioned media applied to the lawn contains Barlp activity, the ⁇ -factor in that region is destroyed, allowing growth of the CY 579 cells.
- this assay is useful for assessing activation of the pheromone response pathway in cells expressing only the endogenous BARl gene.
- the series of serial dilutions of CY 11362 conditioned media described in this example are used to generate a standard curve and thus to provide a semi-quantitative assay for Barlp activity.
- a large pool of CY 1 1362 conditioned media was prepared and aliquots were frozen for use in subsequent experiments.
- Two novel fluorescent substrates have been designed to monitor activity of the Barlp protease in liquid assays that are amenable to high-throughput screening.
- Each of these substrates includes the Barlp peptide-recognition sequence and has been designed such that cleavage by Barl results in a pronounced fluorescence signal.
- the first substrate includes the Barlp peptide-recognition sequence and has been designed such that cleavage by Barl results in a pronounced fluorescence signal.
- EDANS (SEQ ID NO: 4) Is based on a substrate for the HIV-1 protease (Matayoshi et al, Science, 1990).
- the substrate consists of an peptide containing the Barlp recognition sequence with a fluorescent donor, 5-[(2-aminoethyl)amino]naphthalene-l-suIfonic acid (EDANS), and a quenching acceptor, 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL), attached at the COOH- and NH2-termini, respectively.
- DABCYL intramolecular fluorescence resonance energy transfer
- This substrate may be used in a coupled assay, which involves cleavage first by Barlp and then by an added amino peptidase.
- the peptides on the substrate are protected from cleavage by aminopeptidases. Cleavage of the peptide with Barlp, renders the residual Rhodamine-attached peptide susceptible to cleavage by added aminopeptidase. Aminopeptidase removal of the peptide from Rhodamine will result in production of highly fluorescent mono-substituted and free Rhodamine molecules.
- Barl activity can be measured by assaying the activation of an enzyme precurson to an active enzyme.
- Zymogens are enzyme precursors which become active upon specific, limited proteolytic treatment.
- a Barl sensitive site e.g. the sequence of approx. 9-10 amino acids from yeast alpha factor including the Leu-Lys sequence
- a Barl sensitive site is introduced between the precursor pro-region of a zymogen and the mature (active) protein sequence by standard genetic engineering techniques. Treatment of the zymogen with Barlp then releases active enzyme from the zymogen.
- yeast cells, or supernatants from yeast cells, which have been stimulated by a compound to produce Barl can be tested for thier ability to activate a zymogen.
- zymogen activity is then measured by methods well known by those of skill in the art.
- zymogens which may be useful in such assays include trypsinogen, plasminogen, prothrombin, pepsinogen, fibrinogcn and yeast carboxypeptidase Y.
- the above system can also be adapted for intracellular zymogen processing.
- the Barl protease may be expressed cytoplasmically by excision of the sequences necessary for secretion from the gene resulting in intracellular expression of the mature Barl protein. Cells expressing this intracellular Barlp are engineered to coexpress an intracellular zymogen with a Barlp sensitive cleavage and activation site as described above. Fusion of the bacterial Lac alpha fragment with a large peptide or a protein renders it incapable of complementation with the Lac omega fragment. (This is the basis of the blue-white discrimination of in frame insertion clones in Lac alpha vectors).
- Beta galactosidase enzyme activity can be detected and measured by any of a wealth of commonly used methods, the most preferred being a chromogenic assay based on indigo dye formation on treatment of the X-gal substrate. This system may be inco ⁇ orated into the zymogen embodiment above, allowing both beta- galactosidase and zymogen readouts.
- This example demonstrates the utility of the Barl plate assay for assessing agonist-induced activation of the S. cerevisiae pheromone receptor, Ste2p.
- the gene encoding the S. cerevisiae G ⁇ , GPA l was reintroduced into the genome of CY 8034 (MATa gpal *1162 far 1-1 ste2*1154 stel4::trpl::LYS2 fitsl- HIS3 ura3 trpl leu2 lys2 his3 ade2-l metl) by transformation with an integrating plasmid encoding GPAl (Cadus 3907), creating CY 1 1364.
- the gene encoding the S. cerevisiae RGS protein, SST2 was disrupted in this strain to create CY 1 1645.
- Sst2p is involved in desensitization of the pheromone response pathway, its disruption results in increased signaling through the pathway (Reviewed by Sprague and Thorner in Molecular and Cellular Biology of the Yeast Saccharomyces. Vol. 2. 1992).
- a high copy number Ste2 expression plasmid was constructed as follows. The 4.3 kb BamHI fragment containing the entire STE2 gene was excised from the yeast expression plasmid Yep24-STE2 (obtained from J. Thorner, Univ. of California Berkeley) and cloned into the BamHI site of ⁇ RS425 (Cadus 1018) (Sikorski and Heiter, Genetics. 1989). The resulting plasmid, Cadus 2456, and the vecotr control, Cadus 1018, were then introduced into CY 11645 to create CY 1 1728 and CY 1 1727, respectively.
- Barl plate assay can be used to detect activation of the S. cerevisiae G-protein coupled receptor Ste2p.
- this assay can be used to detect activation of any receptor (including non-homologous e.g. mammalian GPCRs) coupled to the S. cerevisiae pheromone response pathway.
- This example demonstrates the utility of the Barl plate assay for assessing activation of mammalian G-protein coupled receptors that have been coupled to the & cerevisiae pheromone response pathway.
- yeast strains expressing the Melatonin lb receptor were constructed.
- a plasmid, pcDNA3-hMLlb, containing the complete open reading frame of the human Melatonin lb receptor was used as a convenient source of the gene.
- the sequence of the Melatonin lb receptor is known in the art (See e.g., Gcnbank accession number U25341). Primers
- Cadus 1651 and 3693 were transformed into CY 1 1645 (described in Example 2) to create CY 1 1729 and CY 1 1730, respectively.
- CY 1 1729 and CY 1 1730 were assessed.
- Lawns of CY 1 1729 and CY 1 1730 cells were prepared on SD LEU-HIS- pH 6.8 plates from SD LEU- pH 6.8 overnight cultures as described in Example 1. After preparation of the lawns, Melatonin (20 ⁇ g) was spotted onto the plates and the plates were incubated at 30°C overnight.
- the Barl plate assay can be used to detect activation of a mammalian G-protein coupled receptor in S. cerevisiae.
- C5a receptor activation is assessed using the Barl plate assay in a yeast strain expressing the chimeric G ⁇ , GPAl4i-G ⁇ i3.
- the chimeric G ⁇ , GPAl4i-G ⁇ i3, was integrated into the GPAl locus of CY 8034 to create CY 1 1365.
- the expression of the FUS1-HIS3 reporter in C Y 8034 and CY 1 1365 was compared. Since C Y 8034 does not express a G ⁇ protein, the pheromone response pathway is constitutively active in this strain. Thus, integration of GPAl4i-G ⁇ i3 would be expected to decrease expression of the reporter. As expected, reporter gene expression was reduced in CY 1 1365, however, it was not completely eliminated. The residual activity is likely due to incomplete coupling of the GPAl4i-G ⁇ i3 chimera to the yeast G ⁇ .
- CHA-CHA Merck C5a receptor agonist
- CY 1 1457 and CY 1 1458 were diluted in SD LEU- pH 6.8 medium to an OD600 of 0.2, and allowed to grow for a few hours at 30°C (to OD600 0.4).
- the cells were collected by centrifugation, washed IX with SD LEU- pH 6.8 medium, and resuspended in 2 ml SD LEU- pH 6.8 medium.
- CHA-CHA (10 ⁇ M) was added to one aliquot and vehicle (in this case, DMSO) was added to the other.
- This example illustrates an embodiment of the subject assays in which enzyme- mediated cleavage of ⁇ -factor by BARlp can be used to control the stability of a substrate, which can be used as a selectable event.
- Cleavage of ⁇ -factor by BARlp leaves an N-terminal lysine residue. Proteins with lysine at their N-terminus have been shown to be unstable in yeast (Bachmair and Varshavsky. 1989. Cell. 56:1019). Therefore, chimeric substrate proteins whose stability in yeast is controlled by the levels of BARlp can be constructed.
- the ⁇ -factor peptide sequence is introduced into the open reading frame of an easily-assayed protein. BARlp induction then causes cleavage of the ⁇ -factor sequence within the chimeric substrate and degradation of the substrate by the N-end rule pathway.
- the ⁇ -factor peptide sequence is fused to the N-terminus of a model substrate, for example, lacZ using standard recmobinant DNA techniques.
- the construct is placed under the control of a constitutive, moderately expressed promoter in a yeast expression vector.
- This vector is introduced into yeast cells in which Barlp activity can be induced upon stimulation with an appropriate test compound and LacZ (either enzyme activity or protein levels) is then assayed in cells which have been contacted with test compounds.
- Test compounds that induce Barlp are selected based on decreased stability of the chimeric LacZ substrate.
- Lac Z can be replaced with, for example, an essential gene (to provide negative selection for Barlp activity) or a repressor protein (to provide positive selection for Barlp activity).
