WO1998001561A1 - VACCIN PURIFIE CONTRE $i(STREPTOCOCCUS EQUI) - Google Patents

VACCIN PURIFIE CONTRE $i(STREPTOCOCCUS EQUI) Download PDF

Info

Publication number
WO1998001561A1
WO1998001561A1 PCT/IE1997/000046 IE9700046W WO9801561A1 WO 1998001561 A1 WO1998001561 A1 WO 1998001561A1 IE 9700046 W IE9700046 W IE 9700046W WO 9801561 A1 WO9801561 A1 WO 9801561A1
Authority
WO
WIPO (PCT)
Prior art keywords
fibrinogen
binding protein
equi
protein
fgbp
Prior art date
Application number
PCT/IE1997/000046
Other languages
English (en)
Inventor
Mary Christine Meehan
Peter Owen
Original Assignee
The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin filed Critical The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin
Priority to AU31877/97A priority Critical patent/AU3187797A/en
Publication of WO1998001561A1 publication Critical patent/WO1998001561A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the invention relates to a fibrinogen-binding protein of Streptococcus equi and to the use of the purified protein in the preparation of a vaccine against 5. equi infection in horses.
  • Strangles is one of the most important infectious diseases affecting horses. It is of major economic importance to the racing and thoroughbred industry. Strangles is caused by the bacterium Streptococcus equi also known as Streptococcus equi subsp. equi (a group C streptococcus), affects the upper respiratory tract and is highly contagious. Horse to horse spread often leads to large outbreaks with many animals infected. Even horses with mild forms of the disease must be isolated and removed from training, stud or other heavy work for up to three months. Existing vaccines have poor efficacy (Yelle, 1987; Timoney, 1988). The present invention involves the development of a novel and efficacious vaccine against the disease and is based on a novel, high molecular-weight (M ) protective antigen which has fibrinogen-binding properties i.e. an M-like protein.
  • M high molecular-weight
  • M proteins The main protective antigen of 5. equi is thought to be an M protein.
  • the best characterized M proteins are those of the group A streptococcus, Streptococcus pyogenes.
  • M proteins are members of a broad family of proteins from Gram-positive bacteria. These proteins are associated with the cell wall and are thus generally called cell-wall- associated proteins. They are surface exposed and usually interact with various factors present in the extracellular matrix of mammalian tissues and in body fluids. These factors include collagen, complement components, antibodies, fibrinogen (Fg), fibronectin, kininogen, laminin, 2-macro-globulin, plas in, prothro bin and salivary glycoproteins. Cell-wall-associated proteins, although quite distinctive, share some common features.
  • these proteins are usually o ⁇ -helical coiled-coil dimers, the N-terminal halves of which project from the cell as fibri liar-type structures.
  • the N-terminal signal sequences usually show significant homologies.
  • the C-terminal regions which are responsible for anchoring these proteins to the bacterial cell wall and membrane also show some homology. For example, there is usually a pro/gly rich region followed by a highly conserved Lys-Pro-X-Thr-Gly-X (LPXTGX) motif, a stretch of about 20 hydrophobic residues and a short tail of predominantly charged residues.
  • LPXTGX Lys-Pro-X-Thr-Gly-X
  • many of these proteins possess tandemly repeated sequences. Where a protein shows a number of distinct repeats, these are normally distinguished by letters e.g. A repeats, B repeats etc. (Fischetti, 1991; Goward et al., 1993).
  • M protein was a name given to a group of proteins of S. pyogenes. These proteins conferred on the bacterium the ability to resist phagocytic killing and they were also thought to be involved in adhesion to host surfaces. These two properties are thought to be due in part to two characteristic binding functions of M proteins i.e. the ability to bind fibrinogen and complement factor H. In addition to these binding functions, M proteins also undergo phase and antigenic variation, and up to 80 different serotypes have been discerned (Fischetti, 1991).
  • mutanolysin extracts there are two reacting bands in the 58-kDa region and a higher molecular mass band of 120 kDa.
  • the 58-, 46-, 41- and 29-kDa proteins possess the same N-terminal amino acid sequence (data not shown in Timoney & Mukhtar, 1993). Timoney's group suggest that the 58-kDa protein is the native M-protein, that the lower molecular weight reacting bands are peptide fragments i.e.
  • M-protein of S. equi has been implicated in inhibition of phagocytosis. Recent evidence suggests that resistance to phagocytosis may be related to the ability of M-protein to interfere with the deposition of equine complement on the cell surface (Boschwitz & Timoney, 1994a). These authors have also provided some additional evidence that binding of fibrinogen to S. equi cells has some anti-phagocytic activity.
  • M-protein may bind fibrinogen since a strain of 5. equi expressing low levels of M-protein bound- 64% less fibrinogen than another strain expressing normal M-protein levels (Boschwitz & Timoney, 1994b). However, binding of fibrinogen to a defined molecular species has not been shown.
  • a mouse model has also been used to test the protective potential of streptococcal extracts and of immunoglobulin preparations. Acid-extracted M-protein (containing the mixture of immunologically-reactive species described above) and monoclonal antibodies generated to this preparation have been shown to afford 60-80% protection in a mouse model (Timoney & Trachman, 1985; Jean-Francois et al., 1991). Efforts were also undertaken to clone the gene encoding M-protein (Galan & Timoney, 1987, Timoney et al., 1991).
  • M-protein of 5 In contrast to the M-protein of 5. pyogenes a variety of evidence suggests that there is only one serotype of M-protein from S. equi. This includes evidence from precipitin and passive protection experiments, sensitivity to bactericidal serum, immunoblot and M analysis, DNA restriction analysis and Southern blot analysis (see Galan & Timoney, 1988)
  • the antigenic material to be used in this invention can be inactivated whole organisms or appropriate extracts prepared from these organisms or recombinant DNA or synthetic peptides. It is stated that the preferred technique for preparing antigenic material is by enzyme extraction using enzymes such as pepsin, lysozyme or mutanolysin and to follow the enzyme extraction with treatment with an anionic detergent such as SDS.
  • the object of the present invention is to provide a cheap, effective vaccine against S. equi infection or strangles of horses.
  • a further object is to provide a defined subunit vaccine against strangles. It is also an object to isolate a protective cell-wall- associated protein from 5. equi, and to purify this protein to homogeneity. An additional objective is to isolate the gene encoding the said protein.
  • fibrinogen- binding protein isolated from S. equi subspecies equi having the following characteristics:- ( 1) i t mi grates on Laemml i SDS-PAGE gel s with an apparent molecul ar weight of approximately 220 , 000 ,
  • the fibrinogen-binding protein is preferably associated with the cell wall of 5. equi.
  • the fibrinogen-binding protein may be a multimeric alpha-helical coiled-coil structure, the individual monomers having a molecular weight of approximately 55,000.
