WO1997038723A1 - Vecteurs viraux a cibles definies - Google Patents

Vecteurs viraux a cibles definies Download PDF

Info

Publication number
WO1997038723A1
WO1997038723A1 PCT/US1997/006590 US9706590W WO9738723A1 WO 1997038723 A1 WO1997038723 A1 WO 1997038723A1 US 9706590 W US9706590 W US 9706590W WO 9738723 A1 WO9738723 A1 WO 9738723A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
nucleic acid
cell
aav
viral
Prior art date
Application number
PCT/US1997/006590
Other languages
English (en)
Inventor
Michael Mamounas
Gang Yu
Qicheng Yang
Qi-Xiang Li
Jack Barber
Mang Yu
Original Assignee
Immusol Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Immusol Incorporated filed Critical Immusol Incorporated
Priority to EP97918752A priority Critical patent/EP0927044A4/fr
Priority to AU26780/97A priority patent/AU2678097A/en
Publication of WO1997038723A1 publication Critical patent/WO1997038723A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/13011Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041Use of virus, viral particle or viral elements as a vector
    • C12N2740/13045Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/40Vectors comprising a peptide as targeting moiety, e.g. a synthetic peptide, from undefined source
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00Vectors comprising a targeting moiety
    • C12N2810/50Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/859Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from immunoglobulins