- the assay it may be desirable to remove the signals for secretion present at the N- and C-terminus of BARlp to thereby inhibit targeting of Barlp to the secretion machinery. This allows for greater access of Barlp to the chimeric substrate present in the cytoplasm.
- This example describes the construction of yeast expression plasmids encoding a series of PH04ISTE12 chimerae. These chimerae are used make an easily-assayed gene product, the secreted acid phosphatase Pho5p, pheromone inducible. Changes in gene expression as a consequence of pheromone induction are mediated by the Stel2p transcription factor. In the presence of pheromone signaling Stel2p becomes a potent transcriptional activator of genes whose promoters contain a well-defined DNA binding site (the pheromone response element, or PRE) (Reviewed by Sprague and Thorner in The Molecular and Cellular Biology of the Yeast Saccharomyces Vol. 2, 1992).
- PRE pheromone response element
- the transcription factor Pho4p is activated when cells are starved for phosphate. Once activated, Pho4p binds to promoter elements in several genes, including Pho5, and induces their transcription (Reviewed by Johnston and Carlson in The Molecular and Cellular Biology of the Yeast Saccharomyces Vol. 2, 1992). Chimeric transcription factors that contain the transcription activation domains of Stel2p have been constructed by fusing regions of Stel2p with the DNA binding domain of Pho4p. Expression of these chimerae in yeast results in induction of Pho5 expression when the pheromone response pathway is activated. This induction is due to stimulation by the Ste 12 transcription activation domain brought into proimity with the Pho5 promoter by the Pho4 DNA binding domain. Expression of Pho5 can be easily assessed by several well- defined methods for detecting acid phosphatase activity.
- a yeast expression plasmid was constructed that contains the yeast ADH promoter fused to sequences encoding an 11 amino acid nuclear localization signal and the PH04 DNA binding domain (amino acids 227-312). Sequences encoding the PH04 DNA binding domain were amplified from yeast genomic DNA using the primers 5'CGACTAAGCTTATGGGTGCACCTCCTAAAAAGAAGAGAAAGGTAGCCCCGCACGGATC GAGCCAT 3 ' ( SEQ ID NO : 8 ) and 5 ' CCGGAATTCCGTGCTCACGTTC- 3 ' .
- Plasmid pCD72 (Cadus 3973) was obtained from Dr. J. Broach. It is a high copy number yeast vector containing the ADH promoter and transcription termination sequences as well as sequences encoding the GAL4 DNA binding domain.
- Cadus 4183 was constructed by digesting pOF22[GAL4-STE12 1-688] (Cadus 3918) with EcoRI. The 2.8 kb fragment containing the entire STE12 open reading frame was gel purified and subcloned into the EcoRI site of Cadus 4129.
- Cadus 4184 was constructed by digesting pYZl 1 [GAL4-STE12 214-688] (Cadus 3916) with EcoRI. The 2.2 kb EcoRI fragment encoding amino acids 214-688 of Stel2p was gel purified and subcloned into the EcoRI site of Cadus 4129.
- Cadus 4185 was constructed by digesting pXBl [GAL4-STE12 214-473] (Cadus 3972) with EcoRI and BamHI.
- the 780 bp fragment encoding amino acids 214-473 of Stel2p was gel purified and ligated to Cadus 4129 that had been digested with EcoRI and BamHI.
- Cadus 4186 was constructed by digesting pOG4[GAL4-STE12 1-473] (Cadus 3919) with EcoRI and BamHI.
- the 1.42 kb fragment encoding amino acids 1-473 of Stel2p was gel purified and ligated to Cadus 4129 that had been digested with EcoRI and BamHI.
- Cadus 4747 contains the amplified product of plasmid lk85 (Cadus 3913), Cadus 4553 the product of plasmid lkl03 (Cadus 3910), Cadus 4554 the product of DI l [D253-305] (Cadus 3911, Cadus 4555 the product of D7[D512-699] (Cadus 3912), and Cadus 4556 the product of D22[D588-669].
- Example 7 Detection of Ste2p Activation using the PH04/STE12 chimerae This example demonstrates the use of the PH04/STE12 chimerae (described in
- Example 5 to induce expression of the PH05 gene when the pheromone response pathway is activated.
- CACGTGCTCACGTTCTGCTGTAGGTGACGGATGTAGCATAGGCCACTAGTGGATCTG 3 ' SEQ ID NO : 13 .
- the amplification product was flanked by sequences corresponding to the 5' and 3' ends of the PH04 gene. This DNA was transformed into CY 1638. Transformants were selected on YEPD + geneticin (200 ⁇ g/ml) plates.
- PH04 in this strain was verified by assessing acid phosphatase activity in cells grown on phosphate-depleted YEPD medium (100 ml YEPD, 1 ml NH4OH, 1 ml MgSO4 [1 M]; let stand 30 min; filter) (Biscon and Thorner, Genetics. 1982). Acid phosphatase activity was assessed using the overlay assay of Toh-e et al (J. Bacteriol, 1973). Cells were patched onto YEPD or phosphate-depleted YEPD plates and allowed to grow overnight.
- the small amount of acid phosphatase activity observed in CY 9788 is likely that of Pho3p.
- the PH03 gene also encodes a secreted acid phosphatase, but its expression is not regulated by Pho4p. Instead, its expression is induced under high-phosphate conditions and is further increased by thiamine starvation (Reviewed by Vogel and
- CY 1 1643 bearing the deletion of the Pho3 gene.
- the disruption of PH03 in CY 1 1643 was verified by measuring acid phosphatase activity on YEPD plates and on phosphate- depleted YEPD plates as described above. As expected CY 1 1643 had extremely low acid phosphatase activity on both plate.
- Pho4/Stel2 chimeric transcription factors can be used to render the PH05 gene pheromone- inducible.
- this readout can be used to detect activation of any G-protein coupled receptor expressed in S. cerevisiae, as well as activation of any pheromone respoonse pathway component downstream of the receptor. Such activation may be due to modulation by a compound or by protein-protein interaction (e.g., by interaction with a cloned heterologous gene product).
- Example 8 Functional Expression of a Mammalian G Protein-Coupled Receptor and Ligand in an Autocrine Yeast Strain.
- a yeast cell expressing a G protein-coupled receptor which is suitable for use in the instant assays is described.
- This example details the following: (1) expression of human C5a receptor in yeast; (2) expression of the native ligand of this receptor, human C5a, in yeast; and (3) activation of the endogenous yeast pheromone pathway upon stimulation of the C5a receptor by C5a when both of these molecules are expressed within the same strain of autocrine yeast.
- the utility of autocrine strains of yeast that functionally express the human C5a receptor is outlined.
- Human C5a is a 74 amino acid polypeptide that derives from the fifth component of complement during activation of the complement cascade; it is the most potent of the complement-derived anaphylatoxins.
- C5a is a powerful activator of neutrophils and macrophage functions including production of cytotoxic super oxide radicals and induction of chemotaxis and adhesiveness.
- C5a stimulates smooth muscle contraction, induces degranulation of mast cells, induces serotonin release from platelets and increases vascular permeability.
- the C5a anaphylatoxin can also amplify the inflammatory response by stimulating the production of cytokines.
- C5a is a highly potent inflammatory agent, it is a primary target for the development of antagonists to be used for intervention in a variety of inflammatory processes.
- the C5a receptor is present on neutrophils, mast cells, macrophages and smooth muscle cells and couples through G proteins to transmit signals initiated through the binding of C5a.
- the plasmid pCDM8-C5aRc, bearing cDNA sequence encoding the human C5a receptor, was obtained from N. Gerard and C. Gerard (Harvard Medical School, Boston, MA) (Gerard and Gerard 1991 ). Sequence encoding C5a was derived from this plasmid by PCR using VENT polymerase (New England Biolabs Inc., Beverly MA), and the following primers:
- Primer #1 contains a single base-pair mismatch (underlined) to C5a receptor cDNA. It introduces an Xbal site (in bold) 201 bp downstream from the TAG termination codon of the C5a receptor coding sequence.
- Primer #2 contains two mismatched bases and serves to create an Ncol site (in bold) surrounding the ATG initiator codon (double underlined). The second amino acid is changed from an aspartic acid to an asparagine residue. This is the only change in primary amino acid sequence from the wild type human C5a receptor.
- the PCR product was restricted with Ncol and Xbal (sites in bold) and cloned into CADUS 1002 (YEp51Nco), a Gal 10 promoter expression vector.
- the sequence of the entire insert was determined by dideoxy sequencing using multiple primers.
- the sequence between the Ncol and Xbal sites was found to be identical to the human C5a receptor sequence that was deposited in GenBank (accession #.105327) with the exception of those changes encoded by the PCR primers.
- the C5a receptor-encoding insert was transferred to CADUS 1289 (pLPXt), a PGK promoter expression vector, using the Ncol and Xbal sites, to generate the C5a receptor yeast expression clone, CADUS 1303.