  • the fibrinogen-binding protein comprises an amino acid sequence selected from (1) NSEVSRTATPRL and (2) LQKAKDERQALTESFNKTLS.
  • the invention also provides an 5. equi fibrinogen-binding protein which comprises the nucleotide sequence as shown in Figures 15 or 18.
  • the invention further provides a DNA fragment selected from fragments as deposited at The National Collections of Industrial and Marine Bacteria, St. Machar Drive, Aberdeen, Scotland under the Accession Numbers NCIMB 40807 on 25th June 1996, and NCIMB 40883 on 19th June 1997 encoding the 5.
  • equi fibrinogen-binding protein or a fragment substantially similar thereto also encoding S. equi fibrinogen-binding protein and/or Strangles protective activity.
  • the invention further relates to a host cell comprising a DNA fragment as described above and to a method of producing a fibrinogen-binding protein comprising culturing a host cell containing the said DNA fragment and isolating the protein from the culture.
  • the invention provides a method of producing an 5. equi fibrinogen-binding protein comprising the steps:-
  • suitable truncate is meant a fibrinogen-binding protein derivative which is lacking the C-terminal segment responsible for anchoring the protein to the cell envelope.
  • Such a truncate would not be capable of binding to the cell wall since it would be lacking its cell wall/membrane anchor domains, and would thus be secreted into the supernatant, simplifying the purification procedure.
  • the fibrinogen-binding protein or truncate may be isolated in a cell- free supernatant fraction by either (a) lysis of the host cell followed by centrifugation or by any of a number of filtration methods known in the art, or by (b) isolation of the culture supernatant by centrifugation or by any of a number of filtration methods known in the art.
  • the fibrinogen-binding protein or truncate may be purified by fibrinogen- affinity chromatography or other chromatographic procedures known in the art.
  • the invention further provides a vaccine comprising a fibrinogen- binding protein as defined above or whenever produced by a method as described above.
  • the invention also provides an S. equi fibrinogen-binding protein as defined above for use in the preparation of a vaccine against Strangles infection in horses.
  • substantially similar herein is meant DNA fragments encoding fibrinogen-binding activity which have sufficient sequence identity or homology to the deposited DNA fragments, by virtue of the degeneracy of the genetic code or by virtue of mutation, to hybridise therewith and to bind fibrinogen and to protect against 5. equi infection or Strangles in horses.
  • Figure 1 Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and fibrinogen-affinity blotting analysis of proteins released from purified cell walls of S. equi following treatment with mutanolysin. Samples were boiled at 100°C in Laemmli sample buffer and analysed by SDS-PAGE using a 12.5% (wt/vol) polyacryla ide separation gel (Laemmli, 1970).
  • SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis
  • fibrinogen-affinity blotting analysis of proteins released from purified cell walls of S. equi following treatment with mutanolysin. Samples were boiled at 100°C in Laemmli sample buffer and analysed by SDS-PAGE using a 12.5% (wt/vol) polyacryla ide separation gel (Laemmli, 1970).
  • Lane 1A and IB cell envelopes following extraction with 2% (wt/vol) SDS; lane 2A and 2B, supernatant fraction from purified cell walls following incubation with mutanolysin; lane 3A and 3B, supernatant fraction from purified cell walls incubated without mutanolysin.
  • the SDS-gel in Panel A was stained with Coomassie-brilliant blue.
  • Panel B shows an identical gel electrotransferred onto nitrocellulose and affinity probed with horseradish peroxidase conjugated-horse fibrinogen. Positions and molecular masses of mutanolysin-extracted proteins and of mutanolysin are indicated at the right of panel A.
  • the position of the fibrinogen-reacting 220-kDa protein is indicated by arrowhead at the right of Panel B.
  • Molecular masses were determined from the relative mobilities of the following standard molecular mass marker proteins: rabbit yosin (205 kDa), ⁇ -galactosidase (116 kDa), phosphorylase b (94 kDa), bovine serum albumin (66.2 kDa), catalase (61 kDa), glutamate dehydrogenase (55.4 kDa), fumarase (48.5 kDa), alcohol dehydrogenase (41 kDa), Omp F protein of E. col i (36.5 kDa), carbonic anhydrase (30 kDa), chymotrypsinogen (25.1 kDa), trypsin inhibitor (20.1 kDa), lysozyme (14.3 kDa).
  • FIG. 1 Analysis by SDS-PAGE of the purification of the FgBP from 5. equ i .
  • Lane 1 cell envelope fraction; lane 2, cell envelope fraction following incubation with mutanolysin; lane 3, pellet obtained following incubation of cell envelopes with mutanolysin; lane 4, supernatant fraction obtained following incubation of cell envelopes with mutanolysin; lane 5, proteins eluted unbound from the fibrinogen affinity column; lane 6, FgBP purified by fibrinogen-affinity chromatography.
  • the position of the FgBP is indicated. Indicated to the left of the SDS-gel are the positions (in kilodaltons) to which standard molecular mass marker proteins migrated.
  • FIG. 3 Protective effect of FgBP against lethal S. equi infection in mice, (a) Twenty one, and seven days prior to challenge, a group of 11 mice were immunized (subcutaneously) with partially purified FgBP emulsified in MPL+S-TDCM Ribi adjuvant. A control group of mice were immunized (subcutaneously) with MPL+S-TDCM Ribi adjuvant emulsified in phosphate-buffered saline (PBS). All mice were subsequently challenged with 3 x 10 colony forming units (CFU) of S. equi cells, (b) Forty two and fourteen days prior to challenge, a group of 10 mice were immunized
  • FIG. 4 Serum IgG response, as monitored by ELISA, of mice vaccinated with FgBP and of control unvaccinated mice. The log of serum dilutions versus the mean absorbance readings of the vaccinated ( ⁇ ) group of mice and of the control ( p ) group of mice are shown.
  • Figure 6 Total daily clinical scores during equine trial. Days of vaccination (V) and challenge (C) are indicated.
  • Q denotes horse HI; O denotes horse H2; ⁇ denotes horse H3.
  • Figure 7 Daily temperature score during equine trial. Days of vaccination (V) and challenge (C) are indicated. E! denotes horse HI; O denotes horse H2; ⁇ denotes horse H3.
  • Figure 8 Daily fibrinogen levels and white blood cell counts for horse HI during equine trial. Days of vaccination (V) and challenge (C) are indicated. ⁇ denotes fibrinogen level; ⁇ denotes white blood cell counts.
  • Figure 9 Daily fibrinogen levels and white blood cell counts for horse H2 during equine trial. Days of vaccination (V) and challenge (C) are indicated. ⁇ denotes fibrinogen level; denotes white blood cell counts.
  • FIG. 10 Daily fibrinogen levels and white blood cell counts for horse H3 during equine trial. Days of vaccination (V) and challenge (C) are indicated. GQ denotes fibrinogen level; ⁇ denotes white blood cell counts.
  • FIG. 1 Nasal mucosa (secretory) IgG titres against FgBP for horses HI, H2 and H3 taken on days post primary vaccination. Days of vaccination (V) and challenge (C) are indicated.
  • CD denotes horse HI; o denotes horse H2; ⁇ denotes horse H3.
  • Figure 14 Genotypes of bacterial strains.
  • Figure 15 Nucleotide and deduced amino acid sequence of the 5' region of the gene encoding the FgBP of 5. equi. The probable start of the signal sequence is arrowed. The sequences corresponding to that determined by direct amino acid sequence analysis of the V8 protease fragments are underl ined.
