WO1998010078A2

WO1998010078A2 - CLONING OF FULL-LENGTH HUMAN PEX cDNA

Info

Publication number: WO1998010078A2
Application number: PCT/CA1997/000617
Authority: WO
Inventors: Andrew C. Karaplis; David Goltzman; Janet E. Henderson; Mark L. Lipman; Dibyendu Panda; Yingnian Shen
Original assignee: Karaplis Andrew C; David Goltzman; Henderson Janet E; Lipman Mark L; Dibyendu Panda; Yingnian Shen
Priority date: 1996-09-05
Filing date: 1997-09-04
Publication date: 1998-03-12
Also published as: WO1998010078A3; AU4107397A; CA2264955A1

Abstract

The present invention relates to the cloning of full-length human PEX cDNA isolated from tumors causing oncogenous hypophosphatemia osteomalacia, uses of PEX active site for the design of drugs to inhibit protein activity in cases of hyperphosphatemia or chronic renal failure, uses of the PEX active site as a target for the treatment of hyperphosphatemia or chronic renal failure and uses in the diagnosis of hyperphosphatemia or chronic renal failure, use of PEX for the design of drugs to inhibit protein activity in cases of hyperphosphatemia or chronic renal failure, use of PEX as a target for the treatment of hyperphosphatemia, chronic renal failure, hypophosphatemia or idiopathic hypercalcuria, and use of PEX in the diagnosis of hyperphosphatemic states, chronic renal failure, hypophosphatemic states or idiopathic hypercalcuria.

Description

CLONING OF FULL-LENGTH HUMAN PEX cDNA

BACKGROUND OF THE INVENTION (a) Field of the Invention

The invention relates to the cloning of full- length human PEX cDNA isolated from tumors causing oncogenous hypophosphatemia osteomalacia, uses of PEX active site for the design of drugs to inhibit protein activity in cases of hyperphosphatemia or chronic renal failure, uses of the PEX active site as a target for the treatment of hyperphosphatemia or chronic renal failure and uses in the diagnosis of hyperphosphatemia or chronic renal failure, use of PEX for the design of drugs to inhibit protein activity in cases of hyperphosphatemia or chronic renal failure, use of PEX as a target for the treatment of hyperphosphatemia, chronic renal failure, hypophosphatemia or idiopathic hypercalcuria, and use of PEX in the diagnosis of hyperphos- phatemic states, chronic renal failure, hypophos- phatemic states or idiopathic hypercalcuria.

( ) Description of Prior Art

Oncogenous hypophosphatemic osteomalacia (OHO) is a rare acquired disease characterized by severe hypophosphatemia, inappropriate phosphaturia, reduced vitamin D levels, and defective bone mineralization (Ryan, E.A. and Reiss, E., 1984, The -Ameri can Journal of Medi cine, 77:501-512). This syndrome is associated with a variety of histologically distinct, usually benign, mesenchymal tumors. Resection of the tumor reverses the metabolic abnormalities and results in cure of the bone disease. It has been postulated that a phosphaturic factor produced by these tumors promotes the renal phosphate loss, which in turn results in osteomalacia. The putative phosphaturic factor may also inhibit the renal conversion of 25-hydroxyvitamin D3 to 1, 25-dihydroxy-vitamin D3. Depressed 1,25-dihy- droxyvitaminD3 levels and chronic phosphate depletion may act synergistically to produce osteomalacia in these patients. The nature of the phosphaturic substance remains unknown and is distinct from parathyroid hormone and calcitonin, two polypeptide hormones known to inhibit the tubular reabsorption of phosphorus.

X-linked hypophosphatemia (HYP) is an inherited disorder of phosphate homeostasis with biochemical and physical findings very similar to OHO (Scriver, CR. and Tenenhouse, H.S., 1992, J. Inher. Metab . Dis . , 15:610-624). By positional cloning, a gene which spans the deleted region Xp22.1 in HYP patients, or is mutated in non-deletion patients has been identified and its partial cDNA sequence reported. This gene exhibits homology to a family of endopeptidase genes involved either in activation or degradation of a number of peptide hormones and has been named PEX (phosphate regulating gene with homologies to endopep- tidases, on the X chromosome) (The HYP Consortium, 1995, Na ture Genetics , 11:130-136).

