MXPA00000028A - Compounds encoding the protective m-like protein of streptococcus equi - Google Patents

Abstract

The present invention relates generally to molecular compounds which encode the protective M-like protein ofStreptococcus equi (SeM), the amino acid compound which is thereby encoded, and compositions of matter which incorporate either the encoding compounds or the cellular components for which they encode. For instance, vaccines which utilize the amino acid compounds or vectors and cell lines useful to make the amino acid compounds described herein are subjects of the present invention. The present invention provides methods to stimulate S. equi-specific immune response in horses. It also provides diagnostic assays for Streptococcus equi.

Description

COMPOUNDS THAT CODIFY FOR THE PROTEIN SIMILAR TO M PROTECTIVE OF STREPTOCOCCUS EQUI AND TESTS FOR THE SAME BACKGROUND OF THE INVENTION The present invention relates generally to molecular compounds which code for the protective M-like protein of Streptococcus equi (Se), the amino acid compounds which are encoded by it and the compositions of matter which incorporate either the coding or the cellular components for which they code. For example, vaccines which utilize the protective amino acid compounds and cell lines useful for making the amino acid compounds described herein are subjects of the present invention. The present invention provides methods for stimulating the specific immune response for S. equi in horses. It also provides diagnostic tests for Streptococcus equi. Streptococcus equi a streptococcus of group C of Lancefield, causes strangulation, a highly contagious disease of the nasopharynx and drain lymph nodes in equines. The 58 kDa antifagocytic M-like protein (SeM) is a major virulence factor of the protective antigen, and fuses by limiting the deposition of C3b on the bacterial surface and by binding directly to fibrinogen. Boschwitz and Timoney, 17 Microbiol. Pathogenesis 121 (1994) and Boschwitz and Timoney, 62 Infecí. Immun. 3515 (1994). In the recent past, S. equi attacks on horses on farms have been prevented and treated by quarantine of suspect animals; antiseptic handling of food, bed and lodging; and antibiotics when indicated. Vaccines comprising S. equi avirulent or fractions thereof have been described, but success rates have been low. The US patent 5,183,659 describes a vaccine which stimulates the response of nasopharyngeal antibodies in horses, but the vaccine has a limitation of many such vaccines, which is the risk of reversion to virulence and development of occasional abscesses in vaccinated horses. S. equi is disseminated in the nasal discharges and in the pus of the lymph nodes of the affected animals. The usual laboratory detection of bacteria involves the bacteriological culture of nasal isoposes, nasal washes and pus from abscesses and it is often difficult due to background contamination, small amounts of the organism and the presence of S. zooepidemius and others. ß-hemolytic streptococci. The completion of culture and identification usually requires 2 to 3 days, an excessively long interval given the highly contagious nature of the strangulation and the need to quickly identify the carrier horses so that they can be isolated in the early stages of an attack.

BRIEF DESCRIPTION OF THE INVENTION An object of the present invention is to provide molecular compounds which code for SeM and compositions of matter which incorporate either the encoded compounds or the cellular components for which they encode. Therefore, one goal is to provide vectors, cell lines and cell membrane preparations using the described compounds. Still another objective is to provide a method for providing assays for Streptococcus equi detection. Other objects and features of the present invention will be apparent from the following detailed description, examples and claims.

Definitions As used herein, the following terms will have the corresponding meaning that is established. All other terms are intended to have the meaning as commonly understood by those in the relevant field of the art. "Biological sample" means a sample of nasal or oral mucus or a blood sample. "Transformation" and "transfection" means causing the nucleic acid to enter a cell, whether the nucleic acid is incorporated into the genome or not.