  • FIG. 16 Partial restriction map of pFBP200.
  • the open box represents the multiple cloning site in lacZ of pGEM7.
  • the thin line represents ⁇ GEMU DNA.
  • the thicker line represents 5.
  • equi DNA The region which has been sequenced, in pFBPlOO, has a bar beneath it.
  • the region of DNA encoding the truncated fbp gene is indicated by an arrow.
  • FIG. 1 Partial restriction map for the insert in pFBP700.
  • the thick line represents the coding region for the FgBP and an arrow indicates the direction of transcription.
  • the directions of the universal forward (F) and reverse (R) primers present in pBK-CMV are also shown.
  • FIG. 18 Nucleotide sequence and deduced amino acid sequence of the gene (fbp) encoding the FgBP.
  • a putative ribosome binding site (RBS) and possible -10 and -35 promoter signals are underlined.
  • the putative signal peptidase cleavage site is marked with an arrow, the stop codon is marked with an asterick and a possible transcriptional termination hairpin loop is underlined with arrowheads.
  • Underlined amino acids correspond to the sequences determined by direct amino acid sequence analysis of the V8 protease fragments.
  • the repeat regions (Al, A2, A3, Bl and B2), the consensus LPSTGE motif (in bold), membrane anchoring domain (M) and the charged tail (C) are also indicated.
  • FIG. 19 Purification of hexahistidyl -tagged FgBP truncate analysed by SDS-PAGE and fibrinogen-affinity blotting. Samples were solubilized in Laemmli sample buffer and analysed by SDS-PAGE using a 12.5% (wt/vol) polyacrylamide separating gel (Laemmli, 1970). Lane 1, soluble fraction of f. col i harbouring pQE30; lane 2, soluble fraction of E. col i harbouring pQE30- fbp; lane 3 and 5, proteins eluted from the Ni -IDA column with 100 mM imidazole; lanes 4 and 6, proteins eluted from the
  • Lanes 1-4 were stained for protein with Coomassie brilliant blue. Lanes 5-6 were electrotransferred onto nitrocellulose and affinity probed with horseradish peroxidase co ⁇ jugated-horse fibrinogen. The position of the 220-kDa and 90-kDa FgBP truncates are indicated to the right. Indicated to the left of the SDS-gel are the positions (in kilodaltons) to which molecular mass marker proteins migrated.
  • Bacterial cells were harvested by centrifugation (16,000 x g for 15 min), washed once in lO M Tris-HCl buffer pH 7.2 (Tris buffer) and finally resuspended in 120 ml Tris buffer containing DNase (50ug/ml), RNase (50 jjg/ml) and protease inhibitors (phenylmethylsulfonyl- floride [2 mM] , and benzamidine hydrochloride [2 mM] . The bacteria were then lysed by two passages through a French pressure cell (32,000 lb/in ). Unlysed cells were removed from the cell lysate by centrifugation (3,000 x g for 10 min).
  • Cell wall -membranes were pelleted from the cleared lysate by centrifugation (45,000 x g for 1 h) and washed three times in Tris buffer. The cell envelopes were then resuspended in 36 ml of Tris buffer containing 2% (wt/vol) sodium dodecyl sulphate (SDS) and incubated at 20°C for 1 h. Purified cell-wall material (plus associated polymers and proteins) was obtained as an SDS-insoluble (pellet) fraction following centrifugation (45,000 x g for 1 h). The SDS-extraction was repeated once more as outlined above.
  • SDS sodium dodecyl sulphate
  • the SDS-insoluble pellet was washed 5 times in Tris buffer, once in 10 mM sodium phosphate buffer, pH 7.2, and finally resuspended in 9 ml of 10 mM sodium phosphate buffer, pH 7.2.
  • the purified cell wall was then digested by incubation for 18 h at 37°C with mutanolysin (Sigma; 18,000 U) , in the presence of protease inhibitors (N ⁇ * -p-tosyl-L-lysinechloromethylketone [2mM] , phenylmethylsulfonyl- floride [2 mM] , and benzamidine hydrochloride [2 mM]).
  • protease inhibitors N ⁇ * -p-tosyl-L-lysinechloromethylketone [2mM] , phenylmethylsulfonyl- floride [2 mM] , and benzamidine hydrochloride [2
  • the extract was centrifuged (45,000 x g for 1 h) and material released from the digested cell wall was obtained in the supernatant fraction. These various fractions were analysed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The results showed that several proteins were specifically released from the digested peptidoglycan. These proteins included one major protein of apparent M r 220,000. Other proteins of apparent M r 94,000, 74,000 and 56,000 and minor species of M r 44,000, 38,000 and 29,000 were also detected ( Figure 1, lane 2A) . It can be concluded that these proteins are likely to be associated with the cell wall.
  • TM Sepharose 4B using the method recommended by the manufacturer (Pharmacia LKB Biotechnology).
  • Horse fibrinogen (10 mg/ml in 50 mM sodium phosphate, 1 mM ethylenediaminetetraacetate (EDTA) and 0.5M NaCl , pH 7.5) was then applied to the gelatin column. Fibronectin remained bound to the column, whereas fibrinogen was eluted as unbound material. The eluate was then- dialysed against 100 M sodium acetate (pH 5.0), and a precipitate of lipoproteins removed by centrifugation (16,000 x g for 15 min).
  • Contaminating horse IgG was then removed from the supernatant fraction using a protein G/agarose affinity column and following the procedure recommended by the manufacturer (Pierce Chemical Co.). Horse IgG remained bound to the column whereas fibrinogen was eluted as unbound material. Purified fibrinogen (free of fibronectin and IgG) was then dialysed against distilled water and lyophilised.
  • Purified fibrinogen was labelled with horseradish peroxidase based on a method described by Winston et al . (1995). This entailed firstly treatment of horseradish peroxidase (5 mg/ml) with 40 mM NalO, in the dark for 30 min at 20°C. Ethylene glycol was then added to a final concentration of 0.64 M and the solution incubated for a further 1 h before dialysis versus 1 M sodium acetate buffer (pH 4.4). Lyophilised fibrinogen (25 mg) was the dissolved in the above solution of horseradish peroxidase.
  • the pH of the solution was adjusted to 9.5 using 100 M sodium carbonate buffer (pH 9.5) and the mixture was incubated in the dark for lh at 20°C. 0.1 ml of aqueous NaBH ⁇ (4 mg/ml) was added and the solution incubated for a further 1 h in order to reduce reactive groups.
  • Peroxidase-labelled fibrinogen was then dialysed extensively against phosphate buffered saline (pH 7.2; PBS) and finally stored at -20°C.
  • Affinity blotting assays were performed in a similar manner to that described for Western immunoblotting (Caffrey et al., 1988). 2% (wt/vol) dried skimmed milk was used as a blocking reagent. Bound peroxidase- conjugated horse fibrinogen was visualized with 4-chloro-l-naphthol . The results of the affinity blot showed that the protein of apparent M of 220,000 bound horse fibrinogen ( Figure IB).
  • the fibrinogen-binding protein (FgBP) of apparent 220,000 was purified to homogeneity using fibrinogen-affinity chromatography.
  • the purification steps are outlined below and an SOS polyacrylamide gel of the various purification steps are shown in Figure 2.
  • Bacterial cell envelopes i.e. cell wall -membranes which had not been extracted in SDS
  • Isolated cell envelopes were then washed three times in Tris buffer, once in 10 mM sodium phosphate buffer (pH 6.8) and finally resuspended in 12 ml of sodium phosphate buffer containing mutanolysin (9600 U) and protease inhibitors (- -p-tosyl-L-lysinechloro- methylketone [2mM], phenyl-methylsulfonylfloride [2 mM] , and benzamidine hydrochloride [2 mM]). The suspension was extracted at 37°C for 18 h and then centrifuged (45,000 x g for 1 h).