- a version of the C5a receptor which contains a yeast invertasc signal sequence and a myc epitope tag at its amino terminus was expressed in Cadus 1270-transferred yeast under control of a GAL 10 promoter. Plasmids encoding an untagged version of the C5a receptor and a myc-tagged derivative of FUS 1 served as controls. The expression of the tagged receptor in yeast was confirmed by Western blot using the anti- myc monoclonal antibody 9E10. In the lane containing the extract from the Cadus 1270-transformant, the protein that is reactive with the anti-myc monoclonal antibody 9E10 was approximately 40 kD in size, as expected. Note that this receptor construct is not identical to the one used in the autocrine activation experiments. That receptor is not tagged, does not contain a signal sequence and is driven by the PGK promoter.
- C5a A synthetic construct of the sequence encoding C5a was obtained from C. Gerard (Harvard Medical School, Boston, MA). This synthetic gene had been designed as a FLAG-tagged molecule for the secretion from E. coli (Gerard and Gerard (1990) Biochemistry 29:9274-9281).
- C5a5' CCCCTTAAGCGTGAGGCAGAAGCTACTCTGCAAAAGAAGATC (SEQ ID NO:20)
- C5a3 ' GAAGATCTTCAGCGGCCGAGTTGCATGTC (SEQ ID NO:21)
- CADUS 1215 an expression vector designed to express peptide sequences in the context of Mf ⁇
- the 5' primer also contains pre-pro ⁇ -factor sequence.
- authentic human C5a should be secreted by yeast containing CADUS 1297.
- the insert sequence in CADUS 1297 was sequenced in both orientations by the dideoxy method and found to be identical to that predicted by the PCR primers and the published sequence of the synthetic C5a gene (Franke et al. (1988) Methods in Enzymology 162: 653-668).
- C5a was immunologically detected in both culture supernatant and lysed cells using a commercially available enzyme-linked immunosorbent assay (ELISA)(Table 1). This assay indicated the concentration of C5a in the culture supernatant to be approximately 50 to 100 nM. In comparison, in data derived from mammalian cells, the binding constant of C5a to its receptor is 1 nM (Boulay et al.( 1991 ) Biochemistry 30:2993-2999.
- C5a expressed in yeast was shown to compete for binding with commercially obtained (Amersham Co ⁇ oration, Arlington Heights. IL), radiolabeled C5a on induced HL60 cells.
- CY455 MAT ⁇ tbtl-1 ura3 leu2 t ⁇ l his3 fusl-HIS3 canl stel4::TRPl ste3* 1 156
- a pheromone inducible HIS3 gene fusl-HIS3, is integrated at the Fusl locus.
- a hybrid gene containing sequence encoding the first 41 amino acids of GPAl (the yeast G ⁇ subunit) fused to sequence encoding human G ⁇ i2a (minus codons for the N-terminal 33 amino acids) replaces GPAl at its normal chromosomal location.
- the yeast STE 14 gene is disrupted to lower the basal level of signaling through the pheromone response pathway.
- the yeast a-factor receptor gene, STE3 is deleted. The last two modifications are probably not essential, but appear to improve the signal-to-noise ratio.
- CY455 (MAT ⁇ tbtl-1 ura3 leu2 t ⁇ l his3 fusl-HIS3 canl stel4::TRPl ste3* 1156) was transformed with the following plasmids:
- the activity of the fusl promoter was determined colorometrically using a fusl-lacZ fusion in a similar set of strains.
- C Y878 MAT ⁇ tbtl- 1 fusl-HIS3 caN 1 stel4::t ⁇ l::LYS2 ste3* 1156 gpal(41)-G ⁇ i2 was used as the starting strain for these experiments.
- This strain is a t ⁇ l derivative of CY455.
- the transformants for this experiment contained CADUS 1584 (pRS424-fusl-lacZ) in addition to the receptor and ligand plasmids.
- C5a antagonists A primary use of the autocrine C5a strains will be in the discovery of C5a antagonists. Inhibitors of the biological function of C5a would be expected to protect against tissue damage resulting from inflammation in a wide variety of inflammatory disease processes including but not limited to: respiratory distress syndrome (Duchateau et al. (1984) Am Rev Respir Dis 130: 1058); (Hammerschmidt et al. (1980) Lancet
- a straightforward approach involves screening compounds to identify those which inhibit growth of the R+L+ strain described above in selective media but which do not inhibit the growth of the same strain or of a R+L- strain in non-selective media.
- the counterscreen is necessary to eliminate from consideration those compounds which are generally toxic to yeast. Initial experiments of this type have led to the identification of compounds with potential therapeutic utility.
- fusl-HIS3 read-out with one of several negative selection schemes (fusl-URA3/FOA, fusI-GALl /galactose or deoxygalactose, Farl sst2 or other mutations that render yeast supersensitive for growth arrest) would generate a test system in which the presence of an antagonist would result in the growth of the assay strain.
- Such an approach would be applicable to high-throughput screening of 5 compounds as well as to the selection of antagonists from random peptide libraries expressed in autocrine yeast.
- optimization of screens of this type would involve screening the R+L+ strain at a concentration of aminotriazole which ablates growth of the R+L- strain (for example, 0.6 to 0.8 mM) and counterscreening the R+L- strain at a concentration of aminotriazole which gives an identical growth rate (for example, 0.14 o mM).
- the system could employ one of several colorometric, fluorescent or chemiluminescent readouts. Some of the genes which can be fused to the fusl promoter for these alternate read-outs include lacZ (colorometric and fluorescent substrates), glucuronidase 20 (colorometric and fluorescent substrates), phosphatases (e.g.
- the autocrine C5a strains have further utility as follows:
- Novel peptide agonists would contribute to structure/function analyses used to guide the rational design of C5a antagonists.
- receptors may be selected from highly mutagenized populations by growth on selective media. These constitutively active receptors may have utility in permitting the mapping of the sites of interaction between the receptor and the G-protein. Identification of those sites may be important to the rational design of drugs to block that interaction.
- receptors could be o selected for an ability to be stimulated by some agonists but not others or to be resistant to antagonist. These variant receptors would aid in mapping sites of interaction between receptor and agonist or antagonist and would therefore contribute to rational drug design efforts.
- Example 9 Construction of Hybrid G ⁇ Genes Construction of two sets of chimeric yeast/mammalian G ⁇ genes, GPA 41 -G ⁇ and GPAl Bam -G ⁇ .
- the G ⁇ subunit of heterotrimeric G proteins must interact with both the ⁇ complex and the receptor. Since the domains of G ⁇ required for each of these interactions have not been completely defined and since our final goal requires G ⁇ proteins that communicate with a mammalian receptor on one hand and the yeast ⁇ subunits on the other, human-yeast chimeric G ⁇ proteins with an optimized ability to perform both functions were derived. From the studies reported here it was determined that inclusion of only a small portion of the amino terminus of yeast G ⁇ is required to couple a mammalian G ⁇ protein to the yeast ⁇ subunits. It was anticipated that a further benefit to using these limited chimeras was the preservation of the entire mammalian domain of the G ⁇ protein believed to be involved in receptor contact and interaction. Thus the likelihood that these chimeras would retain their ability to interact functionally with a mammalian receptor expressed in the same yeast cell was expected to be quite high.
- pRS4 ⁇ 6-GPAl (Cadus 1069).
- An Xbal - Sad fragment encoding the entire GPAl promotor region, coding region and approximately 250 nucleotides of 3' untranslated region was excised from 10 YCplacl 1 1-GPA1 (from S. Reed, Scripps Institute) and cloned into YEp vector pRS416 (Sikorski and Hieter, Genetics 122: 19 (1989)) cut with Xbal and Sad.
- G ⁇ 47-based expression vector (Cadus 1127).
- a 350 nucleotide fragment spanning the 3' untranslated region of GPAl was amplified with Taq polymerase (AmpliTaq; Perkin Elmer) using the oligonucleotide primers A ( 5 ' CGAGGCTCGAGGGAACGTATAATTAAAGTAGTG 3 ' ) (SEQ ID NO:23) and
- Cadus 1 110 The Notl and Sacl sites in the polylinker of Cadus 1092 were removed by restriction with these enzymes, filling in with the Klenow fragment of DNA polymerase I, and blunt end ligation to yield Cadus 1 110.
- the amplified product, bearing an EcoRI site at its 5' end and novel Sad, Notl and Sail sites at its 3' end was restricted with EcoRI and Sail, gel purified using GeneClean II (BiolOl), and cloned into EcoRI and Sail restricted Cadus 1 1 10 to yield Cadus 1127.
- the DNA sequence of the vector between the EcoRI site at -200 and the Kpnl site at the 3' end of the 3' untranslated region was verified by restriction enzyme mapping and dideoxynucleotide DNA sequence analysis.