It would be highly desirable to be provided with a means to inhibit protein activity in cases of hyperphosphatemia, to be provided with a target for the treatment of hyperphosphatemia and to be provided with a diagnostic tool for hyperphosphatemic states.

SUMMARY OF THE INVENTION One aim of the present invention is to employ the PEX active site of the design of drugs to inhibit protein activity in cases of hyperphosphatemia.

Another aim of the present invention is to employ the PEX active site as a target for the treat- ment of hyperphosphatemic or hypophosphatemic disorders such as chronic renal failure, or idiopathic hypercalcuria, respectively.

Another aim of the present invention is to employ the PEX active site in the diagnosis of hyper- phosphatemic and hypophosphatemic disorders.

The availability of full length PEX cDNA provides us with an unprecedented opportunity to study the biology of PEX and evaluate its role in conditions such as OHO, idiopathic hypercalcuria, HYP (a hypophos- phatemic disorder) and in common pathological states characterized by impaired phosphate excretion including the large and expanding population of patients with chronic renal failure.

In accordance with the present invention there is provided a recombinant PEX protein generated from cloned cDNA depicted in Figs. 1A to 1G .

In accordance with the present invention there is provided a polyclonal or monoclonal antibody raised against the PEX active site which consists of at least amino acid residue 579 to residue 749 illustrated in

Figs. 1A to 1G.

In accordance with the present invention there is provided a method for the design of drugs to be used as competitive inhibitors or activators of PEX enzy- matic activity and/or its receptor in cases of hyperphosphatemia (as in chronic renal failure) or hypophosphatemia, which comprises the steps of: a) developing a radiolabeled or fluorescent-labeled metalloendopeptidase substrate which reversibly or irreversibly binds PEX; and b) using PEX and the labeled ligand to screen an expression library for an endogenous protein which binds PEX; or

-using labeled PEX to examine its competitive binding to a receptor ; or -using labeled recombinant PEX to screen an expression library in order to clone its receptor.

In accordance with the present invention there is provided a method for the treatment of hyperphosphatemia or of chronic renal failure which comprises administering to a patient an effective amount of a pharmaceutical compound targeted to inhibit PEX active site and/or its receptor.

In accordance with the present invention there is provided a method for the diagnosis of hyperphos- phatemic or hypophosphatemic conditions in patient, which comprises the steps of : a) preparing a solid support having bound thereto at least one of the anti-PEX antibody of the present invention, the recombinant PEX protein of the present invention, or the active site thereof; b) screening a biological sample of the patient on the solid support; and c) detecting the presence of PEX protein or PEX antibody in the sample, thereby indicating the presence of hyperphosphatemic or hypophosphatemic conditions.

In accordance with the present invention there is provided a transgenic mouse in which the wild type and mutant PEX cDNA depicted in Figs. 1A to 1G has been inserted into the murine genome to cause alterations in blood and urine phosphate and the murine counterpart of HYP and OHO. Such a transgenic mouse may be used to study the biology of PEX protein in vivo and its ability to reverse biochemical and physical abnormalities associated with HYP in mice and patients in the form of gene therapy. In accordance with the present invention there is provided a method for the treatment of cancer which comprises determining the role of PEX in tumor growth by assessing its activity and/or prenylation during neoplastic transformation and using drug design to create novel anticancer treatments which interfere with PEX protein function.

BRIEF DESCRIPTION OF THE DRAWINGS Figs. 1A-1G illustrate the nucleotide sequence and predicted amino acid sequence of tumor PEX cDNA;

Figs. 2A-2C illustrate the amino acid homology between PEX and human NEP cDNA with the sequence comparison performed by LALIGN (a computer program designed to maximally align two different protein sequences ) ; and

Fig. 3 illustrates the hydropathy plot of PEX cDNA.

DETAILED DESCRIPTION OF THE INVENTION

In accordance with the present invention, PEX expression in tumors associated with the syndrome (OHO) was examined.

We have used the PCR technique to clone and characterize full-length human PEX cDNA from two tumors associated with OHO and have determined its normal fetal and adult tissue distribution. We show that full- length human PEX cDNA encodes a 749 amino acid protein (Figs. 1A-1G) with extensive homology to the human neu- tral endopeptidase (Fig. 2) (NEP; EC 3.4.24.11), suggesting that PEX is a metalloendopeptidase . The additional sequences provided by our PEX cDNA clone include 603 nucleotides of the 5' noncoding region, the first 3 and the last 108 amino acids of the protein, comprising residues postulated to be critical for the formation of the active site of the protein and hence its enzymatic activity, the termination codon, as well as 276 nucleotides of the 3' noncoding region, including the polyadenylation signal. We also show that PEX has a cleavable signal sequence and a consensus sequence for prenylation of the protein at its carboxyl terminal.

In summary, the cloning of the full-length human PEX cDNA from tumors causing OHO is reported in the present invention. The availability of this cDNA opens new and exciting avenues of investigation in a number of clinical specialties, such as endocrinology, nephrology, and oncology. The biology of PEX will be evaluated in conditions such as OHO, idiopathic hypercalcuria, and HYP.

Tumor Tissues

Tumor tissues were removed from two patients with well-documented OHO. Resection of the tumors resulted in the complete reversal of the biochemical and physical abnormalities associated with the syndrome. Tumor tissue was frozen immediately in liquid nitrogen and stored at -70°C.

PEX Expression in OHO-associated tumors To determine whether PEX is expressed in tumors associated with OHO, RNA was extracted from tumor tissue using Qiagen RNeasy Kit™ and reversed transcribed using oligodT primer and Superscript II (BRL) reverse transcriptase for 1 hour at 42 °C in a final reaction volume of 30 μl . The resulting cDNA was then amplified using human PEX-specific primers, PEX 1 ( 5 ^• GGAGGAATTGGTTGAGGGCG 3 ' ) and PEX 2 (5' GTAGACCACCAAGGATCCAG 3'). Following amplification (35 cycles) the PCR reaction was fractionated on a 1% agarose gel stained with ethidium bromide. PEX mRNA was readily amplified from both samples demonstrating the expected 509 bp amplified fragment, as predicted from the published partial sequence.

Cloning of full-length PEX cDNA from tumors Cloning of the 5 ' end of PEX cDNA was accomplished by anchored PCR. Total cellular RNA was initially extracted from tumor tissue followed by the isolation of mRNA. 1.5 μg of mRNA was then reverse transcribed into cDNA using 200 ng of a PEX specific antisense oligomer (PEX 2) and 200 units of Superscript II (BRL) reverse transcriptase for 1 hour at 42 °C in a final reaction volume of 30 μl . The resulting cDNA was size fractionated on a 1% agarose gel and fragments corresponding to >600 bp were purified and resuspended in H2O. The 3' end of the first strand cDNA was homopolymer tailed with dGTP using 1 μl of Terminal deoxynucleotidyl transferase ( TdT ) at 37°C for 30 minutes in a volume of 50 μl . Following heat inacti- vation of the enzyme, RNA template was removed by incu- bation with RNase H and the tailed cDNA was purified by phenol-chloroform extraction followed by ammonium acetate precipitation. The purified tailed cDNA was resuspended in H2O and an aliquot was used for anchored PCR along with 200 ng of an internal PEX specific antisense primer (PEX 3, 5' CGTGCCCAGAACTAGGGTGCCACC 3') and 200 ng of oligodC as the sense primer. Forty cycles of PCR were performed using 0.5 μl of Taq polymerase (Promega) in a reaction volume of 50 μl . Cycling parameters were: 1 minute of denaturation at 95 °C, 2 minutes of annealing at 55°C and 2 minutes of extension at 72°C. The PCR products were fractionated on a 1% agarose gel and a band of 700 bp was isolated, purified, and ligated into pPCRII vector ( Invitrogen) . Following transformation into HB101 bacteria, clones containing the appropriate size insert were sequenced using Sequenase kit (US Biochem). To clone the 3' end of PEX cDNA, an aliquot of an amplified unidirectional cDNA library in pCDNA3 vector (Invitrogen) generated from tumor mRNA was grown overnight in LB medium and plasmid DNA extracted. DNA (0.5 μg ) was subjected to PCR using a PEX-specific sense oligomer (PEX1) and an antisense oligomer corresponding to SP6 RNA polymerase binding site sequences present in the pCDNA3 vector. Thirty five cycles of amplification were performed in a 50 μl reaction volume with each cycle consisting of 1 min. denaturation at 94°C, 1 min. annealing at 55°C and 1 min. extension at 72 °C. Amplified products were fractionated on a 1% agarose gel and a 1.2 kb fragment corresponding to the 3' end of PEX cDNA was subcloned and sequenced. Figs. 1A-1G show the nucleotide and predicted amino acid sequence of the full-length PEX cDNA cloned from tumor tissue. In both tumors, there were three amino acids that differ from the published partial PEX sequence, ³⁶³D->A(GAC to GCC), ⁰³R->W(AGG to TGG ) , and ^{6 1}A->G(GCG to GGA). Full-length human PEX cDNA encodes 749 amino acids and has extensive homology to the human neutral endopeptidase (Fig. 2) (NEP; EC 3.4.24.11), suggesting that PEX is a metalloendopeptidase. The additional sequences provided by our PEX cDNA clone include 603 nucleotides of the 5' noncoding region, as well as the first 3 and the last 108 amino acids of the protein. These additional amino acids comprise residues that may be critical for the formation of the active site of the protein and hence its enzymatic activity, such as ⁶⁴²E, ⁷¹⁰H, and 693 , 733 , 746_c . _{0ur PEX c}ι_one also identifies the termination codon, as well as 276 nucleotides of the 3' noncoding region, including the polyadenylation signal. Hydropathy plot and PSORT analysis of the PEX protein identified a putative cleavable signal sequence composed of the first 49 amino acids, implicating amino acid 50 at the beginning of the mature protein (Fig. 3). This contrasts with the human NEP sequence that does not have a cleavable signal sequence. PEX protein has also been shown to have a carboxyl terminal motif (CAAX box: CRLW) that may direct prenylation of the protein, a post-transla- tional modification that may be important in neoplastic processes, and could be targeted for pharmacological manipulation .

Northern-blot analysis

Total RNA was prepared from human Saos-2 osteosarcoma cells by Trizol™ and polyA+ RNA was isolated using standard procedures. Twenty micrograms of PolyA+ RNA were fractionated on 1% denaturing agarose gel, transferred to nylon membrane and probed with 32p_ labeled human PEX cDNA. The blot was washed in 0.1 X SSC at 55°C for 20 min., and subjected to autoradio- graphy for 7 days. To monitor loading, the membrane was re-probed with an GAPDH cDNA probe. In these cells, a single weak transcript was detected with mobility slightly faster than 28S RNA, consistent with the predicted size from the cloned PEX cDNA (~3.1 kb) and a more intense signal was observed of ~6.6 kb size.

Tissue Distribution of PEX mRNA

Recent studies have not documented the presence of PEX mRNA in normal tissues except for fetal brain and human leukocytes (The HYP Consortium, 1995, Na ture Genetics, 11:130-136). Following the cloning of full- length PEX, we examined PEX expression in normal fetal and adult tissues and in a number of established human cell lines using RT-PCR. PEX was found to be expressed in fetal calvarium (bone) and to a lesser degree in fetal kidney and muscle while no expression was apparent in fetal liver. In adult tissues, PEX mRNA was identified in kidney, but not in liver, or endomyocar- dium. Interestingly, weak expression was evident in tissue from an atrial myxoma, a tumor of mesenchymal origin and in renal cell carcinoma, an epithelial tumor. A number of established human cell lines were also shown to express PEX, including the Saos-2 osteosarcoma cells.

In vi tro transcription and translation

Plasmid pPEX was linearized at the Xhol site of the polylinker region and sense RNA strand was transcribed using T7 RNA polymerase. Translation reactions in rabbit reticulocyte lysate were performed according to the manufacturer's (Promega) procedure either in the absence or presence of canine pancreas microsomal mem- branes . Samples were processed for SDS-polyacrylamide gel electrophoretic (PAGE) analysis of the peptides, and autoradiography were performed. In the absence of microsomal membranes, PEX cRNA was translated into a ~82kD protein. Following the addition of microsomal membranes, two translated products of higher molecular weight were apparent, consistent with N-glycosylation of PEX (nine potential sites).

The present invention will be more readily understood by referring to the following examples which are given to illustrate the invention rather than to limit its scope.

EXAMPLE I Uses of recombinant PEX protein

Recombinant PEX protein will be generated from the cloned cDNA and an assay will be developed to clone the PEX substrate and/or PEX receptor which may also have important biological functions. For this assay, a soluble form of PEX protein will be used to bind a fluorescent substrate and conditioned media from COS cells transfected with various cDNA expression libraries will be used to compete with the substrate for the PEX protein. Step-wise analysis will lead to identification of the cDNA encoding the physiological substrate of PEX. Other studies will determine if radiolabeled recombinant PEX interacts with a specific receptor and if so, the receptor will be cloned by expression cloning .

EXAMPLE II Uses of specific anti-PEX antibody

Specific PEX antibodies will be generated for developing assays that will measure circulating levels of this peptide in various clinical states such as chronic renal failure.

EXAMPLE III Competitive inhibitors or activators of

PEX enzymatic activity

Other studies will concentrate on the role of

PEX in common pathological states characterized by impaired phosphate excretion, as in patients with chronic renal failure. These patients develop hyperphosphatemia that causes a number of complications such as ectopic calcifications, secondary hyperparathyroid- ism and inevitable metabolic bone disease leading to increased morbidity and mortality. The potential therapeutic value of pharmacological manipulation of PEX in this condition will be examined by designing competitive inhibitors or activators of its enzymatic activity and/or its receptor, and studying their effects, first in animal models of chronic renal failure, and eventually in patients.

EXAMPLE IV Gene transfer using PEX cDNA

In animal studies, we will use the technique of gene transfer to introduce normal and mutated PEX cDNA in normal mice and in mice with the murine counterpart of HYP to study the biology of the protein and its ability to reverse the biochemical and physical abnormalities associated with the latter disorder. Potentially, these experiments can be extended for therapeutic purposes to patients with HYP as well as other disorders of phosphate homeostasis.

EXAMPLE V Role of PEX in tumors

Finally, studies will also be directed in defining the role of PEX in tumor growth by assessing its activity and/or prenylation during neoplastic transformation. Prenylation is necessary for association with the plasma membrane and cell transformation. The critical role of prenylation can be exploited by the use of rational drug design to create novel anti- cancer treatments that interfere with PEX protein function .

While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth, and as follows in the scope of the appended claims .

Claims

WE CLAIM;

1. Recombinant PEX protein generated from cloned cDNA depicted in Figs. 1A to 1G.

2. A polyclonal or monoclonal antibody raised against the PEX active site which consists of at least amino acid residue 579 to residue 749 illustrated in Figs. 1A to 1G.

3. A method for the design of drugs to be used as competitive inhibitors or activators of PEX enzymatic activity and/or its receptor in cases of hyperphosphatemia (as in chronic renal failure) or hypophosphatemia, which comprises the steps of: a) developing a radiolabeled or fluorescent-labeled metalloendopeptidase substrate which reversibly or irreversibly binds PEX; and b) using PEX and said labeled ligand to screen an expression library for an endogenous protein which binds PEX; or using labeled PEX to examine its competitive binding to a receptor ; or using labeled recombinant PEX of claim 1 to screen an expression library in order to clone its receptor.

4. A method for the treatment of hyperphosphatemia or of chronic renal failure which comprises administering to a patient an effective amount of a pharmaceutical compound targeted to inhibit PEX active site and/or its receptor.

5. A method for the diagnosis of hyperphosphatemic or hypophosphatemic conditions in patient, which comprises the steps of : a) preparing a solid support having bound thereto at least one of the antibody of claim 2, the recombinant PEX protein of claim 1, or the active site thereof; b) screening a biological sample of the patient on said solid support; and c) detecting the presence of PEX protein or PEX antibody in said sample, thereby indicating the presence of hyperphosphatemic or hypophosphatemic conditions.

6. A transgenic mouse in which the wild type and mutant PEX cDNA depicted in Figs. 1A to 1G has been inserted into the murine genome to cause alterations in blood and urine phosphate in the murine counterpart of HYP and OHO.

7. The use of the mouse of claim 6 to study the biology of PEX protein in vi vo and its ability to reverse biochemical and physical abnormalities associated with HYP in mice and patients in the form of gene therapy.

8. A method for the treatment of cancer which comprises determining the role of PEX in tumor growth by assessing its activity and/or prenylation during neoplastic transformation and using drug design to create novel anticancer treatments which interfere with PEX protein function.