  • the fibrinogen-sepharose 4B slurry was poured into a 1 x 9 cm chromatography column, and eluted with 10 mM sodium phosphate buffer (pH 6.8) until the 0D 28Qnm approached zero. 0.2 M glycine (pH 2.5) was used to elute bound FgBP. Fractions were collected into 1M Tris-HCl (pH 8.0) and analysed by SDS-PAGE. Those containing FgBP were pooled, dialysed against PBS and lyophilised.
  • S. equi cells used for challenge of the mice were grown as described in the Section entitled "Isolation of cell wall-associated proteins”. Harvested cells were washed twice in sterile PBS (1/5 culture volume), resuspended in PBS (1/100 culture volume) and suspensions were stored in aliquots at -70°C. S. equi cells stored in this manner maintained viability for several months. On the day of challenge, an aliquot of frozen cells was thawed and diluted appropriately in PBS.
  • the protective immunogen was a preparation of FgBP which had been isolated following mutanolysin extraction of purified cell walls and further purified (to approximately 80% homogeneity) by gel filtration chromatography. Eleven mice were immunized subcutaneously on days 0 and 14 with 100 ug protein emulsified in MPL+S-TDCM Ribi adjuvant (active ingredients monophosphoryl lipid A and trehalose dimycolate; RIBI Imrnunochem Research, Inc.). Ten control mice were immunized with adjuvant emulsified in PBS only. All mice were c challenged on day 21 by intraperitoneal injection of 3 x 10 colony forming units (CFU) of virulent S.
  • CFU colony forming units
  • Enzyme-linked immunosorbent assays were performed on sera taken from vaccinated and control mice prior to challenge in order to determine the serum IgG response to FgBP. Assays were carried out using standard procedures (Newell et al . , 1988). Briefly, icrotitre plates were filled with 50 .1 volumes of purified FgBP solution (50.4 ng/j-1 of 100 mM sodium carbonate buffer, pH 9.6) and incubated overnight at 20°C.
  • Coated- wells were blocked by incubation for 45 min with 50 mM Tris acetate buffer pH, 7.4 containing 1% (wt/vol) bovine serum albumin, 0.05% (vol/vol) Tween 20 and 0.9% (wt/vol) NaCl and washed three times with 0.05% (vol/vol) Tween 20 in 0.9% (wt/vol) NaCl (wash buffer).
  • the wells were incubated for 2 h with serial two-fold dilutions of sera prediluted 1:250 in blocking solution and then washed three times in wash buffer.
  • FgBP fibrinogen-affinity chromatography as described in the Section entitled "Purification of the fibrinogen-binding protein " .
  • H3 a thoroughbred
  • Intranasal vaccination and challenge were administered using a dog urinary catheter (50 cm length x 2.0 mm diameter) attached at the proximal end to a 20-ml syringe.
  • the distal end of the dog catheter was heat-sealed and about 15-20 small holes ( ⁇ 1 mm in diameter) were made around its circumference.
  • the entire length of the catheter was inserted into the horse's nose and the fluid sprayed into the tonsillar region. A 2-ml volume was delivered in this manner up each nostril.
  • the clinical response of the horses to vaccination and challenge was determined on a daily or every-other-day basis, using the clinical scoring system outlined in Figure 5.
  • Blood samples and two nasal swabs were taken at weekly intervals. Blood samples were subject to routine haematological and biochemical tests as well as ELISA tests to monitor serum IgG to FgBP.
  • nasal swabs were analyzed for icrobial flora and by ELISA for secretory IgG and IgA to FgBP.
  • Haematological , biochemical and microbiological tests were performed by the Irish Equine Centre, Johnstown, Co. Kildare, Ireland. Blood haematology tests included those for red blood cell, packed cell volume, haemoglobin, mean cell volume, mean corpuscular haemoglobin content, platelets, white blood cell, fibrinogen, neutrophils, lymphocytes, monocytes and eosinophils. Blood biochemical tests included those for total protein, albumin, aspartate aminotransferase, creatinine kinase, gamma glutamyltransferase, total bilirubin, sodium and potassium levels.
  • Microbiological analysis included routine tests for the presence of Staphlycoccus aureus, alpha-haemolytic streptococci, ⁇ -haemolytic streptococci, Neisseria sp., Bacteroides sp., Clostridium sp., non-haemolytic Escherichia col i and Streptococcus equi.
  • Nasal swabs were individually immersed in 1 ml of saline for 18 h at 4°C. Samples were then vortexed vigorously for 2 min and the saline removed. The swab was then vortexed in a further 0.5 ml of saline. The final volume of the combined nasal swab washings was then adjusted to 1.5 ml, the washings were centrifuged at 13,000 x g for 10 minutes and the supernatant fluids were stored at -20°C until use.
  • ELISA assays were carried out by standard procedures essentially as described in the Section entitled "Assessment of the protective potential of the FgBP in the mouse model". After coating with FgBP and washing, wells were incubated for 2 h with serial two-fold dilutions of either sera (prediluted 1:500 in blocking buffer) or nasal swab washings.
  • the total clinical scores of the three horses are shown in Figure 6. Of the 16 individual clinical symptoms incorporated in the total clinical scores (Figure 5), temperature is considered to be the best indicator of forthcoming illness and is highlighted in Figure 7. Two other relevant (blood) parameters i.e. fibrinogen levels and white blood cell counts, which are indicative of infection and inflammation are shown in Figures 8, 9 and 10. The immunoglobulin titres of the sera and nasal swab washings are shown in Figures 11 and 12, respectively.
  • HI showed a higher base-line total daily clinical score than either of the other two ( Figure 6), a feature caused principally by slightly enlarged lymph glands (i.e. a lymph palpation clinical score of 2 as compared to a score of 0 for both H2 and H3) and which may have been due to an underlying chronic respiratory disease.
  • the vaccinated pony (H2) exhibited very erratic fibrinogen levels (Figure 9), a feature caused not by infection/inflammation but by fluctuations in physical activity as evidenced by dramatic changes in the levels of two muscle enzymes (aspartate aminotransferase and creatinine kinase; data not shown). It is apparent from a study of individual clinical indices and the total daily clinical score prior to challenge that there were no adverse reactions to the vaccination regimen.
  • the general strategy for cloning the gene encoding the FgBP involved: (a) the design of a degenerate oligonucleotide probe made from a knowledge of amino acid sequence; (b) Southern blotting experiments to identify positive clones in 5. equi DNA libraries; (c) subcloning and sequencing of positive-reacting restriction fragments.
  • N-terminal amino acid sequence analysis of defined peptides fragments of FgBP was undertaken.
  • Peptide fragments were generated as follows. Mutanolysin- soluble extracts of purified cell-wall material from 5. equi were electrophoresed on SDS-polyacrylamide gels containing 12.5% [wt/vol] polyacrylamide. The SDS-gels were stained with Coomassie-brilliant blue and bands corresponding to FgBP were excised from the gel.