- the primer pairs used in the amplification are as follows: G ⁇ S Primer 1 : 5 ' CTGCTGGAGCTCCGCCTGCTGCTGCTGGGTGCTGGAG3 ' ( Sad 5 ' ) (SEQ ID NO : 27 ) Primer 2 : 5 ' CTGCTGGTCGACGCGGCCGCGGGGGTTCCTTCTTAGAAGCAGC3 ⁇ ( Sai l 3 ' ) ( SEQ ID NO : 28 )
- Primer 2 5' CTGCTGGTCGACGCGGCCGCGCCCCTCAGAAGAGGCCGCGGT CC3 1 (Sail 3') (SEQIDNO:31)
- Primer 3 5' GGGCTCGAGCCTCAGAAGAGGCCGCAGTC3 ' (Xhol 3') (SEQIDNO:32)
- the hybrid GPA 41 -G ⁇ subunits were cloned via a Sad site introduced at the desired position near the 5' end of the amplified genes and a Sail or Xhol site introduced in the 3' untranslated region. Ligation mixtures were electroporated into competent bacteria and plasmid DNA was prepared from 50 cultures of ampicillin resistant bacteria.
- the 1.1 kb PCR product was gel purified with GeneClean II (BiolOl), restricted with Ncol and BamHI and cloned into NcoI-BamHI cut and phosphatased Cadus 1 122 to yield Cadus 1605.
- the sequence of Cadus 1605 was verified by restriction analysis and dideoxy-sequencing of double-stranded templates.
- Recombinant GPA Barn -G ⁇ hybrids of Gas, Gai2, and G ⁇ l6 were generated. Construction of Cadus 1855 encoding recombinant GPA Bam -G ⁇ 16 serves as a master example: construction of the other hybrids followed an analogous cloning strategy.
- Cadus 1617 The parental plasmid Cadus 1617, encoding native G ⁇ l6, was restricted with Ncol and BamHI, treated with shrimp alkaline phosphatase as per the manufacturer's specifications and the linearized vector was purified by gel electrophoresis.
- Cadus 1605 was restricted with Ncol and BamHI and the 1.1 kb fragment encoding the amino terminal 60% of GPAl with a novel BamHI site at the 3' end was cloned into the Ncol- and BamHI-restricted Cadus 1617.
- the resulting plasmid encoding the GPA Bam -G ⁇ 16 hybrid was verified by restriction analysis and assayed in tester strains ror an ability to couple to yeast G ⁇ and thereby suppress the gpal null phenotype.
- Two additional GPA Bam -G ⁇ hybrids, GPA Bam -G ⁇ s and GPA Bam -G ⁇ i2, described in this application were prepared in an analogous manner using Cadusl606 as the parental plasmid for the construction of the GPA Bam -G ⁇ i2 hybrid and Cadus 1 181 as the parental plasmid for the construction of the GP ⁇ Bam -G ⁇ s hybrid.
- Strains CY4874 and CY4877 are isogenic but for the presence of Q205L mutation in the cloned G ⁇ i2 gene cloned into plasmid 1.
- Strains CY4901 and CY4904 each have a chromosomally integrated chimeric G ⁇ fusion comprising 41 amino acids of gpal at the N terminus of the human G ⁇ i2 gene and are isogenic but for the presence of a constitutively activating mutation in the C5a receptor gene of CY4901.
- Strain CY5058 is a gpal mutant which carries only the yeast G ⁇ subunits and no G ⁇ subunit. This strain is a control strain to demonstrate specificity of action on the G ⁇ subunit.
- the Q205L mutation is a constitutively activated GTPase deficient mutant of the human G ⁇ i2 gene.
- Antagonist compounds, chemicals or other substances which act on G ⁇ i2 can be recognized by their action to reduce the level of activation and thus reduce the signal from the fusl-lacZ reporter gene on the second plasmid (Plasmid 2).
- test component gpa 4
- control component gpa 4
- fusl-His3 strains are preferred for screening for agonists and the fus2-CANl strains are preferred for antagonist screens.
- fus 1 -lacZ CY4874 reduce ⁇ -gal activity CY4877
- fus2-CANl CY4892 induce growth on CY4386 canavanine
- the C5aR* mutation has a Leucine residue in place of the Proline residue of the wild- type at position 184 of the amino acid sequence.
- fusl -lacZ CY4901 reduce ⁇ -gal activity CY4904
- fus2-CAN l CY4365 induce growth on CY4362 canavanine
- Example 11 Identification of a surrogate ligand using expression of a random peptide library in yeast expressing an orphan mammalian receptor
- FPRL-1 (formyl peptide receptor-like 1) is a structural homolog of the formyl peptide receptor (FPR).
- FPR is a G protein-coupled receptor, expressed on neutrophils and phagocytic cells, that is stimulated by N-formyl peptides of bacterial origin. Specific binding of the natural ligand, f-Met-Leu-Phe, stimulates transduction of a signal to mobilize calcium, resulting in cellular changes including chemotaxis and the release of granule contents.
- Low stringency hybridization of HL60 cDNA libraries with an FPR cDNA probe permitted the identification of the related receptor, FPRL-1 (Mu ⁇ hy et al. supra; Ye et al. supra).
- the FPRL-1 cDNA encodes a 351 amino acid protein with 69% sequence homology to FPR (Mu ⁇ hy ct al. supra)
- FPR and FPRL-1 were found to co-localize to human chromosome 19 and to have a tissue expression pattern identical to that of FPR, i.e., expression is restricted to cells of myeloid origin (Mu ⁇ hy et al. supra).
- Ye et al. demonstrated weak binding of f-Met-Leu-Phe (uM concentrations) to fibroblasts transfected with FPRL-1 cDNA.
- FPRL-1 appears to be an o ⁇ han receptor whose specific ligand differs from the formyl peptide ligands to which FPR responds.
- a plasmid, pFPRLl -L31, containing a 2.6 kb EcoRI-Xhol fragment encoding the FPRL-1 cDNA in the BluescriptIISK+ vector was obtained from Philip Mu ⁇ hy (NIH).
- the sequence encoding FPRLl was amplified by the polymerase chain reaction using VENT polymerase (New England Biolabs, Inc., Beverly, MA) through 20 cycles and the following oligonucleotide primers:
- the PCR product was purified, restricted with Bsal and cloned into Cadus 1651 (plPBX-1), a PGK promoter-driven expression vector, using Ncol and BamHI sites, to yield CADUS 231 1.
- the sequence of the entire insert was determined and found to be identical to the FPRL-1 sequence deposited in GenBank (accession number M84562).
- yeast strain CY1141 (MATalpha farl * 1441 tbtl -1 fusl-HIS3 can 1 stel4::t ⁇ l:;LYS2 ste3* l 156 gpal(41 )-Galphai2 lys2 ura3 leu2 t ⁇ l his3) was used in the experiments that follow.
- CY1 141 contains a pheromone inducible HIS3 gene, fusl- HIS3 integrated at the FUS1 locus and a hybrid gene encoding the first 41 amino acids of GPAl (yeast G alpha) fused to sequence encoding human G alphai2 (lacking codons encoding the N-terminal 33 amino acids) replacing GPAl at its chromosomal locus.
- GPAl yeast G alpha
- human G alphai2 lacking codons encoding the N-terminal 33 amino acids
- the yeast STE 14 gene is disrupted to lower the basal level of signaling through the pheromone response pathway.
- the yeast a-factor receptor gene, STE3 is deleted.
- CY1 141 was transformed with Cadus 231 1 to yield CY6571 , a strain expressing the human o ⁇ han receptor, FPRL-1.
- CY6571 exhibited LIRMA (ligand independent receptor mediated activation), that is, activation of the yeast pheromone pathway in the absence of ligand. It was determined that the yeast growth on selective media that resulted from LIRMA was eliminated by the additional of 2.5millimolar concentrations of 3-aminotriazole (AT). AT is an inhibitor of the HIS3 gene product that serves to reduce background growth. Therefore, selection protocols aimed at the identification of surrogate ligands for the FPRL-1 receptor were carried out at this concentration of AT.
- LIRMA ligand independent receptor mediated activation
- CY6571 was inoculated to 10 mis of standard synthetic media (SD) lacking leucine (-Leu) and incubated overnight at 30°C.
- SD standard synthetic media
- the 10 ml overnight culture was used to inoculate 50 mis of YEPD; this culture was incubated at 30°C for 4.5-5 hours at which time the cells were harvested and prepared for transformation with DNA encoding a random peptide library falpha-NNK (6.24.94)] encoding tridecapeptides of random sequence, by electroporation.
- Post electroporation in 0.2 cm cuvettes, 0.25 ⁇ F, 200 ⁇ , 1.5 kV the cells were immediately diluted in 1 ml ice-cold IM sorbitol and lOO ⁇ L aliquots were placed onto 10 synthetic media plates (pH6.8) lacking leucine and uracil (-Leu-Ura). The plates were incubated at 30°C for 2-4 days at which time two replicas of each original transformation plate were made to synthetic media (pH6.8) lacking leucine, uracil and histidine and supplemented with 2.5mM AT(-Leu-Ura-His+2.5mM AT). The replicas were incubated at 30°C for 3-5 days.