Definitions

  • Cells can be stably transduced with a number of viral vectors including those derived from retroviruses, pox viruses, adenoviruses (Ads), herpes viruses and parvoviruses.
  • Common viral vectors include those derived from murine leukemia viruses (MuLV), gibbon ape leukemia viruses (GaLV), human immuno deficiency viruses (HIV), adenoviruses, adeno associated viruses, Epstein Barr viruses, canarypox viruses, cowpox viruses, and vaccinia viruses.
  • Viral vectors based upon retroviruses, adeno-associated viruses, herpes viruses and adenoviruses are all used as gene therapy vectors for the introduction of therapeutic nucleic acids into the cells of an organism by ex vivo and in vivo methods.
  • Prior art viral vectors suffer from a common problem.
  • the vectors are typically able to transduce only those cells infected by a wild-type virus corresponding to the vector.
  • vectors are often either unable to transfect a desired target cell, or promiscuously transfect many cell types other than a specific target cell.
  • prior art gene therapy vectors may be ineffective, or have undesirable side effects due to transduction of non-target cells.
  • Prior art attempts to make viral vectors cell-specific have been only partially successful, and have been largely limited to Retroviral vectors. For instance, retroviruses are typically "pseudotyped" to alter the specificity of the virus.
  • VSV vesicular stomatitis virus
  • Retroviral vectors have recently been engineered to express various cell receptor ligands in env, enabling the vectors to be targeted to cells which express the receptors. See, Cosset et al. (1995) Journal of Virology 69: 6314-6322, and Somia et al. (1995) Proc. Natl. Acad. Sci. USA. 92: 7570-7574. However, this procedure results in low infectivity of the vector, and it is not clear what the resulting host range of the engineered vectors is. In addition, described retroviral vectors only infect dividing cells.
  • the invention provides targeted viral vectors which transfect selected cell types, and which do not enter cells through the mechanisms which ordinarily permit entry of the corresponding virus into the cell.
  • the vectors of the invention have a nucleic acid, and a viral particle which has a targeting ligand.
  • the particle substantially lacks a functional wild-type viral cell binding site.
  • the Targeting ligand binds to a protein expressed on the surface of a target cell, targeting the vector to the target cell.
  • the wild-type viral cell binding site on the particle is deleted by deleting nucleic acid sequence which encode the site (or sites) on a virus corresponding to the vector which interact with the viral cell binding site.
  • the deleted site is replaced with a targeting ligand such as streptavidin, polylysine, a cell receptor ligand, an antibody against a cell receptor or an antibody binding ligand.
  • a targeting ligand such as streptavidin, polylysine, a cell receptor ligand, an antibody against a cell receptor or an antibody binding ligand.
  • the targeting ligand is optionally cloned into a site other than site of the deletion.
  • the wild-type site is not deleted entirely from the vectors, but is blocked, e.g., by binding an antibody to the wild-type site.
  • the targeting ligand is optionally cloned into the vector, or incorporated into the monoclonal antibody which is bound to the vector(e.g., by chemical modification of the antibody with a biotin label).
  • the nature of the viral particle varies depending on the type of vector.
  • the particle in vectors derived from capsid viruses, such as Ad and parvoviruses, the particle is essentially a capsid.
  • the viral particle in enveloped vectors, the viral particle includes the lipid envelope and internal nucleic acid packaging components.
  • Preferred vectors include recombinant herpes virus vectors, retroviral vectors, parvovirus vectors, Ad vectors, pox virus vectors and other vectors known to persons of skill.
  • the vectors comprise an expression cassette for expression of a nucleic acid, which optionally codes for a protein.
  • the vectors include nucleic acids.
  • the nucleic acids encode part or all of the vector particle.
  • the nucleic acid optionally encodes AAV or Ad ITRs, or retroviral LTRs, and structural proteins such as capsid proteins, envelope proteins, or the like.
  • the nucleic acids in the vectors do not code for the vector, but are packaged by the vector.
  • the nucleic acids optionally include a viral packaging site such that when the nucleic acid is bound by viral packaging components it is packaged into particles.
  • the nucleic acid is optionally grown in a packaging cell which expresses viral packaging components.
  • the nucleic acids are unrelated to the vector particle, and are simply associated with the particle, e.g., by chemically coupling the particle to the nucleic acid.
  • the vectors of the invention are used to transfect a target cell with a target nucleic acid.
  • Methods of transfection include contacting the cell with the vector in vitro or in vivo.
  • the method optionally includes the step of binding a biotinylated antibody to the vector which binds to a molecule on the surface of the cell to direct entry of the vector into the cell.
  • the invention provides targeted Ad nucleic acids and vectors.
  • Preferred nucleic acids have a deletion in the L5 region of the genome, thereby reducing the natural specificity of the virus.
  • a targeting ligand is cloned into the L5 region.
  • the nucleic acid optionally encodes all of the components of the viral particle, or is optionally packaged into the viral particle with particle components encoded by heterologous nucleic acids, e.g., in a packaging cell.
  • the invention provides targeted AAV vectors.
  • These vectors include a nucleic acid and a capsid which packages the nucleic acid.
  • the capsid has reduced or deleted specificity for the AAV cellular receptor.
  • the AAV vector particle has a deletion in capsid proteins.
  • deletions in Vpl or Vp3 are preferred and typically provide capsids with reduced specificity for the AAV receptor.
  • amino acids 239-244 from Vp3 are deleted.
  • Vpl has a deletion in the proline rich region, e.g., amino acids 26-34 in Vpl.
  • the AAV vectors include a targeting ligand expressed on the surface of the capsid.
  • Preferred expression sites include Vpl and Vp3. Highly preferred expression sites include amino acids 26-34 of Vpl and 239-244 of Vp3.
  • the nucleic acid packaged by the AAV particle encodes the AAV particle.
  • the nucleic acid optionally is packaged into the particle in an AAV packaging system, or an AAV transfection system such as an AAV packaging cell.
  • the Ad and AAV vectors of the invention are typically capable of introducing nucleic acids into target cells.
  • the vectors are brought into contact with the cells, and the vectors gain entry to the cell by interaction of the targeting ligand with a molecule on the surface of the cell.
  • the ligand is optionally incorporated into the capsid, or a molecule is optionally inco ⁇ orated into the capsid which binds a second molecule such as a monoclonal antibody.
  • the cell targeting ligand is a biotinylated protein and the capsid comprises a streptavidin moiety.
  • the invention provides non-enveloped vectors such as Ad and AAV based vectors.
  • the vectors have a capsid and a nucleic acid, where the nucleic acid is typically encapsidated in the capsid.
  • Antibodies are optionally bound to the capsid, at either the cell binding site (thus inhibiting entry of the vector into a cell through normal cellular mechanisms), or to a ligand cloned into the cell binding site. Typically, the antibody is biotinylated.
  • the antibody either binds to a cell surface molecule, facilitating entry of the vector into cells comprising the surface molecule, or the antibody is coupled through a molecular bridge (e.g., a streptavidin intermediate) to a second antibody which recognizes a cell surface molecule.
  • a molecular bridge e.g., a streptavidin intermediate
  • the invention provides combinatorial methods and libraries for selecting targeting ligands, and for optimization of vectors which comprise the targeting ligands.
  • a targetable vector library comprising a plurality of recombinant targeted viral vectors having reduced specificity for a cellular receptor as compared to a corresponding wild-type virus is provided.
  • each of the targeted viral vectors has a vector nucleic acid encoding a viral surface protein-targeting ligand fusion protein.
  • a preferred library is derived from AAV, in which the recombinant targeted vectors are derived from AAV and the viral surface protein is an AAV capsid (cap) protein.
  • Preferred targets for the vectors and libraries of the invention include cell surface proteins such as CD4 and
  • a targeting nucleic acid encoding a targeting peptide which binds to a target cell is provided.
  • This targeting nucleic acid is randomly cloned into a vector nucleic acid comprising a mutant surface protein subsequence which encodes a viral surface protein (typically, this protein has reduced affinity for a viral receptor as compared to a wild-type virus), thereby providing a library of random insertions of the targeting nucleic acid into the mutant surface protein subsequence.
  • This library is selected for a vector that infects a target cell, thereby selecting the targeted vector.
  • a phage display library is used to select the targeting ligand.
  • a variety of random cloning strategies are provided, including creation of random plasmid libraries followed by subcloning into a vector, random linker insertion, transposon mutagenesis and the like.
  • the invention includes isolated viral vectors which are isolated using the library screening methods of the invention.
  • a vector having a targeting ligand which binds to a cell surface protein such as a cell receptor (e.g., CD34, CD4 an HIV co-receptor surface protein or the like) is provided.
  • the vector is made by isolating a bacteriophage particle, which specifically binds to a cell expressing the surface protein, from a random phage display library, thereby providing an identified bacteriophage particle.
  • the relevant targeting ligand is then subcloned out of the display phage (or a synthetic sequence corresponding to the targeting ligand is made), and cloned into a viral nucleic acid.
  • the nucleic acid is expressed in a vector packaging cell, thereby making a protein comprising the targeting ligand.
  • the protein is incorporated into the viral vector in the packaging cell, the nucleic acid optionally encodes other features of the vector particle (capsid or envelope proteins, or the like), and is optionally packaged by the vector.
  • the vector is an AAV vector.
  • Polypeptides which specifically bind to CD4 are provided.
  • Preferred polypeptides include GAVQPRGATSKLYLLRMTDK, MGEKLHRVHIRTNTPSVYSR, LEPRVAQRGQMVKFTYMRLP, HAWWKPWGWSIEALAPTAGP, and, conservative modifications thereof.
  • Nucleic acids encoding the polypeptides are also provided.
  • the nucleic acids are encoded in a viral particle which expresses the polypeptides on the surface of the particle.
  • the polypeptides can be incorporated into a viral surface protein such as an AAV capsid protein.
  • Fig. 1. Is a schematic phage particle with a randomized 20-mer at the n-terminus of the PHI region of the phage capsid protein.
  • Fig. 2. Is a schematic procedure for selection of high affinity binding phage.
  • Fig. 3. describes theoretical mechanisms of AAV entry into a target cell, including a) AAV vector binds to target cell receptor; b) receptor-mediated entry into specific cellular compartment where c) modification/uncoating of the vector occurs; d) release from the compartment of modified vector followed by trafficking to the nucleus; e) hypothetical ligand binds to receptor that f) is internalized by mechanism not compatible with AAV transduction. Also, theoretical entry of AAV into target cell where I) receptor binding is II) independent from mechanism of internalization.
  • Fig. 4. is a schematic representation for construction of targetable vector library and subsequent enrichment steps.
  • Fig. 5. is a simplified diagram of the transposable element AT-2. Shown are 4 nucleotide U3 elements necessary for integration; unique restriction sites RE with — 15 nucleotide flanking sequences; selection marker dihydrofolate reductase gene (DHFR). Fig. 6 shows AAV binding mutants.
  • AAV helper virus is a virus which supplies some or all of the functions necessary for AAV (or rAAV vector) replication which are not encoded by a wild-type AAV. Typically these functions are supplied in trans by viruses such as adenovirus or herpes virus during viral replication. Adenovirus and herpes virus are examples of AAV helper viruses.
  • AAV ITR sequence refers to the sequences which comprise the palindroniic terminal repeats at the 3' and 5' ends of the AAV genome. Typically, the repeats are about 150 nucleotides in length.
  • the AAV ITR regions provide sequences for packaging the AAV provirus (i.e., the AAV genome) into the AAV viral capsid.
  • the ITR regions also form secondary structures which act as self- primers for AAV replication. Samulski (supra) describes AAV ITR sequences and structures.
  • An "adenovirus ITR” refers to the 3' and 5' terminal regions of the adenovirus genome. See, e.g., Gingeras et al. (1982) J. Biol. Chem. 257:13475- 13491.
  • an “antibody” is a polypeptide substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof which specifically bind and recognize an analyte (antigen). Recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
  • An exemplary immunoglobulin (antibody) structural unit comprises a tetramer.
  • Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 Kd) and one "heavy” chain (about 50-70 Kd).
  • the N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
  • the terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively.
  • Antibodies exist e.g., as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases.
  • pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2, a dimer of Fab which itself is a light chain joined to VH-CH1 by a disulfide bond.
  • the F(ab)'2 may be reduced under mild reducing conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)'2 dimer into an Fab' monomer.
  • the Fab' monomer is essentially an Fab with part of the hinge region (see, Fundamental Immunology, Third Edition, W.E. Paul, ed., Raven Press, N.Y. (1993) for a more detailed description of other antibody fragments).
  • antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such Fab' fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology. Single chain antibodies are commonly referred to a ScAbs. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies.
  • An antibody or other protein specifically binds to a cognate molecule when it binds with an affinity (K ⁇ ) of at least about 10- 6 , preferably about 10- 8 , and usually about 10- 9 or better.
  • a “cell surface receptor” or a “cell membrane receptor” is a cellular molecule expressed on the cell's outer membrane surface which is bound by a ligand. Typically, in the context of the present invention, the binding of a cell surface receptor to its cognate ligand causes endocytosis of the receptor and ligand.
  • a “cell surface protein” is a protein expressed at least partially on the outer membrane of a cell, including transmembrane proteins and proteins associated with the outer cell membrane.
  • Two vectors are "complementary" when the two together encode functions necessary for vector packaging, and when each individually does not encode all of the functions necessary for packaging. Thus, for instance, when the two vectors transduce a single cell they together encode the information for production of vector particles.
  • the use of such complementary vectors is preferred because it increases the safety of any packaging cell made by transformation with a vector.
  • Encapsidation refers to the general process of incorporating a viral genome into a viral capsid.
  • Endocytosis refers generally to the phenomenon of a cell ingesting material, e.g., by phagocytosis or pinocytosis. Receptor-mediated endocytosis provides an efficient means of causing a cell to ingest material which binds to a cell surface receptor. See, Wu and Wu (1987) J. Biol. Chem. 262:4429-4432; Wagner et al. (1990) Proc. Natl. Acad. Sci. USA 87:3410-3414, and EP-A1 0388 758.
  • heterologous when used with reference to a nucleic acid indicates that the nucleic acid comprises two or more subsequences which are not found in the same relationship to each other in nature.
  • the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid.
  • the nucleic acid has a promoter from one gene arranged to direct the expression of a coding sequence from a different gene.
  • the promoter is heterologous.
  • a "human cell” is any cell which is substantially human in origin, including organismal cells, tissue culture cells, and chimeric cells with human chromosomes.
  • nucleic acid refers to a deoxy ribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, encompasses known analogues of natural nucleotides that hybridize to nucleic acids in manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence includes the complementary sequence thereof.
  • a "nucleic acid vector” is a composition which can transduce, transform, transfect or infect a cell, thereby causing the cell to replicate and/or express nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell.
  • a vector includes a "vector nucleic acid” (ordinarily RNA or DNA) to be expressed or replicated by the cell.
  • a vector nucleic acid optionally encodes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like.
  • a "cell transformation vector” is a vector which encodes a nucleic acid capable of transforming a cell once the nucleic acid is transduced into the cell.
  • operably linked refers to functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
  • a nucleic acid expression control sequence such as a promoter, or array of transcription factor binding sites
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • a “potential targeting peptide” is a peptide to be tested for the its ability to target a vector to a target cell.
  • a “promoter” is an array of nucleic acid control sequences which direct transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
  • the promoter also includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.
  • a “constitutive” promoter is a promoter which is active under most environmental conditions and states of development or cell differentiation.
  • An “inducible” promoter responds to an extracellular stimulus.
  • a “receptor-binding ligand” is a biological molecule which binds to a receptor molecule on the surface of a cell.
  • the molecule is either naturally occurring or artificial (e.g., synthetic).
  • the binding of the receptor binding ligand to its cognate receptor results in endocytosis of the receptor binding ligand, along with materials which are attached to the receptor binding ligand.
  • the term "recombinant" when used with reference to a viral vector indicates that the vector comprises or is encoded by one or more nucleic acids which are derived from a nucleic acid which was artificially constructed.
  • the vector can comprise or be encoded by a cloned nucleic acid formed by joining heterologous nucleic acids as taught, e.g., in Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, CA (Berger) and in Sambrook et al. (1989) Molecular Cloning - A Laboratory Manual (2nd ed.) Vol. 1-3 (Sambrook).
  • a "recombinant expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements which permit transcription of a target nucleic acid.
  • the recombinant expression cassette can be derived from a plasmid, virus, chromosome or nucleic acid fragment.
  • the recombinant expression cassette includes a nucleic acid to be transcribed (a target nucleic acid), and a promoter.
  • the expression cassette also includes, e.g. , an origin of replication, and/or chromosome integration elements such as viral LTRs or viral ITRs.
  • a vector has "reduced specificity" for a cellular receptor when the vector binds to the cellular receptor with lower specificity than a corresponding wild- type virus, or a vector with a wild-type viral cell recognition protein.
  • competition binding assays are used to establish that the mutant AAVs described bind to cells with less specificity than wild-type AAV.
  • a "corresponding wild-type virus” is the virus from which the cell recognition protein on the viral vector particle is derived (e.g., envelope or capsid proteins, depending on the vector).
  • a viral "cell recognition protein” is the protein on the surface of the viral particle derived from a wild-type virus which binds a cellular receptor, thereby mediating entry of the wild-type virus.
  • the vector with reduced specificity binds to the cellular receptor at a rate which is 50% or lower than that of a vector or virus with a wild-type cell recognition protein.
  • the vector with reduced specificity binds to the cellular receptor at a rate 25 % or lower, and often 1 % or lower than a vector or virus with a wild-type cell recognition protein. Binding to the cellular receptor can be measured by cellular uptake of nucleic acids, by ELISA assays, by viral competition assays, or by directly measuring the binding of the cellular receptor to the virus by labeling the receptor or the vector.
  • the viral vector with reduced specificity for the cellular receptor also includes a targeting ligand
  • the vector typically binds to a molecule on a cell through the targeting ligand with high specificity.
  • specificity measurements of the binding of the viral vector to a cellular receptor other than one which binds the targeting ligand should be carried out on cells which do not comprise a molecule which binds the targeting ligand.
  • the binding mediated through the targeting ligand can be independently estimated and subtracted away from the binding results.
  • Sequences necessary for AAV packaging in the context of an AAV helper nucleic acid include AAV sequences active in trans found between or within the AAV ITR regions which encode nucleic acids and proteins necessary for encapsidation of the rAAV nucleic acid into an AAV capsid, e.g., typically the AAV capsid proteins (Vp 1, Vp 2, Vp3) and replicase proteins (Rep 78, Rep 68, Rep 40, Rep 52).
  • AAV capsid proteins Vp 1, Vp 2, Vp3
  • Rep 78, Rep 68, Rep 40, Rep 52 replicase proteins
  • sequences necessary for AAV packaging refer to cw-active sequences which permit the rAAV nucleic acid to be “encapsidated” (packaged into an AAV viral capsid; “encapsulated” is equivalent terminology herein). These sequences typically include the AAV ITR regions.
  • a “Subsequence” in the context of a nucleic acid or polypeptide refers to a sequence corresponding to a portion of the nucleic acid or polypeptide. The portion is up to 100% of the nucleic acid or polypeptide, or can be only a small portion of a molecule.
  • a “target nucleic acid” is a nucleic acid to be transduced into a cell.
  • the target nucleic acid can integrate into a cell's genome, or remain episomal.
  • targeting when used with reference to a viral vector indicates that the vector is bound by a specific subset of cells, enabling the vector to transfer associated nucleic acids into a cell of the subset.
  • a "targeting ligand” is a molecule which either specifically binds a cell or is bound by a second molecule or complex of molecules which specifically bind a cell.
  • the strength or affinity of binding interactions can be expressed in terms of the dissociation constant (K D ) of the interaction, wherein a smaller K D represents a greater affinity.
  • Immunological binding properties of selected polypeptides can be quantified using methods well known in the art.
  • One such method entails measuring the rates of antigen-binding site/antigen complex formation and dissociation, wherein those rates depend on the concentrations of the complex partners, the affinity of the interaction, and on geometric parameters that equally influence the rate in both directions.
  • K on the "on rate constant"
  • off rate constant K saddle ff
  • K D dissociation constant
  • a cell is specifically bound when the ligand (or ligand complex) has a K D of 10- 5 or better, preferably 10- 6 or better, more preferably lfr 7 or better, generally 10- 8 or better and usually 10-° or better.
  • nucleic acid associated with the vector is transferred into the cell upon incubation of the cell with the vector, while the nucleic acid is transferred into cells which lack a receptor for the targeting ligand at a substantially reduced level.
  • vector nucleic acid is transferred into the cell with a receptor which binds the targeting ligand at a rate of at least about 5x and preferably at least about lOx that observed for a cell which lacks the receptor.
  • a cell lacks a receptor when the cell cannot be isolated from a population of cells by FACS using an antibody against the receptor as a marker, or when an isotype matched antibody control binds to the cell with the same intensity ( ⁇ about 5%) as an antibody specific for the receptor.