  • TM Problot and N-terminal amino acid sequence analysis was performed directly on three of these peptides using an Applied Biosystems 447A pulsed- liquid protein sequencer. Analysis yielded two distinct sequences. These are given as follows in standard single letter code (1) NSEVSRTATPRL; and (2), LQKAKDERQALTESFNKTLS. A suitable degenerate oligonucleotide (Figure 13) was then made from a consideration of amino acid sequence No. 2 above.
  • Genomic DNA was isolated from S. equi using a modification of the method described by Lindberg et al. (1972). Bacteria were cultured in 150 ml of broth as described in the section entitled "Isolation of cell wall -associated proteins”. Bacteria were then harvested, washed once in 50 M Tris-malate (pH 7.0) containing 10 mM MgCl ?
  • genomic DNA was isolated from S equi essentially as described by Yu and Ferretti (1989) with the following modifications. Prior to harvesting of bacterial cells, the 20-ml bacterial culture was treated for 30 min with hyaluronidase (0.3 ug/ml).
  • the resultant DNA was further purified by stepwise extraction with equal volumes of (a) phenol/chloroform (1:1) and (b) chloroform/isoamyl alcohol (24:1), before finally precipitating with 0.6 vol of isopropanol. Ethanol -washed pellets were finally resuspended in TE buffer (10 mM Tris-HCl and 10 M EDTA, pH ⁇ .O).
  • a gene bank in the lambda replacement phage, ⁇ GEMll was made essentially as described by the suppliers (Titus, 1991a). S. equi genomic DNA was partially cleaved with the restriction endonuclease, Sat/JAl, in order to generate fragments in the size range 15-20 kb. These were then partially filled-in with dATP and dGTP using DNA poly erase 1 Klenow fragment and were ligated with the left and right arms of the /iGEMll, which had been precleaved with X ⁇ oI and partially filled-in with dATP and dGTP. Size selection of inserts is achieved during packaging as only arms containing inserts of between 9 and 23 kb are encapsidated. The titre of the resultant library was 2 x 10 .
  • the degenerate oligonucleotide ( Figure 13) was labelled with P dATP using T4 polynucleotide kinase as described by S. Tabor (1995).
  • the reaction mixture containing forward exchange buffer 50 M Tris-HCl, pH 7.5, 10 mM MgCl 2 , 5 mM dithiotreitol [DTT] and 0.1 mM spermidine
  • 10 pmol degenerate oligonucleotide 50 uCi ⁇ '- P dATP (3000 Ci/rnmol " )
  • T4 polynucleotide kinase (10 U) was incubated at 37°C for 50 min.
  • the reaction was terminated by addition of 25 mM EDTA (pH 8.0) and the volume of the reaction mixture was increased to 100 i. Unincorporated dATP was removed from the labelled probe using a Sephadex G-25 column (NAP-5) as described by the supplier (Pharmacia LKB Biotechnology).
  • Plaques of the /t library were propagated on E. col i LE392 (about 500 plaques per plate; Figure 14) using the overlay method outlined in Titus (1991a). Plaque hybridizations were based on the method of Southern (1975) as outlined by O'Reilly et al . (1988) with the following modifications. Plaque blots were hybridized at 50°C for 2 h in prehybridization solution (5X SSC [saline sodium citrate contains 0.17 M sodium citrate and 0.15 M NaCl], 0.5% [wt/vol] SDS and 5X Denhardts solution) and hybridized at 50°C for 18 h in prehybridization solution containing 1 pmol labelled oligonucleotide probe.
  • prehybridization solution 5X SSC [saline sodium citrate contains 0.17 M sodium citrate and 0.15 M NaCl], 0.5% [wt/vol] SDS and 5X Denhardts solution
  • Blots were then washed at 37°C for 15 min in 5X SSC, for 15 min in 2X SSC and at 42°C for 15 min in IX SSC. The blots were then sealed into plastic bags and exposed to X-ray film at -70°C for 3-7 days.
  • DNA was isolated from ⁇ SE12.1 by a method which involved purification and concentration of phage particles, lysis of phage capsids and purification of released DNA.
  • a high titre plate stock of SE12.1 (3 x 10 ) plaque forming units [PFU] were prepared as detailed by O'Toole & Foster (1988). This plate stock was then used to prepare a high titre liquid lysate stock of y SE12.1 as described by O'Toole & Foster (1988) with the following modifications. 500 ul of an 18-h culture of E.
  • This mixture was then added to 250 ml of phage medium (1% casamino acids, 1 x M9 salts, 0.4% (wt/vol) glucose, 0.4% (wt/vol) maltose, 5 mM MgCl ? , 0.1 M CaCl ?
  • Phage DNA was digested with various restriction enzymes using conditions described by the manufacturers and the restriction digests were
  • Sacl restriction fragments of /.SE12.1 was ligated to 5 ⁇ JCI -digested plasmid pGEM-7 Zf+ (Promega) and transformed into E. col i XLl-Blue ( Figure 14) as described by Titus (1991b) and Seid an et al., 1995. Transformants were plated onto L-agar plates containing ampicillin (lOOjjg/ml, 5-bromo-4-chloro-3-indolyl ⁇ -D-galactopyranoside (X-gal; 40 ug/ml) and isopropyl- ⁇ -D-thiogalactopyranoside (IPTG; 40 uM) .
  • Plasmid DNA was isolated from several transformants (Birnboim, 1983; Birnboim & Doly, 1979) and analyzed in Southern hybridization experiments using the labelled oligonucleotide probe.
  • pGEM7 One recombinant of pGEM7 containing a positive-reacting 1.8 kb insert was identified and the recombinant plasmid is termed pFBPlOO.
  • the nucleotide sequence of most of the Sacl insert was determined. This involved preparation of plasmid DNA, generation of nested deletions of the plasmid and DNA sequence analysis of 300-400 bp stretches of the said deletions.
  • Plasmid DNA was purified from broth-grown E. col i (pFBPlOO) by a modified alkaline lysis method as outlined by Feliciello & Chinali (1993). 10 ug of the purified plasmid DNA was cleaved to completion with two restriction enzymes Sphl and fcoRI, which generates exonuclease III resistant and exonuclease III sensitive sites, respectively. 200-300 bp nested deletions of the digested plasmid were generated using exonuclease
  • the deleted plasmid DNA was then treated with Klenow DNA polymerase, ligated with T4 DNA ligase and transformed into E. col i DH5o
  • DNA sequence analysis plasmid DNA with overlapping deletions was isolated by the method of Feliciello and Chinali (1993). Automated DNA sequence analysis of the overlapping deletions was performed using an Applied Biosystems 373A DNA sequencer and Taq DyeDeoxy terminator chemistry (DNA sequencing service, King's College School of Medicine and Dentistry, London). DNA sequence was determined using the M13 forward primer 24mer (5' CGCCAGGGTTTTCCCAGTCACGAC) and, where appropriate, specific primers synthesized from a knowledge of established DNA sequence.
  • 1400 bp of nucleotide sequence was determined in one strand only ( Figure 15). Translation, to amino acids, of the reverse complement of the 1400 bp sequence resulted in the identification of two stretches of amino acid sequence corresponding to those determined from direct amino acid sequence analysis of V8 protease fragments of the protein itself ( Figure 15 and Section entitled "Amino acid sequence analysis of FgBP). Immediately preceding one of these amino acid sequences (sequence No. 1) is a stretch of 36 amino acids which shows homology with signal sequences of other streptococcal cell wall proteins. The results of the nucleotide sequencing experiments had thus identified an open reading frame (0RF) encoding the 5' end of the gene ⁇ fbp) for FgBP. However, the absence of a stop codon or of translated amino acid sequence characteristic of the C-terminal cell wall/membrane anchoring domain of cell wall -associated proteins (see
  • the labelled fragment was used, in Southern blotting experiments, to screen ⁇ SE12.1 which had been digested with various restriction enzymes.