- Plasmid DNA was isolated from each of these bacteria cultures using Qiagen columns (Qiagen, Inc., Chatsworth, CA)). Each plasmid DNA pellet was resuspended in 50 ⁇ L Tris lOmM, EDTA 1 mM, pH 8.0. Strain CY6571 was transformed with l ⁇ L of each plasmid pool by electroporation. Post electroporation the cells were diluted into 400 ⁇ L IM sorbitol. From each electroporated cell suspension, l ⁇ L and 400 ⁇ L of cells were plated on -Leu- Ura synthetic media, pH6.8 to yield "low density” and "high density” platings.
- the cells were scraped from this plate into 5 mis of H2O, the ODg ⁇ O of the cell suspension was determined and a crude plasmid isolation was done on 15 OD units of yeast cells.
- the pellet obtained was resuspended in 40 ⁇ L lOmM Tris, 1 mM EDTA, pH8.0 and l ⁇ L was used to transform E. coli. Plasmid DNA was isolated by miniprep from 3 ml 2XYT cultures of single bacterial colonies resulting from this transformation.
- Transformants were first selected on -Leu-Ura, pH6.8 then three yeast transformants of each type (from 11 CY6571 transformations and 1 1 CY6263 transformations) were patched to -Leu-Ura, pH6.8 to expand the colonies. Once expanded, streaks of the transformants were made on -Leu-Ura-His+2.5mM AT to test for growth in the absence of histidine. All plasmids except the one denoted A2 conferred a growth advantage on media lacking histidine to yeast bearing the FPRL-1 -encoding plasmid but not to yeast lacking the receptor plasmid.
- the peptide sequence found to be encoded by plasmids Al and A3-A10 is: SerLeuLeuT ⁇ LeuThrCysArgProT ⁇ GluAlaMet, (SEQ ID NO:40) and is encoded by the nucleotide sequence 5 ' -TCT CTG CTT TGG CTG ACT TGT CGG CCT TGG GAG GCG ATG-3'. (SEQ ID NO:41)
- the activity of the fusl promoter was determined colorimetrically using a fusl-lacZ fusion in a parallel set of test strains.
- CY1 141 described above, was used as the recipient strain for these experiments.
- Transformants contained CADUS 1584 (pRS424-fusl-lacZ) in addition to receptor (R +/ ") and ligand (L + _ ) plasmids.
- Four strains (bearing the identical plasmids) were grown overnight in minimal media lacking leucine, uracil, and tryptophan, pH8.6.
- Example 12 Identification of surrogate ligands using expression of a random peptide library in yeast expressing the orphan mammalian receptor, MDR-1S.
- MDR15 monocyte derived receptor monocyte-derived receptor 15
- yeast strain CY6573
- This receptor is an alternative spliced form of the Burkitt's lymphoma receptor 1 (BLR1) encoded by a human Burkitt's lymphoma cDNA (Dobner et al. (1992) Eur. . Immunol 22, 2795- 2799).
- Strain CY6573 was transformed in a similar manner with the NNK13 library, and, following selection on ten -Leu-Ura (4.4 x 10 5 colonies per plate), replica plated to -Leu-Ura-His+ ImM AT plates.
- Eight often pools showed signicantly enriched colony formation on -Leu-Ura-His+ ImM AT plates.
- Eight unique plasmids derived from these pools when retransformed into CY6573 conferred growth on -Leu-Ura-His+ ImM AT plates.
- One of these plasmids failed to confer growth in a yeast strain lacking the MDR15 receptor.
- Example 13 Identification of a ligand using expression of a random peptide library in yeast expressing the human thrombin receptor
- the receptor for thrombin is present on numerous cell types including platelets, vascular smooth muscle, fibroblasts and on a subset of cells that function in immunity.
- Thrombin a serine protease
- Thrombin a serine protease
- the post- cleavage N-terminal residues then act as a "tethered ligand' to activate the receptor molecule (Vu et al. 1994).
- signaling through the thrombin receptor has been shown to result in numerous effects including stimulation of phospholipase C, mobilization of intracellular Ca ⁇ + and inhibition of adenylyl cyclase.
- the human thrombin receptor was amplified by PCR from pcDNA3:Hu-Thr9b-5' (Bristol Myers Squibb) using the following oligonucleotides:
- CY7467 exhibited LIRMA (ligand independent receptor mediated activation), that is, activation of the yeast pheromone pathway in the absence of ligand. It was determined that the yeast growth on selective media that resulted from LIRMA was eliminated by the addition of 2.5 millimolar concentrations of 3-aminotriazole (AT). AT is an inhibitor of the HIS3 gene product that serves to reduce background growth.
- the yeast strain CY1 141 (MATalpha farl* 1442 tbtl-1 fusl-HIS3 canl stel4::t ⁇ l ::LYS2 ste3*l 156 gpal(41)-Galphai2 lys2 ura3 leu2 t ⁇ l his3) was transformed with CADUS 2260 to yield strain CY7467, expressing the human thrombin receptor. CY7467 was inoculated to 10 mis of standard synthetic media (SD) lacking leucine (-Leu) and incubated overnight at 30 C.
- SD standard synthetic media
- the 10 ml overnight culture was used to inoculate 50 mis of YEPD media; this culture was incubated at 30 C for 4.5-5 hours at which time the cells were harvested and prepared for transformation with DNA encoding a random peptide library [alpha-NNK (6.24.94)] by electroporation.
- Post electroporation in 0.2 cm cuvettes, 0.25 mF, 200W, 1.5 kV the cells were immediately diluted in 1 ml ice-cold 1 M sorbitol and 1 OOmL aliquots were plated onto 10 synthetic media plates (pH6.8) lacking leucine and uracil (-Leu-Ura).
- the plates were incubated at 30 C for 2-4 days at which time two replicas of each original transformation plate were made to synthetic media (pH6.8) lacking leucine, uracil and histidine and supplemented with 2.5mM AT(-Leu-Ura-His+ 2.5mM AT).
- the replicas were incubated at 30 C for 3-5 days. Post incubation the colonies present on the replica sets of two were scraped from the plates into a total of 10 mis of H2O (5 mis each plate).
- the OD 0O of each cell suspension was determined and crude plasmid isolations were done on 8-16 OD units of cells for each pool. A total often pools resulted.
- the pellets obtained from these crude plasmid isolations were resuspended in 40mL of 10 mM Tris, 1 mM EDTA, pH8.0 and lmL was used to transform E. coli by electroporation (0.1 cm cuvettes, 0.25 mF, 200W, 1.8 kV). Post electroporation the cells were immediately diluted into 1 ml 2XYT media and incubated, with shaking, at 37 C for 30 minutes after which time the cells were used to inoculate 50 mis of 2xYT supplemented with 100 ug/ml ampicillin. The 10 resulting cultures were incubated at 37 C overnight.
- Plasmid DNA was isolated from each of these bacterial cultures using Qiagen columns (Qiagen, Inc., Chatsworth, CA). Each plasmid DNA pellet was resuspended in 50mL Tris lOmM, EDTA 1 mM, pH 8.0.
- Strain CY7467 was transformed with lmL of each plasmid pool by electroporation. Post electroporation the cells were diluted into 400mL IM sorbitol. From each electroporated cell suspension, lmL and 400mL of cells were plated on -Leu- Ura synthetic media, pH6.8 to yield "low density” and "high density” platings. The plates were incubated at 30 C for 3 days, at which time replicas of both the low and high density plates were made to -Leu-Ura-His+ 2.5mM AT.
- Plasmid DNA was isolated by miniprep from 3 ml 2XYT cultures of single bacterial colonies resulting from these transformations (three bacterial colonies for each DNA pool were processed in this way). DNAs deriving from three individual bacterial colonies per pool were resuspended in 20mL 10 M Tris 1 mM EDTA, pH8.0. The three DNAs derived per pool were sequenced and found to encode identical peptides. Thus three differing DNA sequences were derived, one representing each amplified pool. One plasmid representing each of the three original amplified pools was used to transform CY7467 (containing the thrombin receptor expression vector) and CY6263 (CY1141 containing a control expression vector lacking any receptor sequence) by electroporation.
- CADUS 1625 a control vector lacking sequences encoding a peptide was included and used to transform both the receptor+ and receptor- strains of yeast.
- CADUS 1651 a control vector lacking sequences encoding a receptor included and used to transform both the Iigand+ and ligand- strains of yeast.. Transformants were first selected on -Leu-Ura, pH6.8, then two yeast transformants of each type were patched to -Leu-Ura, pH6.8 to expand the colonies. Once expanded, streaks of the transformants were made on -Leu-Ura-FIis+ 2.5mM AT to test for growth in the absence of histidine.