  • Uptake of nucleic acid into the cell can be measured by Southern or northern analysis, quantitative PCR, by expression of encoded proteins (e.g., by ELISA or western blotting) or the like.
  • a Targetable vector library is a collection of related vectors, where at least one of the vectors in the collection specifically binds to a protein expressed on the surface of the cell.
  • a “targeted vector” is a viral vector which includes a targeting ligand. Preferably, the vector has reduced binding to a cellular receptor for the corresponding virus.
  • a targeting nucleic acid encodes a targeting ligand such as a peptide which binds to a protein expressed on the outer membrane of a cell.
  • a “target cell” is a cell to be transduced by a selected vector.
  • “Titers” are numerical measures of the "concentration" of a virus or viral vector compared to a reference sample, where the concentration is determined either by the activity of the virus, or by measuring the number of viruses in a unit volume of buffer.
  • the titer of viral stocks are determined, e.g., by measuring the infectivity of a solution or solutions (typically serial dilutions) of the viruses, e.g., on HeLa cells using the soft agar method (see, Graham & Van Der eb (1973) Virology 52:456-467) or by monitoring resistance conferred to cells, e.g., G418 resistance encoded by the virus or vector, or by quantitating the viruses by UV spectrophotometry (see, Chardonnet & Dales (1970) Virology 40:462-477).
  • a cell is “transduced” with a selected nucleic acid when the nucleic acid is translocated from the extracellular environment into the cell.
  • a cell is “stably transduced” with a selected nucleic acid when the selected nucleic acid is replicated and passed on to progeny cells.
  • a virus or vector "transduces” a cell when it transfers a nucleic acid associated with the vector into the cell.
  • a cell is “transformed” by a nucleic acid when a nucleic acid transduced into the cell becomes stably replicated by the cell, either by incorporation of the nucleic acid into the cellular genome, or by episomal replication.
  • a virus or vector is "infective" when it transduces a cell, replicates, and (without the benefit of any complementary virus or vector) spreads progeny vectors or viruses of the same type as the original transducing virus or vector to other cells in an organism or cell culture, wherein the progeny vectors or viruses have the same ability to reproduce and spread throughout the organism or cell culture.
  • Transduction refers to the process in which a foreign nucleic acid (which is packaged in a viral particle or associated with a viral particle when outside of the cell) is introduced into a cell. The foreign nucleic acid is typically integrated into the cellular genome, but in some embodiments remains episomal.
  • Transfection refers broadly to the process of causing a nucleic acid to enter a cell.
  • the term is sometimes used to refer to a process wherein the nucleic acid is "naked,” i.e., not in a viral capsid or associated with other biologicals.
  • transfection refers to the process of causing a nucleic acid to enter the cell as a "naked" nucleic acid, and/or to the process of causing a nucleic acid which is associated with other biologicals, such as nucleic acid binding molecules, viral components, receptor ligands etc. to enter a cell.
  • a "viral particle” in the context of a viral vector refers to virally derived vector material (proteins, glycoproteins, lipids, etc.) which package or is associated with a nucleic acid competent to be packaged by a wild-type virus in the vector.
  • a viral particle can be a capsid (e.g., where the virus is Ad or AAV), or a capsid with a lipid envelope (e.g., where the virus is a retrovirus).
  • a nucleic acid competent to be packaged by a wild-type viral particle includes packaging sequences recognized by the corresponding virus, such as the psi site in a retrovirus or the Ad or AAV ITRs.
  • a viral vector viral particle will ordinarily package nucleic acid.
  • One preferred measure of packaging is nuclease resistance of the packaged nucleic acid. If the viral vector particle protects the vector nucleic acid from a nuclease which ordinarily degrades the nucleic acid, it packages the nucleic acid.
  • a particle protects a nucleic acid from degradation when the rate of cleavage of the packaged nucleic acid upon exposure to a nuclease is slowed by at least about 5%, and preferably at least about 10%, typically at least about 20%, more typically at least about 30%, usually at least about 40%, ordinarily at least about 50%, and generally at least about 60%. In preferred embodiments, cleavage by the nuclease is slowed by 90% or more.
  • a "viral vector” is a nucleic acid vector which has components derived from a virus which aid in packaging the nucleic acid and/or transferring the nucleic acid into a cell.
  • an AAV viral vector has AAV components such as AAV capsid proteins
  • an HIV viral vector has HIV components such as
  • Viral vectors are optionally heterologous, i.e., they optionally comprise components from more than one virus.
  • a vector optionally comprises homologous components from more than one virus (e.g., env proteins from MuLV and VSV on the surface of a viral particle), or complementary proteins from more than one virus (e.g., VSV env proteins on the surface of a retroviral particle with MuLV capsid antigen proteins packaging a nucleic acid inside of the retroviral outer lipid envelope).
  • a "viral surface protein” is a protein expressed on the outer surface of the protein, such as a capsid protein or an envelope protein.
  • a "viral surface protein-targeting ligand fusion protein” is a fusion protein which has a surface protein domain, which optionally encodes part or all of the surface protein, linked to a ligand protein domain.
  • the fusion protein is produced by recombinantly joining a nucleic acid which encodes a targeting ligand peptide to a nucleic acid which encodes at least a portion of the surface protein, and expressing the resulting recombinant molecule.
  • a wild-type viral cell binding site is an epitope on the surface of a viral vector which is derived from an epitope on the surface of a wild type virus which mediates entry of the virus into a cell within the host range of the virus.
  • a "wild-type cell viral binding site” is the site on the cell bound by the epitope on the wild-type virus (i.e., the cellular receptor for the virus).
  • a functional AAV receptor is a cell surface protein which is bound by a wild-type AAV, wherein binding of the cell surface protein facilitates entry of the AAV into the cell, e.g., by receptor mediated endocytosis.
  • cell transformation vectors are becoming increasingly useful as gene therapy vectors. Some of the most widely used cell transformation vectors include those derived from wild-type viruses. Typically, the vectors have viral nucleic acid subsequences which permit packaging of the nucleic acid into a viral particle corresponding to the virus from which the sequence is derived. For instance, retroviruses have a packaging site which is typically located adjacent to the 5' LTR, e.g., next to the gene for gag. See, Aldovani et al. (1990) Journal of
  • Virology 64(5): 1920-1926 The packaging sites for parvoviruses such as B 19 and AAV are located in the viral ITRs. See, Samulski, supra. Adenovirus packaging sites are located in the adenoviral ITRs.
  • vectors also include sequences for chromosomal integration of vector nucleic acids into a host chromosome.
  • sequences include parvovirus
  • Transcription cassettes competent to express genes of interest in a cell are often placed between these chromosome integration elements for integration into the host chromosome.
  • Targeting vectors to particular cell types is of interest for both in vitro and in vivo transformation of cells. For instance, in replacement gene therapy where defective or absent genes are replaced using cell transformation vectors, only a subset of all an organism's cells ideally express a replacement gene. Similarly, only selected cell types are targets for intracellular immunization procedures which immunize cells against virus infection by expressing anti-viral agents in the cells. When using gene therapeutic procedures against cancers, it is desirable to limit expression of anti-cancer agents to cancer cells.
  • the present invention provides a general approach to making targeted gene therapy vectors.
  • the first step in making targeted vectors of the invention is to destroy the natural specificity of a given vector. This is done to prevent the vector from infecting cells within the host range of the virus from which the vector is derived.
  • the natural specificity of a vector is destroyed by recombinantly deleting or mutating the site on the vector which is ordinarily recognized by a cellular receptor during entry of the vector (the viral cell binding site).
  • the envelope glycoproteins are mutated to prevent recognition by a cellular receptor.
  • the cellular receptor is CD4 (i.e., when the vector has a particle based upon a primate lentivirus)
  • the envelope glycoproteins are mutated such that CD4+ cells no longer permit entry of the vector.
  • the capsid proteins are recombinantly altered so that cells infectable by the corresponding virus no longer permit entry of the modified vector.
  • the viral cell binding site can be modified chemically or by binding an antibody (or other moiety) to the site to' prevent interaction of the site with a cell.
  • the second step in making a targeted vector is to incorporate a targeting molecule into the vector.
  • the targeting molecule is typically a peptide epitope recognized by a cell, or is a peptide moiety recognized by a coupling complex.
  • the epitope can be the binding site for a cellular receptor (e.g., IL-2, IL-4, FC ⁇ I, Fc ⁇ ll and Fc ⁇ lH receptors, CD4, CD8, CD34, HIV co- receptors such as a member of the 7 transmembrane receptor family, such as fusin, CKR5, CKR-3 or CKR-2b or other chemokine receptors) on the surface of a cell.
  • a cellular receptor e.g., IL-2, IL-4, FC ⁇ I, Fc ⁇ ll and Fc ⁇ lH receptors, CD4, CD8, CD34, HIV co- receptors such as a member of the 7 transmembrane receptor family, such as fusin, CKR5, CKR
  • T-cell-tropic HIV-1 isolates Recently, a seven-transmembrane domain protein was shown to serve as an accessory factor for T-cell-tropic (T-tropic) HIV-1 isolates. See, Feng et al. ,
  • Fusin is an appropriate target which a targeted vector of the invention can be directed against.
  • a second member of the seven-transmembrane domain protein family the beta-chemokine receptor CKR-5 (alternately known as "CC-CKR5" or as "CCR- 5"), mediates infection of macrophage by M-tropic HIV viruses.
  • Co-expression of CKR-5 with CD4 enables nonpermissive cells to form syncytia with cells infected by M-tropic, but not T-tropic, HIV-1 env proteins.
  • Expression of CKR-5 and CD4 permits entry of M-tropic, but not T-tropic, virus strain. See, Doranz et al. (1996) Cell 85 (7): 1149-58; Feng et al. (1996) Science 272 (5263): 872-7; Alkhatib et al.
  • T cells also express CKR-5 (e.g., in addition to fusin), and CKR-5 can also mediate infection of M-tropic HIV viruses into these T cells.
  • CKR-5 is an appropriate target which a targeted vector of the invention can be directed against. Sequence for the CKR5 receptor is found in GenBank at Accesion U57840. See also, Combadiere et al. (1996) J. Leukoc. Biol. 60 (1), 147-152 and Combadiere May 9, 1996 Direct submission to GenBank).
  • a dual-tropic primary HIV-1 isolate (89.6) utilizes both Fusin and
  • CKR-5 as entry cofactors. See, Doranz et al. , id. Cells expressing the 89.6 env protein form syncytia with QT6 cells expressing CD4 and either Fusin or CKR-5.
  • the beta-chemokine receptors CKR-3 and CKR-2b support HIV-1 89.6 env-mediated syncytia formation. These known chemokine receptors are also appropriate targets for the targeted vectors of the invention.
  • a targeting ligand optionally binds more than one cell surface protein, such as CD4 and an HIV co-receptor molecule such as fusin or CKR5.
  • the targeting molecule is streptavidin
  • the vector is targeted to a cell by binding a second biotinylated targeting molecule to the streptavidin through the biotinylation site.
  • This second targeting molecule can be an antibody which recognizes a particular cell type, or a cell receptor ligand for a receptor found on a target cell type.
  • the vectors of the invention comprise recombinant nucleic acids which optionally encode targeting molecules, expression cassettes, viral packaging sites, chromosomal integration elements (e.g., AAV ITRs or retroviral LTRs) and the like.
  • chromosomal integration elements e.g., AAV ITRs or retroviral LTRs
  • one of skill can construct a variety of vectors containing functionally equivalent nucleic acids. Cloning methodologies to accomplish these ends, and sequencing methods to verify the sequence of nucleic acids are well known in the art. Examples of appropriate cloning and sequencing techniques, and instructions sufficient to direct persons of skill through many cloning exercises are found in Berger and Kimmel,
  • a nucleic acid encoding targeting peptide such as a cell receptor ligand, or a streptavidin peptide is used in an insertional mutagenesis procedure.
  • the nucleic acid is inserted into the coding region for a capsid or surface envelope protein at locations which potentially encode the natural viral cell binding site on the surface of the corresponding wild-type vector.
  • the insertion is performed such that the reading frame of the coding region is not altered.
  • Resulting vectors are then screened for their ability to enter a target cell through the targeting peptide, and for their inability to enter a cell through the receptor which recognizes a corresponding virus.
  • An example of insertional mutagenesis on herpes virus is found in Chiang et al. (1994) 68(4): 2529-2543.
  • nucleic acid compositions of this invention are isolated from biological sources or synthesized in vitro.
  • the nucleic acids of the invention are present in transformed or transfected whole cells, in transformed or transfected cell lysates, or in a partially purified or substantially pure form.
  • RNA polymerase mediated techniques e.g., NASBA
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • NASBA RNA polymerase mediated techniques
  • Oligonucleotides for use as probes e.g., in in vitro amplification methods, for use as gene probes, or as inhibitor components (e.g., ribozymes) are typically synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981), Tetrahedron Letts., 22(20): 1859-1862, e.g., using an automated synthesizer, as described in Needham-VanDevanter et al. (1984) Nucleic Acids Res., 12:6159-6168.
  • Oligonucleotides can also be custom made and ordered from a variety of commercial sources known to persons of skill. Purification of oligonucleotides, where necessary, is typically performed by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson and Regnier (1983) J. Chrom. 255: 137-149. The sequence of the synthetic oligonucleotides can be verified using the chemical degradation method of Maxam and Gilbert (1980) in Grossman and Moldave (eds.) Academic Press, New York, Methods in Enzymology 65:499-560. Making Conservative Substitutions
  • nucleic acid sequence by reference to a given polypeptide sequence by reference to the genetic code, using synthetic or recombinant techniques as described, supra.
  • one of skill can easily make nucleic acids encoding the polypeptides GAVQPRGATSKLYLLRMTDK, MGEKLHRVHIRTNTPSVYSR, LEPRVAQRGQMVKFTYMRLP, and HAWWKPWGWSIEALAPTAGP, as well as conservative modifications of these proteins. Conservative modifications of the vectors of the invention are also appropriate.
  • nucleic acid and polypeptide constructs of the invention disclosed yield functionally identical constructs.
  • silent substitutions i.e., substitutions of a nucleic acid sequence which do not result in an alteration in an encoded polypeptide
  • conserve amino acid substitutions in one or a few amino acids in an amino acid sequence of a packaging or packageable construct are substituted with different amino acids with highly similar properties and are also readily identified as being highly similar to a disclosed construct.
  • conservatively substituted variations of each explicitly disclosed sequence are a feature of the present invention.
  • nucleic acid variations are "silent variations,” which are one species of “conservatively modified variations.” Every nucleic acid sequence which encodes a polypeptide also describes every possible silent variation.
  • each codon in a nucleic acid can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each "silent variation" of a nucleic acid which encodes a polypeptide is implicit in any described sequence. Furthermore, one of skill will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1 %) in an encoded sequence are "conservatively modified variations" where the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substimtion tables providing functionally similar amino acids are well known in the art.
  • the following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R),
  • a nucleic acid which encodes a polypeptide is optimized for translation efficiency by selecting codons which are prevalent in the cell type which the virus is to be expressed in.
  • Species codon bias tables are well known, and in common use.
  • a complementary nucleic acid refers to a nucleic acid complementary to the sense strand.
  • a sense strand encoding a given polypeptide hybridizes under stringent conditions to the complementary strand.
  • Stringent hybridization or wash conditions in the context of nucleic acid hybridization experiments such as Southern and northern hybridizations are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes part I chapter 2
  • An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formalin with 1 mg of heparin at 42 °C, with the hybridization being carried out overnight.
  • An example of stringent wash conditions is a .2x SSC wash at 65 °C for 15 minutes (see, Sambrook, supra for a description of SSC buffer). Often the high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example low stringency wash is 2x SSC at 40°C for 15 minutes. In general, a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization.
  • a coding nucleic acid refers to the sense strand of a nucleic acid. Nucleic acids which do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, e.g. , when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • mutagenic agents and radiation are collectively referred to herein as "mutagens"
  • chemical synthesis of a desired oligonucleotide e.g., in conjunction with ligation and/or cloning to generate large nucleic acids
  • nucleic acid of the invention can select a desired nucleic acid of the invention based upon the sequences provided and upon knowledge in the art regarding viruses generally.
  • the life-cycle, genomic organization, developmental regulation and associated molecular biology of viruses have been the focus of over a century of intense research.
  • the specific effects of many mutations in viral genomes are known.
  • general knowledge regarding the nature of proteins and nucleic acids allows one of skill to select appropriate sequences with activity similar or equivalent to the nucleic acids and polypeptides disclosed in the sequence listings herein. Conservative amino acid substitutions are described herein.
  • nucleic acids are evaluated by routine screening techniques in suitable assays for the desired characteristic. For instance, changes in the immunological character of encoded polypeptides can be detected by an appropriate immunological assay. Modifications of other properties such as nucleic acid hybridization to a complementary nucleic acid, redox or thermal stability of encoded proteins, hydrophobicity, susceptibility to proteolysis, or the tendency to aggregate are all assayed according to standard techniques.
  • Making Parvovirus Vectors A general introduction to human parvoviruses is found, e.g., in
  • AAVs utilize helper viruses such as adenovirus or herpes virus to achieve productive infection.
  • helper virus functions AAV integrates (site-specifically) into a host cell's genome, but the integrated AAV genome has no pathogenic effect.
  • the integration step allows the AAV genome to remain genetically intact until the host is exposed to the appropriate environmental conditions (e.g., a lytic helper virus), whereupon it re-enters the lytic life-cycle.
  • Samulski (1993) Current Opinion in Genetic and Development 3:74-80 and the references cited therein provides an overview of the AAV life cycle.
  • AAVs adenovirus or herpes helper functions
  • the genome of AAV is described in Laughlin et al. (1983) Gene, 23:65-73.
  • Expression of AAV is described in Beaton et al. (1989) J. Virol. , 63:4450-4454.
  • AAV-based vectors are used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and in in vivo and ex vivo gene therapy procedures. See, West et al. (1987) Virology 160:38-47; Carter et al. (1989) U.S. Patent No. 4,797,368; Carter et al. WO 93/24641 (1993); Kotin (1994) Human Gene Therapy 5:793-801; Muzyczka (1994) J. Clin. Invst.
  • Cell lines that can be transformed by rAAV include those described in Lebkowski et al. (1988) Mol. Cell. Biol., 8:3988-3996.
  • rAAV vectors deliver foreign nucleic acids to a wide range of mammalian cells (Hermonat & Muzycka (1984) Proc Natl
  • rAAV vectors are used to inhibit, e.g., viral infection, by including anti-viral transcription cassettes in the rAAV vector.
  • Chatterjee et al. (Science (1992), 258: 1485-1488, hereinafter Chatterjee et al. i) describe anti-sense inhibition of HIV-1 infectivity in target cells using an rAAV vector with a constitutive expression cassette expressing anti-TAR RNA.
  • Chatterjee et al (PCT application PCT/US91/03440 (1991), hereinafter Chatterjee et al. 2) describe rAAV vectors, including rAAV vectors which express antisense TAR sequences. Chatterjee and Wong (Methods, A companion to Methods in Enzymology (1993), 5:
  • rAAV vectors for the delivery of antisense RNA.
  • rAAV vectors have several properties which make them preferred gene delivery systems in clinical settings. They have no known mode of pathogenesis and 80% of people in the United States are currently seropositive for AAV (Blacklow et al. (1971) J Natl Cancer Inst 40:319-327; Blacklow et al. (1971)
  • rAAV vectors have little or no endogenous promoter activity, specific promoters may be used, depending on target cell type. rAAV vectors can be purified and concentrated so that multiplicities of infection exceeding 1.0 can be used in transduction experiments. This allows virtually 100% of the target cells in a culture to be transduced, eliminating the need for selection of transduced cells.
  • the basic strategy for creating a targetable rAAV is to destroy the normal binding region on the AAV capsid and to add a targeting ligand to the capsid.
  • the natural specificity of the AAV capsid was destroyed by mutations in either Vpl or Vp3, while still retaining the ability of the viral capsid to protect the encapsidated nucleic acid from DNAse 1 digestion.
  • Combinatorial methods for rapidly screening AAV mutants are also provided below.
  • a nucleic acid encoding a streptavidin peptide is cloned into a capsid protein gene, resulting in a capsid protein which binds biotin.
  • Vectors comprising the recombinant capsid protein are targeted to particular cells by binding a biotinylated targeting agent to the vector which agent is recognized by a particular type of cell. For instance, a biotinylated antibody which binds a particular cell type is used to target the vector to the cell type.
  • the streptavidin nucleic acid is cloned into the site of the mutation (e.g., deletion) which makes the capsid unable to bind the AAV cellular receptor.
  • a targeting ligand which binds to a cell receptor such as a single chain antibody protein against CD34, the C4 peptide which binds to CD4, or other targeting ligands are cloned into the AAV vector.
  • a targeting ligand is identified by combinatorial screening methods from phage libraries of peptides.
  • the targeting ligand is typically about 20 amino acids in length, although longer or shorter peptides are also useful.
  • Retrovirus-based vectors are useful due to their ability to transduce cells efficiently with target nucleic acids, and because of their ability to integrate a target nucleic acid into a cellular genome.
  • the majority of approved gene transfer trials in the United States rely on replication-defective retroviral vectors harboring a therapeutic polynucleotide sequence as part of the retroviral genome (see. Miller et al. (1990) Mol Cell. Biol. 10:4239 (1990); Kolberg (1992) J. NIH Res. 4:43, and Cornetta et al. Hum. Gene Ther. 2:215 (1991)).
  • Widely used vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof.
  • MiLV murine leukemia virus
  • GaLV gibbon ape leukemia virus
  • SIV Simian Immuno deficiency virus
  • HAV human immuno deficiency virus
  • the basic strategy for creating a targetable retroviral vector is to destroy the normal binding region on the retroviral envelope and to add a targeting ligand to the envelope. As described for rAAVs, this technique is performed recombinantly, or by adding a targeting agent to the viral particles. Because the retroviral particles have a lipid envelope, targeting molecules which bridge the lipid envelope are optionally added to the envelope, e.g., using liposomes comprising the targeting agent.
  • retroviral vectors of the invention have a streptavidin peptide cloned into the N-terminal region of the relevant retroviral surface protein.
  • MLV vectors with Sfi 1 and Not 1 restriction sites at codon 6 are available. See, Cosset, id.
  • the retroviral vectors are targeted to a cell by complexing the retroviral particle comprising the streptavidin site with an antibody or other protein specific for a target cell type.
  • any other targeting ligand as described herein can be cloned into a retroviral vector in the N terminal region of an env gene. As described supra, combinatorial methods for optimizing these vectors are provided.
  • herpes viruses including herpes simplex, varicella zoster, cytomegalovirus, Epstein-bar virus and human herpes viruses 6 and 7 are found in Zuckerman et al. (eds) (1994) John Wiley & Sons, New York Chapter 1 (see, Cleator and Klapper, Kangoro and Harper, Griffiths, Crawford and Fox et al).
  • Herpes virus vectors are described in Cochran et al. (1993) U.S. Pat.
  • Glycoprotein gD on the HSV envelope and the homologous glycoprotein on other herpes envelopes, mediate infectivity of the virus.
  • Chiang et al. (1994) Journal of Virology 68(4) 2529-2553 and the references therein describe the functional regions of the protein, including the receptor binding site.
  • the protein is disabled for its ability to bind the herpes virus receptor, either recombinantly, or by binding an antibody or other protein to the receptor.
  • a targeting molecule is then incorporated into the viral envelope, either recombinantly into the gD protein, or using liposomes, or by binding the targeting molecule to the surface of the vector.
  • One class of preferred herpes virus vectors of the invention have a streptavidin peptide cloned into residues from the region from 270-310 of the gD surface protein.
  • the herpes virus vectors are targeted to a cell by complexing the herpesvirus particle comprising the streptavidin site with an antibody specific for a target cell type.
  • Other preferred herpes vectors utilize any other peptide targeting ligand described herein cloned into the region from 270-310 of the gD protein.
  • Adenovirus Vectors An introduction to adenoviruses is found in Zuckerman et al (eds)
  • Adenovirus vectors for gene delivery are described, e.g., in Denefle et al. WO 95/238967; Vigne et al. (1995) Restorative Neurology and Neuroscience 8: 35-36; Kremer and Perricaudet (1995) British Medical Bulletin 51(1): 31-44; Haddada et al. (1995) in The Molecular Repitoire of Adenoviruses III,
  • Adenovirus capsids are essentially composed of three proteins: hexons, pentons, and penton fibers. Each virion capsid contains 240 hexon proteins that comprise the bulk of the virion icosahedral shell. At each vertex of the capsid is a penton base protein which is non-covalently attached to the amino terminus of the penton fiber protein. At the carboxy terminus of the penton fiber there is a knob-like strucmre which mediates receptor binding of the virus.
  • deletions or other mutations are made in the binding domain of the carboxy terminus of the fiber protein which is located in region L5 of the adenoviral genome (85-95 nut).
  • Targeting ligands are then cloned into the capsid protein genes, preferably into the mutated region of the pention fiber.
  • the coding sequence for streptavidin is cloned into the region corresponding to the fiber binding domain.
  • Streptavidin is capable of high affinity binding to biotin (Kd ⁇ 10-' 3 ) and procedures are readily available for biotinylating proteins of interest.
  • biotinylated antibodies (or other ligands) of choice are used to form non-covalent linkage with adenovirus containing fiber/streptavidin fusion proteins.
  • This modified vector allows for cloning genes of interest into typical adenovirus cloning regions and, upon linkage of biotinylated targeting protein, is able to specifically bind to target cells with high affinity, without significant non-target cell interactions.
  • other preferred Ad vectors utilize any other peptide targeting ligand described herein cloned into the L5 region.
  • the vectors of the invention are targeted by binding antibodies specific for a target cell to the vector, or single chain antibodies are recombinantly expressed on the surface of a vector of the invention.
  • Methods of producing polyclonal and monoclonal antibodies are known to those of skill in the art, and many anti-cellular antibodies, including antibodies which recognize tumors, virally infected cells, hematopoietic cells and other targets for gene therapy are commercially available.
  • Specific monoclonal and polyclonal antibodies and antisera will usually bind with a K D of at least about .1 mM, more usually at least about 1 ⁇ M, preferably at least about .1 ⁇ M or better, and most typically and preferably, .01 ⁇ M or better.
  • the vectors of the invention optionally comprise or encode a target molecule such as a protein or ribozyme.
  • a target molecule such as a protein or ribozyme.
  • a particular protein expressed by the recombinant expression cassettes of the invention can be quantified by a variety of immunoassay methods, i.e., when expression of a protein is used to monitor whether the vector transduces a target cell.
  • immunoassay methods i.e., when expression of a protein is used to monitor whether the vector transduces a target cell.
  • the immunoassays of the present invention can be performed in any of several configurations, e.g., those reviewed in Maggio (ed.) (1980) Enzyme Immunoassay CRC Press, Boca Raton, Florida; Tijan (1985) "Practice and Theory of Enzyme Immunoassays," Laboratory Techniques in Biochemistry and Molecular Biology , Elsevier Science Publishers B.V.
  • antibodies or other proteins such as cell receptor ligands are optionally used as targeting agents.
  • These proteins are either recombinantly fused to a viral surface protein, such as an adenoviral or adeno associated viral capsid protein as described supra, or are added to the vector.
  • these proteins are chemically bound to a biological agent such as biotin which binds a cognate on the surface of the vector particle, e.g., a streptavidin moiety.
  • biotin which binds a cognate on the surface of the vector particle, e.g., a streptavidin moiety.
  • Antibodies are proteins which contain a variety of functional groups; e.g., carboxylic acid (COOH) or free amine (-NH 2 ) groups, which are available for reaction with a suitable functional group on an agent molecule to bind the agent thereto.
  • the protein and/or agent may be derivatized to expose or attach additional reactive functional groups.
  • the derivatization may involve attachment of any of a number of linker molecules such as those available from Pierce Chemical Company, Rockford, Illinois.
  • a bifunctional linker having one functional group reactive with a group on a particular agent, and another group reactive with an protein, may be used to form the desired protein conjugate.
  • derivatization may involve chemical treatment of the protein; e.g., glycol cleavage of the sugar moiety of the glycoprotein protein with periodate to generate free aldehyde groups.
  • the free aldehyde groups on the protein may be reacted with free amine or hydrazine groups on an agent to bind the agent thereto.
  • Procedures for generation of free sulfhydryl groups on antibodies or protein fragments are also known (See U.S. Pat. No. 4,659,839).
  • Many procedure and linker molecules for attachment of various compounds including radionuclide metal chelates, toxins and drugs to proteins such as antibodies are known. See, for example, European Patent Application No.
  • biotin is coupled to the targeting protein to facilitate binding of the targeting protein to the viral particle.
  • Biotin strucmre and biological activity are described, e.g., in Stryer (1988) Biochemistry, third edition
  • biotinylating proteins are widely known and used, and biotinylating reagents and kits are widely available, e.g., from Sigma, Aldrich, and Pierce. Harlow and Lane describe methods of biotinylating proteins such as antibodies in Antibodies: A Laboratory Manual (1988) By Cold Spring Harbor Laboratory Press.
  • a biotinylating reagent such as NHS-LC-biotin (Pierce) overnight at 4°C, and then purified on an appropriate column (e.g., a presto desalting column from Pierce). See also, Hawkin et al (1992) J. Mol. Biol. 226, 889-896.
  • poly-1-lysine is coupled to the protein (e.g., where the protein is transferrin which binds the transferrin receptor), or is itself used as a targeting agent.
  • Poly-1-lysine or poly-1 -lysine -transferrin which has been linked to defective adenovirus mutants is delivered to cells wim transfection efficiencies approaching 90% (Curiel et al (1991) Proc Natl Acad Sci USA 88:8850-8854; Cotten et al (1992) Proc Natl Acad Sci USA 89:6094-6098; Curiel et al (1992) Hum Gene Ther 3: 147-154; Wagner et al. (1992) Proc Natl Acad Sci USA
  • Adenovirus-poly-1-lysine-DNA conjugates bind the normal adenovirus receptor and are subsequently internalized by receptor-mediated endocytosis. Herpes viruses have similar properties. Transferrin-poly-1-lysine conjugates enter cells which comprise transferrin receptors. See, e.g., Curiel (1991) Proc. Natl. Acad Sci USA 88: 8850-8854 and Wagner et al.
  • the vectors of the invention are typically targeted against mammalian cells. However, because the vectors can be targeted against essentially any cell by the selection of the targeting agent, the choice of nucleic acids to place within any expression cassette encoded by the vector depends upon the intended target cell. Examples of cells which can be transformed with the vectors of the invention include bacteria, yeast, plant, filamentous fungi, insect and vertabrate cells such as mammalian cells. It is expected that those of skill in the art are knowledgeable in the numerous expression systems available for cloning and expression of nucleic acids. Sambrook, Ausbel, and Berger provide a guide to expression cassettes.
  • Single-Chain Antibody Targeting Cloned single chain antibody molecules can be generated by PCR from the variable region of known antibodies where a hybridoma is available, using standard techniques. This technology is adapted to target a viral vector against essentially any protein of interest. For example, fusions between a viral surface protein, such as a retroviral glycoprotein, an adenoviral coat protein or the AAV cap protein, and a single chain antibody are provided. A fusion protein strategy is favorable since it simplifies large-scale vector production once a vector design is established.
  • ScAb single-chain variable region antibodies
  • CD34 marker was fused to the N-terminus of AAV Vp2 and used to generate AAV particles in packaging experiments. Furthermore, these particles had elevated levels of transduction on cell lines expressing CD34 (KG-1) compared to control vector. FACS binding experiments were performed to demonstrate that the ScAb- vector was able to specifically bind to the CD34 marker.
  • Anti-sera against the ScAb are used to directly detect the presence of the ScAb on intact particles.
  • the construct described above was made using a wild type (WT) rAAV in the construction of vector comprising the ScAb, so that the resulting targetable vector was dual-tropic as it was able to bind to both the AAV receptor and to the CD34 marker.
  • WT wild type
  • a more preferred targetable vector is defective in normal AAV binding to avoid significant dilution by such a dual-tropic vector upon injection into a human.
  • the ScAB is cloned into the cap protein of an AAV binding mutant such as one exemplified herein, which has at least a 100-fold decrease in binding affinity compared to the WT.
  • a nucleic acid encoding the ScAb was fused to the Vp2 region of AAV. See, the Examples, supra.
  • Other constructs include the ScAb nucleic acid fused to the N-terminus of Vpl or Vp3, C-terminal addition of
  • a hinge region (derived from a native immunoglobulin) is preferably provided at the site of attachment of the ScAb. This hinge region increases the flexibility of fusion proteins comprising single chain antibodies and facilitates maintenance of native conformations for the domains of the fusion protein. All constructs are optionally evaluated both for their ability to express the ScAb-capsid fusion protein, generate vector particles, and for the presence of the ScAb domain on the surface of the vector particle. Recombinant vector constructs are assessed for their ability to bind to specific target cells and for transducing activity.
  • One new target cell line provided herein is a Cos cell line expressing CD34. It was found that the common CD34+ cell line, KG-1, appeared to have a defect in its ability to be transduced by AAV relative to non-target cells such as
  • Cos cells are readily transducible by AAV and exhibit low native cross reactivity to CD34 antibodies.
  • Targetable vectors One design consideration for making targetable vectors is determining the optimal placement of the targeting ligand within a surface protein on a vector of the invention.
  • the size of a targeting ligand such as an ScAb is also relevant as the size of the targeting ligand has an impact on the overall conformation of vector proteins which are required for correct vector assembly.
  • a strategy which allows for unbiased construction of vectors capable of targeting and efficiently transducing any cell type of interest is provided herein.
  • Both library technology and in vitro evolution of candidate vectors are utilized so that vectors are randomly selected for that have optimal transduction capacity with respect to both receptor binding and gene delivery.
  • This system is specifically designed within the constraints of limited available information regarding vector structure and internalization processes. Furthermore, this system is amenable to virtually any vector and any target cell, even if a candidate receptor for that cell has not been identified.
  • the library strategy has two basic components: 1) identification of small targeting peptides by phage display libraries, and 2) randomized insertion of those identified peptides in vector surface proteins followed by amplification and evolution viable vector particles.
  • identification of small targeting peptides by phage display libraries and 2) randomized insertion of those identified peptides in vector surface proteins followed by amplification and evolution viable vector particles.
  • the following discussion relates to this strategy for developing AAV vectors; however, the strategy is applied to essentially any vector, including retroviral vectors, adenoviral vectors, parvoviral vectors and the like.
  • the targeting strategy described herein provides for the isolation of a viral vector having a targeting ligand which binds to a cell receptor such as CD34 or CD4.
  • the vector is made by isolating a bacteriophage particle which specifically binds to a cell comprising a selected receptor such as CD34 or CD4 from a random phage display library, subcloning a subsequence derived from the identified bacteriophage particle corresponding to the targeting ligand into a vector nucleic acid, and expressing the vector nucleic acid in a cell, thereby making a targeting protein comprising the targeting ligand.
  • the targeting ligand is packaged into the vector, e.g., in a packaging cell which comprises " additional vector components.
  • the additional components are optionally supplied in trans, i.e., by tr ⁇ /w-complementation as described, supra.
  • one or more additional viral component is encoded in the vector nucleic acid, in addition to the targeting ligand.
  • the targeting ligand is cloned into a viral surface protein, such as an AAV or Ad capsid protein, or a retroviral envelope protein, or the like, as described herein.
  • a vector targeting system contains a cell surface target-binding component (ligand) which can be associated with the vector surface protein (e.g. , AAV cap protein) and which redirects the vector to a new cell surface target (receptor) of choice.
  • the ligand is inserted into the capsid in the form of a fusion protein; however, some currently available candidate ligands for desired receptors are large in size (e.g. , ScAb) and thus may not be optimal due to the influence of the ligand on the overall strucmre of the virion capsid assembly. Consequently, for generation of fusion proteins, it is advantageous to use small peptides ( — 20 amino acids) so that incorporation into the capsid protein results in minimal changes to the overall conformation of the virion.
  • Phage display libraries are used for selection of ligands with unique and high binding affinities for specific cell types. These libraries are used both for the selection of ligands capable of binding to specific receptors of choice (e.g. , CD34, CD4, etc.) and ligands capable of binding to specific cell types of interest (e.g. , hematopoietic stem cells, T-lymphocytes, etc.) where a target receptor has not been identified.
  • specific receptors of choice e.g. , CD34, CD4, etc.
  • ligands capable of binding to specific cell types of interest e.g. , hematopoietic stem cells, T-lymphocytes, etc.
  • true progenitor cells may be identified as CD34+ CD38- as opposed to CD34+ CD38 + , with the only known difference in the receptor profile of these cells being the lack of the CD38 marker in the target true progenitor cell, making targeting to these cell more difficult using previous techniques.
  • Phage display libraries containing randomized peptides are selected against a target cell type, such as primary CD4+ T-cells, CD34+ stem cells or CD34+ CD38- stem cells. Briefly, the cell type used for selection is incubated with phage library at a concentration of le5 cells/3e9 phage particles in 2 ml of PBS/Ca ++ / BSA (standard incubation buffer), at 37 °C. ' After washing, the cells are lysed and the liberated phage particles are amplified in bacteria under standard conditions. The above process is repeated about 3 times, followed by sequencing of the selected clones (See Figs. 1 and 2).
  • a single peptide species is typically isolated by this technique which is specific for the target cell in question, rather than broadly reactive for many cell types. Presumably this is because the starting libraries are substantially under-representative of all possible combinations for randomized 20-mers, thus many species are not contained within any given library.
  • factors which influence high affinity binding and selection for a given peptide are apparently cell type specific. This may be due to receptor abundance or other factors which influence the overall conformation of surface proteins of a given cell type. For example, there are subtle differences in the same protein on different cell types which can be rendered targetable by the phage system. Alternatively, the phage system produces peptides which recognize combinations of surface proteins that have unique quaternerary structure on a given cell type.
  • a peptide is identified it is tested for specific binding by adding a fixed concentration of peptide-phage species in the presence of increasing concentration of purified homologous free-peptide.
  • the cell associated phage is then recovered and titered by standard assays and the resulting affinity value is calculated by Scatchard analysis. Similar experiments are performed on typically at least 5 different unrelated cell types to demonstrate the specificity of the isolated peptide.
  • the library is selected against CD34+ CD38- cells at low stringency, and the resulting bound material is selected against CD34+CD38+ cells at high stringency.
  • the eluate from the latter pass (unbound material) is substantially free of phage which bind to CD34+ CD38+ cells and can thus be selected against CD34+ CD38- cells at high stringency.
  • Peptides which are specific for the desired cell type, relative to the unrelated cell types and which have K thread values greater than or equal to le-6 M, are mutagenized in a new library with homology to the isolated peptide sequence(s).
  • This new library is subjected to an analysis identical to the above with the goal of isolating related peptides with Kj values of greater than or equal to le-9 M.
  • the advantages of this procedure is that binding peptides are made against cells without concern or knowledge of the receptor profile of the given cells.
  • One disadvantage is that even though the peptides are screened for lack of binding against, e.g., five other cell types, it is not certain what the specificity of this peptide is, since its binding target is unknown and there is usually no foundation in the literature to help establish the tissue distribution of the unidentified receptor. Some of these concerns are minimized by testing in animals (e.g. , SCID mice) and empirically determining the tissue distribution of an injected vector comprising the targeting peptide. In addition, if a particular peptide is identified which has an especially low K, (i.e. , le-11 M) it is desirable to perform cross-linking experiments to identify the binding protein in parallel, or prior, to initiating animal smdies.
  • peptides contained in phage display libraries are will be selected against purified binding proteins of interest (i.e., a CD34 protein).
  • purified binding proteins of interest i.e., a CD34 protein
  • methods of screening peptides bound to a solid matrix is known.
  • the peptide phage that are isolated by this analysis are then be screened against cells of interest that contain the protein in question (i.e., CD34 expressing cell lines).
  • This pre-selection step with a purified protein limits the library to the binding protein of interest, and the subsequent selection steps on intact cells isolates phage which bind to regions of the protein that are exposed on the cell surface.
  • the isolated peptide are mutagenized with the goal of obtaining a peptide with a Kd of at least le-9 M.
  • cell lines which express the protein of interest may be used for subtractive purification of binding phage, provided that an identical parent cell is available which does not express the given protein.
  • Such cell lines are prepared by transfection or by infection with common expression vectors such as vaccinia. The phage are bound to the null cell line to remove phage that bind to proteins common to the two cell lines, and then bound and eluted from the target cell line. All peptides obtained by this and the above procedures, and with the appropriate K Crow, are used to construct targetable vector libraries as outlined below.
  • Identifying ligand(s) bound to cell surface CD4 molecules is one of the important tasks in developing a targetable vector that can specifically deliver therapeutic genes into human CD4 + T-lymphocytes.
  • Phage display technology was used as described to explore human CD4 binding peptides from a random peptide library as candidate binding ligands to human CD4.
  • these peptides are useful as epitopes expressed on the surface of a vector to permit the vector to transduce a CD4 cell, in vitro, ex vivo or in vivo.
  • This has general utility in recombinant techniques for transduction of CD4 cells, and in therapeutic techniques where the transduction of CD4 cells by a therapeutic vector is desired, such as in the case of HIV infection.
  • Targetable vector libraries are constructed in AAV vector binding mutants as identified supra. The goal is to generate a vector library with a ligand of interest inserted at random locations within the cap coding sequence. This library is amplified in host cells so that rare vectors, which have the optimal insertion point in the cap coding region for the ligand and forms a functional vector particle, will be enriched.
  • Phase 1 Subcloning of binding mutant cap region into a small plasmid backbone
  • Phase 2 Random linker insertion into cap region to construct a cap linker library
  • Phase 3 Subcloning of the binding ligand coding sequence into a linker library to construct a cap ligand library
  • Phase 4 Subcloning the cap ligand library into a WT AAV background to construct the targetable vector library
  • Phase 5 Packaging of the targetable vector library
  • Phase 6 Infection of target cells with targetable vector library followed by amplification, enrichment, and in vitro evolution of targetable vector
  • Phase 7 sequencing of the enriched vector population.
  • This phase isolates the cap coding sequence within a relatively small DNA plasmid so that subsequent random linker insertion steps, described below, are concentrated on the cap sequence, rather than on irrelevant flanking sequences.
  • a cap sequence which is binding deficient as described, supra is cloned into a plasmid using standard techniques. See, Sambrook, Ausubel, and Berger supra.
  • this step is performed on surface proteins from other viruses, such as a retroviral env protein, or an adenoviral capsid protein.
  • this phase is the insertion of a linker sequence into the cap portion of the cap gene (or other surface protein) in the plasmid constructed in phase 1, to provide unique restriction sites for cloning of the desired ligand.
  • the linker will ultimately be less than 20-30 nucleotides; however, initially a removable selectable marker is included in the linker so that recombinants containing linker sequences can be easily selected for, thereby increasing the frequency of linker containing molecules in the library.
  • a hinge region of approximately 30 nucleotides is optionally included in the final linker.
  • This hinge region increases the flexibility at the site of ligand addition and reduces the impact of the ligand on the final conformation of the cap (or other surface) protein, thereby facilitating vector packaging functions of the protein.
  • a parameter in the construction of the library is the degree of randomness that is achieved, with the ideal simation being a library that contains a linker insertion at every base pair within the nucleic acid encoding the cap (or other surface) protein.
  • Three strategies are optionally analyzed for their ability to produce randomized linker libraries within the cap sequence: 1) partial restriction digest 2) chemical mutagenesis and 3) transposon-based mutagenesis.
  • a partial restriction digestion will be performed on the cap sequence using a restriction enzyme, or multiple enzymes that recognize(s) a four base pair sequence (i.e. , a frequent cutter).
  • the conditions are optimized such that digestion results in individual full-length molecules cut at a single site.
  • the linker is then added by cohesive end ligation using sites at the end of the linker that are compatible with the restriction enzyme used in the partial digestion.
  • An advantage of this procedure is its simplicity.
  • a disadvantage is that it an optimal degree of randomness may not be achieved, as it will be difficult to find restriction enzymes which cut frequently enough.
  • the DNA encoding the cap (or other surface) protein is treated with formic acid, which results in de-purination of the
  • exonuclease III DNA to create a single stranded nick at random locations.
  • the DNA is then treated with exonuclease III to cut both strands of the molecule at the site of the nick.
  • exonuclease III also cuts back from 0-30 nucleotides so that complete randomness with respect to the site of the cut is theoretically possible. Blunt-end ligation of the linker is used to produce closed circles.
  • the advantage of this procedure are that it is highly random.
  • a disadvantage is that the chemical treatment and conditions for exonuclease III digestion may need extensive optimization. This procedure and the partial digestion procedure are outlined in more detail in Sambrook, supra.
  • a final strategy is to use transposon-based mutagenesis to directly insert the linker into random locations within a DNA encoding the cap or other surface protein.
  • the cap plasmid is exposed to a transposon such as At-2 which contains the dHFR gene (see, Fig. 5).
  • This reaction is performed entirely in vitro using Tyl integrase provided from Tyl virus-like particles. Conditions are optimized to maximize the frequency of insertion, which can achieve the theoretical maximum of one insertion per base pair. See, Devine and Boeke (1994) Nucleic Acids Research 22(18): 3765-72.
  • the mutagenized DNA is transformed into e. coli and selected first for ampicillin resistance and subsequently selected for resistance to methopterin.
  • the frequency of recombinants is typically around 1 amp r Tmp' recombinants/ 10e4 amp r transformants; thus, this selection step dramatically increases the representation of recombinants in the final library.
  • Unique restriction sites are available for removing the dHFR gene so that approximately 30 nucleotides are left behind as a linker. This procedure is particularly advantageous because the insertional mutagenesis reaction is a standard reaction which is as easy to perform as a routine restriction digest (a beta-test version of a kit from Perkin-Elmer can be obtained to facilitate the reaction).
  • a disadvantage is that some effort must be made to ensure a maximal level of random insertion frequency.
  • Each of the above procedures can be analyzed for the degree of randomness in the insertion of the linker by digesting the mutagenized DNA population with a unique restriction enzyme that lies outside of the cap gene (i.e., in the vector plasmid) followed by end-labeling of the DNA with 32 P.
  • the DNA is digested with a restriction enzyme that cuts within the linker sequences.
  • the end-labeled DNA is run on a sequencing gel, and under optimal conditions and a "ladder" pattern indicates the degree of randomness.
  • the ladder should have a one base pair separation.
  • the intensity of each band will vary according to its relative abundance, such that under optimal conditions they will be of equal intensity.
  • Different restriction enzymes can be chosen to generate the site of end-labeling so that the insertion points can be analyzed by "walking" down the entire gene (this step is necessary where the resolution capacity of the sequencing gel prohibits analysis of the entire length of the plasmid in a single run).
  • theoretical maximum sizes can be calculated so that only insertions within the cap coding sequence (or other surface protein coding sequence) is assessed.
  • the degree of randomness from each analysis is calculated by determining the mean intensity of the bands and counting the number of band's that fall within 20% of this intensity The sum of this value is equal to the degree of randomness (dR).
  • dR degree of randomness
  • Each run on the sequencing gel would be expected to generate a theoretical maximum dR value of 300-400 as this is the typical resolution capacity of a standard sequencing gel.
  • the total theoretical maximum dR value for cap should be approximately 2500 as this is the length of the cap coding region.
  • the library which is generated by the above procedures which contains the highest degree of randomness is used in Phase 3.
  • Phase 3 Subcloning of binding ligand coding sequence into linker library to construct cap ligand library
  • ligand The primary consideration for this portion of the project is the choice of ligand.
  • Three example ligands include 1) anti-CD34 ScAb used in the examples, supra; 2) ligands generated from phage display libraries, and 3) the HIV C4 region of the HIV envelope protein.
  • Cloning of this ligand is performed using a PCR strategy in which the appropriate restriction sites are placed on the ends to allow for insertion into the linker library.
  • the C4 peptide is also tested on the N-terminus of Vpl and Vp2 in WT AAV, similar to the tests of ScAb described, e.g., in the examples. This allows for a quick screen of C4 utility in AAV vector targeting.
  • Phase 4 Subcloning cap ligand library into WT AAV background to construct targetable vector library
  • Sub-cloning of the cap ligand library of interest is performed into a WT AAV background.
  • the ligand library is digested with appropriate restriction enzymes to release the modified cap (or other surface protein) coding DNAs which are then "shot-gun" cloned into an otherwise WT AAV background.
  • the plasmid cap library contains one of the previously identified cap binding mutations which replaces the wild-type AAV cap protein, the intention is to restore binding and replication competence by addition of a foreign ligand to the resulting AAV vector.
  • Using a replication competent vector allows for amplification of rare recombinants that have the appropriate cap conformation.
  • chemical mutagenesis or irradiation of target cells can be included during the amplification phase so that random mutations can be introduced to optimize and improve the infectivity of virions containing viable insertions.
  • Packaging of the library is by appropriate standard vector packaging methods, depending on the particular vector employed.
  • Phase 6 Infection, amplification, and evolution of targetable vector library
  • target cells of interest are infected with the vector library in the presence of a helper virus such as adenovirus under standard conditions. After maximum cytopathic effect, the cells are harvested and the resulting lysate is used in a subsequent round of infection. This procedure is repeated 3-6 times.
  • a similar experiment is performed, with the exception that during the replication phase of the virus, the cells are mutagenized by irradiation under standard conditions or by treatment with chemical mutagens. The purpose of this mutagenesis phase is to increase the rate of evolution of the virus and subsequent enrichment of forms optimized for infectivity and replication via the target receptor.
  • the chosen cell type for amplification can be any cell or cell line which expresses that protein. If a suitable cell which stably expresses the protein cannot easily be made then a vaccinia virus vector is used both for target protein expression and helper function for AAV. In the case of a targeted cell, the cell that was used in the phage display library selection are used in this experiment as well.
  • Target cells are typically permissive for replication of AAV helper virus (i.e. , adeno, herpes, vaccinia), or recombinantly express the necessary AAV helper components .
  • Phase 7 Sequencing of selected vector Following Phase 6, the material from the final lysate is PCR amplified using primers for the distal 5' and 3' ends of cap. The amplified material is sub-cloned into a standard TA cloning vector and, following transformation, approximately 50-100 colonies are selected for subsequent analysis. Initially, plasmid DNA is prepared and digested to verify that the ligand has been retained within the cap coding sequence (preliminary information can be obtained at this point as to the degree of heterogeneity of the processed library). All positive clones are sequenced using a primer specific within the linker sequence with the goal of identifying flanking sequences which specify the insertion point of the ligand.
  • New primers are selected for any sequencing reactions that do not work, as it is assumed that significant mutation has taken place at the ligand locus, thereby preventing binding of the primer.
  • groupings containing 100% similarity are made based on the number of unique sequences. These groupings are only an estimate of similarity /homology since other important mutations outside the region sequenced can be introduced during the amplification phase. This entire process is improved by incorporation of high-throughput sequencing technology.
  • One clone within each group is packaged and tested for replication competence on the target cell line of interest, e.g., by slot blot analysis for replicating genomic DNA.
  • the most replication competent clone is sequenced in its entirety and used to construct an AAV targetable vector packaging plasmid (or other vector, as appropriate) and subsequently used to produce recombinant targetable AAV (rtAAV).
  • rtAAV targetable AAV
  • sequencing of the ITRs show differences relative to the WT, these new ITRs are tested in the genomic portion of the vector.
  • transduction analysis is performed both on cells which contain the targeting receptor of choice and on cells which contain only the WT AAV receptor. Mixing experiments are performed to verify that the vector is capable of selectively transducing a small population of target cells in the presence of a high background of non-target cells.
  • Binding mutations A number of cap mutants are shown supra. Binding mutations that have been identified to form particles and disrupt binding as measured by the b-gal binding assay are summarized in Fig. 6.
  • All of the mutations in Fig. 6 represent point mutations or small deletions. This was done intentionally to minimize the potential for pleiotropic effects. However, maximal mutations are also desirable as they potentially allow for larger ligands to be inserted, if the overall size of the given cap (or other surface) protein is limiting.
  • the deletions are optionally maximized and the effect of increasing the length of the mutation determined on the phenotype of the vector as measured by previously established assays. Once these additional mutants are identified they are used as a source for DNA encoding the cap (or other surface protein) into which a ligand is cloned.
  • New mutants are generated by random linker insertion into a DNA encoding a WT cap (or other WT surface protein) similar to strategies outlined for the targetable AAV vector. If the C4 peptide is verified to allow for targeting in the
  • WT AAV vector see, Targetable Vector Library, Phase 3
  • the C4 peptide would be cloned into the N-terminus of Vpl and Vp2 prior to linker insertion mutagenesis.
  • the resulting binding mutant library is packaged and bound to HeLa cells in the absence of adenovirus to remove any WT receptor binding AAV.
  • Unbound material is then used to infect HeLa CD4 cells in the presence of adenovirus, and amplified 3-6 times. After each round of amplification, the lysate is passed over normal HeLa cells to remove any WT binding AAV that may have developed. The final lysate is cloned and sequenced by PCR to determine the site of the binding mutations and presence of the C4 ligand. The appropriate clone is then tested for targeting and, subsequently, binding in the absence of C4 peptide. This binding mutant is used to construct future targetable vectors with ligands other than C4 and at more optimal ligand insertion points.
  • AAV serotype 4 was recently isolated at the NIH. Unlike AAV-2, which binds to a receptor that is essentially ubiquitous on animal cells, AAV-4 is very restricted in terms of its tropism. The only cells which have been identified as positive for AAV-4 infection are Cos cells and glial cells. Other standard cell lines for AAV-2 (i.e., HeLa) are not infectable by AAV-4. Furthermore, because AAV-4 was originally obtained in nature from adenovirus infected monkeys, the human population is seronegative for this virus. A recombinant vector system has been constructed from AAV-4 and is essentially identical to the AAV-2 system.
  • titers from r AAV-4 are approximately 10-fold higher than AAV-2 in side-by-side comparisons. If AAV-4 can transduce either CD4+ T-lymphocytes or CD34+ stem cells, it may be used as a vector to transduce these important cell types.
  • AAV-4 is negative for transduction of these cell types, it is optionally used as an alternative to the AAV-2 binding mutants described supra.
  • the advantages of using this vector are essentially three-fold: 1) because the WT AAV-4 vector can be used as a "namral binding mutant" concerns about the impact of mutations on the overall conformation of the particle and changes in adaptability for ligand insertion are eliminated; 2) any observable defect will solely be due to ligand insertion; and 3) the seronegative status of the human population for AAV-4 simplifies in vivo injection of the final vector.
  • the expression of the AAV-2 receptor is knocked-out by expressing a ribozyme in a cell which cleaves the mRNA for the receptor.
  • any cell can have the AAV-2 receptor abrogated by transducing the cell with a vector encoding an appropriate ribozyme.
  • AAV receptor null cells can be identified by FACS or other cell sorting techniques which measure the expression of the receptor (ELISA, western blotting, etc.) on the surface of the cell.
  • AAV-2 receptor null cells are used in a vector library systems as follows: a) In the initial library strategy a potential concern with using binding mutants is that there is a chance that WT recombinants may form, or compensatory mutations may be introduced which restore WT binding. Because of the nature of the overall strategy, these recombinants or second-site mutants would be enriched and may mask enrichment of desired recombinants. Thus, cells which lack WT AAV binding capability would eliminate this concern. b) In a similar strategy cells which do not bind WT AAV can be used to enrich a targetable vector within a library which is randomized both respect to me insertion point of the ligand and binding mutations.
  • a cap vector will be constructed as described for the previous library.
  • Linker insertion mutagenesis will then be performed on this vector.
  • the idea of this particular insertion step is to create a random set of AAV binding knock-out mutants.
  • a targetable ligand is either added to the knock out linker, or a second round of linker insertion mutagenesis is performed followed by ligand addition.
  • This new library is used to infect the AAV-2 receptor null cells which express the targeting protein of interest (i.e. , CD34). Similar to above, amplification and evolution is performed.
  • the resulting vectors are screened for tropism, as some of the vectors that are identified by this procedure can be dual-tropic (i.e., AAV receptor and CD34 binding). Dual tropic vectors are eliminated by screening on AAV-2 receptor positive cells.
  • AAV-2 receptor null cell is adaptable and useful for generating additional AAV binding mutants. Modification of Pre-Formed Vector Particles
  • vectors which incorporate targeting ligands into their capsid protein as a part of the normal assembly process, rather than adding these components later as a modification to pre-formed particles.
  • Vectors containing targetable capsid fusion proteins are more amenable to a reproducible and efficient production process. This approach may be helpful where the strategies outlined above are not optimal. Where generating targetable vectors via post-assembly modification is straightforward, this approach offers a method for rapidly testing ligand/receptor interactions in the context of internalizing a vector and delivering the trans-gene. This approach would thus be useful for analyzing candidate ligands for the fusion protein strategy discussed above, where concern exists that a particular ligand/receptor interaction may not allow for effective internalization of the vector.
  • Several approaches for modifying pre-formed vector particles for purposes of targeting are outlined below.
  • the peptide display libraries that were previously described are used to generate bivalent peptides where one portion binds to AAV and the second portion binds to the target protein of interest.
  • two sets of library panning experiments are performed, where the first experiment is to select peptides which bind to purified AAV particles and the second experiment, in parallel, selects binding peptides for the cell surface marker of interest.
  • the sequencing information from these two experiments is used to generate a single linear peptide which has binding affinity for both AAV and the cell surface marker of interest. If the binding affinity for the AAV binding peptide is not sufficiently high to allow for reliable use of the complex as a targetable vector, then a cross-linking reaction can be performed to covalently attach these ligands to the vector.
  • this method allows for rapid pre-screening of candidate ligands as vector targeting molecules prior to incorporating them into the various vector libraries described, supra.
  • a bivalent peptide that is successfully used in this procedure can also be used to quickly test a panel of binding mutants for transducing function.
  • a similar method for modifying pre-formed vector particles is to utilize bivalent antibodies that have affinities for both AAV and the target receptor of choice. These antibodies are generated by chemically cross-linking monoclonal antibodies.
  • streptavidin could be incorporated into the AAV particle either as a fusion protein or by cross-linkage directly to the AAV particle.
  • biotinylated targeting ligands are added by direct non-covalent binding to streptavidin.
  • the AAV binding peptide technique that is described above may be modified so that the targeting portion of the peptide is not selected to bind to a specific receptor but rather will bind to biotin.
  • Hematopoietic stem cells are the primary targets for many forms of gene therapy, particularly gene therapy for HIV infection. Accordingly, stem cells are a preferred target for the vectors of the invention, particularly when the vectors encode anti-HIV agents.
  • Many ways of isolating stem cells are known. In mice, bone marrow cells are isolated by sacrificing the mouse and cutting the leg bones with a pair of scissors. Stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4 + and CD8 + (T cells), CD45 + (panB cells), GR-1 (granulocytes), and Ia d (differentiated antigen presenting cells). For an example of this protocol see, Inaba et al. (1992) J.
  • bone marrow aspirations from iliac crests are optionally performed e.g., under general anesthesia in the operating room.
  • the bone marrow aspirations is approximately 1 ,000 ml in quantity and is collected from the posterior iliac bones and crests. If the total number of cells collected is ⁇ 2 x 10 8 /kg, a second aspiration using the sternum and anterior iliac crests in addition to posterior crests is performed.
  • two units of irradiated packed red cells are administered to replace the volume of marrow taken by the aspiration.
  • Human hematopoietic progenitor and stem cells are characterized by the presence of a CD34 surface membrane antigen. This antigen is used for purification.
  • the mononuclear cells are separated from the other components by means of ficol gradient centrifugation. This is performed by a semi-automated method using a cell separator (e.g., a Baxter Fenwal CS3000+ or Terumo machine).
  • a cell separator e.g., a Baxter Fenwal CS3000+ or Terumo machine.
  • the light density cells composed mostly of mononuclear cells are collected and the cells are incubated in plastic flasks at 37° C for 1.5 hours.
  • the adherent cells (monocytes, macrophages and B-Cells) are discarded.
  • the non-adherent cells are then collected and incubated with a monoclonal anti-CD34 antibody (e.g., the murine antibody 9C5) at 4°C for 30 minutes with gentle rotation.
  • the final concentration for the anti-CD34 antibody is 10 ⁇ g/ml.
  • CD34+ cells are isolated by peripheral blood leukapheresis after G-CSF mobilization.
  • Therapeutic agents of the invention which are typically expressed by the expression cassettes of the invention, take several forms.
  • the agent is a nucleic acid which has direct therapeutic activity, such as a replacement enzyme, molecular decoy, anti-sense RNA or ribozyme, or indirect anti-viral activity, i.e., where the inhibitor encodes a direct anti-viral activity such as a therapeutic protein or suicide protein.
  • direct therapeutic activity such as a replacement enzyme, molecular decoy, anti-sense RNA or ribozyme
  • indirect anti-viral activity i.e., where the inhibitor encodes a direct anti-viral activity such as a therapeutic protein or suicide protein.
  • a variety of enzyme deficiencies are known to cause disease. See,
  • the present invention provides a treatment for such diseases in which a patient's abnormal cell type (e.g., insulin deficient) is transfected with a vector of the invention.
  • the vector comprises a nucleic acid encoding the deficient enzyme under the control of an appropriate promoter.
  • the vector is targeted to the appropriate cell type using a targeting agent of the invention.
  • the vector can be used to transduce pancreatic cells with a vector encoding insulin.
  • the combinatorial screening methods described herein can be used to identify targeting ligands which specifically hybridize to pancreatic cells. These targeting ligands are optionally recombinantly fused to a protein located on the surface of the vector where they are recognized by pancreatic cells, causing the cells to take up the nucleic acid associated with the vector.
  • Inhibitors antisense nucleic acids, ribozymes, decoy nucleic acids and trans- dominant proteins
  • the therapeutic agent inhibits growth of a target cell (i.e., when the agent is an anti-cancer compound), or of a pathogenic virus (e.g., HIV).
  • Inhibitors are known in the art. The literature describes such genes and their use. See, for example, Yu et al, Gene Therapy, 1 : 13 (1994); Herskowitz, Nature, 329:212 (1987) and Baltimore, Nature, 335:395 (1988).
  • Inhibitors which are optionally inco ⁇ orated into the expression cassettes of the invention include anti-sense genes, suicide genes, ribozymes, decoy genes, and transdominant proteins.
  • a suicide gene produces a product which is cytotoxic.
  • a suicide gene is operably linked to an inducible expression control sequences which is stimulated upon infection of a cell by a pathogen such as HIV.
  • the gene is operably linked to a constimtive promoter where the vector is used to transduce a pathogenic cell (i.e., a cancer cell).
  • pathogenic cell i.e., a cancer cell.
  • suicide genes include thymidine kinase and cytosine deaminase. See, Huber et al. European Patent Application 95100248.4 and Mullen et al. U.S. Pat. 5,358,866.
  • An antisense nucleic acid is a nucleic acid that, upon expression, hybridizes to a particular RNA molecule, to a transcriptional promoter or to the sense strand of a gene. By hybridizing, the antisense nucleic acid interferes with the transcription of a complementary nucleic acid, the translation of an mRNA, or the function of a catalytic RNA.
  • Antisense molecules useful in this invention include those that hybridize to oncogenic and viral gene transcripts. Two example target sequences for antisense molecules are the first and second exons of the HIV genes tat and rev. Chatterjee and Wong, supra, and Marcus-Sekura (Analyticalpha)
  • Biochemistry (1988) 172, 289-285) describe the use of anti-sense genes which block or modify gene expression.
  • a ribozyme is a catalytic RNA molecule that cleaves other RNA molecules having particular nucleic acid sequences.
  • General methods for the construction of ribozymes including hai ⁇ in ribozymes, hammerhead ribozymes,
  • RNAse P ribozymes i.e., ribozymes derived from the namrally occurring RNAse P ribozyme from prokaryotes or eukaryotes
  • ribozymes in general, including group I ribozymes, hammerhead ribozymes, hai ⁇ in ribozymes, RNAse P, and axhead ribozymes.
  • Ribozymes useful in this invention include diose that cleave viral transcripts, particularly HIV gene transcripts. Ojwang et al, Proc. Nat'l. Acad.
  • ribozymes that are particularly useful in this invention include the hai ⁇ in ribozyme and the hammerhead ribozyme.
  • the hammerhead ribozyme see, Rossie et al. (1991) Pharmac. Ther. 50:245-254; Forster and Symons (1987) Cell 48:211-220; Haseloff and Gerlach (1988) Nature 328:596-600; Walbot and Bruening (1988) Nature 334: 196; Haseloff and Gerlach
  • Yamada et al (1994) Human Gene Therapy 1:39-45; Leavitt et al. (1995) Proc Natl Acad Sci USA 92:699-703; Leavitt et al. (1994) Human Gene Therapy 5: 1151-1120; and Yamada et al (1994) Virology 205:121-126) are catalytic molecules having antisense and endoribonucleotidase activity. Intracellular expression of hammerhead ribozymes and a hai ⁇ in ribozymes directed against HIV RNA has been shown to confer significant resistance to HIV infection.
  • the typical sequence requirement for cleavage by a hai ⁇ in ribozyme is an RNA sequence consisting of NNNG/CN*GUCNNNNNNNN (where N*G is the cleavage site, and where N is any of G, U, C, or A).
  • the sequence requirement at the cleavage site for the hammerhead ribozyme is an RNA sequence consisting of
  • NUX (where N is any of G, U, C, or A and X represents C, U or A). Accordingly, the same target within the hai ⁇ in leader sequence, GUC, is targetable by the hammerhead ribozyme.
  • the additional nucleotides of the hammerhead ribozyme or hai ⁇ in ribozyme which mediate sequence specificity, are determined by the common target flanking nucleotides and the hammerhead and hai ⁇ in consensus sequences.
  • RNAse P as a therapeutic agent directed against flu virus.
  • the inhibitors of the invention include anti- HIV ribozymes, such as hai ⁇ in ribozymes (see, Wong-Staal et al WO 94/26877 and PCT/US94/05700 and the references therein; see also, Yu et al. (1993) PNAS 90: 6340-6344; and Yu et al (1995) Virology 206: 381-386), hammerhead ribozymes (see, Dropulic et al. (1992) Journal of Virology, 66(3): 1432-1441), and RNAse P (see, Castanotto et al. (1994) Advances in Pharmacology Academic Press 25: 289-317).
  • ribozymes are constructed to target a portion of the Rev- binding virus' genome or nucleic acid encoded by the genome.
  • Preferred target sites in HIV-1 include the U5 region, and the polymerase gene.
  • a decoy nucleic acid is a nucleic acid having a sequence recognized by a regulatory nucleic acid binding protein (i.e., a transcription factor, cell trafficking factor, etc.). Upon expression, the transcription factor binds to the decoy nucleic acid, rather than to its namral target in the genome.
  • a regulatory nucleic acid binding protein i.e., a transcription factor, cell trafficking factor, etc.
  • the transcription factor binds to the decoy nucleic acid, rather than to its namral target in the genome.
  • Useful decoy nucleic acid sequences include any sequence to which a viral transcription factor binds. For instance, the TAR sequence, to which the tat protein binds, and the HIV RRE sequence to which the rev proteins binds are suitable sequences to use as decoy nucleic acids.
  • a transdominant protein is a protein whose phenotype, when supplied by transcomplementation, will overcome the effect of the native form of the protein.
  • tat and rev can be mutated to retain the ability to bind to TAR and RRE, respectively, but to lack the proper regulatory function of those proteins.
  • rev can be made transdominant by eliminating the leucine-rich domain close to the C terminus which is essential for proper normal regulation of transcription.
  • Tat transdominant proteins can be generated by mutations in the RNA binding/nuclear localization domain of Tat.
  • antisense molecules examples include Weintraub, Sci. Am. , 262:40-46 (Jan. 1990); Marcus-Sekura, Anal. Biochem., 172:289-95 (1988); and Hasselhoff et al. , Nature,
  • the vectors of the invention are useful for in vitro cell transformation.
  • the ability to transform cells is of general commercial importance in biological manufacturing, drug screening assays, cloning procedures and the like.
  • the vectors of the invention optionally comprise a nucleic acid which encodes a commercially valuable protein such as insulin, TPA, erythropoietin, etc.
  • the vector is used to transform a cell, which expresses the protein.
  • the vectors of the invention are useful as cloning vectors for gene transfer in vitro.
  • the vectors are useful as gene therapy vectors in both ex vivo and in vivo procedures.
  • Ex vivo methods of gene therapy involve transducing a target cell ex vivo with a vector of this invention, and introducing the cell into the organism.
  • Target cells are selected based upon the range of the targeted vector. See, e.g., Freshney et al , supra and the references cited therein, and the discussion provided herein for a discussion of how to isolate and culture cells from patients.
  • the cells can be those stored in a cell bank (e.g., a blood bank).
  • a patient infected with a virus such as HIV-1 can be treated for the infection by transducing a population of their cells with a vector of the invention and introducing the transduced cells back into the patient as described herein.
  • the present invention provides a method of protecting cells from infection in vitro, ex vivo or in vivo. In Vivo Therapy
  • Vectors of the invention can be administered directly to the organism for transduction of cells in vivo.
  • Administration of vectors comprising the therapeutic agents of the invention, and cells transduced with the gene therapy vectors is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells.
  • the vectors or cells are administered in any suitable manner, preferably with pharmaceutically acceptable carriers. Suitable methods of administering such vectors or cells in the context of the present invention to a patient are available, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • compositions of the present invention are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions of the present invention.
  • Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the vector dissolved in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
  • Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, tragacanth, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers.
  • Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.
  • a flavor usually sucrose and acacia or tragacanth
  • pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.
  • Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.
  • Suitable formulations for rectal administration include, for example, suppositories, which consist of the vector with a suppository base.
  • Suitable suppository bases include natural or synthetic triglycerides or paraffin hydrocarbons.
  • gelatin rectal capsules which consist of a combination of the vector with a base, including, for example, liquid triglyercides, polyethylene glycols, and paraffin hydrocarbons.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic wim the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • Intravenous administration is the preferred method of administration for gene therapy vectors and transduced cells of the invention.
  • the formulations of vector can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, " and in some embodiments, can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water, for injections, immediately prior to use. For many vectors, this mode of administration will not be appropriate, because many particles are destroyed by lyophilization. Some vectors (e.g., vectors utilizing an AAV capsid), however, tolerate lyophilization well. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transduced by the vector, e.g., as described above in the context of ex vivo therapy, can also be administered parenterally as described above, except that lyophilization is not generally appropriate, since cells are destroyed by lyophilization.
  • the dose administered to a patient should be sufficient to effect a beneficial therapeutic response in the patient over time, or to inhibit infection by a pathogen.
  • the dose will be determined by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated.
  • the size of the dose also will be determined by the existence, nature, and extent of any adverse side- effects that accompany the administration of a particular vector, or transduced cell type in a particular patient.
  • the physician evaluates circulating plasma levels, vector toxicities, progression of the disease, and the production of anti-vector antibodies.
  • the dose equivalent of a naked nucleic acid from a vector is from about 1 ⁇ g to 100 ⁇ g for a typical 70 kilogram patient, and doses of gene therapy vectors which include viral particle such as AAV or retroviral vectors are calculated to yield an equivalent amount of inhibitor nucleic acid.
  • compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intra vesically or intrathecally.
  • the preferred method of administration will often be oral, rectal or intravenous, but the vectors can be applied in a suitable vehicle for the local and topical treatment of virally-mediated conditions.
  • the vectors of this invention can supplement treatment of virally-mediated conditions by any known conventional therapy, including cytotoxic agents, nucleotide analogues and biologic response modifiers.
  • inhibitors and transduced cells of the present invention can be administered at a rate determined by the LD-50 of the inhibitor, vector, or transduced cell type, and the side-effects of the inhibitor, vector or cell type at various concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses.
  • Prior to infusion blood samples are obtained and saved for analysis. Between 1 X IO 8 and 1 X IO 12 transduced cells are infused intravenously over 60- 200 minutes. Vital signs and oxygen saturation by pulse oximetry are closely monitored. Blood samples are obtained 5 minutes and 1 hour following infusion and saved for subsequent analysis.
  • Leukopheresis, transduction and reinfusion are repeated every 2 to 3 months for a total of 4 to 6 treatments in a one year period.
  • infusions can be performed on a outpatient basis at the discretion of the clinician. If the reinfusion is given as an outpatient, the participant is monitored for at least 4, and preferably 8 hours following the therapy.
  • Transduced cells are prepared for reinfusion according to established methods. See, Abrahamsen et al. (1991) J. Clin. Apheresis 6:48-53; Carter et al. (1988) J. Clin. Arpheresis 4:113-117; Aebersold et al. (1988), J. Immunol Methods 112: 1-7; Muul et al (1987) J.
  • the cells should number between 1 X 10 8 and 1 X IO 12 .
  • the growth characteristics of cells vary from patient to patient and from cell type to cell type. About 72 hours prior to reinfusion of the transduced cells, an aliquot is taken for analysis of phenotype, and percentage of cells expressing the therapeutic agent. If a patient undergoing infusion of a vector or transduced cell develops fevers, chills, or muscle aches, he/she receives the appropriate dose of aspirin, ibuprofen or acetaminophen.
  • Example 1 AAV Targeting
  • a targetable gene therapy vector should have the following characteristics: 1) it should be simple to produce at an effective titer, 2) it should be stable so that storage and manipulation of the vector are not prohibitive issues, 3) it should bind specifically and deliver genes of interest to target cells, 4) It should be relatively void of binding to non-target cells, and 5) it should possess safety features which allow for effective and ethical use of the vector, ideally in a large number of individuals.
  • rAAV recombinant adeno-associated virus vectors
  • the basic strategy for creating a targetable rAAV vector was to first delete the normal binding region on the AAV capsid protein and then replace the region with a ligand capable of targeting the virus to a receptor other than AAV.
  • the initial stages of this work were performed in the context of the WT virus, because it is easier to work with than recombinant virus.
  • the appropriate mutant capsid proteins were transferred to an rAAV helper plasmid used in standard rAAV packaging experiments.
  • Vpl 24-135 eliminates Vpl
  • Vp2 24-175 eliminates Vpl and Vp2
  • Vpl hydro 26-34 deletes proline rich region in Vpl
  • Oligonucleotide site-directed mutagenesis was performed by polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the Bst Ell-Sna Bl fragment spanning nucleotides 1700 to 4496 in the AAV-2 genome (Srivatava, et al. (1983) J. Virol, 45; 555-564) was excised from pAV2, and site directed mutagenesis was performed on the purified fragment. Subsequently, the fragment was cloned back into pAV2, or alternatively into the AAV helper plasmid Ad8 (Samulski et al. (1989) J. Virol. 63: 3822-3828).
  • the Vplhydro deletion is shown in bold underline text with flanking nucleic acids. The deletion corresponds to nucleic acids 2278-2304 as given in Srivatava, et al. (1983) J. Virol 45: 555-564.
  • Vplhydro cagtggtggaagctcaaacctggcccaccaccaccaaagcccgcagagcggcataa.
  • the D, deletion is shown in bold underline text with flanking nucleic acids. The deletion corresponds to nucleic acids 2828-2834 as given in Srivatava, et al. (1983) J. Virol. 45: 555-564.
  • Dl gctacaggcagtggcgcaccaatggcagaca
  • D2 deletion is shown in bold underline text with flanking nucleic acids.
  • the deletion corresponds to nucleic acids 2855-2868 as given in Srivatava, et al. (1983) J. Virol. 45: 555-564.
  • the D 3 deletion is shown in bold underline text widi flanking nucleic acids.
  • the deletion corresponds to nucleic acids 2890-2905 as given in Srivatava, et al (1983) J. Virol 45: 555-564.
  • D 4 deletion is shown in bold underline text with flanking nucleic acids.
  • the deletion corresponds to nucleic acids 2921-2935 as given in Srivatava, et al. (1983) J. Virol 45: 555-564.
  • D4 cagagtcatcaccaccagcacccgaacctgggccc
  • Particle formation assay After generating the above mutants, the plasmid DNAs were transfected into adenovirus infected HeLa cells to produce packaged vector. Cell lysates were generated by freeze thaw and subsequently treated with DNase 1. The genome of intact particles were protected from DNase 1 digestion. Each sample was then digested with proteinase K and extracted with phenol/chloroform, and serial dilutions of the extracts were loaded onto a slot blot apparatus. Hybridization was performed using a labeled probe complementary to a region of AAV not contained within the deletions. Intact particle (virion) formation was evident in the WT control, and in the Vplhydro and D4 mutants.
  • adenovirus infected cells were transfected with rAAV containing the b-gal gene plus wild-type, Vplhydro or Dl mutant AAV helper plasmid and 72 hours later the cells were lysed by freeze/thaw, clarified by centrifugation, heated to 56 °C for 45 min and then incubated with DNase 1 for 60 min at 37°C. Subsequently, the samples were treated with proteinase K, phenol/chloroform extracted, and bound to a solid matrix with a slot blot apparatus. Vector nucleic acids were hybridized to a 32-P labeled b-gal probe (the b-gal gene is present in each vector). Results showed that a Vplhydro mutation with a stem cell factor insert had levels of particle formation similar to wild type AAV.
  • samples positive for particle formation were normalized in terms of genome content and used to infect adenovirus infected HeLa cells. Cell lysates were then treated in a manner identical to the particle formation assay.
  • the indicated cell lines were transduced with rAAV vectors containing capsid proteins AAV/ Ad (WT AAV capsid), AAV/Ad vplhydro (AAV binding mutant capsid), or AAV/ Ad vplhydro SCF (AAV binding mutant capsid with SCF insert). All vectors contained the b-gal gene as a reporter.
  • Ad b-gal As an additional positive control an adenovirus vector, Ad b-gal, was included. Table 2
  • AAV/ Ad vplhydro 0 AAV/Ad vplhydro SCF 0 Control (normal cell lysate) 0 B.
  • Control normal cell lysate 0 C.
  • NCI 187 cells 5000 cells per transduction blue cells
  • AAV/ Ad vplhydro 0 AAV/Ad vplhydro SCF 46 Ad b-gal (MOI 10) 246 Ad b-gal (MOI 30) 612 Control (normal cell lysate) 0
  • a chimeric AAV virion protein carrying coding sequences for the variable regions of a single chain antibody (scFv) against human CD34 molecules.
  • scFv single chain antibody
  • CD34 single chain antibody-AAV capsid chimeric proteins in rAAV virions dramatically increased the infectivity of rAAV to CD34+ KG-1 cells, a human myelogenous leukemia cell line that is normally resistant to rAAV transduction.
  • Hematopoietic stem cells are important targets for gene tiierapy.
  • Adenoviral vectors are good candidates for direct in vivo gene delivery to hematopoietic stem cells because they can transduce non-dividing cells (unlike retroviral vectors) and can mediate die integration of transgenes into host genomes (Fisher- Adams, G., et al, Blood 88:492 (1996)).
  • AAV vectors that bind specifically to these cells.
  • HeLa cells were grown in Delbecco's Modified Eagle Media (DMEM) supplemented widi antibiotics and 10% fetal bovine serum.
  • DMEM Delbecco's Modified Eagle Media
  • KG-1 ATCC CCL-246
  • a human acute myelogenous leukemia cell line that expresses CD34 molecules was cultured in Iscove's Modified Eagle Medium supplemented widi 20% fetal bovine serum.
  • the anti-CD34 hybridoma My- 10 (ATCC HB8483) was cultured in RPMI medium in the presence of 10% fetal bovine serum. All cells were maintained at 37°C in a 5.0% CO 2 atmosphere. DNA transfections of HeLa cells were performed by calcium phosphate transfection one day after plating onto culmre dishes (see,
  • the resulting scFv with a strucmre of V H -(GGGGS) 3 -V L comprised an N-terminal heavy chain region of 116 amino acids followed by the linker sequence and a C- terminal light chain region of 112 amino acids.
  • the cloned scFv gene was inserted into a pTrc/his vector (Invitrogen) for bacterial expression of the scFv widi a polyhistidine tag.
  • the histidine tagged scFv protein was purified using a nickel column under denaturing conditions. Renaturation was performed by dialyzing the purified proteins against 10 mM Tris- HCl, pH 7.8, and 0.1 % Triton X-100. Any undissolved proteins were removed before further use and me solubilized protein was identified as scFv-his by western blot analysis using an anti-his C-terminal antibody (Invitrogen).
  • the capsid genes for VPl, VP2, and VP3 were amplified from the pAV2 plasmid, which contains die full lengtii AAV-2 genome (Laughlin, C.A., et al, Gene 23:65 (1983)).
  • the 3' primers co ⁇ esponded to the end of the AAV capsid gene open reading frame and die 5' primers corresponded to die start codon of individual capsid genes, i.e. position 2203-2229 for VPl, 2617-2640 for VP2, and 2810-2833 for VP3.
  • the 3' and 5' primers were synthesized so that Sal I and Xba I sites would be inco ⁇ orated into die VP sequences for ligation into vectors.
  • the amplified sequences with the incorporated restriction sites were subcloned into pCDNA3 expression vectors (Invitrogen) via Xho I and Xba I sites to generate pVPl, pVP2, and pVP3 plasmids.
  • the above cloned anti-CD34 scFv sequence was ligated to die 5' end of the VPl, VP2, and VP3 sequences using Hind III and Not I sites to generate the plasmids pVPl-scFv, pVP2-scFv, and pVP3-scFv.
  • AAV virion proteins and die chimeric proteins were verified in vitro using a TNT transcription and translation kit (Promega). We detected the expression of AAV VPl, VP2, and VP3 proteins as well as VPl-scFv, VP2-scFv, and VP3-scFv.
  • me plasmids were transfected into 2 x IO 5 HeLa cells in 60 mm dishes by calcium phosphate transfection. Forty eight hours later, die cells were collected and cell lysates prepared by adding 30 ⁇ L lysis buffer (10 mM Tris, pH 7.8, 2 mM PMSF, 5 mM MgCl 2 , 0.3 M NaCl, and a proteinase inhibitor cocktail from Boehringer Mannheim) and boiling for 15 min with 10 ⁇ L 3X electrophoresis loading buffer.
  • lysis buffer 10 mM Tris, pH 7.8, 2 mM PMSF, 5 mM MgCl 2 , 0.3 M NaCl, and a proteinase inhibitor cocktail from Boehringer Mannheim
  • the presence of intracellular chimeric proteins was verified by western blot analysis using guinea pig anti-AAV2 antibody (NIH) and HRP-conjugated goat anti-guinea pig antibody.
  • the ECL system (Amersham) was used to detect positive signals.
  • plasmid pAVgal an AAV vector plasmid containing a bacterial lacZ gene under die control of me cytomegalovirus (CMV) early promoter, conjugated to 100 ⁇ L polylysine coupled adenovirus (M.O.I, about 10) (Mamounas, M., et al, Gene Ther. 2:429 (1995)).
  • CMV me cytomegalovirus
  • M.O.I polylysine coupled adenovirus
  • the rAAV particles were extracted from HeLa cells after diree freezing and tiiawing cycles. The crude lysates were spun in a microcentrifuge for 10 min at maximum speed. The rAAV particles were purified by CsCl centrifugation. 30-40 T162 flasks of rAAV-containing lysates were combined and CsCl was added to me lysate to a final density of 1.4 g/ml. After centrifugation at 35,000 ⁇ m, cell debris and die majority of the adenoviruses were removed and a second centrifugation was performed. The contents of the centrifuge tube were collected in 1 mL fractions.
  • each fraction was tested for the presence of intact rAAV particles by slot blot analysis using a lacZ gene probe.
  • the fractions with the highest rAAV particle titer were pooled and dialyzed against DMEM medium for 2 hr at 40°C widi one change of dialysis medium.
  • rAAV particles For transduction wim rAAV particles, about 2 x IO 4 KG-1 or HeLa cells were plated in 24-well plates one day prior to transduction. Appropriate amounts of rAAV were added to me media, and the particles and cells were incubated overnight. After me incubation period, me cells were washed and die expression of die lacZ gene was detected by X-gal staining.
  • vAAV AAV vectors which contained the VP-scFv chimeric proteins
  • 1 x 10 7 HeLa cells in T 162 flasks were transfected widi, in addition to the plasmids pAV/Ad and pAVgal, lO ⁇ g of pVPl-scFv, pVP2-scFv, and pVP3-scFv.
  • PE-ICH3 was the minimum amount required for detection of 1 x 10 5 KG-1 cells.
  • die competitive binding assay we preincubated KG-1 cells wim 1 ⁇ g of histidine tagged scFv or control protein for 30 minutes before die addition of PE-ICH3 antibody.
  • the addition of dialysis medium, control IgG ! or histidine tagged lacZ protein did not interfere wim the binding of ICH3 to KG-1 cells, however, the presence of purified scFv reduced die binding of ICH3 to CD34 by more tiian 90%. This indicates that the scFv we purified bound to CD34 molecules on the KG-1 cell surface.
  • CD43+ cells can be achieved.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention se rapporte à des vecteurs viraux dirigés sur des cibles définies, soit des types de cellules sélectionnés, par blocage des sites de liaison des cellules virales de phénotype sauvage et par introduction d'un agent de ciblage dans la particule vectorielle. L'agent de ciblage se lie au type de cellule sélectionné en se fixant à une molécule sur la surface de la cellule, ou en se fixant à un second agent de ciblage qui se lie à la cellule sélectionnée. L'invention se rapporte également à des vecteurs à base de parvovirus, de rétrovirus, et d'herpèsvirus et de virus Ad, ainsi qu'à des banques de vecteurs viraux comportant l'agent de ciblage. L'invention se rapporte encore à des procédés de sélection de vecteurs viraux de recombinaison dans ledites banques, à des ligands polypeptidiques isolés des banques de vecteurs phages ou viraux.
PCT/US1997/006590 1996-04-16 1997-04-15 Vecteurs viraux a cibles definies WO1997038723A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP97918752A EP0927044A4 (fr) 1996-04-16 1997-04-15 Vecteurs viraux a cibles definies
AU26780/97A AU2678097A (en) 1996-04-16 1997-04-15 Targeted viral vectors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1549796P 1996-04-16 1996-04-16
US60/015,497 1996-04-16

Publications (1)

Publication Number Publication Date
WO1997038723A1 true WO1997038723A1 (fr) 1997-10-23

Family

ID=21771753

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/006590 WO1997038723A1 (fr) 1996-04-16 1997-04-15 Vecteurs viraux a cibles definies

Country Status (4)

Country Link
EP (1) EP0927044A4 (fr)
AU (1) AU2678097A (fr)
CA (1) CA2251738A1 (fr)
WO (1) WO1997038723A1 (fr)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999019500A1 (fr) * 1997-10-10 1999-04-22 The Government Of The United States Of America, Represented By The Secretary, Department Of Healt H And Human Services Complexe de vecteur viral et de ligand biotinyles pour une fourniture de genes ciblee
WO1999056129A1 (fr) 1998-04-24 1999-11-04 The Regents Of The University Of California Procedes de selection d'anticorps d'internalisation
WO1999067393A2 (fr) * 1998-06-19 1999-12-29 Medigene Aktiengesellschaft Proteine structurale de virus associe aux adenovirus, sa production et son utilisation
US6057155A (en) * 1995-11-28 2000-05-02 Genvec, Inc. Targeting adenovirus with use of constrained peptide motifs
WO2000029600A1 (fr) * 1998-11-19 2000-05-25 Georgetown University Systeme d'apport genique systemique de virus/ligands et de therapie genique
US6127525A (en) * 1995-02-21 2000-10-03 Cornell Research Foundation, Inc. Chimeric adenoviral coat protein and methods of using same
WO2000073478A2 (fr) * 1999-06-01 2000-12-07 University Of Washington Vecteurs adenoviraux recombinants pour l'infection specifique de cellules, l'integration de genomes et l'expression de proteines fibreuses chimeriques
WO2001005991A1 (fr) * 1999-07-19 2001-01-25 Medigene Aktiengesellschaft Proteine structurale de virus adeno-associe a proprietes chromatographiques modifiees, sa production et son utilisation
WO2001005990A1 (fr) * 1999-07-15 2001-01-25 Medigene Aktiengesellschaft Proteine de structure d'un virus adeno-associe a antigeneite modifiee, sa production et son utilisation
WO2001059142A1 (fr) * 2000-02-09 2001-08-16 Medimmune, Inc. Therapie genique a anticorps avec vecteurs viraux adeno-associes
WO2001098514A2 (fr) * 2000-06-16 2001-12-27 University Of Medicine And Dentistry Of New Jersey Ciblage de cellules specifiques par des vecteurs viraux
US6455314B1 (en) 1998-09-11 2002-09-24 Genvec, Inc. Alternatively targeted adenovirus
US6491907B1 (en) 1998-11-10 2002-12-10 The University Of North Carolina At Chapel Hill Recombinant parvovirus vectors and method of making
US6576456B2 (en) 1995-02-21 2003-06-10 Cornell Research Foundation, Inc. Chimeric adenovirus fiber protein
US6599737B1 (en) 1998-04-30 2003-07-29 Cornell Research Foundation, Inc. Adenoviral vectors with tandem fiber proteins
WO2003054197A3 (fr) * 2001-12-21 2004-03-18 Medigene Ag Bibliotheque de genes structuraux modifies ou de particules modifiees par des capsides utiles pour l'identification de clones viraux par tropisme cellulaire desire
WO2004083441A2 (fr) * 2003-03-19 2004-09-30 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Bibliotheque peptidique aleatoire s'affichant sur des vecteurs aav
US6913922B1 (en) 1999-05-18 2005-07-05 Crucell Holland B.V. Serotype of adenovirus and uses thereof
US6929946B1 (en) 1998-11-20 2005-08-16 Crucell Holland B.V. Gene delivery vectors provided with a tissue tropism for smooth muscle cells, and/or endothelial cells
US6951755B2 (en) 1994-09-08 2005-10-04 Genvec, Inc. Vectors and methods for gene transfer
US7094398B1 (en) 1999-06-01 2006-08-22 University Of Washington Recombinant adenoviral vectors expressing chimeric fiber proteins for cell specific infection and genome integration
US7244826B1 (en) 1998-04-24 2007-07-17 The Regents Of The University Of California Internalizing ERB2 antibodies
US7314912B1 (en) 1999-06-21 2008-01-01 Medigene Aktiengesellschaft AAv scleroprotein, production and use thereof
US7647184B2 (en) 2001-08-27 2010-01-12 Hanall Pharmaceuticals, Co. Ltd High throughput directed evolution by rational mutagenesis
US7749493B2 (en) 1998-07-08 2010-07-06 Crucell Holland B.V. Chimeric adenoviruses
US7875450B2 (en) 1998-10-21 2011-01-25 The United States Of America As Represented By The Department Of Health And Human Services Virus-like particles for the induction of autoantibodies
US7892809B2 (en) 2004-12-15 2011-02-22 The University Of North Carolina At Chapel Hill Chimeric vectors
US8637255B2 (en) 1998-11-05 2014-01-28 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype I nucleic acid sequences, vectors and host cells containing same
US8889641B2 (en) 2009-02-11 2014-11-18 The University Of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
US9193956B2 (en) 2011-04-22 2015-11-24 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9228205B2 (en) 2000-11-15 2016-01-05 Crucell Holland B.V. Complementing cell lines
US9233131B2 (en) 2003-06-30 2016-01-12 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US9441244B2 (en) 2003-06-30 2016-09-13 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US9457103B2 (en) 2010-10-06 2016-10-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US10883117B2 (en) 2015-03-24 2021-01-05 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
US11021519B2 (en) 2015-03-02 2021-06-01 Adverum Biotechnologies, Inc. Compositions and methods for intravitreal delivery of polynucleotides to retinal cones
US11136557B2 (en) 2013-05-31 2021-10-05 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
US11192925B2 (en) 2016-10-19 2021-12-07 Adverum Biotechnologies, Inc. Modified AAV capsids and uses thereof
US11236360B2 (en) 2016-12-09 2022-02-01 Regents Of The University Of Minnesota Adeno-associated viruses engineered for selectable tropism
US11248214B2 (en) 2014-03-17 2022-02-15 Adverum Biotechnologies, Inc. Compositions and methods for enhanced gene expression in cone cells
US11554180B2 (en) 2016-07-29 2023-01-17 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US11680249B2 (en) 2017-08-28 2023-06-20 The Regents Of The University Of California Adeno-associated virus capsid variants and methods of use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4797368A (en) * 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
WO1993009221A1 (fr) * 1991-10-30 1993-05-13 Thera Gene Hb Apport cible de vecteur viral dans des cellules de mammifere
WO1995023846A1 (fr) * 1994-03-04 1995-09-08 University Of Medicine & Dentistry Of New Jersey Transfert genique specifique de types de cellules a l'aide de vecteurs retroviraux contenant des proteines de fusion d'enveloppe d'anticorps et d'enveloppe de type sauvage
US5474935A (en) * 1990-05-23 1995-12-12 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus (AAV)-based eucaryotic vectors
US5478745A (en) * 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9223084D0 (en) * 1992-11-04 1992-12-16 Imp Cancer Res Tech Compounds to target cells
DE69333471T2 (de) * 1992-11-09 2005-02-24 The United States Government As Represented By The Secretary Of The Department Of Health And Human Services Erzielbare vektorenpartikel
WO1997005266A1 (fr) * 1995-07-25 1997-02-13 Introgene B.V. Procedes et moyens d'apport cible de genes

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4797368A (en) * 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
US5474935A (en) * 1990-05-23 1995-12-12 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus (AAV)-based eucaryotic vectors
WO1993009221A1 (fr) * 1991-10-30 1993-05-13 Thera Gene Hb Apport cible de vecteur viral dans des cellules de mammifere
US5478745A (en) * 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
WO1995023846A1 (fr) * 1994-03-04 1995-09-08 University Of Medicine & Dentistry Of New Jersey Transfert genique specifique de types de cellules a l'aide de vecteurs retroviraux contenant des proteines de fusion d'enveloppe d'anticorps et d'enveloppe de type sauvage

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BIOTECHNOLOGY, November 1996, Vol. 14, No. 11, DOUGLAS et al., "Targeted Gene Delivery by Tropism-Modified Adenoviral Vectors", pages 1574-1578. *
BLOOD, 15 January 1996, Vol. 87, No. 2, SCHWARZENBERGER et al., "Targeted Gene Transfer to Human Hematopoietic Progenitor Cell Lines Through the c-Kit Receptor", pages 472-478. *
BLOOD, 1994, Vol. 84, No. 10, Suppl. 1, WONG et al., "Primary Human CD34+ Peripheral Blood Stem Cells (PBSCs) are Efficient Targets for Adeno-Associated Virus Vector-Mediated Gene Transfer: Prospects for Anti-AIDS Genetic Intervention", page 743A. *
J. VIROLOGY, October 1995, Vol. 69, No. 10, COSSET et al., "Retroviral Retargeting by Envelopes Expressing an N-Terminal Binding Domain", pages 6314-6322. *
J. VIROLOGY, October 1996, Vol. 70, No. 10, WICKHAM et al., "Targeted Adenovirus Gene Transfer to Endothelial and Smooth Muscle Cells by Using Bispecific Antibodies", pages 6831-6838. *
MOLECULAR BIOTECHNOLOGY, December 1996, Vol. 6, No. 3, WALTHER et al., "Targeted Vectors for Gene Therapy of Cancer and Retroviral Infections", pages 267-286. *
PROC. NATL. ACAD. SCI. U.S.A., August 1995, Vol. 92, SOMIA et al., "Generation of Targeted Retroviral Vectors by Using Single-Chain Variable Fragment: An Approach to in Vivo Gene Delivery", pages 7570-7574. *
See also references of EP0927044A4 *
THE FASEB JOURNAL, February 1995, Vol. 9, No. 2, MILLER et al., "Targeted Vectors for Gene Therapy", pages 190-199. *

Cited By (86)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6951755B2 (en) 1994-09-08 2005-10-04 Genvec, Inc. Vectors and methods for gene transfer
US6153435A (en) * 1995-02-21 2000-11-28 Cornell Research Foundation, Inc. Nucleic acid that encodes a chimeric adenoviral coat protein
US6576456B2 (en) 1995-02-21 2003-06-10 Cornell Research Foundation, Inc. Chimeric adenovirus fiber protein
US6127525A (en) * 1995-02-21 2000-10-03 Cornell Research Foundation, Inc. Chimeric adenoviral coat protein and methods of using same
US6057155A (en) * 1995-11-28 2000-05-02 Genvec, Inc. Targeting adenovirus with use of constrained peptide motifs
US6555367B1 (en) 1997-10-10 2003-04-29 The United States Of America As Represented By The Department Of Health And Human Services Complex of biotinylated viral vector and ligand for targeted gene delivery
WO1999019500A1 (fr) * 1997-10-10 1999-04-22 The Government Of The United States Of America, Represented By The Secretary, Department Of Healt H And Human Services Complexe de vecteur viral et de ligand biotinyles pour une fourniture de genes ciblee
US7244826B1 (en) 1998-04-24 2007-07-17 The Regents Of The University Of California Internalizing ERB2 antibodies
US8173424B2 (en) 1998-04-24 2012-05-08 The Regents Of The University Of California Internalizing ErbB2 antibodies
US9388244B2 (en) 1998-04-24 2016-07-12 The Regents Of The University Of California Internalizing ErbB2 antibodies
EP1073905A1 (fr) * 1998-04-24 2001-02-07 The Regents of the University of California Procedes de selection d'anticorps d'internalisation
EP1073905A4 (fr) * 1998-04-24 2004-12-08 Univ California Procedes de selection d'anticorps d'internalisation
US7892554B2 (en) 1998-04-24 2011-02-22 The Regents Of The University Of California Internalizing ErbB2 antibodies
US8974792B2 (en) 1998-04-24 2015-03-10 The Regents Of The University Of California Internalizing erbB2 antibodies
WO1999056129A1 (fr) 1998-04-24 1999-11-04 The Regents Of The University Of California Procedes de selection d'anticorps d'internalisation
US6599737B1 (en) 1998-04-30 2003-07-29 Cornell Research Foundation, Inc. Adenoviral vectors with tandem fiber proteins
EP1783225A1 (fr) * 1998-06-19 2007-05-09 Medigene AG Protéine structurale de Virus Associé aux Adenovirus, sa production et son utilisation
JP2002518050A (ja) * 1998-06-19 2002-06-25 メディジーン・アクチェンゲゼルシャフト Aavの構造タンパク質、その製造及び用途
EP1783226A1 (fr) * 1998-06-19 2007-05-09 Medigene AG Protéine structurale de Virus Associé aux Adenovirus, sa production et son utilisation
AU765330B2 (en) * 1998-06-19 2003-09-18 Medigene Aktiengesellschaft AAV scleroprotein, production and use thereof
WO1999067393A3 (fr) * 1998-06-19 2000-03-30 Medigene Ag Proteine structurale de virus associe aux adenovirus, sa production et son utilisation
JP4652570B2 (ja) * 1998-06-19 2011-03-16 メディジーン・アクチェンゲゼルシャフト Aavの構造タンパク質、その製造及び用途
WO1999067393A2 (fr) * 1998-06-19 1999-12-29 Medigene Aktiengesellschaft Proteine structurale de virus associe aux adenovirus, sa production et son utilisation
US7749493B2 (en) 1998-07-08 2010-07-06 Crucell Holland B.V. Chimeric adenoviruses
US6455314B1 (en) 1998-09-11 2002-09-24 Genvec, Inc. Alternatively targeted adenovirus
US7875450B2 (en) 1998-10-21 2011-01-25 The United States Of America As Represented By The Department Of Health And Human Services Virus-like particles for the induction of autoantibodies
US9567607B2 (en) 1998-11-05 2017-02-14 Trustees Of The University Of Pennsylvania Adeno-associated virus serotype I nucleic acid sequences, vectors and host cells containing same
US8637255B2 (en) 1998-11-05 2014-01-28 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype I nucleic acid sequences, vectors and host cells containing same
US9163260B2 (en) 1998-11-05 2015-10-20 The Trustees Of The University Of Pennsylvania Adeno-associated virus serotype I nucleic acid sequences, vectors and host cells containing same
US6491907B1 (en) 1998-11-10 2002-12-10 The University Of North Carolina At Chapel Hill Recombinant parvovirus vectors and method of making
WO2000029600A1 (fr) * 1998-11-19 2000-05-25 Georgetown University Systeme d'apport genique systemique de virus/ligands et de therapie genique
US6929946B1 (en) 1998-11-20 2005-08-16 Crucell Holland B.V. Gene delivery vectors provided with a tissue tropism for smooth muscle cells, and/or endothelial cells
US6913922B1 (en) 1999-05-18 2005-07-05 Crucell Holland B.V. Serotype of adenovirus and uses thereof
US7094398B1 (en) 1999-06-01 2006-08-22 University Of Washington Recombinant adenoviral vectors expressing chimeric fiber proteins for cell specific infection and genome integration
WO2000073478A3 (fr) * 1999-06-01 2001-07-05 Univ Washington Vecteurs adenoviraux recombinants pour l'infection specifique de cellules, l'integration de genomes et l'expression de proteines fibreuses chimeriques
WO2000073478A2 (fr) * 1999-06-01 2000-12-07 University Of Washington Vecteurs adenoviraux recombinants pour l'infection specifique de cellules, l'integration de genomes et l'expression de proteines fibreuses chimeriques
US7314912B1 (en) 1999-06-21 2008-01-01 Medigene Aktiengesellschaft AAv scleroprotein, production and use thereof
US7556965B2 (en) 1999-07-15 2009-07-07 Medigene Ag Structural protein of adeno-associated virus with modified antigenicity, its production and its use
US7968340B2 (en) 1999-07-15 2011-06-28 Medigene Ag Structural protein of adeno-associated virus with modified antigenicity, its production and its use
EP2060634A1 (fr) * 1999-07-15 2009-05-20 MediGene Aktiengesellschaft Protéine de structure d'un virus adéno-associé dotée d'une antigénéité modifiée, sa fabrication et son utilisation
US7252997B1 (en) 1999-07-15 2007-08-07 Medigene Ag Structural protein of adeno-associated virus with modified antigenicity, its production and its use
AU781397B2 (en) * 1999-07-15 2005-05-19 Medigene Aktiengesellschaft Structural protein of adeno-associated virus with modified antigenicity, its production and its use
WO2001005990A1 (fr) * 1999-07-15 2001-01-25 Medigene Aktiengesellschaft Proteine de structure d'un virus adeno-associe a antigeneite modifiee, sa production et son utilisation
WO2001005991A1 (fr) * 1999-07-19 2001-01-25 Medigene Aktiengesellschaft Proteine structurale de virus adeno-associe a proprietes chromatographiques modifiees, sa production et son utilisation
US7285381B1 (en) 1999-07-19 2007-10-23 Medigene Aktiengesellschaft Scleroprotein of an adeno-associated virus with modified chromatographic properties, the production thereof and use of the same
AU777885B2 (en) * 1999-07-19 2004-11-04 Medigene Aktiengesellschaft Scleroprotein of an adeno-associated virus with modified chromatographic properties, the production thereof and use of the same
WO2001059142A1 (fr) * 2000-02-09 2001-08-16 Medimmune, Inc. Therapie genique a anticorps avec vecteurs viraux adeno-associes
WO2001098514A3 (fr) * 2000-06-16 2002-05-10 Univ New Jersey Med Ciblage de cellules specifiques par des vecteurs viraux
WO2001098514A2 (fr) * 2000-06-16 2001-12-27 University Of Medicine And Dentistry Of New Jersey Ciblage de cellules specifiques par des vecteurs viraux
US9228205B2 (en) 2000-11-15 2016-01-05 Crucell Holland B.V. Complementing cell lines
US7647184B2 (en) 2001-08-27 2010-01-12 Hanall Pharmaceuticals, Co. Ltd High throughput directed evolution by rational mutagenesis
EP2363487A3 (fr) * 2001-12-21 2012-03-21 Medigene AG Bibliothèque de gènes structuraux modifiés ou de particules à capside modifiée utiles pour l'identification de clones viraux ayant un tropisme cellulaire désiré
WO2003054197A3 (fr) * 2001-12-21 2004-03-18 Medigene Ag Bibliotheque de genes structuraux modifies ou de particules modifiees par des capsides utiles pour l'identification de clones viraux par tropisme cellulaire desire
AU2008202032B2 (en) * 2001-12-21 2012-09-20 Medigene Ag A library of modified structural genes or capsid modified particles useful for the identification of viral clones with desired cell tropism
AU2002352261B2 (en) * 2001-12-21 2008-02-07 Medigene Ag A library of modified structural genes or capsid modified particles useful for the identification of viral clones with desired cell tropism
WO2004083441A2 (fr) * 2003-03-19 2004-09-30 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Bibliotheque peptidique aleatoire s'affichant sur des vecteurs aav
WO2004083441A3 (fr) * 2003-03-19 2005-05-12 Deutsches Krebsforsch Bibliotheque peptidique aleatoire s'affichant sur des vecteurs aav
US10046016B2 (en) 2003-06-30 2018-08-14 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US9233131B2 (en) 2003-06-30 2016-01-12 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US9441244B2 (en) 2003-06-30 2016-09-13 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US10214566B2 (en) 2003-06-30 2019-02-26 The Regents Of The University Of California Mutant adeno-associated virus virions and methods of use thereof
US7892809B2 (en) 2004-12-15 2011-02-22 The University Of North Carolina At Chapel Hill Chimeric vectors
US9012224B2 (en) 2004-12-15 2015-04-21 The University Of North Carolina At Chapel Hill Chimeric vectors
US9475845B2 (en) 2009-02-11 2016-10-25 The University Of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
US8889641B2 (en) 2009-02-11 2014-11-18 The University Of North Carolina At Chapel Hill Modified virus vectors and methods of making and using the same
US10494612B2 (en) 2010-10-06 2019-12-03 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9457103B2 (en) 2010-10-06 2016-10-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9458517B2 (en) 2011-04-22 2016-10-04 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US10202657B2 (en) 2011-04-22 2019-02-12 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9587282B2 (en) 2011-04-22 2017-03-07 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US10214785B2 (en) 2011-04-22 2019-02-26 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9193956B2 (en) 2011-04-22 2015-11-24 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US9856539B2 (en) 2011-04-22 2018-01-02 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US11236402B2 (en) 2011-04-22 2022-02-01 The Regents Of The University Of California Adeno-associated virus virions with variant capsid
US11136557B2 (en) 2013-05-31 2021-10-05 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
US11634691B2 (en) 2013-05-31 2023-04-25 The Regents Of The University Of California Compositions and methods of treatment
US11248214B2 (en) 2014-03-17 2022-02-15 Adverum Biotechnologies, Inc. Compositions and methods for enhanced gene expression in cone cells
US11021519B2 (en) 2015-03-02 2021-06-01 Adverum Biotechnologies, Inc. Compositions and methods for intravitreal delivery of polynucleotides to retinal cones
US10883117B2 (en) 2015-03-24 2021-01-05 The Regents Of The University Of California Adeno-associated virus variants and methods of use thereof
US11554180B2 (en) 2016-07-29 2023-01-17 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US11565001B2 (en) 2016-07-29 2023-01-31 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US11565000B2 (en) 2016-07-29 2023-01-31 The Regents Of The University Of California Adeno-associated virus virions with variant capsid and methods of use thereof
US11192925B2 (en) 2016-10-19 2021-12-07 Adverum Biotechnologies, Inc. Modified AAV capsids and uses thereof
US12030914B2 (en) 2016-10-19 2024-07-09 Adverum Biotechnologies, Inc. Modified AAV capsids and uses thereof
US11236360B2 (en) 2016-12-09 2022-02-01 Regents Of The University Of Minnesota Adeno-associated viruses engineered for selectable tropism
US11680249B2 (en) 2017-08-28 2023-06-20 The Regents Of The University Of California Adeno-associated virus capsid variants and methods of use thereof

Also Published As

Publication number Publication date
EP0927044A1 (fr) 1999-07-07
CA2251738A1 (fr) 1997-10-23
EP0927044A4 (fr) 1999-09-08
AU2678097A (en) 1997-11-07

Similar Documents

Publication Publication Date Title
EP0927044A1 (fr) Vecteurs viraux a cibles definies
EP0932418B1 (fr) Methode de therapie genique basee sur des virus adeno-associes de recombinaison
CA2176117C (fr) Production de titres eleves de vecteurs d'aav recombinants
US5939538A (en) Methods and compositions for inhibiting HIV infection of cells by cleaving HIV co-receptor RNA
US8802080B2 (en) Raav expression systems for genetic modification of specific capsid proteins
US20090148949A1 (en) rAAV Expression Systems and Methods of Use
US20010006955A1 (en) Method for recombinant adeno-associated virus-directed gene therapy
JPH06335392A (ja) Hiv阻害性アンチセンスおよび他のヌクレオチド配列を含有する発現構成体、レトロウイルスのベクターおよびそれを含有する組換えレトロウイルス
WO1995034639A9 (fr) Nouvelle enveloppe retrovirale et long segment terminal a repetitions (ltr) et particules de vecteur retroviral comprenant cette enveloppe et/ou le ltr
WO1995034639A1 (fr) Nouvelle enveloppe retrovirale et long segment terminal a repetitions (ltr) et particules de vecteur retroviral comprenant cette enveloppe et/ou le ltr
AU2004226961B2 (en) VP2-modified rAAV vector compositions and uses therefor
NZ300795A (en) Retroviral Plasmid Vectors (enhancer region of LTR replaced, primer binding site replaced or mutated), packaging/transduced cells, use for gene therapy
US5646034A (en) Increasing rAAV titer
CA2208519C (fr) Complexes de vecteurs viraux dotes d'adaptateurs a valence predefinie
US8529885B2 (en) AAV vectors for in vivo gene therapy of rheumatoid arthritis
EP1664315B1 (fr) Vecteurs aav pour therapie genique in vivo destinee a traiter la polyarthrite rhumatoide
US20020164583A1 (en) Targeting viral vectors to specific cells
US20020081711A1 (en) Novel genetic suppressor elements and methods of making the same
AU2010201278B2 (en) AAV vectors for in vivo gene therapy of rheumatoid arthritis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN YU AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2251738

Country of ref document: CA

Ref country code: CA

Ref document number: 2251738

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997918752

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97537427

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1997918752

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997918752

Country of ref document: EP