  • the basic method of Southern blotting was as described in the Section entitled “Southern blotting experiments" with the following modifications. Prehybridizations and hybridizations were carried out a 65 C.
  • the hydridization solution contained 5ng of labelled probe.
  • blots were washed as follows: twice for 2 min at 65°C in a solution containing 2X SSC and 0.5% (wt/vol) SDS, twice for 15 min at 65 C in a solution containing 2X SSC and 0.1% (wt/vol) SDS and twice for 15 min at 25°C in a solution containing IX SSC and 0.1% (wt/vol) SDS.
  • the results of the Southern blots showed that a Sphl-Sfil restriction fragment of approximate size 6kb reacted with the labelled gene probe.
  • This Sphl-Sfil fragment was cloned into the plasmid pGEM-7 Zf(+) (Promega) as follows. Phage DNA was digested to completion with Sfil and Sphl . Digested phage DNA (200 ng) was then filled-in with dNTPs using DNA polymerase 1 Klenow fragment, ligated to 150 ng of Smal-digested pGEM-7 Zf(+) and transformed into E. col i DH5o£(see Section entitled "Cloning of 5acl restriction fragment”). Southern blotting experiments identified a recombinant plasmid (pFBP200) which contained the
  • E. col i MM2 The recombinant E. col i strain is termed E. col i MM2 and was deposited at the National Collections of Industrial and Marine Bacteria under the Accession Number NCIMB 40807 on 25th June 1996.
  • Genomic DNA prepared as described in the section entitled “Isolation of 5. equi genomic DNA”, was partially cleaved with the restriction enzyme Sau3A, in order to generate fragments in the size range 10-12kb.
  • the digested DNA was ligated to tor arms ( ⁇ awHI-CIAP-treated) and packag III Gold packaging extract according to the manufacturers instructions (Stratagene).
  • the ⁇ titre of the resultant library was 6 x 10 pfu/ml.
  • Plasmid pFBPlOO was digested with Sacl and the 1.8kb fragment gel
  • Plaques (approximately 15,000) from the /.ZAP Express library were propagated on E. col i XLl-Blue MRF 1 using the overlay method outlined by Titus (1991a). Plaque hybridizations were carried out as outlined in 'The DIG system user's guide for filter hybridization' (Boehringer Mannheim). Hybridizations were performed at 68 C in standard hybridization buffer (5 x SSC, 1.0% [wt/vol] Boehringer blocking reagent, 0.1% [wt/vol] N-lauroylsarcosine, 0.2% [wt/vol] SDS). Che i luminescent detection was carried out using anti-DIG-alkaline phosphatase and the alkaline phosphatase substrate, CSPD .
  • the FgBP is encoded by an ORF of 1,605 bp which is preceded by sequences typical of promoter signals and ribosome-bindi ⁇ g sites (Fig. 18).
  • the ORF itself has the following features.
  • the first 36 residues of the deduced amino acid sequence show features characteristic of a signal sequence. This region is homologous to signal sequences of other cell wall proteins (see Goward et al., 1993).
  • the fbp gene encodes for a primary translation production of 534 amino acids (M 58,352) which is post-translationally processed to yield a putative mature protein of 498 amino acids (M 54,604).
  • the sequence of the mature protein contains features characteristic of cell wall -associated proteins (see Introduction). Firstly, the sequence contains two blocks (A and B) of repeated sequences. The A repeats are 21 amino acid in length and are repeated at least twice. The B repeats are about 11 amino acids long and are repeated twice. Secondly, the C-terminal part of the protein contains a putative wall/membrane anchoring domain. Thus, the consensus LPSTGE motif is followed almost directly by 21 hydrophobic amino acids (membrane spanning region) and a short charged tail of five amino acid residues (see Figure 18). Structural predictions (Lupas, 1996; Lupas et al .
  • the region of fbp encoding the first 434 amino acids of the mature protein was cloned in the correct reading frame into pQE30.
  • the fbp fragment of DNA was first amplified by polymerase chain reaction (PCR) using pfu polymerase (Stratagene) and appropriate forward and reverse primers.
  • PCR polymerase chain reaction
  • the resultant PCR product was then gel purified, ligated to restriction-digested pQE30 and transformed into E. col i XLl-Blue (Titus, 1991b and Seidman et al., 1995). Positive transformants were identified by restriction digestion of isolated plasmid DNA and confirmed by PCR analysis using the above primers.
  • the hexahistidyl -tagged FgBP truncate was purified using metal chelate affinity chromatography using methodology described by Qiagen GmbH, Germany. Briefly, transformants were grown overnight at 37°C in 10 ml of 2xYT+G medium (tryptone[16 g/1], yeast extract [10 g/1], NaCl [5 g/1], glucose [0.2 g/1] containing ampicillin (100 ug/ml). The overnight culture was then used to inoculate 500 ml of fresh medium and the culture grown to an A g00 of 0.9. IPTG was then added to a final concentration of 1 mM and growth was continued for a further 3 hours.
  • Bacterial cells were harvested, washed and resuspended in 30 ml binding buffer (20 mM Tris-HCl pH 7.9, 0.5M NaCl) containing RNase (50 ug/ml). DNase (50 fig/ml), and the two protease inhibitors, phenylmethylsulfonyl-floride (2 M) and benza idine-HCl (2 mM) .
  • Cells were lysed by passage through a French pressure cell (32,000 p.s.i.) and the lysate was cleared by centrifugation (45,000 x g, 1 hour, 4°C) to yield a soluble supernatant fraction containing the expressed proteins.
  • TM CnBr-activated Sepharose was obtained from Pharmacia LKB
  • Immobilized protein G was obtained from Pierce Chemical Co., IL, USA.
  • 96-well ELISA plates were obtained from Sarsdedt Ltd, Wexford, Ireland.
  • Horse fibrinogen, horseradish peroxidase, peroxidase-label led affinity-purified anti-mouse IgG (H+L), and iminodiacetic acid Sepharose were obtained from Sigma Chemical Co., Dorset, U.K.
  • Restriction enzymes and other molecular biology reagents were obtained from Promega Corporation, WI, USA and New England Biolabs Inc., MA, USA.
  • the pGEM-7 Zf(+) vector, Erase-a-BaseTM, Prime-a-gene labeling system and Wizard PCR preps DNA purification system were obtained from Promega Corporation, WI, USA.
  • Peroxidase-label led affinity-purified goat anti-horse IgG (H+L) was obtained from ICN Bio edicals Inc., CA, USA.
  • Peroxidase-labelled affinity-purified goat anti-horse IgA (alpha-chain specific) was obtained from Bethyl Laboratories Inc., TX.
  • MPL+S-TDCM Ribi adjuvant was obtained from RIBI I ⁇ -munochem Research Inc., MT, USA.
  • the DIG labelling and detection kits were obtained from Boehringer Mannheim, GmbH, Biochemica.
  • the ZAP Express predigested vector (BamHI/CIAP-treated) and
  • TM Gigapack III packaging extract were obtained from Strategene.
  • the QIA express pQE30 vector system was obtained from Qiagen GmbH, Germany.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Protéine de Streptococcus equi liant le fibrinogène, fragment d'ADN codant cette protéine et utilisation de protéine purifiée liant le fibrinogène ou de dérivés appropriés de ladite protéine dans la préparation d'un vaccin contre l'infection provoquée par S. equi, connue également sous le terme de gourme, chez les chevaux.
PCT/IE1997/000046 1996-07-03 1997-07-02 VACCIN PURIFIE CONTRE $i(STREPTOCOCCUS EQUI) WO1998001561A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU31877/97A AU3187797A (en) 1996-07-03 1997-07-02 Subunit vaccine for (streptococcus equi)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IE960488 IES76925B2 (en) 1996-07-03 1996-07-03 Subunit Vaccine for Streptococcus Equi
IES960488 1996-07-03