BRIEF DESCRIPTION OF THE DRAWINGS The invention will be further described in connection with the accompanying drawings, in which: Figure 1 is a nucleotide sequence and deduced amino acids of SeM. The positions of the bases and the amino acids are shown on the left. The putative promoter and ribosomal binding sites (RBS) are enclosed in rectangles and the signal and membrane anchor sequences are shown in bold. The repeated parts are underlined. Figure 2 is the result of an immunoblot test showing the reactions of a lysate of E. coli BL21, SeM02 and a mutanolisin extract of S. equi with antisera 216 and 963 of recombinant SeM and SeM, respectively. Figure 3 is the result of an immunoblot test showing the reactions of mutanolysin extracts from a series of temporally and geographically separated isolates of S. equi with antisera for recombinant SeM. The estimated molecular masses are shown to the right of the figure. Figure 4 is the result of an immunoblot test showing the linear epitopes recognized by IgA in nasal washes of convalescent horses (8 weeks). Figure 5 is a graph illustrating SeM regions reactive with antibodies in horse sera taken 8 weeks after the choke recovery.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides nucleic acid compounds comprising a compound of the following sequence. 1 AGCTTTCTGTCACCTGATGGTCCTTATCAAATACTGTAATTGATAACTTCAAACAGCCCT 61 GTAGAGATTTTACTAACGACATAGTATCCATGCTAAGCGTCACCCCCTTCATAATCCTCA CGGTATCTTATTCTATCTTAAAATTTAAGAAAAGCAAGGATATGCACTTATAATGAAAAA 121 181 241 ATACACATAAAAAACAATAATATACATTCTTGCTTATTAAATAAAAATGACAATGTACTG CATAAAGAAGTTCCTGTCATTAAAATAAAAGTGCCATGAGGTTATAATAGTATGGTAAAA CAAAAAAGTGTGCCCATAACGGGTAGAGAGGAATTGACATATGTTTTTGAGAAATAACAA 301 361 421 GCCAAAATTTAGCATCAGAAAACTAAGTGCCGGTGCAGCATCAGTATTAGTTGCAACAAG TGTGTTGGGAGGCACAACTGTAAAAGCGAACTCTGAGGTTAGTCGTACGGCGACTCCAAG ATTATCGCGTGATTTAAAAAATAGATTAAGCGATATAGCCATAAGTGGAGATGCCTCATC 81 01 41 AGCCCAAAAAGTTCGAAATCTTCTAAAAGGCGCCTCTGTTGGGGATTTACAGGCATTATT GAGAGGTCTTGATTCAGCAAGGGCTGCGTATGGTAGAGATGATTATTACAATTTATTGAT 661 GCACCTTTCATCGATGTTAAATGATAAACCTGATGGGGATAGAAGACAATTAAGTTTCCC TTCATTACTTGTAGATGAAATTGAAAAGCGGATTGCTGATGGAGATAGGTATGCAAAACT 721 781 841 TCTTGAGGCTAAACTTGCAGCTATTAAATCTCAACAAGAAATGCTTAGAGAAAGAGATTC CCAACTTCGAAATCTAGAGAAGGAGAAAGAACAAGAGCTCACAAAAGCTAAAGATGAGCG 5901 TCAAGCTCTTACCGAATCATTCAA CAAAACTTTATCAAGATCAACAAAAGAGTATAATAA 961 ACTAAAAACAGAACTTGCAAAAGAAAAAGAAAAAGCAGCTAAGATGACTAAGGAATTAGC AGATAAGCTAAGC-AATGCTGAAGCAAGTCGTGATAAAGCCTTTGCAGTATC.AAAAGATTT 1021 1081 1141 AGCAGATAAACTAAGTAGTGCTGAAGC AAGTCGTGATAAAGCTTTTGCAGTATCAAAAGA TTTAGC? GATAAATTGC-CAGCTAAAACAGCAGAAGCTGAAAAGTTAATGGAAAACGTTGG October 1201 1251 TAGTCTAGACCCCTTCCTAGAGTCTGCAAAACGTGAAATGGCTCAAAAATTAGCAGAAAT TGATC-AATTAACTGCTGATAAGGCTAAGGCTGATGCAGAGCTTGCAGCTGCAAATGACAC 1321 CATTCC? TCACTTCAAACAGAGCTAGAAAAAGCTAAGAC? GAGCTTGCTGTTTCAGAGCG 1381 TTTGATTGAATC? GGCAAACGTGAAATTGCTGAGCTACAAAAAC-AAAAAGATGCTTCT ^ 1441 TAACCCTTTAGTAGAATCACAAGCTAATGTAGCAGAGCTTGAAAAACAAAAAGCAGCATC AGATGCTAAGGTAGCAGAGCTTGAAAAAGAAGTTGAAGCTGCTAAAGCTGAGGTTCCACA 1561 1501 1621 TCTTAAAGCACAATTAGCTAAGAAAGAAGAAGAGCTTGAAGCCGTTAAGAAGGAAAAAGA AGCGCTTGAAGCTAAGATTGAAGAGCTCAAAAAAGCT (ATGCTC? GGAACTTTC-AAAACT 1681 TAAAGAAATGCTTGAGAAGAAAGACC ATGCAAATGCAGATCTTCAAGCAGAAATCAATCG CTTGAAGCAAGAGCTAGCTGACAGGATTAAGTCATTGTCACAAGGTGGTCGTCCTTCACA 1741 0 1801 1861 AACAAACCCAGGCACTACAACTGCTAAAGCAGGTCAATTGCCATCTACTGGTGAGTCTGC TAACCCATTCTTCACTATTGCAGCTCTTACTGTCATCGCTGGTGCTGGAATGGCTGTGGT GTCTCCTAAACGCAAAGAAAACTAAGCTATTTCCTCTTTCCCCAATGGACAATAGCCGAA 1921 1981 2041 ATAATAGAGCGACTATCGTTCTAACAC'AAAAGCAACAGTCTCCTGTCTGTTGCTTTTTGT GATATTAGGGCTCATCAGTCTAGGCT ATGGTTTTCTCCCCTTTATCTGCA 5 ^^, «JHJfeftt ^.

[SEC. FROM IDENT. NO: 1 (Gene for protein M (SeM) of S. equi)]. The open reading frame begins at 341 and continues to base 1934. Preferably, the compound is the SEC. FROM IDENT. NO: 1. However, compounds are also provided which are complementary to the SEC. FROM IDENT. N0: 1 or complementary to the portions of the SEC. FROM IDENT. N0: 1 A preferred portion of SEC. FROM IDENT. NO: l is the one described above as the base number 341 to 1943, inclusive (SEQ ID NO: 3). In addition, the compound defined by the number of bases 452 to about 1331 is also preferred (SEQ ID NO: 4). Those of ordinary skill in the art will appreciate that the DNA compounds exemplified above can easily be taught as useful complementary RNA sequences. Any such RNA sequences are also considered to be within the scope of the present invention. In the present description, the group of DNA compounds and AR? they are referred to as "nucleic acid compounds." In addition, cells transfected with one (or a multiplicity of copies of a) nucleic acid compound of the present invention are provided. A cell transfected with SEC is preferred. FROM IDE? T. ? O: 1 or a portion of it. Such cells may be prokaryotic or eukaryotic. Preferred cells include E. coli, S. cerevisiae, and Salmonella spp. Vectors transfected with one (or multiple copies) are also provided ^ gs ^^^^^^^ & Ed & j ^^^ y? of a) nucleic acid compound of the present invention. Preferred vectors include pox virus, adenovirus or other viral vectors. The nucleic acid compounds can be obtained by PCR using primers as is known to those skilled in the art, or from Gen Bank, accession number U73162. Vectors and cell lines can also be obtained as established by those skilled in the art. In addition, the amino acid compound is also provided: 10 15 20 25 30 1 M F L R N N K P K F S I R K L S A G A S S V L V A T S V L G 31 G T T V K A N S E V S R T A T P R L S R D L K N R L S D I A 61 I S G D A S S A Q K V R N L L K G A S V G D L Q A L L R G L 91 D S A R A Y C R D D Y Y N L L M H L S Y M L N D K P D G D 121 R R Q L S S L L V D E I E K R A D G D R Y A K L L E A 151 K L A A 1 K S Q Q E M L R E R D S L L R N L E K E K E Q E L 181 T K A K D E R Q A L T E S F N K T L S R S T K E Y N K L K T 211 E L A K E K A A K M T K E L A D K L S N A E S D D K A 241 F A V S K D L A D K L S S E E S S D D K A F A S K D L A D 271 K L A A K T A E E K L M E N V G S L D R L V E S A K R E M 301 A Q K L A Y I D Q L T A D K A K A D E L A A N D T I A S 331 L Q T E L E K A K T E L A V S E R L I S S G K R E I A E L Q 361 K Q K D A S D K A L V E S Q A N V A E L E K A K A S S A K 391 V A B L E K E V A A K A E. V A D L K A Q L A K K E E B L E £ tt £ g | L 421 A V K K E K A L E K K A H E E L S K L K E M 451 L E K K D H A N D L Q A E I N R L X Q E L A D S K S L S 481 Q G G A S S T T T T T A K A G S P S T G E S A N P F 511 F T I A A L T V I A G A G M A V V S P K R K E N which is the SEC. FROM IDENT. NO.- 2. The present invention also includes portions of the previous sequence. The most preferred portion of the above sequence is: residues 37 to 330 (SEQ ID NO: 5), however, one skilled in the art will recognize that any antigenic portion especially is commercially important and is included within the scope of the invention. present invention. The amino acid compounds can be obtained either by overexpression and purification in microorganisms or, in some cases, by conventional peptide synthesis. Therefore, a vaccine for S. equi is provided by the present invention. A vaccine which is administered intranasally or orally is a "preferred embodiment." A vaccine of the present invention may comprise the entirety of SEQ ID NO: 2, or portions thereof, The vaccines of the present invention may be In any pharmaceutically acceptable formulation, for example, SEQ ID NO: 5 can be incorporated into bilayer vesicles (liposomes), in an aqueous medium according to known procedures, such as those described by Debs et al., 265 J. Biol. Chem. 10189 (1990) .Any carrier or lipid forming If the liposomes can be used in any formulation which supplies the SeM antigen, for example, poly-DL-lactide-co-glycolide can be used in an intranasal spray formulation which comprises 1%. . SEC. FROM IDENT. NO: 5. Also within the scope of the present invention are formulations which include adjuvants which improve the delivery of the antigen to the mucosa, such as small amounts of the B subunit of the cholera toxin. The present invention also provides methods for stimulating the specific immune response against S. equi in horses, which comprises administering a compound of SEQ. FROM IDENT. NO: 2 or portions of it. The introduction of the nasal or oral antigen is preferred. Finally, the present invention provides methods for determining the presence of S. equi in horses by means of polymerase chain reaction. The polymerase chain reaction diagnostic assay of the present invention can be carried out according to known methods insofar as the primers for the sequence described herein are used as part of the initial materials. Methods for PCR can be found in many magazines and books, for example, PCR diagnostic methods can be carried out according to -Tec nigues iin PCR, PCR, CUrrent Protocols in Molecular Biology or Maniari s. As those skilled in the art know, preferred primers are those which have at least 50% GC content, ideally 19 to 23 base pairs in length, and are not capable of alignment to duplicate sections of the target DNA.

Examples Example 1: Cloning, sequencing and expression of SeM Chromosomal DNA of S. equi CF32 is partially digested with Tsp 5091 (New England Biolabs Inc., Beverly MA) and fragments of 3-8 kb are ligated to? ZAPII digested with EcoRI (Stratagene, LaJolla, CA). After packing (Gigapack II) (Stratagene, LaJolla, CA) and transfection in E. coli XLl-Blue MRF (Stratagene, LaJolla, CA), the library is plated, amplified and stored at -70 ° C in 7% DMSO. The library is analyzed on duplicate nitrocellulose discs by using rabbit antiserum 216 (1: 4000 dilution) to the acid fragment extracted from 41 kDa of SeM. Several reaction plates are analyzed until all the plates provide a positive signal. The proteins in these phage lysates are separated by SDS-PAGE and immunoblotted with serum 216. A plasmid containing a 3.5 kb fragment encoding SeM from a positive phage and the resulting plasmid is called pSeMOl. The nucleotide sequencing is performed on HindIII, Pvu II and Hind III-Pvu II fragments of the S. equi insertion in pSK by automated cycle sequencing. The sequences are aligned and connected by DNASIS (Hitachi Software Engineering America, Ltd., San Diego, CA). SeM is subcloned without its signal sequence at the Sá Hl site of the expression vector pET15b (Novagen, Madison, Wl) using the polymerase chain reaction (PCR) with pSeMOl as a template and the primers SeM-F (gcggatcCGAACTCTGAGGTTAGTCGT) (SEC ID NO: 6) and SeM-R (gcggatCCATAGCTTAGTTTTCTTTGCG) (SEQ ID NO: 7). The resulting plasmid is designated pSeM02 and transformed into E. coli BL21 (DE3). The recombinant SeM is isolated from a BL21 lysate by affinity chromatography on His-Bind resin (Novagen, Madison, l). The analysis of the connected sequences shows the presence of an open reading frame of 1605 nucleotides coding for the SeM gene (see Figure 1). The translation of SeM reveals a basic protein (CH +4.5) of 535 amino acids of calculated molecular mass of 58,251 and pl of 8.67. The amino acid sequence in the N-terminal part (residues 37-52) is identical to that obtained by direct micro-sequencing of the 41 kDa SeM fragment purified from an acidic extract of S. equi. The predicted amino acid sequence shows typical features of streptococcal surface proteins. The signal sequence has 36 residues. The N-terminal part of the mature protein has a net positive charge. The anchor membrane encompasses one region and the charged tail sequences are similar to those of another group A and C streptococcal sequences. Two direct repeated sequences (21 residues) are located between residues 226 and 267. Another shorter direct repeated part varies in length from 3 to 6 residues and is present in the carboxy terminal half of the molecule. Analysis of the secondary structure of the translated proteins shows an extensive region of alpha helix extending approximately from residue 120 to 480. The prediction of secondary structure shows turns in the vicinity of residues 120 and 480 to 500.

Example 2: Determination of the amino acid sequence SeM (2 mg) extracted with acid is purified as described in Example 3 and loaded onto a 2 cm wide slot in a 1.5 mm thick acrylamide gel (9%) for preparative SDS-PAGE. The gel is run in advance with 0.1 mM thioglycolic acid for _ 40 min at 100 V before loading the protein. After electrophoresis, and electrophoretic transfer to? Mmobilon P (Millipore), the 41 and 46 kDa major fragments of SeM are identified by staining for 1 min with Coomassie blue 0.025% in 40% methanol and glacial acetic acid 5% followed by destaining for 2 minutes in 30% methanol and 5% glacial acetic acid. The 41 kDa band is cut and the microsequence analysis is performed in a pulse phase 477A liquid phase sequencer (Applied Bio -fea-- Systems) at the University of Kentucky-Macromolecular Synthesis Laboratory.

Example 3: Protein extraction The M-like protein is extracted from a culture overnight (18 h) of S. equi by extraction in hot acid (Lancefield and Perlmann 96 J. Exp. Med. 71 (1952) and adsorbed to a hydroxyapatite column in 10 mM phosphate buffer pH 7.2 M-like proteins are eluted in 0.2 M Na2HP04, the salt is removed in Sephadex G25 The granulate is dissolved in 25% acetonitrile + 0.5% trifluoroacetic acid and loaded onto a reversed phase RP phenyl column (Bio-Rad, San Francisco AC) and connected to a Waters 650 protein purification system ( Waters, Marlborough, MA) .The protein is eluted using a linear gradient of 25-65% acetonitrile + 0.5% TFA.A spot of an 'immunoblot test on cellulose nitrate using rabbit antiserum specific for SeM is used to analyze The peak containing the SeM protein elutes at a concentration of approximately 42% acetonitrile.The positive peaks of several runs accumulate and are further purified in the same column.The purified protein is lyophilized, resuspended in PBS and It is stored in aliquots at -20 ° C. Extracts of mutanolysin from strains are made * ^ Jts? *? k & amp; and S. equi as previously described (Galán and Timoney, 26 J. Clin. Microbiol. 1142 (1988).

Example 4: Antisera Antiserum is produced against SeM purified by a combination of hydroxyapatite and reverse phase chromatography. New Zealand white rabbits (216) are injected subcutaneously with 50 μg of SeM in complete Freund's adjuvant followed at 3 week intervals by 2 similar doses emulsified in incomplete Freund's adjuvant. The serum is harvested at 8 weeks. It is hyperimmunized in a manner similar to a 963 rabbit with recombinant SeM from an E. coli sonicate. Rabbits Ec are immunized with a lysate of E. coli NovaBlue containing the pT7 Blue plasmid without an insert. Adult ICR mice are immunized with 25 μg of purified SeM from E. coli sonicate by HlS-Tag chromatography. Purified SeM (25 μg) is mixed with 5 μg of mycolic dipeptide (MDP) and alhydrogel (30%) and administered subcutaneously in a 100 ml dose volume. Two subcutaneous booster doses containing 25 μg of SeM but not MDP are administered 10 and 20 days later. Blood samples are taken from the mice at 28 days. All antisera are stored at -70 ° C until used.

"* R-Afi¡? ¡Ff- * -., R.

Example 5: Immunoblotting test Proteins in streptococcal or purified extracts of E. coli sonicate are separated by electrophoresis in SDS-10% polyacrylamide gel (PAGE) and electroblotted onto a nitrocellulose sheet and incubated in the appropriate diluted antiserum 1: 200 in PBS and then in protein G conjugated with peroxidase (1: 4000). The reactive bands are visualized using 4-chloro-l-naphthol (0.5 mg / ml) as substrate. The 963 rabbit antiserum for recSeM reacts with a 58 kDa protein in a mutanolisin extract of S. equi and with a protein slightly greater than 60 kDa expressed by E. coli BL21 containing pScM02 (see Figure 2). The same protein bands are recognized by the rabbit antiserum 216 for the 41 kDa fragment of SeM. Figure 3 shows the immunoblot profiles of mutanolysin extracts from a series of S. equi isolates collected at different times in the United States and Europe. The antiserum with recSeM recognizes two protein bands of 58 and 56 kDa in all extracts.

And *? T > Example 6: ELISA A fragment extracted with acid (41 kDa) of SeM purified by preparative agarose electrophoresis is used to coat wells (2.5 mg / wells) of polystyrene ELISA plates (Costar, 25880, Corning Glass Company, Corning NY). After washing and blocking with 0.5 M phosphate buffered saline (PBS) containing 0.05 Tween 20 and 1% bovine serum albumin, mouse or rabbit sera diluted 1:80 and 1: 200, respectively, in PBS are added to the wells (100 ml / well) in triplicate. After incubation for 3 hours at 37 ° C, bound IgG is detected either with protein G conjugated with peroxidase (1: 4000) or rabbit IgG against mouse, followed by a solution of O-phenylenediamine (0.0001 mM). Mean DO values of triplicate readings are contrasted with wells considered as white containing antigen and PBS.

Example 7: Opsonic test Equine neutrophils are separated from freshly harvested heparinized horse blood with a discontinuous Percoll gradient Pycock et al., 42 Res. Vet. Sci 411 (1987). Neutrophils from 7 ml of blood are suspended in RPMI medium (Gibco, Grand Island, NY) and aliquots of 80 ml (6 X 10 5 cells) are added in triplicate to wells of a cell culture group. ? ^ g ^^ = 24 wells (Costar, Cambridge, Mass). Each well contains a circular glass coverslip (12 mm diameter). Cell groups are incubated for 2 h at 37 ° C in 5% C02 and the cells are washed once with PBS to remove non-adherent neutrophils. Test organisms (S. equi CF32 and S. zooepidermicus W60) are grown overnight at 37 ° C in THB with 0.2% yeast tract up to an OD of 0.6. 20 ml of culture are added to 25 ml of serum and 450 ml of RPMI are added. After the plate is shaken gently for 30 minutes at 37 ° C, the coverslips are washed once with PBS (pH 7.2), fixed in 10% formalin and stained with Giemsa. The numbers of neutrophils with associated streptococci are counted per 100 cells for each serum and expressed as a percentage. All tests were performed in triplicate. The differences in the opsonic activities of the immune sera and control are statistically evaluated by Student's t test (unpaired observations) based on the means of three experiments. Sera from mice immunized with purified recombinant SeM shows 15 times more opsonic activity (p <0.01) for S. equi than for sera from non-immune mice. These sera also show strong antibody responses by ELISA to the 41 kDa SeM fragment (see Example 6). ^^^^^^^^ ßBß | É ^^^ | j ^^^ --------------? - ^ ---- ^ --- ^^ = j ^^ ^^^ - i ^^^^ - ii ???; = * M ?? Example 8: Fibrinogen binding assay Equine fibrinogen (0.5 mg / well) is attached to 96-well polystyrene ELISA plates (Costar). After washing and blocking, recombinant SeM (0.4 mg / well) is added in triplicate to wells separately and incubated for 2 hours at 37 ° C. After washing, 1:80 dilutions of the rabbit antisera are added to the 41 kDa fragment of SeM to the appropriate wells and incubated at 37 ° C for 2 hours. Control wells consist of wells from which fibrinogen and wells treated with sera from the same rabbits are omitted before immunization. The amounts of rabbit specific antibody that binds fixed SeM to fibrinogen are detected as described under ELISA. SeM shows a strong binding to equine fibrinogen immobilized in wells of ELISA plates. The average value of ELISA (± standard deviation, SD) for SeM bound to fibrinogen after correction for nonspecific binding of the protein to blocked well surfaces is 0.9 ± 0.1. The corrected value is 0.1 ± 0.1 when the pre-immune serum is used for assay for streptococcal protein binding.

Example 9: Access numbers for the nucleotide sequence The GenBank accession number for the nucleotide sequence of SeM is U73162.

Example 10: Homologies With the exception of signal and membrane anchoring sequences, SeM homology with the group A or GM protein sequences has not been detected in the GenBank database. SeM shows some homology between its signal sequences (39% identity) and membrane anchoring (66% identity) with those found in the database.

Example 11: Presence of antibodies that bind to SeM in convalescent horses Figure 3 shows the SeM regions reactive with antibodies in horse sera taken 8 weeks after recovery from strangulations. Most horses show responses to epitopes in the central region of SeM (residues 170 to 270). The responses of individual horses to the third N terminal region and to the carboxy terminal region of SeM are much more variable. No horse responds to peptide 151-166 alone. Linear epitopes recognized by IgA in nasal washes of convalescent animals (8 weeks) are found in the same reactive region with serum antibodies (see Figure 4). Multiple epitopes are targeted and, as in the case of serum antibodies, there is considerable variation in the responses of individual horses.

Example 12: Immunization of one-year-old ponies not exposed Two groups of three one-year-old Welsh ponies were immunized with the recombinant microencapsulated fusion protein peptide M (SeM, amino acids 231-330) produced in E. coli BL21 and with a microencapsulated extract of E coli host only. The encapsulated protein (100 μg) is sprayed on each nare on day 1 using a nasal spray. Booster doses of 150 and 350 μg are administered on days 7 and 42, respectively. Serum and nasal washings are collected on days 1, 7, 21 and 42 and tests are performed for specific IgG "for SeM in serum, and IgA in nasal washes." The mucosal IgA responses specific for SeM were evident on day 21 in 2 of the 3 ponies and in all the ponies on day 49. None of the three controls immunized with E. coli extract alone responded to SeM, no serum antibody responses were detected in any pony. the feasibility of selectively inducing specific mucosal antibody responses in - ^^ * j? horses by using a microencapsulated streptococcal peptide.

Example 13: PCR diagnostic assay Nasal isopos were collected (Precision Dynamic Corp. San Fernando, CA: Culturette, Baxter Healthcare Corp. Deerfield, IL) of horses affected and exposed by contact 1 to 5 days after the clinical diagnosis of strangulation in farms A, B, C and D. Some horses were sampled more than once in the next 3 weeks. Nasal washes were collected in the United Kingdom farm 15 and 85 days after a combined exposure to 2 horses with clinical strangulation. All these horses developed strangulation in the following 17 days of combined exposure. Nasal washes were collected by instilling 50 ml of phosphate buffered saline (pH 7.2) by means of a 8 mm diameter latex tube inserted 15 cm into the nare and collecting the altered fluid by draining. The fluid is centrifuged at 3000 g and the sedimented residues are separated for culture and for PCR. The isopos and sediments of the nasal wash were cultured on Columbia CNA horse blood agar and incubated for 18 hours at 37 ° C. The beta hemolytic colonies were subcultured and their fermentation behavior was tested in lactose, sorbitol and trehalose broths. Beta mucoid colonies ^^ aa --- BBB. ^^^^^^^^^^^^^ hemolytics that do not ferment any of these sugars were identified as S. Equi. DNA for PCR from nasal isoposes and washes is prepared as follows: the tips of the isopos were placed in 5 300 μl of sterile water, vortexed, the tips removed and the fluid centrifuged at 14,000 g for 10 minutes. minutes The pellets were resuspended in 20 μl of K buffer (buffer IX gen Amp II, Perkin Elmer, Tween 20 0.05%, 100 μg / ml proteinase K). The nasal washings or pellets were suspended in an equal volume of K buffer. The suspensions were incubated for 30 minutes at 55 ° C, boiled for 5 minutes and then centrifuged for 5 minutes at 14,000 g. The reaction mixture for PCR in a total volume of 30 μl is prepared in Gen Amp II buffer and contains MgCl, 2 mM, 0.2 mM dNTP, 0.5 units of Taq polymerase, SeM6 SeM7 primers, 0.25 μl, and a sample of 2-5 μl. The primer sequences were 5 '-TGCATAAAGAAGTTCCTGTC (SeM7-direct (bases 239-258) SEQ ID NO: 8) and 5'- GATTCGGTAAGAGCTTGACG (Reverse SeM (bases 899-918) SEQ ID NO: 9). Mineral oil (30 μl) is added to seal the reaction mixture. The cyclization is carried out as follows: -92 ° C for 2 minutes. 92 ° C for 1 minute; 58 ° C for 1 minute; 72 ° C for 1 minute (30 times); 72 ° C for 5 minutes; 4CC final. The PCR products are separated by gel electrophoresis of agarose and ethidium bromide. The SeM fragment is amplified with SeM 6 and 7 selators having 679 bp. The PCR test detected a DNA fragment of 679 bp in 37 samples that included 14 of 15 which were positive by culture. The sensitivity of PCR seems to be much higher than that of culture. Although the present invention has been fully described, it should be noted that various changes and modifications are evident to those skilled in the art. Such changes and modifications should be understood to be included within the scope of the present invention as defined in the appended claims. ? íS. t tn ^ ^ LIST OF SEQUENCES < 110 > Timoney, John F. Artiushin, Sergey University of Kentucky Research Foundation < 120 > Compounds that code for protein similar to protective m Streptococcus equi and tests for it < 130 > P-1045 < 140 > deposited in the present < 141 > 1998-06.23 < 150 > 60 / 050,577 < 151 > 1997-06-24 < 160 > 9 < 170 > Patentln Ver. 2.0 < 210 > 1 < 211 > 2091 < 212 > DNA < 213 > Streptococcus equi < 400 > 1 agctttctgt cacctgatgg tccttatcaa atactgtaat tgataacttc aaacagccct 60 gtagagattt tactaacgac atagtatcca tgctaagcgt tacccccttc ataatcctca 120 ttctatctta cggtatctta aaagcaagga aaatttaaga taatgaaaaa tatgcactta 180 atagacataa aaaacaataa tatacattct tgcttattaa ataaaaatga caatgtactg 240 cataaagaag ttcctgtcat taaaataaaa gtgccatgag gttataatag tatggtaaaa 300 caaaaaagtg tgcccataaa gggtagagag gaattgacat atgtttttga gaaataacaa 360 agcatcagaa gccaaaattt aactaagtga cggtgcagaa tcagtattag ttgcaacaag 420 tgtgttggga gggacaactg taaaagcgaa ctctgaggtt agtcgtacgg cgactccaag 480 attatcgcgt gatttaaaaa atagattaag cgatatagcc ataagtggag atgcctcatc 540 agccaaaaaa gttcgaaatc ttctaaaagg agcctctgtt ggggatttac aggcattatt 600 gattcagcaa gagaggtctt gggctgcgta tggtagagat gattattaca atttattgat 660 tcgatgttaa gcacctttca atgataaacc tgatggggat agaagacaat taagtttggc 720 ttcattactt gtagatgaaa ttgaaaagag gattgatgat ggagataggt atgcaaaact 780 tcttgaggct aaacttgaag ctattaaatc tcaacaagaa atgcttagag aaagagattc 840 ccaacttcga aatctaga ga aggagaaaga acaagagctc acaaaagcta aagatgagag 900 tcaagctctt accgaatcat tcaacaaaac tttataaaga tcaacaaaag agtataataa 960 gaacttgcac actaaaaaca aagaaaaaga aaaagcagct aagatgacta aggaattagc 1020 agataagata agcaatgctg aagcaagtcg tgataaagcc tttgcagtat caaaagattt 1080 agcagataaa ctaagtagtg atgaagcaag tcgtgataaa gattttgcag tatcaaaaga 1140 tttagcagat aaattggaag ataaaacagc agaagctgaa aagttaatgg aaaacgttgg 1200 tagtctagac cgcttggtag agtctgcaaa acgtgaaatg gctcaaaaat tagcagaaat 1260 actgctgata tgatcaatta aggctaaggc tgatgcagag cttgcagatg aaaatgacac 1320 cattgcatca cttcaaacag agctagaaaa agctaagaca gagcttgctg tttcagagag 1380 tttgattgaa tcaggcaaac gtgaaattgc tgagctacaa aaacaaaaag atgcttctga 1440 taaggcttta gtagaatcac aagctaatgt agcagagctt gaaaaaaaaa aagcagcatc 1500 agatgctaag gtagcagagc ttgaaaaaga agttgaagct gctaaagctg aggttgcaga 1560 caattagcta tcttaaagca agaaagaaga agagcttgaa gccgttaaga aggaaaaaga 1620 agcgcttgaa gctaagattg aagagctcaa aaaagctcat gctgaggaaa tttcaaaact 1680 attgagaaga taaagaaatg AAGA ccatgc aaatgcagat attcaagcag aaatcaatcg 1740 gagctagctg cttgaagcaa acaggattaa gtcattgtca gtgcttcaca aaaggtggtt 1800 ggtactacaa aacaaaccca ctgctaaagc aggtcaattg ccatctaatg gtgagtctga 1850 taacccattc ttcactattg cagctcttac tgtcatcgct ggtgctggaa tggctgtggt 1920 cgcaaagaaa gtctcctaaa actaagctat ttcctctttc cccaatggac aatagccgaa 1980 ataatagagc gactatcgcc ctaacacaaa agcaacagtc tcctgtctgc tgctttttgt 1040 gatattaggg ctcatcagtc taggctaatg gttttctgcg ctttatctgc to 2091 < 210 > 2 < 211 > 534 < 212 > PRT < 213 > Streptococcus equi < 400 > 2 Met Phe Leu Arg Asn Asn Lys Pro Lys Phe Ser lie Arg Lys Leu Ser 1 5 10 15 Ala Gly Ala Ala Ser Val Leu Val Ala Thr Ser Val Leu Gly Gly Thr 20 25 30 Thr Val Lys Wing Asn Ser Glu Val Ser Arg Thr Wing Thr Pro Arg Leu 35 40 45 JHg ^^ - ^^^^^^ and ^ ¡gg Ser Arg Asp Leu Lys Asn Arg Leu Ser Asp lie Ala lie Ser Gly Asp 50 55 60 Ala Ser Be Ala Gln Lys Val Arg Asn Leu Leu Lys Gly Ala Ser Val 65 70 75 80 Gly Asp Leu Gln Wing Leu Leu Arg Gly Leu Asp Being Wing Arg Wing Wing 85 90 95 Tyr Gly Arg Asp Asp Tyr Tyr Asn Leu Leu Met His Leu Ser Ser Met 100 105 110 Leu Asn Asp Lys Pro Asp Gly Asp Arg Arg Gln Leu Ser Leu Wing Ser 115 120 125 Leu Leu Val Asp Glu lie Glu Lys Arg lie Wing Asp Gly Asp Arg Tyr 130 135"140 Ala Lys Leu Leu Glu Ala Lys Leu Ala Ala lie Lys Ser Gln Gln Glu 145 150 155 160 Met Leu Arg Glu Arg Asp Ser Gln Leu Arg Asn Leu Glu Lys Glu Lys 165 170 175 Glu Gln Glu Leu Thr Lys Wing Lys Asp Glu Arg Gln Wing Leu Thr Glu 180 185 190 Being Phe Asn Lys Thr Leu Being Arg Being Thr Lys Glu Tyr Asn Lys Leu 195 200 205 Lys Thr Glu Leu Wing Lys Glu Lys Glu Lys Wing Wing Lys Met Thr Lys 210 215 2201 Glu Leu Wing Asp Lys Leu Ser Asn Wing Glu Wing Being Arg Asp Lys Wing 225 230 235 240 Phe Ala Val Ser Lys Asp Leu Ala Asp Lys Leu Ser Ser Ala Glu Ala 245 250 255 Ser Arg Asp Lys Ala Phe Ala Val Ser Lys Asp Leu Ala Asp Lys Leu 260 '265 270 Ala Ala Lys Thr Ala Glu Ala Glu Lys Leu Met Glu Asn Val Gly Ser 275 280 285 Leu Asp Arg Leu Val Glu Be Ala Lys Arg Glu Met Wing Gln Lys Leu 290 295 300 Wing Glu lie Asp Gln Leu Thr Wing Asp Lys Wing Lys Wing Asp Wing Glu 305 310 315 320 Leu Ala Ala Ala Asn Asp Thr lie Ala Ser Leu Gln Thr Glu Leu Glu 325 330 335 Lys Wing Lys Thr Glu Leu Wing Val Ser Glu Arg Leu lie Glu Ser Gly 340 345 350 Lys Arg Glu Lie Wing Glu Leu Gln Lys Gln Lys Asp Wing Being Asp Lys 355 360 365 Ala Leu Val Glu Ser Gln Ala Asn Val Ala Glu Leu Glu Lys Gln Lys 370 375 380 Ala Ala Ser Asp Ala Lys Val Ala Glu Leu Glu Lys Glu Val Glu Ala 385 390 395 400 Ala Lys Ala Glu Val Ala Asp Leu Lys Ala Gln Leu Ala Lys Lys Glu 405 410 415 Glu Glu Leu Glu Wing Val Lys Lys Glu Lys Glu Wing Leu Glu Wing Lys 420 425 430 lie Glu Gln Leu Lys Lys Wing His Wing Glu Glu Leu Lys Ser Lys Leu 435 440 445 Glu Met Leu Glu Lys Lys Asp His Wing Asn Wing Asp Leu Gln Wing Glu 450 455 460 lie Asn Arg Leu Lys Gln Glu Leu Wing Asp Arg lie Lys Ser Leu Ser 465 470 475 480 Gln Gly Gly Arg Wing Being Gln Thr Asn Pro Gly Thr Thr Thr Wing Lys 485 490 495 Wing Gly Gln Leu Pro Being Thr Gly Glu Being Wing Asn Pro Phe Phe Thr 500 505 510 He Ala Ala Leu Thr Val He Ala Gly Ala Gly Met Ala Val Val Ser 515 520 525 Pro Lys Arg Lys Glu Asn 530 < 210 > 3 < 211 > 1603 < 212 > DNA < 213 > Streptococcus equi < 400 > 3 atgtttttga gaaataacaa gccaaaattt agcatcagaa aactaagtgc aggtgcagca 60 tcagtattag ttgcaacaag tgtgttggga gggacaactg taaaagcgaa ctctgaggtt 120 agtcgtacgg cgactccaag attatcgcgt gatttaaaaa atagattaag tgatatagta 180 ataagtggag atgcctcatc agcccaaaaa gttcgaaatc ttctaaaagg tgcctctgtt 240 ggggatttac aggcattatt gagaggtctt gattaagcaa gggctgagta tggtagagat 300 gattattaca atttattgat gcacctttca tcgatgttaa atgataaacc tgatggggat 360 agaagacaat taagtttggc ttcattactt gtagatgaaa ttgaaaagcg gattgctgat 420 ggagataggt atgcaaaact tcttgaggct aaccttgcag ctattaaatc tcaacaagaa 480 atgcttagag aaagagattc aaaacttcga aggagaaaga aatctagaga acaagagctc 540 acaaaagcta aagatgagcg tcaagctctt accgaatcat tcaacaaaac tttatcaaga 600 agtataataa tcaacaaaag actaaaaaca gaacttgcaa aagaaaaaga aaaagcagct 660 aagatgacta aggaattagc agataagcta agaaatgctg aagcaagtcg tgataaagcc 720 tttgcagtat caaaagattt agcagataaa ctaagtagtg ctgaagcaag tcgtgataaa 780 gcttttgcag tatcaaaaga tttagcagat aaattggcag ctaaaacagc agaagctgaa 840 aagttaatgg aaaacgttgg tagtctagac cgcttggtag agtctgcaaa acgtgaaatg 900 gctcaaaaat tagcagaaat tgatcaatta actgctgata aggctaaggc tgatgcagag 960 cttgcagctg caaatgacac cattgcatca cttcaaacag agctagaaaa agctaagaca 1020 gagtttgctg tttcagagcg tttgattgaa tcaggcaaac gtgaaattgc tgagctacaa 1080 aaacaaaaag atgcttctga taaggcttta gtagaatcac aagctaatgt agcagagctt 1140 gaaaaacaaa aagcagcatc agatgctaag gtagcagagc ttgaaaaaga agttgaagct 1200 aggttgcaga gctaaagctg tcttaaagca caattagcta agaaagaaga agagcttgaa 1260 aggatttaga gccgttaaga agcgcttgaa gctaagattg aagagctcaa aaaagctcat 1320 gctgaggaac tttcaaaact taaagaaatg cttgagaaga aagacaatgt aaatgcagat 1380 cttcaagaag aaatcaatcg cttgaagcaa gagctagctg gtcattgtca acaggattaa 1440 gtgcttcaca caaggtggtc aacaaaccca ggcactacaa ctgctaaagc aggtcaattg 1500 ccatctactg gtgagtctgc taacccattc ttcactattg cagctcttac tgtcatcgat 1560 ggtgctggaa tggctgtggt gtctcctaaa cgcaaagaaa act 1603"^^^ gg ^^^^^^ U ^^^^^^^ gKSB ^^^^^^^^^^^^^^^^^^ S ^^^^^^^^^^^ ^^^^^^^^ < 210 > 4 < 211 > 880 < 212 > DNA < 213 > Streptococcus equi < 400 > 4 tctgaggtta gtcgtacggc gactccaaga ttatcgcgtg atttaaaaaa tagattaagc 60 gatatagcca taagtggaga tgcctcatca gcccaaaaag ttcgaaatct tctaaaaggc 120 gcctctgttg gggatttaca ggcattattg agaggtcttg attcagcaag ggctgcgtat 180 ggtagagatg attattataa tttattgatg cacctttcat cgatgttaaa tgataaacct 240 gatggggata gaagacaatt aagtttggct tcattacttg tagatgaaat tgaaaagcgg 300 attcgtgatg gagataggta tgcaaaactt cttgaggcta aacttgcagc tattaaatct 360 caacaagaaa tgcttagaga caacttcgaa aagagattcc atctagagaa ggagaaagaa 420 caaaagctaa caagagctca agatgagcgt caagctctta ccgaatcatt caacaaaact 480 ttatcaagat caacaaaaga gtataataaa aacttgcaaa ctaaaaacag agaaaaagaa 540 agatgactaa aaagcagcta ggaattagta gataagctaa gcaatgctga agcaagtcgt 600 gataaagcct ttgcagtatc aaaagattta gcagataaac taagtagtgc tgaagcaagt 660 cgtgataaag cttttgcagt atcaacagat ttagcagata aattggcagc taaaacagca 720 agttaatgga gaagctgaaa aaacgttggt agtctagaac gtctgcaaaa gcttggtaga 780 cgtgaaatgg ctcaaaaatt agcagaaatt gatcaattaa ccgctgataa ggctaaggct 840 gatgcagagc ttgcagctgc aaatgacacc attgcataac 880 < 210 > 5 < 211 > 294 < 212 > PRT < 213 > Streptococcus equi | jfcÉ ^^^^^^^^^^^? g ^^^^^^^^ rf ^^ < 400 > Asn Ser Glu Val Ser Arg Thr Wing Thr Pro Arg Leu Ser Arg Asp Leu 1 5 10 15 Lys Asn Arg Leu Being Asp He Wing He Ser Gly Asp Wing Being Ser Wing 20 25 30 Gln Lys Val Arg Asn Leu Leu Lys Gly Wing Ser Val Gly Asp Leu Gln 35 40 45 Wing Leu Leu Arg Gly Leu Asp Being Wing Arg Wing Wing Tyr Gly Arg Asp 50 55 60 Asp Tyr Tyr Asn Leu Leu Met His Leu Ser Being Met Leu Asp Asp Lys 65 70 75 80 Pro Asp Gly Asp Arg Arg Gln Leu Ser Leu Wing Ser Leu Leu Val Asp 85 90 95 Glu He Glu Lys Arg He Wing Asp Gly Asp Arg Tyr Wing Lys Leu Leu 100 105 110 Glu Ala Lys Leu Ala Ala He Lys Ser Gln Gln Glu Met Leu Arg Glu 115 120 125 Arg Asp Ser Glu Leu Arg Asn Leu Glu Lys Glu Lys Glu Gln Glu Leu 130 135 140 Thr Lys Wing Lys Asp Glu Arg Gln Wing Leu Thr Glu Being Phe Asn Lys 145 150 155 160 Thr Leu Ser Arg Ser Thr Lys Glu Tyr Asn Lys Leu Lys Thr Glu Leu 165 170 175 Ala Lys Glu Lys Glu Lys Ala Ala Lys Met Thr Lys Glu Leu Ala Asp 180 185 190 Lys Leu Ser Asn Wing Glu Wing Ser Arg Asp Lys Wing Phe Wing Val Ser 195 200 205 Lys Asp Leu Wing Asp Lys Leu Ser Ser Wing Glu Wing Ser Arg Asp Lys 210 215 220 Wing Phe Wing Val Ser Lys Asp Leu Wing Asp Lys Leu Wing Wing Lys Thr 225 230 235 240 Wing Glu Wing Glu Lys Leu Met Glu Asn Val Gly Ser Leu Asp Arg Leu 245 250 255 Val Glu Be Wing Lys Arg Glu Met Wing Gln Lys Leu Wing Glu He Asp 260 265 270 Gln Leu Thr Wing Asp Lys Wing Lys Wing Asp Wing Glu Leu Wing Wing Wing 275 280 285

Claims (14)

1. A compound comprising a compound of the formula: SEC. FROM IDENT. NO: 1.

2. A compound of claim 1, which is SEC. FROM IDENT. NO: 1.

3. A prokaryotic cell comprising a compound of claim 1.

4. A eukaryotic cell comprising a compound of claim 1.

A cell of claim 3, which is E. coli

6. A cell of claim 3, which is

Salmonella spp. 1 . A compound of the formula: SEC. FROM IDENT. NO: 2 or a portion of it.

8. A vaccine 'comprising a compound of claim 7.

9. A compound of claim 7, which is SEC. FROM IDENT. NO: 5

10. A compound of claim 9, which is incorporated into a liposome.

11. A compound of claim 10, which further comprises subunit B of the cholera toxin.

12. A method for inducing specific immunity against S. equi in a horse, which comprises administering a compound of claim 9.

13. A method to identify a horse infected with S. equi, which comprises: obtaining a biological sample of the horse; prepare the sample for PCR; perform the PCR test using appropriate primers for the SEC. FROM IDENT. NO: l; electrophoresing the final product; and determine the presence or absence of the size fragment appropriately.

14. A method of claim 13, wherein the primers used are SEC. FROM IDENT. NO: 8 and SEC. FROM IDENT. O: 9.