- the peptide sequence encoded by this plasmid is: Val-Cys-Pro-Ala-Arg-Tyr-Val-Leu-Pro-Gly-Pro-Val-Leu (SEQ ID NO:45)and was encoded by the nucleotide sequence GTT TGT CCT GCG CGT TAT GTG CTG CCT GGG CCT GTT TTG . (SEQ ID NO:44)
- ATTORNEY/AGENT INFORMATION (A) NAME: DeCONTI , GIULIO A., JR.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Mycology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Saccharide Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP10515880A JP2001501097A (ja) | 1996-09-24 | 1997-09-24 | レセプターエフェクターを同定する方法及び組成物 |
| EP97944430A EP0929691B1 (en) | 1996-09-24 | 1997-09-24 | Methods and compositions for identifying receptor effectors |
| CA002266543A CA2266543C (en) | 1996-09-24 | 1997-09-24 | Methods and compositions for identifying receptor effectors |
| AT97944430T ATE284972T1 (de) | 1996-09-24 | 1997-09-24 | Verfahren und zusammensetzungen für die identifizierung von receptor effectoren |
| AU45930/97A AU733007B2 (en) | 1996-09-24 | 1997-09-24 | Methods and compositions for identifying receptor effectors |
| DE69731960T DE69731960T2 (de) | 1996-09-24 | 1997-09-24 | Verfahren und zusammensetzungen für die identifizierung von receptor effectoren |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US71891096A | 1996-09-24 | 1996-09-24 | |
| US08/718,910 | 1996-09-24 | ||
| US85146997A | 1997-05-05 | 1997-05-05 | |
| US08/851,469 | 1997-05-05 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO1998013513A2 true WO1998013513A2 (en) | 1998-04-02 |
| WO1998013513A3 WO1998013513A3 (en) | 1998-09-03 |
Family
ID=27109999
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1997/017159 Ceased WO1998013513A2 (en) | 1996-09-24 | 1997-09-24 | Methods and compositions for identifying receptor effectors |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US6159705A (cg-RX-API-DMAC7.html) |
| EP (1) | EP0929691B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2001501097A (cg-RX-API-DMAC7.html) |
| AT (1) | ATE284972T1 (cg-RX-API-DMAC7.html) |
| AU (1) | AU733007B2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2266543C (cg-RX-API-DMAC7.html) |
| DE (1) | DE69731960T2 (cg-RX-API-DMAC7.html) |
| WO (1) | WO1998013513A2 (cg-RX-API-DMAC7.html) |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999018211A1 (en) * | 1997-10-07 | 1999-04-15 | Cadus Pharmaceutical Corporation | Yeast cells expressing modified g proteins and methods of use therefor |
| WO1999063099A1 (en) * | 1998-06-02 | 1999-12-09 | Cadus Pharmaceutical Corporation | Functional expression of adenosine receptors in yeast |
| WO2000006722A1 (en) * | 1998-07-28 | 2000-02-10 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Eukaryotic cell-based gene interaction cloning |
| WO2000031261A3 (en) * | 1998-11-25 | 2000-07-27 | Cadus Pharmaceutical Corp | Methods and compositions for identifying effectors of the formyl peptide receptor like-1 (fprl-1) receptor |
| WO2001007642A1 (en) * | 1999-07-22 | 2001-02-01 | Becton, Dickinson And Company | Computer-assisted formulation of culture media |
| US6184016B1 (en) | 1997-06-11 | 2001-02-06 | New York University | Polypeptides having prenylcysteine carboxyl methyltransferase activity or inhibiting activity |
| US6251605B1 (en) | 1998-10-27 | 2001-06-26 | Cadus Pharmaceutical Corporation | Yeast cells having mutations in Cav1 and uses therefor |
| US6255059B1 (en) | 1993-03-31 | 2001-07-03 | Cadus Pharmaceutical Corporation | Methods for identifying G protein coupled receptor effectors |
| EP1015478A4 (en) * | 1997-02-06 | 2002-01-23 | Cornell Res Foundation Inc | Library screening as a strategy to clone drugs for g protein coupled receptors |
| US6355473B1 (en) | 1998-05-06 | 2002-03-12 | Cadus Pharmaceutical Corp. | Yeast cells having mutations in stp22 and uses therefor |
| JP2002527727A (ja) * | 1998-10-13 | 2002-08-27 | アリーナ・フアーマシユーチカルズ・インコーポレーテツド | 疾患の処置に有用な細胞表面膜受容体のモジュレーターを同定する方法 |
| US6504008B1 (en) * | 1999-02-01 | 2003-01-07 | Cadus Technologies, Inc. | Cell based signal generation |
| WO2002046369A3 (en) * | 2000-12-08 | 2003-03-13 | Septegen Ltd | Yeast-based assays involving gpcrs |
| WO2003002726A3 (en) * | 2001-06-28 | 2003-03-20 | Vlaams Interuniv Inst Biotech | Cellular reporter gene assay with a ligand amplifying feedback loop |
| WO2002050104A3 (en) * | 2000-12-01 | 2003-04-10 | Wyeth Corp | Methods and cells for detecting modulators of rgs proteins |
| US6555325B1 (en) | 1999-06-14 | 2003-04-29 | Cadus Technologies, Inc. | System for detection of a functional interaction between a compound and a cellular signal transduction component |
| EP1373496A4 (en) * | 2001-02-22 | 2004-10-27 | Praecis Pharm Inc | METHODS OF IDENTIFYING PEPTIDES MODULATING A BIOLOGICAL PROCESS |
| WO2003072600A3 (en) * | 2002-01-23 | 2005-01-27 | Gardner Rebecca Katherine | Methods of screening molecular libraries for active molecules that restore the function of target proteins and peptides that restore the function of mutant p53 |
| US6864060B1 (en) | 1993-03-31 | 2005-03-08 | Cadus Technologies, Inc. | Yeast cells expressing modified G proteins and methods of use therefor |
| US7081360B2 (en) | 1998-07-28 | 2006-07-25 | Cadus Technologies, Inc. | Expression of G protein-coupled receptors with altered ligand binding and/or coupling properties |
| US7105309B2 (en) | 1993-03-31 | 2006-09-12 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates and uses therefor |
| US7223533B2 (en) | 1999-09-10 | 2007-05-29 | Cadus Technologies, Inc. | Cell surface proteins and use thereof as indicators of activation of cellular signal transduction pathways |
| US7235648B1 (en) | 1993-03-31 | 2007-06-26 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor |
| US7250263B2 (en) | 1993-03-31 | 2007-07-31 | Cadus Technologies, Inc. | Methods and compositions for identifying receptor effectors |
| US7273747B2 (en) | 1998-08-27 | 2007-09-25 | Cadus Technologies, Inc. | Cell having amplified signal transduction pathway responses and uses therefor |
| US7416881B1 (en) | 1993-03-31 | 2008-08-26 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor |
| US11130979B2 (en) | 2017-06-20 | 2021-09-28 | Albumedix Ltd | Protein expression strains |
| US12371457B2 (en) | 2015-12-22 | 2025-07-29 | Sartorius Albumedix Limited | Protein expression strains |
Families Citing this family (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU743259B2 (en) * | 1997-04-14 | 2002-01-24 | Arena Pharmaceuticals, Inc. | A method of identifying modulators of cell surface membrane receptors useful in the treatment of disease |
| US7119190B2 (en) * | 1997-04-14 | 2006-10-10 | Arena Pharmaceuticals, Inc. | Endogenous and non-endogenous versions of human G protein-coupled receptors |
| US6897066B1 (en) * | 1997-09-26 | 2005-05-24 | Athersys, Inc. | Compositions and methods for non-targeted activation of endogenous genes |
| FR2780512B1 (fr) * | 1998-06-25 | 2003-10-17 | Lipha | Utilisation de recepteurs de la famille rev-erb pour le criblage de substances utiles dans le traitement des dysfonctionnements du metabolisme lipidique |
| US6472151B1 (en) * | 1998-08-19 | 2002-10-29 | Bristol-Myers Squibb Company | Method of screening for compounds that modulate the activity of a molecular target |
| DE19860833C1 (de) * | 1998-12-30 | 2000-09-07 | Albrecht E Sippel | Methode zur zellulären High-Throughput(Hochdurchsatz)-Detektion von Rezeptor-Liganden-Interaktionen |
| US6406863B1 (en) * | 2000-06-23 | 2002-06-18 | Genetastix Corporation | High throughput generation and screening of fully human antibody repertoire in yeast |
| CN1516706A (zh) * | 2001-02-26 | 2004-07-28 | 阿伦纳药品公司 | 人g蛋白偶联受体的内源性和非内源性形式 |
| AU2001243556A1 (en) * | 2001-03-12 | 2002-09-24 | Alydar Pharmaceuticals, Inc. | Screening non-peptide, non-steroid invertebrate pheromone compounds for mitogen-activated protein kinase modulating activity |
| WO2002077200A2 (en) * | 2001-03-27 | 2002-10-03 | Inscent, Inc | Efficient methods for isolating functional g-protein coupled receptors and identifying active effectors and efficient methods to isolate proteins involved in olfaction and efficient methods to isolate and identifying active effectors |
| US20070003980A1 (en) * | 2001-03-27 | 2007-01-04 | Woods Daniel F | Efficient methods to isolate effectors of proteins involved in olfactory or chemosensory pathways and efficient methods to use these effectors to alter organism olfaction, chemosensation, or behavior |
| US20100248268A1 (en) * | 2001-03-27 | 2010-09-30 | Woods Daniel F | Methods to utilize invertebrate chemosensory proteins for industrial and commercial uses |
| EP1399467A4 (en) * | 2001-05-09 | 2004-09-15 | Newbiotics Inc | PRODRUGS ACTIVATED BY PEPTIDDEFORMYLASE |
| US6833441B2 (en) | 2001-08-01 | 2004-12-21 | Abmaxis, Inc. | Compositions and methods for generating chimeric heteromultimers |
| NZ513755A (en) * | 2001-08-24 | 2001-09-28 | Ann Rachel Holmes | Protein expression system in yeast comprising a vector encoding a heterologous membrane protein and its application in screening for drugs |
| US20060105377A1 (en) * | 2001-08-30 | 2006-05-18 | Eglen Richard M | Screening to optimize RNAi |
| AU2002332724A1 (en) * | 2001-08-30 | 2003-03-18 | Discoverx, Inc. | Genetic construct intracellular monitoring system |
| US7358043B2 (en) * | 2001-10-16 | 2008-04-15 | Duke University | Proteomic interaction and genomic action determinations in the presence of associated redox state conditions |
| US7175983B2 (en) * | 2001-11-02 | 2007-02-13 | Abmaxis, Inc. | Adapter-directed display systems |
| US20040067532A1 (en) | 2002-08-12 | 2004-04-08 | Genetastix Corporation | High throughput generation and affinity maturation of humanized antibody |
| US7229762B2 (en) * | 2002-10-15 | 2007-06-12 | Duke University Medical Center | Proteomic screening for redox state dependent protein—protein interactions |
| JP2006511220A (ja) * | 2002-12-23 | 2006-04-06 | グライコフィ, インコーポレイテッド | 遺伝子発現のステロイド受容体調節 |
| US20040209246A1 (en) * | 2003-04-15 | 2004-10-21 | Agouron Pharmaceuticals, Inc. | Dual reporter/dye reduction methodology for evaluating antiviral and cytotoxicity of hepatitis C virus inhibitors |
| US7718363B2 (en) * | 2003-04-25 | 2010-05-18 | The Kenneth S. Warren Institute, Inc. | Tissue protective cytokine receptor complex and assays for identifying tissue protective compounds |
| US20050112551A1 (en) * | 2003-11-24 | 2005-05-26 | Agouron Pharmaceuticals, Inc. | Dual assay for evaluating activity and cytotoxicity of compounds in the same population of cells |
| WO2005055944A2 (en) | 2003-12-05 | 2005-06-23 | Cincinnati Children's Hospital Medical Center | Oligosaccharide compositions and use thereof in the treatment of infection |
| JP5392992B2 (ja) * | 2007-03-30 | 2014-01-22 | アズワン株式会社 | 自己リン酸化受容体のアゴニスト、アンタゴニストのスクリーニング方法、遺伝子組換え酵母 |
| US8877688B2 (en) | 2007-09-14 | 2014-11-04 | Adimab, Llc | Rationally designed, synthetic antibody libraries and uses therefor |
| EP3124497B1 (en) | 2007-09-14 | 2020-04-15 | Adimab, LLC | Rationally designed, synthetic antibody libraries and uses therefor |
| US12529164B2 (en) | 2007-09-14 | 2026-01-20 | Adimab, Llc | Rationally designed, synthetic antibody libraries and uses therefor |
| US20090203149A1 (en) * | 2008-02-13 | 2009-08-13 | General Electric Company | Enhanced methods for gas and/or vapor phase analysis of biological assays |
| DE102008064553B4 (de) | 2008-12-22 | 2015-05-13 | Technische Universität Dresden | Verfahren zum Nachweis und/oder zur Identifizierung hormonell wirksamer Substanzen |
| KR102318383B1 (ko) | 2010-07-16 | 2021-10-27 | 아디맵 엘엘씨 | 항체 라이브러리 |
| EP3394243A1 (en) * | 2015-12-22 | 2018-10-31 | Albumedix Ltd. | Improved protein expression strains |
| CN109071626A (zh) | 2016-02-24 | 2018-12-21 | 阿罗姆斯公司 | 用于检测气味、香味和味道的生物传感器 |
| US10209239B1 (en) | 2017-08-16 | 2019-02-19 | Aromyx Corporation | Method of making an aromagraph comprising ectopic olfactory receptors |
| CN110904123B (zh) * | 2019-01-07 | 2021-11-05 | 广西科学院 | 一种用于促进高产甘蔗糖蜜酒精发酵的菌株及其应用 |
| WO2025008607A1 (en) * | 2023-07-06 | 2025-01-09 | Imperial College Innovations Limited | Determining the effects of modified peptides |
Family Cites Families (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NZ207926A (en) * | 1983-04-25 | 1988-04-29 | Genentech Inc | Use of yeast #a#-factor to assist in expression of proteins heterologus to yeast |
| US4613572A (en) * | 1983-08-15 | 1986-09-23 | Kansas State University Research Foundation | Yeast BAR1 gene plasmid |
| US4880734A (en) * | 1984-05-11 | 1989-11-14 | Chiron Corporation | Eukaryotic regulatable transcription |
| GB8521496D0 (en) * | 1985-08-29 | 1985-10-02 | Ciba Geigy Ag | Repressible yeast promoters |
| WO1988010308A1 (en) * | 1987-06-24 | 1988-12-29 | Whitehead Institute For Biomedical Research | Pheromone-inducible yeast promoter |
| CA1340772C (en) * | 1987-12-30 | 1999-09-28 | Patricia Tekamp-Olson | Expression and secretion of heterologous protiens in yeast employing truncated alpha-factor leader sequences |
| EP0428000A1 (en) * | 1989-11-03 | 1991-05-22 | Abbott Laboratories | Fluorogenic substrates for the detection of proteolytic enzyme activity |
| US5283173A (en) * | 1990-01-24 | 1994-02-01 | The Research Foundation Of State University Of New York | System to detect protein-protein interactions |
| DK93990D0 (da) * | 1990-04-17 | 1990-04-17 | Carlsberg As | Fluorogene peptider og deres anvendelse ved bestemmelse af enzymatisk aktivitet |
| US5401629A (en) * | 1990-08-07 | 1995-03-28 | The Salk Institute Biotechnology/Industrial Associates, Inc. | Assay methods and compositions useful for measuring the transduction of an intracellular signal |
| DK0548165T3 (da) * | 1990-09-13 | 2001-07-16 | Univ Duke | Ekspression af G-proteinkoblede receptorer i gær |
| WO1994010300A1 (en) * | 1992-10-30 | 1994-05-11 | The General Hospital Corporation | Interaction trap system for isolating novel proteins |
| WO1994016100A1 (en) * | 1993-01-05 | 1994-07-21 | The Salk Institute For Biological Studies | Functional assays for the identification of ligands which modulate signal transduction |
| US5876951A (en) * | 1993-03-31 | 1999-03-02 | Cadus Pharmaceutical Corporation | Yeast cells engineered to produce pheromone system protein surrogates and uses therefor |
| DK0692025T3 (da) * | 1993-03-31 | 2002-02-11 | Cadus Pharmaceutical Corp | Gærceller, der er konstrueret således, at de producerer surrogater for proteiner i feromonsystemet, og anvendelser deraf |
| US5571688A (en) * | 1993-05-06 | 1996-11-05 | Mekalanos; John J. | Method of detecting gene expression |
| GB9310978D0 (en) * | 1993-05-27 | 1993-07-14 | Zeneca Ltd | Compounds |
| US5491084A (en) * | 1993-09-10 | 1996-02-13 | The Trustees Of Columbia University In The City Of New York | Uses of green-fluorescent protein |
| WO1995021191A1 (en) * | 1994-02-04 | 1995-08-10 | William Ward | Bioluminescent indicator based upon the expression of a gene for a modified green-fluorescent protein |
| CA2188950C (en) * | 1994-04-26 | 2001-07-03 | James R. Broach | Functional expression of mammalian adenylyl cyclase in yeast |
| DK0815257T3 (da) * | 1995-01-31 | 2002-04-22 | Bioimage As | Fremgangsmåde til karakterisering af biologisk aktive stoffer |
| GB9502830D0 (en) * | 1995-02-14 | 1995-04-05 | Ecole Polytech | Regulation of polypeptide production in cells |
| GB9504446D0 (en) * | 1995-03-06 | 1995-04-26 | Medical Res Council | Improvements in or relating to gene expression |
| US5610015A (en) * | 1995-03-23 | 1997-03-11 | Wisconsin Alumni Research Foundation | System to detect protein-RNA interactions |
| US6008373A (en) * | 1995-06-07 | 1999-12-28 | Carnegie Mellon University | Fluorescent labeling complexes with large stokes shift formed by coupling together cyanine and other fluorochromes capable of resonance energy transfer |
| US5569588A (en) * | 1995-08-09 | 1996-10-29 | The Regents Of The University Of California | Methods for drug screening |
-
1997
- 1997-09-24 AU AU45930/97A patent/AU733007B2/en not_active Ceased
- 1997-09-24 EP EP97944430A patent/EP0929691B1/en not_active Expired - Lifetime
- 1997-09-24 CA CA002266543A patent/CA2266543C/en not_active Expired - Fee Related
- 1997-09-24 AT AT97944430T patent/ATE284972T1/de not_active IP Right Cessation
- 1997-09-24 JP JP10515880A patent/JP2001501097A/ja not_active Ceased
- 1997-09-24 US US08/936,632 patent/US6159705A/en not_active Expired - Fee Related
- 1997-09-24 WO PCT/US1997/017159 patent/WO1998013513A2/en not_active Ceased
- 1997-09-24 DE DE69731960T patent/DE69731960T2/de not_active Expired - Fee Related
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6864060B1 (en) | 1993-03-31 | 2005-03-08 | Cadus Technologies, Inc. | Yeast cells expressing modified G proteins and methods of use therefor |
| US7611854B2 (en) | 1993-03-31 | 2009-11-03 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor |
| US7416881B1 (en) | 1993-03-31 | 2008-08-26 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor |
| US7361498B2 (en) | 1993-03-31 | 2008-04-22 | Cadus Technologies, Inc. | Yeast cells expressing modified G proteins and methods of use therefor |
| US7250263B2 (en) | 1993-03-31 | 2007-07-31 | Cadus Technologies, Inc. | Methods and compositions for identifying receptor effectors |
| US7235648B1 (en) | 1993-03-31 | 2007-06-26 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor |
| US7122305B2 (en) | 1993-03-31 | 2006-10-17 | Cadus Technologies, Inc. | Methods and compositions for identifying receptor effectors |
| US7105309B2 (en) | 1993-03-31 | 2006-09-12 | Cadus Technologies, Inc. | Yeast cells engineered to produce pheromone system protein surrogates and uses therefor |
| US6255059B1 (en) | 1993-03-31 | 2001-07-03 | Cadus Pharmaceutical Corporation | Methods for identifying G protein coupled receptor effectors |
| EP1015478A4 (en) * | 1997-02-06 | 2002-01-23 | Cornell Res Foundation Inc | Library screening as a strategy to clone drugs for g protein coupled receptors |
| US6432403B1 (en) | 1997-06-11 | 2002-08-13 | New York University | Antibodies to polypeptides having prenylcysteine carboxyl methlytransferase activity or inhibiting activity |
| US6184016B1 (en) | 1997-06-11 | 2001-02-06 | New York University | Polypeptides having prenylcysteine carboxyl methyltransferase activity or inhibiting activity |
| US6232108B1 (en) | 1997-06-11 | 2001-05-15 | New York University | Prenylcysteine carboxyl methyltransferase, DNA encoding same, and a method of screening for inhibitors thereof |
| WO1999018211A1 (en) * | 1997-10-07 | 1999-04-15 | Cadus Pharmaceutical Corporation | Yeast cells expressing modified g proteins and methods of use therefor |
| US6355473B1 (en) | 1998-05-06 | 2002-03-12 | Cadus Pharmaceutical Corp. | Yeast cells having mutations in stp22 and uses therefor |
| WO1999063099A1 (en) * | 1998-06-02 | 1999-12-09 | Cadus Pharmaceutical Corporation | Functional expression of adenosine receptors in yeast |
| US7081360B2 (en) | 1998-07-28 | 2006-07-25 | Cadus Technologies, Inc. | Expression of G protein-coupled receptors with altered ligand binding and/or coupling properties |
| WO2000006722A1 (en) * | 1998-07-28 | 2000-02-10 | Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw | Eukaryotic cell-based gene interaction cloning |
| US7273747B2 (en) | 1998-08-27 | 2007-09-25 | Cadus Technologies, Inc. | Cell having amplified signal transduction pathway responses and uses therefor |
| US7319009B2 (en) | 1998-10-07 | 2008-01-15 | Cadus Technologies, Inc. | Methods and compositions for identifying receptor effectors |
| JP2002527727A (ja) * | 1998-10-13 | 2002-08-27 | アリーナ・フアーマシユーチカルズ・インコーポレーテツド | 疾患の処置に有用な細胞表面膜受容体のモジュレーターを同定する方法 |
| US6251605B1 (en) | 1998-10-27 | 2001-06-26 | Cadus Pharmaceutical Corporation | Yeast cells having mutations in Cav1 and uses therefor |
| WO2000031261A3 (en) * | 1998-11-25 | 2000-07-27 | Cadus Pharmaceutical Corp | Methods and compositions for identifying effectors of the formyl peptide receptor like-1 (fprl-1) receptor |
| US7022513B2 (en) | 1999-02-01 | 2006-04-04 | Cadus Technologies, Inc. | Cell based signal generation |
| US6504008B1 (en) * | 1999-02-01 | 2003-01-07 | Cadus Technologies, Inc. | Cell based signal generation |
| US7090991B2 (en) | 1999-06-14 | 2006-08-15 | Cadus Technologies, Inc. | System for detection of a functional interaction between a compound and a cellular signal transduction component |
| US6555325B1 (en) | 1999-06-14 | 2003-04-29 | Cadus Technologies, Inc. | System for detection of a functional interaction between a compound and a cellular signal transduction component |
| WO2001007642A1 (en) * | 1999-07-22 | 2001-02-01 | Becton, Dickinson And Company | Computer-assisted formulation of culture media |
| US7223533B2 (en) | 1999-09-10 | 2007-05-29 | Cadus Technologies, Inc. | Cell surface proteins and use thereof as indicators of activation of cellular signal transduction pathways |
| WO2002050104A3 (en) * | 2000-12-01 | 2003-04-10 | Wyeth Corp | Methods and cells for detecting modulators of rgs proteins |
| WO2002046369A3 (en) * | 2000-12-08 | 2003-03-13 | Septegen Ltd | Yeast-based assays involving gpcrs |
| EP1373496A4 (en) * | 2001-02-22 | 2004-10-27 | Praecis Pharm Inc | METHODS OF IDENTIFYING PEPTIDES MODULATING A BIOLOGICAL PROCESS |
| WO2003002726A3 (en) * | 2001-06-28 | 2003-03-20 | Vlaams Interuniv Inst Biotech | Cellular reporter gene assay with a ligand amplifying feedback loop |
| WO2003072600A3 (en) * | 2002-01-23 | 2005-01-27 | Gardner Rebecca Katherine | Methods of screening molecular libraries for active molecules that restore the function of target proteins and peptides that restore the function of mutant p53 |
| US8304211B2 (en) | 2002-01-23 | 2012-11-06 | Mohamed Raafat El-Gewely | Methods of screening molecular libraries and active molecules identified thereby |
| US12371457B2 (en) | 2015-12-22 | 2025-07-29 | Sartorius Albumedix Limited | Protein expression strains |
| US11130979B2 (en) | 2017-06-20 | 2021-09-28 | Albumedix Ltd | Protein expression strains |
| US11396670B2 (en) | 2017-06-20 | 2022-07-26 | Albumedix Limited | Protein expression strains |
Also Published As
| Publication number | Publication date |
|---|---|
| AU733007B2 (en) | 2001-05-03 |
| ATE284972T1 (de) | 2005-01-15 |
| WO1998013513A3 (en) | 1998-09-03 |
| JP2001501097A (ja) | 2001-01-30 |
| EP0929691B1 (en) | 2004-12-15 |
| DE69731960D1 (de) | 2005-01-20 |
| AU4593097A (en) | 1998-04-17 |
| CA2266543A1 (en) | 1998-04-02 |
| DE69731960T2 (de) | 2005-12-15 |
| US6159705A (en) | 2000-12-12 |
| EP0929691A2 (en) | 1999-07-21 |
| CA2266543C (en) | 2003-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0929691B1 (en) | Methods and compositions for identifying receptor effectors | |
| US6255059B1 (en) | Methods for identifying G protein coupled receptor effectors | |
| US7105309B2 (en) | Yeast cells engineered to produce pheromone system protein surrogates and uses therefor | |
| EP0692025B1 (en) | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor | |
| US5789184A (en) | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor | |
| US7319009B2 (en) | Methods and compositions for identifying receptor effectors | |
| US20080268475A1 (en) | Yeast cells expressing modified g proteins and methods of use therefor | |
| JP2009143932A (ja) | 改変g蛋白質を発現する酵母細胞及びそれらの利用方法 | |
| US5876951A (en) | Yeast cells engineered to produce pheromone system protein surrogates and uses therefor | |
| US7250263B2 (en) | Methods and compositions for identifying receptor effectors | |
| US7273747B2 (en) | Cell having amplified signal transduction pathway responses and uses therefor | |
| US7022513B2 (en) | Cell based signal generation | |
| US6355473B1 (en) | Yeast cells having mutations in stp22 and uses therefor | |
| US6251605B1 (en) | Yeast cells having mutations in Cav1 and uses therefor | |
| US7611854B2 (en) | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor | |
| US7235648B1 (en) | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor | |
| AU7169600A (en) | Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE GH HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT |
|
| ENP | Entry into the national phase |
Ref document number: 2266543 Country of ref document: CA Ref country code: CA Ref document number: 2266543 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1998 515880 Kind code of ref document: A Format of ref document f/p: F |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1997944430 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1997944430 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1997944430 Country of ref document: EP |