Publications (1)

Publication Number Publication Date
WO1998001561A1 true WO1998001561A1 (fr) 1998-01-15

Family

ID=11041201

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IE1997/000046 WO1998001561A1 (fr) 1996-07-03 1997-07-02 VACCIN PURIFIE CONTRE $i(STREPTOCOCCUS EQUI)

Country Status (3)

Country Link
AU (1) AU3187797A (fr)
IE (1) IES76925B2 (fr)
WO (1) WO1998001561A1 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000037648A1 (fr) * 1998-12-22 2000-06-29 The University Of Tennessee Research Corporation Antigene protecteur de streptococci de groupe a (spa)
US6458358B1 (en) 1997-06-24 2002-10-01 University Of Kentucky Research Foundation Compounds encoding the protective M-like protein of Streptococcus equi and assays therefor
WO2002034771A3 (fr) * 2000-10-27 2003-01-16 Chiron Spa Acides nucleiques et proteines derives des groupes de streptocoques a et b
WO2004032957A1 (fr) 2002-10-11 2004-04-22 Bengt Guss Immunisation de mammiferes non humains contre streptococcus equi
US7063850B1 (en) 1998-12-22 2006-06-20 University Of Tennessee Research Foundation Protective antigen of group A Streptococci
US7270827B2 (en) 2001-10-26 2007-09-18 University Of Tennessee Research Foundation Multivalent streptococcal vaccine compositions and methods for use
WO2009075646A1 (fr) 2007-12-13 2009-06-18 Bengt Guss Composition d'immunisation améliorée
AU2008200977B2 (en) * 2000-10-27 2009-11-12 J. Craig Venter Institute, Inc. Nucleic acids and proteins from streptococcus groups A & B
US7709009B2 (en) 2003-07-31 2010-05-04 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for streptococcus pyogenes
US7731978B2 (en) 2007-12-21 2010-06-08 Novartis Ag Mutant forms of streptolysin O
US7838010B2 (en) 2004-10-08 2010-11-23 Novartis Vaccines And Diagnostics S.R.L. Immunogenic and therapeutic compositions for Streptococcus pyogenes
WO2011149419A1 (fr) 2010-05-26 2011-12-01 Intervacc Ab Vaccin contre des infections streptococciques basé sur des protéines de recombinaison
US8287885B2 (en) 2007-09-12 2012-10-16 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
US8778358B2 (en) 2004-07-29 2014-07-15 Novartis Vaccines And Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae
US8945589B2 (en) 2003-09-15 2015-02-03 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus agalactiae

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GALAN J E ET AL: "MOLECULAR ANALYSIS OF THE M PROTEIN OF STREPTOCOCCUS EQUI AND CLONING AND EXPRESSION OF THE M PROTEIN GENE IN ESCHERICHIA COLI", INFECTION AND IMMUNITY, vol. 55, no. 12, December 1987 (1987-12-01), pages 3181 - 3187, XP000645178 *
SUSANNE R. TALAY ET AL.: "Structure of a group C streptococcal protein that binds to fibrinogen, albumin and immunoglobulin G via overlapping modules", BIOCHEMICAL JOURNAL, vol. 315, no. 2, 15 April 1996 (1996-04-15), pages 577 - 582, XP002040105 *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6458358B1 (en) 1997-06-24 2002-10-01 University Of Kentucky Research Foundation Compounds encoding the protective M-like protein of Streptococcus equi and assays therefor
US7063850B1 (en) 1998-12-22 2006-06-20 University Of Tennessee Research Foundation Protective antigen of group A Streptococci
WO2000037648A1 (fr) * 1998-12-22 2000-06-29 The University Of Tennessee Research Corporation Antigene protecteur de streptococci de groupe a (spa)
US7939087B2 (en) 2000-10-27 2011-05-10 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from Streptococcus groups A & B
WO2002034771A3 (fr) * 2000-10-27 2003-01-16 Chiron Spa Acides nucleiques et proteines derives des groupes de streptocoques a et b
US8025890B2 (en) 2000-10-27 2011-09-27 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A and B
US8431139B2 (en) 2000-10-27 2013-04-30 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from Streptococcus groups A and B
AU2008200977B2 (en) * 2000-10-27 2009-11-12 J. Craig Venter Institute, Inc. Nucleic acids and proteins from streptococcus groups A & B
US8137673B2 (en) 2000-10-27 2012-03-20 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from Streptococcus groups A & B
US7955604B2 (en) 2000-10-27 2011-06-07 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups A and B
US7270827B2 (en) 2001-10-26 2007-09-18 University Of Tennessee Research Foundation Multivalent streptococcal vaccine compositions and methods for use
WO2004032957A1 (fr) 2002-10-11 2004-04-22 Bengt Guss Immunisation de mammiferes non humains contre streptococcus equi
US8404245B2 (en) 2002-10-11 2013-03-26 Intervacc Ab Immunization of non-human mammals against Streptococcus equi
US9056912B2 (en) 2003-07-31 2015-06-16 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus pyogenes
US8529913B2 (en) 2003-07-31 2013-09-10 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus pyogenes
US8128936B2 (en) 2003-07-31 2012-03-06 Novartis Vaccines And Diagnostics, S.R.L. Immunogenic compositions for Streptococcus pyogenes
US7709009B2 (en) 2003-07-31 2010-05-04 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for streptococcus pyogenes
US8945589B2 (en) 2003-09-15 2015-02-03 Novartis Vaccines And Diagnostics, Srl Immunogenic compositions for Streptococcus agalactiae
US8778358B2 (en) 2004-07-29 2014-07-15 Novartis Vaccines And Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as Streptococcus agalactiae
US7838010B2 (en) 2004-10-08 2010-11-23 Novartis Vaccines And Diagnostics S.R.L. Immunogenic and therapeutic compositions for Streptococcus pyogenes
US8287885B2 (en) 2007-09-12 2012-10-16 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
US8399651B2 (en) 2007-09-12 2013-03-19 Novartis Ag Nucleic acids encoding GAS57 mutant antigens
US8858957B2 (en) 2007-09-12 2014-10-14 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
US9102741B2 (en) 2007-09-12 2015-08-11 Novartis Ag GAS57 mutant antigens and GAS57 antibodies
WO2009075646A1 (fr) 2007-12-13 2009-06-18 Bengt Guss Composition d'immunisation améliorée
US8039005B2 (en) 2007-12-21 2011-10-18 Novartis Ag Mutant forms of streptolysin O
US8409589B2 (en) 2007-12-21 2013-04-02 Novartis Ag Mutant forms of streptolysin O
US7731978B2 (en) 2007-12-21 2010-06-08 Novartis Ag Mutant forms of streptolysin O
WO2011149419A1 (fr) 2010-05-26 2011-12-01 Intervacc Ab Vaccin contre des infections streptococciques basé sur des protéines de recombinaison
EP3135684A1 (fr) 2010-05-26 2017-03-01 Intervacc AB Vaccin contre des infections streptococciques basé sur des protéines de recombinaison
US9795664B2 (en) 2010-05-26 2017-10-24 Intervacc Ab Vaccine against streptococcal infections based on recombinant proteins

Also Published As

Publication number Publication date
IES960488A2 (en) 1997-11-19
AU3187797A (en) 1998-02-02
IES76925B2 (en) 1997-11-19

Similar Documents

Publication Publication Date Title
Hedén et al. Molecular characterization of an IgA receptor from group B streptococci: sequence of the gene, identification of a proline‐rich region with unique structure and isolation of N‐terminal fragments with IgA‐binding capacity
Frithz et al. Extensive sequence homology between IgA receptor and M proteins in Streptococcus pyogenes
Billington et al. The Arcanobacterium (Actinomyces) pyogenes hemolysin, pyolysin, is a novel member of the thiol-activated cytolysin family
Jacobs et al. Identification, purification, and characterization of a thiol-activated hemolysin (suilysin) of Streptococcus suis
Lee et al. Molecular cloning and expression of a Streptococcus mutans major surface protein antigen, P1 (I/II), in Escherichia coli
Cleary et al. Virulent human strains of group G streptococci express a C5a peptidase enzyme similar to that produced by group A streptococci
Meehan et al. Affinity purification and characterization of a fibrinogen-binding protein complex which protects mice against lethal challenge with Streptococcus equi subsp. equi
WO1998001561A1 (fr) VACCIN PURIFIE CONTRE $i(STREPTOCOCCUS EQUI)
US20090117142A1 (en) Recombinant fusobacterium necrophorum leukotoxin vaccine and preparation thereof
WO1998021337A9 (fr) Proteine de liaison c3 de streptococcus pneumoniae
AU5355398A (en) C3 binding protein of (streptococcus pneumoniae)
US5281694A (en) Methods and compositions for production of mycoplasmal adhesins
US7449310B2 (en) Recombinant Fusobacterium necrophorum leukotoxin vaccine and preparation thereof
US6015889A (en) Protein rib, a cell surface protein that confers immunity to many strains of the group B streptococcus: process for purification of the protein, reagent kit and pharmaceutical composition
EP1140994B1 (fr) Proteines de surface exterieure, leurs genes, et leur utilisation
AU2001259138A1 (en) Recombinant fusobacterium necrophorum leukotoxin vaccine and preparation thereof
CA2507163C (fr) Molecule d'adhesion de streptococcus uberis
Ogier et al. A 40-kilodalton cell wall protein-coding sequence upstream of the sr gene of Streptococcus mutans OMZ175 (serotype f)
US6458358B1 (en) Compounds encoding the protective M-like protein of Streptococcus equi and assays therefor
AU672971B2 (en) Footrot antigens, vaccines and diagnostic assays
GB2267148A (en) OVINE FOOTROT: Proteases,antibodies,vaccines and diagnostic assays.
MXPA00000028A (en) Compounds encoding the protective m-like protein of streptococcus equi

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AT AU AZ BA BB BG BR BY CA CH CN CU CZ CZ DE DE DK DK EE EE ES FI FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT UA UG US UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 98504997

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase