WO1997034013A1 - Chemotactic cytokine ii - Google Patents

Abstract

The invention relates to CCII polypeptides, polynucleotides encoding the polypeptides, methods for producing the polypeptides, in particular by expressing the polynucleotides, and agonists and antagonists of the polypeptides. The invention further relates to methods for utilizing such polynucleotides, polypeptides, agonists and antagonists for applications, which relate, in part, to research, diagnostic and clinical arts.

Description

CHEMOTACTIC CYTOKINE II

This invention relates, in part, to newly identified polynucleotides and polypeptides; variants and derivatives of the polynucleotides and polypeptides; processes for making the polynucleotides and the polypeptides, and their variants and derivatives; agonists and antagonists of the polypeptides; and uses of the polynucleotides, polypeptides, variants, derivatives, agonists and antagonists. In particular, in these and in other regards, the invention relates to polynucleotides and polypeptides of human Chemotactic cytokine II, sometimes hereinafter referred to as "CCII".

BACKGROUND OF THE INVENTION The cytokine family of proteins exhibits a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including polymorphonuclear cells and macrophages. Many cytokines have proinflammatory activity and are involved in multiple steps during inflammatory reactions. In addition to their involvement in inflammation, cytokines have been shown to exhibit other activities. For example, interleukin-8 (IL-8) promotes proliferation of keratinocytes.

In light of the diverse biological activities, it is not surprising that cytokines have been implicated in a number of physiological and disease conditions, including cell migration, for example, lymphocyte trafficking, wound healing, hematopoietic regulation and immunological reactions such as allergy, asthma and arthritis.

The SlOO family of calcium binding proteins has chemotactic activity for polymorphonuclear cells, mononuclear cells and neutrophils and are calcium binding proteins. The SlOO protein has been recently identified in cells of myeloid origin and consists of macrophage inhibitory factor-related protein (MRP-8) , MRP-14, chemotactic protein 10 (CP-10) and calgranulin C.

MRP-8 and MRP-14 are expressed in a cell lineage-specific manner. Alignment of individual sequences shows that there is overall conservation of structure within the family, a notable feature being the two calcium binding sites, which are the "EF hand" type. Sequences at both the NH₂- and COOH- terminal ends of MRP-8 and MRP-14 are relatively hydrophobic. An attractive hypothesis is that these regions of the molecule are buried until calcium binding brings about the conformational changes that cause their exposure, making them potentially available for interactions with other effector molecules. Because of the extended sequence of its COOH- terminal "tail" MRP-14 is the largest member of the SlOO family. (Hessian, P., et al. , J. Leuk. Bio.. 53:197-204 (1993) .

Each gene in the SlOO family is composed of three exons with one intron interrupting the protein-coding sequence between the two EF hands. The MRP-8 and MRP-14 genes are both localized to chromosome 1Q12-Q21 with an undefined distance between them (Dorin, J.R., et al., Nature. 326:614-617 (1987) and Lagasse, E. and Clere, R.G., Mol. Cell Biol.. 8:2402, 2410 (1988)). Two other SlOO family members 1882 (CAP ) and calcyclin/2A9 (CACY) also map to chromosome 1Q12-Q21 (Dorian, J.R. , et al., Genomics. 8:420-426 (1990). It is probably that co-segregation of these five genes on chromosome 1 may represent an SlOO family locus. However, this does not apply to all SlOO homologs.

MRP-8 and MRP-14 are restricted to cells of the monocytes/macrophage lineage, neutrophils, and under certain circumstance keratinocytes, suggesting that its expression is tightly regulated during differentiation (Hogg, N. , et al., Eur. J. Immunol.. 19:1053-1061 (1989)). Thus, monocytes and neutrophils in the circulation express MRP-8 and MRP-14, in contrast to other related cells such as lymphocytes, platelets, basophils and eosinophils which do not (Id. ) .

Resident tissue macrophages do not express MRP-8 and MRP-14, implying that differentiation of monocytes to macrophages is normally associated with loss of this molecule (Id. ) . Furthermore, immunohistochemical data show that at inflammatory sites MRP-8 and MRP-14 positive cells are associated with vessels but that the majority of monocytes already within the tissues at these sites have lost MRP-8 and MRP-14 expression (Id. ) . In keeping with these observations, tissue culture-matured monocytes down regulate this molecule (Zwadlo, G. , et al . , Clin. Exp. Immunol., 72:510-515

(1988) ) .

At sites of chronic inflammation in patients with diseases such as rheumatoid arthritis, sarcoidosis, tuberculosis or onchocerciasis macrophages express both MRP-8 and MRP-14 (Palmer, D.G. , et al . , Clin. Immunol. Immunopathol. , 45:17-28 (1987)) . In contrast, macrophages in acutely inflamed tissues may express only MRP-14 (Delabie, J., et al . , Clin. Exp. Immunol.. 81:123-126

(1990) ) . The expression of MRP-8 and MRP-14 by macrophages could be flecked exposure to tissue stimuli that either maintain expression or induce re-expression of the molecule (Palmer, D.G., et al., Clin. Immunol. Immunopathol. , 45:17-28 (1987)) .

In common with other members of the SlOO family, MRP-8 and MRP-14 are found predominately in a cytosolic location in both monocytes and neutrophils (Dale, I., et al . , Eur. J. Biochem.. 134:1-6 (1983)) . It is also possible that MRP-8 and MRP-14 can be expressed on the cell surface, although the majority of antibodies specific for these proteins do not react with circulating monocytes or neutrophils. There is also evidence that MRP-8 and MRP-14 exist extracellularly, however, neither protein has the signal peptide sequence for membrane translocation. Thus, MRP-8 and MRP-14 fall into the category of proteins, including interleukin-1 and basic fibroblast growth factor, that clearly have extracellular functions but about which little is known of their cellular release. Finally, MRP-8 and MRP-14 are found in the serum of patients with cystic fibrosis and other chronic inflammatory states such as rheumatoid arthritis and sarcoidosis (Bullock, S., et al . , Clin. Gene .. 21:336-341 (1982)) . MRP-14 also belongs to a novel subfamily of highly homologous calcium-binding proteins which includes SlOO alpha, SlOO beta, intestinal calcium-binding protein, Pll and calcyclin (2A9) .

CP-10 is one of the most potent chemotactic cytokines of the SlOO family. The CCII gene of the present invention has homology to murine CP-10, purified from supematants of activated murine spleen cells (Lackman, M. , et al . , J. Biol. Chem.. 267:7499 (1992)). An extracellular function of the murine CP-10 includes a potent chemotactic agent for murine and human polymorphonuclear cells (PMN) and murine monocytes and is involved in phagocyte recruitment during inflammatory reactions. CP-10 has maximal chemotactic activity for neutrophils at 10(-13) M. The 76 amino acid sequence revealed up to 55% sequence homology with SlOO, Ca⁺⁺- binding proteins. A combination of Western and Northern analyses identified CP-10 in murine peritoneal exudate PMN and macrophages, splenocytes, bone marrow cells, and WEHI-265 cells (all of myeloid origin) , but not in thymus, liver, lung, 3T3 fibroblasts, EL4 lymphoma cells, or bEND 3 brain endothelial cells, indicating cell- specific regulation of CP-10 expression. CP-10 has an apparent molecular weight of 10.3 kd and a complete sequence of 88 amino acids.

SlOO proteins are characterized by two calcium binding regions, which are strongly conserved and are separated by an 8 to 12 amino acid hinge region (Kligman, D., Trends Biochem. Sci.. 13:437 (1988)) . Although the hinge region length is conserved, the amino acid sequences are widely divergent. This divergence led to the hypothesis that the hinge region may concur functional specificity by interaction with the factor proteins (Id. ) .

SUMMARY OF THE INVENTION

Toward these ends, and others, it is an object of the present invention to provide polypeptides, inter alia, that have been identified as novel cytokines by homology between the amino acid sequence set out in Figure 1 (SEQ ID NO:2) and known amino acid sequences of other proteins such as CP-10 proteins.

It is a further object of the invention, moreover, to provide polynucleotides that encode CCII, particularly polynucleotides that encode the polypeptide herein designated CCII. In a particularly preferred embodiment of this aspect of the invention the polynucleotide comprises the region encoding human CCII in the sequence set Out in Figure 1 (SEQ ID N0:1) .

In accordance with this aspect of the present invention there is provided an isolated nucleic acid molecule encoding a mature polypeptide expressed by the human cDNA contained in ATCC Deposit No. 97405.

In accordance with this aspect of the invention there are provided isolated nucleic acid molecules encoding human CCII, including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically, diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and derivatives.

Among the particularly preferred embodiments of this aspect of the invention are naturally occurring allelic variants of human CCII.

It also is an object of the invention to provide CCII polypeptides, particularly human CCII polypeptides, that may be employed to treat tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasitic infections, psoriasis, asthma, allergy, to regulate hematopoiesis, to stimulate growth factor activity, to inhibit angiogenesis, to promote wound healing, to treat inflammatory disorders, to control cellular immune reactions, to treat malignant diseases, and to inhibit casein kinase to activity.

In accordance with this aspect of the invention there are provided novel polypeptides of human origin referred to herein as CCII as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing.

Among the particularly preferred embodiments of this aspect of the invention are variants of human CCII encoded by naturally occurring alleles of the human CCII gene.

It is another object of the invention to provide a process for producing the aforementioned polypeptides, polypeptide fragments, variants and derivatives, fragments of the variants and derivatives, and analogs of the foregoing. In a preferred embodiment of this aspect of the invention there are provided methods for producing the aforementioned CCII polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-derived human CCII-encoding polynucleotide under conditions for expression of human CCII in the host and then recovering the expressed polypeptide.

In accordance with another object the invention there are provided products, compositions, processes and methods that utilize the aforementioned polypeptides and polynucleotides for research, biological, clinical and therapeutic purposes, inter alia .

In accordance with certain preferred embodiments of this aspect of the invention, there are provided products, compositions and methods, inter alia, for, among other things: assessing CCII expression in cells by determining CCII polypeptides or CCII- encoding mRNA; stimulating migration of PMN's and stimulating cellular immune reactions, in vitro, ex vivo or in vivo by exposing cells to CCII polypeptides or polynucleotides as disclosed herein; assaying genetic variation and aberrations, such as defects, in CCII genes,- and administering a CCII polypeptide or polynucleotide to an organism to augment CCII function or remediate CCII dysfunction.

In accordance with certain preferred embodiments of this and other aspects of the invention there are provided probes that hybridize to human CCII sequences.

In certain additional preferred embodiments of this aspect of the invention there are provided antibodies against CCII polypeptides. In certain particularly preferred embodiments in this regard, the antibodies are highly selective for human CCII.

In accordance with another aspect of the present invention, there are provided CCII agonists. Among preferred agonists are molecules that mimic CCII, that bind to CCII-binding molecules or receptor molecules, and that elicit or augment CCII-induced responses. Also among preferred agonists are molecules that interact with CCII or CCII polypeptides, or with other modulators of CCII activities, and thereby potentiate or augment an effect of CCII or more than one effect of CCII.

In accordance with yet another aspect of the present invention, there are provided CCII antagonists. Among preferred antagonists are those which mimic CCII so as to bind to CCII receptor or binding molecules but not elicit a CCII-induced response or more than one CCII-induced response or which prevent expression of CCII. Also among preferred antagonists are molecules that bind to or interact with CCII so as to inhibit an effect of CCII or more than one effect of CCII. The agonists and antagonists may be used to mimic, augment or inhibit the action of CCII polypeptides.

Antagonists may be employed to treat certain auto-immune diseases, atherosclerosis, chronic inflammatory and infectious diseases, histamine and igE-mediated allergic reactions, pros aglandin-independent fever, bone marrow failure, cancers, silicosis, sarcoidosis, rheumatoid arthritis, shock, hyper- eoεinophilic syndrome and fibrosis in the asthmatic lung, cystic fibrosis, malignant diseases, psoriasis, diapedesis and urinary and kidney stones.

In a further aspect of the invention there are provided compositions comprising a CCII polynucleotide or a CCII polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise a CCII polynucleotide for expression of a CCII polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity of CCII.

Other objects, features, advantages and aspects of the present invention will become apparent to those of skill from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS The following drawings depict certain embodiments of the invention. They are illustrative only and do not limit the invention otherwise disclosed herein. Figure 1 shows the nucleotide and deduced amino acid sequence of human CCII.

Figure 2 shows the regions of similarity between amino acid sequences of CCII and murine CP-10 polypeptide (SEQ ID NO:9) .

Figure 3 shows structural and functional features of CCII deduced by the indicated techniques, as a function of amino acid sequence. GLOSSARY

The following illustrative explanations are provided to facilitate understanding of certain terms used frequently herein, particularly in the examples. The explanations are provided as a convenience and are not limitative of the invention.

DIGESTION of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes referred to herein are commercially available and their reaction conditions, cofactors and other requirements for use are known and routine to the skilled artisan.

For analytical purposes, typically, 1 μg of plasmid or DNA fragment is digested with about 2 units of enzyme in about 20 μl of reaction buffer. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in proportionately larger volumes.

Appropriate buffers and substrate amounts for particular restriction enzymes are described in standard laboratory manuals, such as those referenced below, and they are specified by commercial suppliers.

Incubation times of about 1 hour at 37°C are ordinarily used, but conditions may vary in accordance with standard procedures, the supplier's instructions and the particulars of the reaction. After digestion, reactions may be analyzed, and fragments may be purified by electrophoresis through an agarose or polyacrylamide gel, using well known methods that are routine for those skilled in the art.

GENETIC ELEMENT generally means a polynucleotide comprising a region that encodes a polypeptide or a region that regulates transcription or translation or other processes important to expression of the polypeptide in a host cell, or a polynucleotide comprising both a region that encodes a polypeptide and a region operably linked thereto that regulates expression.

Genetic elements may be comprised within a vector that replicates as an episomal element; that is, as a molecule physically independent of the host cell genome. They may be comprised within mini-chromosomes, such as those that arise during amplification of transfected DNA by methotrexate selection in eukaryotic cells. Genetic elements also may be comprised within a host cell genome; not in their natural state but, rather, following manipulation such as isolation, cloning and introduction into a host cell in the form of purified DNA or in a vector, among others.

ISOLATED means altered [from] "by the hand of man" from its natural state; i.e., that, if it occurs in nature, it has been changed or removed from its original environment, or both.

For example, a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not "isolated, " but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein. For example, with respect to polynucleotides, the term isolated means that it is separated from the chromosome and cell in which it naturally occurs.

As part of or following isolation, such polynucleotides can be joined to other polynucleotides, such as DNAs, for mutagenesis, to form fusion proteins, and for propagation or expression in a host, for instance. The isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment. Similarly, the polynucleotides and polypeptides may occur in a composition, such as a media formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and. therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.

LIGATION refers to the process of forming phosphodiester bonds between two or more polynucleotides, which most often are double stranded DNAs. Techniques for ligation are well known to the art and protocols for ligation are described in standard laboratory manuals and references, such as, for instance, Sambrook et al. , MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed. ; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989) and Maniatis et al., pg. 146, as cited below.

OLIGONUCLEOTIDE(S) refers to relatively short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can refer as well to single-or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others.

Oligonucleotides, such as single-stranded DNA probe oligonucleotides, often are synthesized by chemical methods, such as those implemented on automated oligonucleotide synthesizers. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.

Initially, chemically synthesized DNAs typically are obtained without a 5' phosphate. The 5' ends of such oligonucleotides are not substrates for phosphodiester bond formation by ligation reactions that employ DNA ligases typically used to form recombinant DNA molecules. Where ligation of such oligonucleotides is desired, a phosphate can be added by standard techniques, such as those that employ a kinase and ATP.

The 3' end of a chemically synthesized oligonucleotide generally has a free hydroxyl group and, in the presence of a ligase, such as T4 DNA ligase, readily will form a phosphodiester bond with a 5' phosphate of another polynucleotide, such as another oligonucleotide. As is well known, this reaction can be prevented selectively, where desired, by removing the 5' phosphates of the other polynucleotide(s) prior to ligation.

PLASMIDS generally are designated herein by a lower case p preceded and/or followed by capital letters and/or numbers, in accordance with standard naming conventions that are familiar to those of skill in the art. Starting plasmids disclosed herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids by routine application of well known, published procedures. Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art. Moreover, those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent to those of skill from the present disclosure.

POLYNUCLEOTIDE(S) generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single-and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. Inaddition, polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide.

As used herein, the term polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein.

It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia.

POLYPEPTIDES, as used herein, includes all polypeptides as described below. The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art. In this context, the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.

It will be appreciated that polypeptides, as is well known and as the term is used herein, generally are formed of the 20 naturally occurring amino acids, and that the amino acids in a polypeptide generally are joined to one another in a linear chain by peptide bonds between the alpha carboxyl and the alpha amino groups of adjacent, succeeding amino acids.

By convention, the sequence of amino acids in a chain usually, but not always, is written beginning (on the left and at the top) with the amino acid having a free alpha amino group. This amino acid is taken as the amino terminus of the polypeptide, also referred to as the N-terminus. Each successive amino acid then is listed in turn, ending with the amino acid having a free carboxyl group (at bottom and right) , which is taken as the carboxyl terminus of the polypeptide, also called the C-terminus.

Individual amino acids in a polypeptide commonly are referred to as amino acid residues, and as residues. Generally, the amino acids in a polypeptide are numbered beginning with the amino terminus and proceeding integer by integer and residue by residue to the carboxyl terminus. However, for polypeptides that first are synthesized in cells as precursors to a mature form, it also is common to begin numbering amino acids with the first residue of the mature form. Then, the upstream residues (i.e., those closer to the N-terminus) are assigned negative numbers counting back from residue one (the N-terminus of the mature form) to the N-terminus of the earliest precursor form. Other numbering schemes also have been employed, but less commonly. Notwithstanding the foregoing general characteristics, it will be appreciated that polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal amino acids, may be modified in a given polypeptide, either by natural processes, such as processing and other post- translational modifications, but also by chemical modification techniques which are well known to the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art. Among the known modifications which may be present in polypeptides of the present are, to name an illustrative few, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

Such modifications are well known to those of skill and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid • residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as, for instance PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993) . Many detailed reviews are available on this subject, such as, for example, those provided by Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York (1983); Seifter et al. , Analysis for protein modifications and nonprotein cofactors, Meth. Enzymol. 182: 626-646 (1990) and Rattan et al. , Protein Synthesis: Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci. 663: 48-62 (1992).

It will be appreciated, as is well known and as noted above, that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing event and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well.

Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well. For instance, the amino terminal residue of polypeptides made in E. coli, prior to proteolytic processing, almost invariably will be N-formylmethionine.

The modifications that occur in a polypeptide often will be a function of how it is made. For polypeptides made by expressing a cloned gene in a host, for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide amino acid sequence. For instance, as is well known, glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell. Insect cell often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to express efficiently mammalian proteins having native patterns of glycosylation, inter alia. Similar considerations apply to other modifications.

It will be appreciated that the same type of modification may be present in the same or varying degree at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications.

In general, as used herein, the term polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.

VARIANT(S) of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this sense are described below and elsewhere in the present disclosure in greater detail.

(1) A polynucleotide that differs in nucleotide sequence from another, reference polynucleotide. Generally, differences are limited so that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical.

As noted below, changes in the nucleotide sequence of the variant may be silent. That is, they may not alter the amino acids encoded by the polynucleotide. Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same amino acid sequence as the reference. Also as noted below, changes in the nucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.

(2) A polypeptide that differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many region, identical.

A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.

Among preferred variants are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacemen s, one for another, among the aliphatic amino acids Ala, Val, Leu and lie; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.

RECEPTOR MOLECULE, as used herein, refers to molecules which bind or interact specifically with CCII polypeptides of the present invention, including not only classic receptors, which are preferred, but also other molecules that specifically bind to or interact with polypeptides of the invention (which also may be referred to as "binding molecules" and "interaction molecules," respectively and as "CCII binding molecules" and "CCII interaction molecules. " Binding between polypeptides of the invention and such molecules, including receptor or binding or interaction molecules may be exclusive to polypeptides of the invention, which is very highly preferred, or it may be highly specific for polypeptides of the invention, which is highly preferred, or it may be highly specific to a group of proteins that includes polypeptides of the invention, which is preferred, or it may be specific to several groups of proteins at least one of which includes polypeptides of the invention.

Such molecules generally are proteins, which may be single or multichain proteins and multisubunit or multiprotein complexes, such as those of classic cell surface receptors, which are highly preferred in the invention. Receptor molecules also may be non¬ protein molecules that bind to or interact specifically with polypeptides of the invention.

Such molecules may occur in membranes, such as classic cell surface receptors, or they may occur intracellularly, in the cytosol, inside organelles, or in the surface of organelles, for instance. Among particularly preferred receptor molecules in this regard are membrane bound receptors, particularly cell membrane receptors, especially cell surface receptors. Also among preferred receptors are those that occur in the membranes of organelles, particularly nuclear membrane receptors and mitochondrial membrane receptors. Receptors also may be non-naturally occurring, such as antibodies and antibody-derived reagents that bind specifically to polypeptides of the invention.

DESCRIPTION OF THE INVENTION

The present invention relates to novel CCII polypeptides and polynucleotides, among other things, as described in greater detail below. In particular, the invention relates to polypeptides and polynucleotides of a novel human CCII, which is related by amino acid sequence homology to murine CP-10

The invention relates especially to CCII having the nucleotide and amino acid sequences set out in Figure 1 (SEQ ID NOS:l and 2) , and to the CCII nucleotide and amino acid sequences of the human cDNA in ATCC Deposit No. 97405. It will be appreciated that the nucleotide and amino acid sequences set out in Figure 1 (SEQ ID NOS:l and 2) were obtained by sequencing the human cDNA of the deposited clone. Hence, the sequence of the deposited clone is controlling as to any discrepancies between the two and any reference to the sequences of Figure 1 (SEQ ID NO:l) include reference to the sequence of the human cDNA of the deposited clone.

Polynucleotides

In accordance with one aspect of the present invention, there are provided isolated polynucleotides which encode the CCII polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) .

Using the information provided herein, such as the polynucleotide sequence set out in Figure 1 (SEQ ID NO:l) , a polynucleotide of the present invention encoding human CCII polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA from cells of a human fetal kidney as starting material.

Human CCII of the invention is structurally related to other proteins of the SP100 family, as shown by the results of sequencing the cDNA encoding human CCII in the deposited clone. The cDNA sequence thus obtained is set out in Figure 1 (SEQ ID NO:l) . It contains an open reading frame encoding a protein of about 98 amino acid residues with a deduced molecular weight of about 11471.30 Daltons. The protein exhibits greatest homology to murine CP-10 among known proteins. The amino acid residues of the CCII of Figure 1 (SEQ ID NO:2) have about 20.225 % identity and about 52.809 % similarity with the amino acid sequence of murine CP-10.

Polynucleotides of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof. The DNA may be double-stranded or single-stranded. Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.

A polynucleotide of the present invention may a naturally occurring sequence, such as that of a naturally occurring allelic variant, or it may have a sequence that does not occur in nature, such as a sequence that has been produced, for instance, by in vitro mutagenesiε techniques.

The coding sequence which encodes the polypeptide may be identical to the coding sequence of the polynucleotide shown in Figure l (SEQ ID NO:l) . It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptide of the DNA of Figure 1 (SEQ ID NO:l) .

Polynucleotides of the present invention which encode the polypeptide of Figure 1 (SEQ ID NO:2) may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing - including splicing and polyadenylation signals, for example -ribosome binding and stability of mRNA.

In accordance with the foregoing, the term "polynucleotide encoding a polypeptide" as used herein encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly the human CCII having the amino acid sequence set out in Figure 1 (SEQ ID NO:2) . The term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide, together with additional regions, that also may contain coding and/or non-coding sequences.

The present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) . A variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally. Such non-naturally occurring variants of the polynucleotide may be made by mutageneεis techniques, including those applied to polynucleotides, cells or organisms.

The present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure l (SEQ ID NO:2) . Further, the invention includes variants of such polynucleotides that encode a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) . Among variants in this regard are variants that differ from the aforementioned polynucleotides by nucleotide substitutions, deletions or additions. The substitutions, deletions or additions may involve one or more nucleotides. The variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non- conservative amino acid substitutions, deletions or additions.

Variants of the invention may have a sequence that occurs in nature or they may have a sequence that does not occur naturally. As herein above indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID N0:l) . As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides.

Among the particularly preferred embodiments of the invention in this regard are polynucleotides encoding polypeptides having the amino acid sequence of CCII set out in Figure l (SEQ ID NO:2) ; variants, analogs, derivatives and fragments thereof, and fragments of the variants, analogs and derivatives.

Further particularly preferred in this regard are polynucleotides encoding CCII variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments, which have the amino acid sequence of the CCII polypeptide of Figure 1 (SEQ ID NO:2) in which several, a few, 5 to 10, l to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the CCII. Also especially preferred in this regard are conservative substitutions. Most highly preferred are polynucleotides encoding polypeptides having the amino acid sequence of Figure 1 (SEQ ID N0:2) without substitutions.

Further preferred embodiments of the invention are polynucleotides that are more than 70% identical to a polynucleotide encoding the CCII polypeptide having the amino acid sequence set out in Figure l (SEQ ID NO:2) , and polynucleotides which are complementary to such polynucleotides. Alternatively, most highly preferred are polynucleotides that comprise a region that is at least 70% identical to a polynucleotide encoding the CCII polypeptide of the human cDNA of the deposited clone. In this regard, polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred. Furthermore, those with at least 97% are highly preferred among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly preferred, with at least 99% being the more preferred.

Also particularly preferred in this regard are polynucleotides encoding a polypeptide having the amino acid sequence of the CCII set out in Figure l (SEQ ID NO:2) . As set out elsewhere herein, the polynucleotide may encode the polypeptide in a continuous region or in a plurality of two or more discontinuous exons, and it may comprise additional regions as well, which are unrelated to the coding region or regions.

Most highly preferred in this regard are polynucleotides that comprise a region that are at least 70% identical to the CCII- encoding portion of the polynucleotide set out in Figure 1 (SEQ ID NO:l) . Alternatively, most highly preferred are polynucleotides that comprise a region that is at least 85% identical to the CCII- encoding portion of the human cDNA the deposited clone. Among such polynucleotides, those at least 90% identical to the same are particularly preferred, and, among these particularly preferred polynucleotides, those with at least 95% are especially preferred. Furthermore, those with at least 97% are highly preferred among those with at least 95% and among these those with at least 98% and at least 99% are particularly highly preferred, with at least 99% being the more preferred of these.

The present invention also includes polynucleotides in which the sequence encoding the mature polypeptide is fused in the same reading frame to additional sequences. Such sequences include signal sequences, which facilitate transport of the nascent protein into the endoplasmic reticulum, pro-sequences that are associated with inactive precursor forms of the polypeptide, which may facilitate trafficking of the protein in a cell or out of a cell or may improve persistence of the protein in a cell or in an extracellular compartment. Such sequences also may be added to facilitate production and purification, or to add additional functional domains, as discussed elsewhere herein. T h u s , polynucleotides of the invention may encode, in addition to a mature cytokine, particularly CCII, for example, a leader sequence, such as a signal peptide which functions as a secretory sequence for controlling transport of the polypeptide into the lumen of the endoplasmic reticulum. The leader sequence may be removed by the host cell, as is generally the case for signal peptides, yielding another precursor protein or the mature polypeptide. A precursor protein having a leader sequence often is called a preprotein.

The polynucleotides also may encode a polypeptide which is the mature protein plus additional amino or carboxyl-terminal amino acids, or amino acids interior to the mature polypeptide (when the mature form has more than one polypeptide chain, for instance) . Such sequences may play a role in processing of a protein from precursor to a mature form, may facilitate protein trafficking, may prolong or shorten protein half-life or may facilitate manipulation of a protein for assay or production, among other things. As generally is the case in situ, the additional amino acids may be processed away from the mature protein by cellular enzymes.

A precursor protein, having the mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide. When prosequences are removed such inactive precursors generally are activated. Some or all of the prosequences may be removed before activation. Generally, such precursors are called proproteins.

In sum, a polynucleotide of the present invention may encode a mature protein, a mature protein plus a leader sequence (which may be referred to as a preprotein) , a precursor of a mature protein having one or more prosequences which are not the leader sequences of a preprotein, or a preproprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.

A polynucleotide of the present invention may encode a mature or precursor pre-, pro- or prepropolypeptide as discussed above, among others, fused to additional amino acids, such as those which provide additional functionalities. Thus, for instance, the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, such as the tag provided in the vector pQE, among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci., USA 86: 821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Typically, it does not adversely affect protein structure or function, and it binds efficiently, selectively and tightly to metal chelate resins, particularly nickel chelate resins. For instance, as is well known, hexa-histidine tags often bind especially well to nickel-NTA resin, which is well known and readily available and can be obtained commercially from, for instance, Qiagen. Moreover, the histidine-metal interaction not only is stable to a variety of conditions useful to remove non- specifically bound material, but also the fusion polypeptide can be bound and removed under mild, non-denaturing conditions. The hexa-histidine tag can be fused most conveniently to the amino or the carboxyl terminus of the CCII polypeptide. A tag of the hexa- histidine type is particularly useful for bacterial expression.

Another useful marker sequence in certain other preferred embodiments is a hemagglutinin ("HA") tag, particularly when a mammalian cell is used for expression,- e.g., COS-7 cells. The HA tag corresponds to an epitope derived of influenza hemagglutinin protein, which has been described by Wilson et al., Cell 37: 767 (1984), for instance.

Deposited materials

A deposit containing a human CCII cDNA has been deposited with the American Type Culture Collection, as noted above. Also as noted above, the human cDNA deposit is referred to herein as "the deposited clone" or as "the cDNA of the deposited clone."

The deposited clone was deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, USA, on January 2, 1996 and assigned ATCC Deposit No. 97405.

The deposited material is a pBluescript SK (-) plasmid (Stratagene, La Jolla, CA) that contains the full length CCII cDNA, referred to as DNA plasmid 951112 upon deposit.

The deposit has been made under the terms of the Budapest Treaty on the international recognition of the deposit of micro¬ organisms for purposes of patent procedure. The strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. The deposit is provided merely as convenience to those of skill in the art and is not an admission that a deposit is required for enablement, such as that required under 35 U.S.C. §112.

The sequence of the polynucleotides contained in the deposited material, as well as the amino acid sequence of the polypeptide encoded thereby, are controlling in the event of any conflict with any description of sequences herein.

A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

Probes

The present invention further relates to polynucleotides that hybridize to the herein above-described chemokine sequences, particularly CCII sequences. Preferred in this regard are polynucleotides that have at least 70% identity to the sequences described herein above. Particularly preferred are sequences that have at least 90% identity. Especially preferred are sequences that have at least 95% identity. In this regard, the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.

Particularly preferred embodiments in this respect, moreover, are polynucleotides which hybridize to the above-described polynucleotides and encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the human cDNA of Figure 1 (SEQ ID NO:l) .

As discussed additionally herein regarding polynucleotide assays of the invention, for instance, a probe as discussed above, derived from the full length CCII cDNA, including the entire CCII cDNA of Figure 1 (SEQ ID NO:l), or the coding region of thereof, or any part thereof useful as a probe, may be used as a hybridization probe for cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding CCII and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the human CCII gene. Such probes generally will comprise at least 15 bases. Preferably, such probes will have at least 30 bases and may have at least 50 bases. Particularly preferred probes will have at least 30 bases and will have 50 bases or less.

Such probes may also be used to identify additional cDNA clones corresponding to a full length transcript and a genomic clone or clones that contain the complete human CCII gene including regulatory and promoter regions, exons, and introns.

For example, the coding region of the CCII gene may be isolated by screening using the known DNA sequence to synthesize an oligonucleotide probe. A labeled oligonucleotide having a sequence complementary to that of a gene of the present invention is used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease, as further discussed herein relating to polynucleotide assays, inter alia .

Polypeptides The present invention further relates to a human CCII polypeptide which has the deduced amino acid sequence of Figure 1 (SEQ ID NO:2) .

The invention also relates to fragments, analogs and derivatives of these polypeptides. The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure l (SEQ ID NO:2) , means a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain preferred embodiments it is a recombinant polypeptide.

The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID NO:2) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a εubstituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

Among the particularly preferred embodiments of the invention in this regard are polypeptides having the amino acid sequence of CCII set out in Figure 1 (SEQ ID NO:2), variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments. Alternatively, particularly preferred embodiments of the invention in this regard are polypeptides having the amino acid sequence of the CCII of the cDNA in the deposited clone, variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments.

Further particularly preferred in this regard are variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments, having the amino acid sequence of the CCII polypeptide of Figure 1 (SEQ ID NO:2) , in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the CCII. Also especially preferred in this regard are conservative substitutions. Most highly preferred are polypeptides having the amino acid sequence of Figure 1 (SEQ ID NO:2) without substitutions.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at leaεt 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.

Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full- length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to syntheεize full-length polynucleotideε of the present invention. As part of or following isolation, such polynucleotides can be joined to other polynucleotides, such as DNAs, for mutagenesiε, to form fusion proteins, and for propagation or expression in a host, for instance. The isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAε still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment. Similarly, the polynucleotides and polypeptides may occur in a composition, such as a media formulation, a solution for introduction into cells, a composition or solution for chemical or enzymatic reaction, and the like, which are not naturally compositions, and therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.

Fragments

Also among preferred embodiments of this aspect of the present invention are polypeptides comprising fragments of CCII, moεt particularly fragments of the CCII having the amino acid set out in Figure 1 (SEQ ID NO:2) , and fragments of variants and derivatives of the CCII of Figure 1 (SEQ ID NO:2) .

In this regard a fragment iε a polypeptide having an amino acid sequence that entirely is the same as part but not all of the amino acid sequence of the aforementioned CCII polypeptides and variants or derivatives thereof.

Such fragments may be "free-standing," i.e., not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region. When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region. However, several fragments may be comprised within a single larger polypeptide. For instance, certain preferred embodiments relate to a fragment of a CCII polypeptide of the present comprised within a precursor polypeptide designed for expression in a host and having heterologous pre and pro- polypeptide regions fused to the amino terminus of the CCII fragment and an additional region fused to the carboxyl terminus of the fragment. Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fuεion polypeptide or fuεion protein derived from CCII.

Among preferred fragmentε of CCII are fragments about 5-15, 10-20, 15-40, 25-50, 35-60, 50-75, 65-80, 65-90, 65-98, 50-98, 75- 98 and 90-98 amino acids long.

In this context about includeε the particularly recited range and rangeε larger or εmaller by εeveral, a few, 5, 4, 3, 2 or l amino acid at either extreme or at both extremeε. For inεtance, about at leaεt 65-98 amino acidε in this context means a polypeptide fragment of at least 65, at least 65 plus or minus several, a few, 5, 4, 3, 2 or 1 amino acid to at least 90 or at least 90 plus or minus several a few, 5, 4, 3, 2 or 1 amino acid residues, i.e., ranges a broad as at least 65 minus εeveral amino acids to at least 90 plus several amino acids to as narrow as at least 65 plus several amino acids to at least 90 minus several amino acids.

Highly, preferred in this regard are the recited ranges plus or minus as many as 5 amino acidε at either or at both extremes. Particularly highly preferred are the recited ranges means plus or minus as many as 3 amino acids at either or at both extremes. Especially particularly highly preferred are ranges plus or minus 1 amino acid at either or at both extremes. Most highly preferred of all in this regard are fragments at least 5-15, 10-20, 15-40, 25-50, 35-60, 50-75, 65-80, 65-90, 65-98, 50-98, 75-98, and 90-98 amino acids long are preferred.

Among especially preferred fragments of the invention are truncation mutants of CCII. Truncation mutants include CCII polypeptides having the amino acid sequence of Figure l (SEQ ID NO:2) , or of variants or derivatives thereof, except for deletion of a continuous series of residueε (that is, a continuous region, part or portion) that includes the amino terminus, or a continuous serieε of reεidueε that includeε the carboxyl terminuε or, as in double truncation mutants, deletion of two continuous serieε of reεidueε, one including the amino terminus and one including the carboxyl terminus. Fragmentε having the εize ranges set out about also are preferred embodiments of truncation fragments, which are especially preferred among fragments generally.

Also preferred in this aspect of the invention are fragments characterized by structural or functional attributes of CCII. Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions") , beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions") , coil and coil-forming regions ("coil-regions") , hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of CCII.

Certain preferred regions in these regards are εet out in Figure 3, and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure l (SEQ ID NO:2) . As set out in Figure 3, such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions and coil-regions, Chou-Fasman alpha- regions, beta-regions and turn-regions, Kyte-Doolittle hydrophilic regions and hydrophilic regions, Eisenberg alpha and beta amphipathic regions, Karplus-Schulz flexible regionε, Emini εurface-forming regions and Jameson-Wolf high antigenic index regionε.

Among highly preferred fragmentε in thiε regard are thoεe that compriεe regionε of CCII that combine several structural features, such as several of the features set out above. In this regard, the regions defined by the residues about 20 to about 40, expecially 25 to 35, and about 50 to about 65, especially 56 to 62 and about 65 to about 75, especially 66-70 and about 85 to about 98 of Figure 1 (SEQ ID NO:2) , which all are characterized by amino acid compoεitionε highly characteristic of turn-regions, hydrophilic regions, flexible-regions, surface-forming regions, and high antigenic index-regionε, are eεpecially highly preferred regionε. Such regions may be comprised within a larger polypeptide or may be by themselves a preferred fragment of the present invention, as diεcuεεed above. It will be appreciated that the term "about" aε used in this paragraph has the meaning set out above regarding fragments in general.

Further preferred regions are those that mediate activities of CCII. Most highly preferred in this regard are fragments that have a chemical, biological or other activity of CCII, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Highly preferred in this regard are fragments that contain regions that are homologs in sequence, or in position, or in both sequence and to active regions of related polypeptides, such as the related polypeptide set out in Figure 2 (SEQ ID NO:9) . Among particularly preferred fragments in these regards are truncation mutants, as discusεed above.

It will be appreciated that the invention also relates to, among others, polynucleotides encoding the aforementioned fragments, polynucleotides that hybridize to polynucleotides encoding the fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode the fragments. In these regards, preferred polynucleotides are those that correspond to the preferred fragments, as discuεεed above.

Vectorε, hoεt cellε, expression

The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention. For instance, polynucleotides may be introduced into host cellε uεing well known techniques of infection, transduction, transfection, transvection and tranεformation. The polynucleotideε may be introduced alone or with other polynucleotideε. Such other polynucleotideε may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.

Thus, for instance, polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for co- tranεfection and εelection in, for inεtance, mammalian cellε. In this case the polynucleotides generally will be εtably incorporated into the hoεt cell genome.

Alternatively, the polynucleotideε may be joined to a vector containing a εelectable marker for propagation in a hoεt. The vector construct may be introduced into host cells by the aforementioned techniques. Generally, a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. Electroporation also may be used to introduce polynucleotides into a host. If the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells. A wide variety of techniques suitable for making polynucleotides and for introducing polynucleotides into cells in accordance with this aspect of the invention are well known and routine to those of skill in the art. Such techniques are reviewed at length in Sambrook et al. cited above, which is illuεtrative of the many laboratory manualε that detail these techniques. I n accordance with this aspect of the invention the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double-stranded RNA or DNA viral vector. Such vectors may be introduced into cells as polynucleotideε, preferably DNA, by well known techniques for introducing DNA and RNA into cells. The vectors, in the case of phage and viral vectors also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction. Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.

Preferred among vectors, in certain respectε, are thoεe for expreεεion of polynucleotides and polypeptides of the present invention. Generally, such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expresεed. Appropriate trans-acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.

In certain preferred embodiments in this regard, the vectors provide for specific expression. Such specific expresεion may be inducible expression or expression only in certain types of cells or both inducible and cell-specific. Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives. A variety of vectors suitable to this aspect of the invention, including constitutive and inducible expresεion vectors for uεe in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art.

The engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, εelecting transformants or amplifying geneε. Culture conditionε, εuch as temperature, pH and the like, previously used with the host cell selected for expresεion generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art.

A great variety of expresεion vectors can be used to expresε a polypeptide of the invention. Such vectorε include chromoεomal, episomal and virus-derived vectors e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elementε, from viruεeε εuch aε baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruseε, and vectorε derived from combinations thereof, such aε those derived from plasmid and bacteriophage genetic elements, such as coεmids and phagemids, all may be uεed for expreεsion in accordance with this aspect of the present invention. Generally, any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be uεed for expreεεion in thiε regard.

The appropriate DNA εequence may be inεerted into the vector by any of a variety of well-known and routine techniqueε. In general, a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA ligase. Procedures for restriction and ligation that can be used to this end are well known and routine to those of skill. Suitable procedures in this regard, and for constructing expression vectors using alternative techniqueε, which also are well known and routine to those skill, are set forth in great detail in Sambrook et al. cited elsewhere herein.

The DNA sequence in the expresεion vector iε operatively linked to appropriate expression control sequence(s), including, for instance, a promoter to direct mRNA transcription. Repreεentativeε of such promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoterε and promoters of retroviral LTRs, to name juεt a few of the well-known promoterε. It will be understood that numerous promoters not mentioned are suitable for use in thiε aεpect of the invention are well known and readily may be employed by those of skill in the manner illustrated by the discussion and the examples herein.

In general, expression constructs will contain sites for transcription initiation and termination, and, in the transcribed region, a ribosome binding εite for tranεlation. The coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.

In addition, the constructε may contain control regions that regulate as well as engender expression. Generally, in accordance with many commonly practiced procedures, such regions will operate by controlling transcription, such as represεor binding siteε and enhancers, among others.

Vectors for propagation and expreεεion generally will include selectable markerε. Such markers alεo may be εuitable for amplification or the vectorε may contain additional markers for this purpose. In thiε regard, the expreεsion vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells. Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline or ampicillin resistance genes for culturing E. coli and other bacteria.

The vector containing the appropriate DNA sequence aε described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide. Representative examples of appropriate hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells,- fungal cells, such as yeast cells,- insect cells such as Drosophila S2 and Spodoptera Sf9 cells,- animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for of a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aεpect of the preεent invention.

More particularly, the present invention also includes recombinant constructs, such as expression constructs, comprising one or more of the sequences described above. The constructs comprise a vector, such as a plasmid or viral vector, into which εuch a sequence of the invention has been inserted. The sequence may be inserted in a forward or reverse orientation. In certain preferred embodiments in this regard, the conεtruct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectorε and promoterε are known to thoεe of εkill in the art, and there are many commercially available vectorε suitable for use in the present invention.

The following vectors, which are commercially available, are provided by way of example. Among vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen,- pBS vectorε, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors are listed solely by way of illustration of the many commercially available and well known vectors that are available to those of εkill in the art for uεe in accordance with thiε aεpect of the present invention. It will be appreciated that any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expresεion of a polynucleotide or polypeptide of the invention in a hoεt may be ^■ used in this aspect of the invention.

Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferaεe ("cat") tranεcription unit, downεtream of reεtriction εite or εites for introducing a candidate promoter fragment; i.e., a fragment that may contain a promoter. As is well known, introduction into the vector of a promoter-containing fragment at the reεtriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT asεayε. Vectorε εuitable to thiε end are well known and readily available. Two such vectorε are pKK232-8 and pCM7. Thus, promoters for expression of polynucleotides of the present invention include not only well known and readily available promoters, but also promoters that readily may be obtained by the foregoing technique, using a reporter gene.

Among known bacterial promoters εuitable for expression of polynucleotides and polypeptides in accordance with the present invention are the E. coli lad and lacZ and promoters, the T3 and T7 promoters, the gpt promoter, the lambda PR, PL promoters and the trp promoter. Among known eukaryotic promoters suitable in this regard are the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV") , and metallothionein promoters, such as the mouse metallothionein-I promoter.

Selection of appropriate vectors and promoters for expression in a host cell is a well known procedure and the requisite techniques for expression vector construction, introduction of the vector into the host and expression in the host are routine skillε in the art.

The preεent invention alεo relateε to host cells containing the above-described constructs discussed above. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.

Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methodε. Such methods are described in many standard laboratory manuals, such as Davis et al. BASIC METHODS IN MOLECULAR BIOLOGY, (1986) .

Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers. Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructε of the preεent invention. Appropriate cloning and expreεεion vectorε for use with prokaryotic and eukaryotic hosts are described by Sambrook et al. , MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Presε, Cold Spring Harbor, N.Y. (1989) .

Generally, recombinant expreεεion vectorε will include originε of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector. Among suitable promoters are those derived from the genes that encode glycolytic enzymes εuch as 3- phoεphoglycerate kinaεe ("PGK"), a-factor, acid phoεphataεe, and heat εhock proteins, among others. Selectable markerε include the ampicillin resistance gene of E. coli and the trpl gene of S. cerevisiae.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryoteε may be increased by inserting an enhancer sequence into the vector. Enhancerε are cis- acting elementε of DNA, uεually about from 10 to 300 bp that act to increaεe tranεcriptional activity of a promoter in a given hoεt cell-type. Examples of enhancerε include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Polynucleotides of the invention, encoding the heterologous εtructural sequence of a polypeptide of the invention generally will be inserted into the vector uεing εtandard techniques so that it is operably linked to the promoter for expresεion. The polynucleotide will be poεitioned εo that the tranεcription start site is located appropriately 5' to a ribosome binding εite. The riboεome binding εite will be 5' to the AUG that initiateε tranεlation of the polypeptide to be expreεsed. Generally, there will be no other open reading frames that begin with an initiation codon, usually AUG, and lie between the ribosome binding site and the initiating AUG. Also, generally, there will be a translation stop codon at the end of the polypeptide and there will be a polyadenylation signal and a transcription termination signal appropriately disposed at the 3' end of the transcribed region.

For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the expresεed polypeptide. The signals may be endogenous to the polypeptide or they may be heterologous signals.

The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion εignalε but alεo additional heterologouε functional regionε. Thuε, for inεtance, a region of additional amino acidε, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persiεtence in the hoεt cell, during purification or during εubsequent handling and storage. Also, region also may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among otherε, are familiar and routine techniqueε in the art.

Suitable prokaryotic hosts for propagation, maintenance or expresεion of polynucleotides and polypeptides in accordance with the invention include Escherichia coli, Bacillus subtilis and Salmonella typhimurium. Various species of Pseudomonaε, Streptomyces, and Staphylococcus are suitable hostε in thiε regard. Moreover, many other hosts also known to those of skill may be employed in thiε regard.

Aε a representative but non-limiting example, useful expresεion vectors for bacterial use can comprise a εelectable marker and bacterial origin of replication derived from commercially available plaεmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) . Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) . These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expresεed. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, where the selected promoter is inducible it is induced by appropriate means (e.g. , temperature shift or exposure to chemical inducer) and cellε are cultured for an additional period.

Cellε typically then are harvested by centrifugation, disrupted by physical or chemical meanε, and the resulting crude extract retained for further purification.

Microbial cells employed in expresεion of proteinε can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.

Various mammalian cell culture systems can be employed for expresεion, aε well. Exampleε of mammalian expression syεtems include the COS-7 lines of monkey kidney fibroblast, described in Gluzman et al., Cell 23: 175 (1981). Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines.

Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necesεary ribosome binding siteε, polyadenylation sites, splice donor and acceptor siteε, transcriptional termination sequences, and 5' flanking non-transcribed sequenceε that are necessary for expresεion. In certain preferred embodimentε in thiε regard DNA sequences derived from the SV40 splice sites, and the SV40 polyadenylation sites are used for required non-transcribed genetic elements of these types.

The CCII polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification. Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.

Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, inεect and mammalian cellε. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non- glycoεylated. In addition, polypeptideε of the invention may alεo include an initial modified methionine reεidue, in εome caεeε as a result of host-mediated processeε.

CCII polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties CCII. Additional applications relate to diagnosiε and to treatment of diεorders of cellε, tiεεues and organisms. These aspects of the invention are illustrated further by the following discuεεion.

Polynucleotide assays

This invention is also related to the use of the CCII polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of CCII associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a diseaεe or susceptibility to a disease which results from under-expression over-expression or altered expression of CCII.

Individuals carrying mutations in the human CCII gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis. PCR (Saiki et al. , Nature, 324: 163-166 (1986)) . RNA or cDNA may alεo be uεed in the same ways. As an example, PCR primers complementary to the nucleic acid encoding CCII can be used to identify and analyze CCII expression and mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled CCII RNA or alternatively, radiolabeled CCII antisense DNA sequences. Perfectly matched sequenceε can be diεtinguiεhed from mismatched duplexeε by RNase A digestion or by differences in melting temperatures.

Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing. In addition, cloned DNA segmentε may be employed aε probeε to detect specific DNA segmentε. The εensitivity of such methodε can be greatly enhanced by appropriate uεe of PCR or another amplification method. For example, a sequencing primer is used with double- stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and inεertionε can be viεualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230: 1242 (1985)) .

Sequence changes at specific locations alεo may be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al., Proc. Natl. Acad. Sci., USA, 85: 4397-4401 (1985)).

Thus, the detection of a specific DNA sequence may be achieved by methods εuch as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphismε ("RFLP") and Southern blotting of genomic DNA.

In addition to more conventional gel-electrophoreεiε and DNA εequencing, mutations also can be detected by in situ analysiε.

Chromosome assayε

The sequences of the present invention are alεo valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular siteε on the chromosome. Few chromosome marking reagents based on actual εequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention iε an important first step in correlating those sequences with genes associated with disease.

In certain preferred embodiments in thiε regard, the cDNA herein diεclosed is used to clone genomic DNA of a CCII gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA the is used for in situ chromosome mapping using well known techniques for this purpose. Typically, in accordance with routine procedures for chromosome mapping, εome trial and error may be necessary to identify a genomic probe that gives a good in situ hybridization signal.

In some cases, in addition, sequences can be mapped to chromosomes by preparing PCR primerε (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragmen .

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Uεing the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA librarieε.

Fluoreεcence in εitu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60. For a review of this technique, see Verma et al. , HUMAN CHROMOSOMES: A MANUAL OF BASIC TECHNIQUES, Pergamon Press, New York (1988) . Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, MENDELIAN INHERITANCE IN MAN, available on line through Johns Hopkins University, Welch Medical Library. The relationship between genes and diseaseε that have been mapped to the same chromosomal region are then identified through linkage analysiε (coinheritance of physically adjacent genes) .

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the diseaεe.

With current reεolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region asεociated with the disease could be one of between 50 and 500 potential causative genes. (This asεumes l megabase mapping resolution and one gene per 20 kb) .

Polypeptide aεεayε

The preεent invention alεo relates to a diagnostic assays such aε quantitative and diagnoεtic asεayε for detecting levels of CCII protein in cells and tisεueε, including determination of normal and abnormal levelε. Thuε, for instance, a diagnostic assay in accordance with the invention for detecting over-expression of CCII protein compared to normal control tissue samples may be used to detect the presence of an immune disorder, for example. Assay techniques that can be used to determine levels of a protein, εuch aε an CCII protein of the preεent invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding asεayε, Weεtera Blot analysis and ELISA asεayε. Among theεe ELISAs frequently are preferred. An ELISA assay initially comprises preparing an antibody specific to CCII, preferably a monoclonal antibody. In addition a reporter antibody generally is prepared which binds to the monoclonal antibody. The reporter antibody is attached a detectable reagent such aε radioactive, fluoreεcent or enzymatic reagent, in this example horseradish peroxidase enzyme. To carry out an ELISA a sample is removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any CCII proteins attached to the polystyrene dish. Unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase iε placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to CCII. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a colorimetric substrate are then added to the dish. Immobilized peroxidase, linked to CCII through the primary and secondary antibodies, produces a colored reaction product. The amount of color developed in a given time period indicates the amount of CCII protein present in the sample. Quantitative results typically are obtained by reference to a standard curve.

A competition asεay may be employed wherein antibodieε εpecific to CCII attached to a εolid support and labeled CCII and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of CCII in the sample.

Immunoassays and reagents

The polypeptides, their fragments or other derivatives, or analogs thereof, or cellε expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, aε well as Fab fragments, or the product of an Fab expresεion library. Variouε procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the preεent invention can be obtained by direct injection of the polypeptideε into an animal or by adminiεtering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itεelf. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptideε. Such antibodies can then be used to isolate the polypeptide from tissue expresεing that polypeptide.

For preparation of monoclonal antibodieε, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C. , Nature 256: 495-497 (1975), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today 4: 72 (1983) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., pg. 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Lisε, Inc. (1985) .

Techniqueε deεcribed for the production of single chain antibodies (U.S. Patent No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice, or other organiεmε εuch aε other mammals, may be used to expresε humanized antibodieε to immunogenic polypeptide products of this invention.

The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromatography.

Thus, among others, the chemotactic cellular immune activitieε of CCII iε useful to treat tumors, chronic infections, leukemia, T-cell mediated auto-immune diseaεes, parasitic infections, psoriasiε, aεthma, allergy, to regulate hematopoieεiε, to εtimulate growth factor activity, to inhibit angiogeneεiε, to promote wound healing, to treat inflammatory diεorderε, to control cellular immune reactions, to treat malignant diseases, and to inhibit casein kinase to activity.

More εpecifically, CCII polypeptideε may be employed to inhibit bone marrow stem cell colony formation as adjunct protective treatment during cancer chemotherapy and for leukemia.

CCII polypeptides may also be employed to inhibit epidermal keratinocyte proliferation for treatment of psoriaεiε, which iε characterized by keratinocyte hyper-proliferation.

CCII polypeptides may also be employed to treat solid tumors by stimulating the invasion and activation of host defense cells, e.g., cytotoxic T cells and macrophages and by inhibiting the angiogenesis of tumorε. They may also be employed to enhance host defenses against resiεtant chronic and acute infections, for example, mycobacterial infections via the attraction and activation of microbicidal leukocytes.

CCII polypeptides may also be employed to inhibit T cell proliferation by the inhibition of IL-2 biosynthesis for the treatment of T-cell mediated auto-immune diseaseε and lymphocytic leukemiaε.

CCII polypeptides may also be employed to stimulate wound healing, both via the recruitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF0-mediated fibrosis. In this same manner, l may also be employed to treat other fibrotic disorderε, including liver cirrhosis, osteoarthritis and pulmonary fibroεis.

CCII polypeptides of the present invention may also be employed as cytostatic agents for antibacterial and antimicrobial functions.

They may also be employed to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells, for example, to release mature leukocyteε from the bone marrow following chemotherapy.

In theεe regardε, CCII polypeptides are preferred, particularly the CCII having the amino acid sequence set out in Figure 1 (SEQ ID N0:2) .

Aε εet out further below, these and other activities and properties of the CCII polynucleotides and polypeptides of the invention have various applications and uses in numerous fields including applications involving chemotaxis and cellular immune reactions.

CCII binding molecules and asεayε

This invention also provides a method for identification of molecules, such as receptor molecules, that bind CCII. Genes encoding proteins that bind CCII, such as receptor proteins, can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan et al., Current Protocols in Immunology 1(2): Chapter 5 (1991) .

For instance, expression cloning may be employed for this purpose. To this end polyadenylated RNA is prepared from a cell responsive to CCII, a cDNA library is created from this RNA, the library is divided into pools and the pools are transfected individually into cells that are not responsive to CCII. The transfected cells then are exposed to labeled CCII. (CCII can be labeled by a variety of well-known techniques including standard methodε of radio-iodination or inclusion of a recognition site for a site-specific protein kinase.) Following exposure, the cellε are fixed and binding of CCII is determined. These procedures conveniently are carried out on glasε εlideε.

Pools are identified of cDNA that produced CCII-binding cells. Sub-pools are prepared from these positives, transfected into host cells and screened as described above. Using an iterative sub- pooling and re-screening process, one or more single clones that encode the putative binding molecule, such as a receptor molecule, can be isolated.

Alternatively a labeled ligand can be photoaffinity linked to a cell extract, such as a membrane or a membrane extract, prepared from cells that express a molecule that it binds, such as a receptor molecule. Cross-linked material is resolved by polyacrylamide gel electrophoresiε ("PAGE") and expoεed to X-ray film. The labeled complex containing the ligand-receptor can be exciεed, resolved into peptide fragmentε, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing can be used to design unique or degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding the putative receptor molecule.

Polypeptides of the invention also can be used to asεeεs CCII- binding capacity of CCII binding molecules, such as receptor molecules, in cells or in cell-free preparations.

Agonists and antagonists - assayε and molecules

The invention alεo provideε a method of screening compounds to identify those which enhance or block the action of CCII on cells, εuch as its interaction with CCII-binding molecules such as receptor molecules. An agonist is a compound which increaεeε the natural biological functions of CCII or which functions in a manner similar to CCII, while antagonists decrease or eliminate such functions.

For example, a cellular compartment, such as a membrane or a preparation thereof, such as a membrane-preparation, may be prepared from a cell that expresεes a molecule that binds CCII, such as a molecule of a signaling or regulatory pathway modulated by CCII. The preparation is incubated with labeled CCII in the absence or the presence of a candidate molecule which may be a CCII agonist or antagonist. The ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand. Molecules which bind gratuitously, i.e., without inducing the effects of CCII on binding the CCII binding molecule, are most likely to be good antagonists. Molecules that bind well and elicit effects that are the same as or closely related to CCII are agonists.

CCII-like effects of potential agonists and antagonists may by measured, for instance, by determining activity of a second messenger syεtem following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of CCII or molecules that elicit the same effects aε CCII. Second meεsenger syεtems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phoεphoinositide hydrolysiε second mesεenger εyεtemε.

Another example of an assay for CCII antagonists is a competitive asεay that combines CCII and a potential antagonist with membrane-bound CCII receptor molecules or recombinant CCII receptor molecules under appropriate conditionε for a competitive inhibition assay. CCII can be labeled, such as by radioactivity, such that the number of CCII molecules bound to a receptor molecule can be determined accurately to asεess the effectiveness of the potential antagonist.

Potential antagonists include small organic moleculeε, peptideε, polypeptideε and antibodieε that bind to a polypeptide of the invention and thereby inhibit or extinguiεh its activity. Potential antagonistε alεo may be εmall organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the εame εiteε on a binding molecule, εuch as a receptor molecule, without inducing CCII-induced activities, thereby preventing the action of CCII by excluding CCII from binding.

Potential antagonists include a small molecule which binds to and occupies the binding site of the polypeptide thereby preventing binding to cellular binding molecules, such as receptor molecules, such that normal biological activity is prevented. Examples of small moleculeε include but are not limited to small organic molecules, peptides or peptide-like molecules.

Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discuεεed, for example, in - Okano, J. Neurochem. 56: 560 (1991); OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Preεε, Boca Raton, FL (1988) . Triple helix formation iε discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al. , Science 251: 1360 (1991) . The methods are based on binding of a polynucleotide to a complementary DNA or RNA. For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 baεe pairε in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of CCII. The antisenεe RNA oligonucleotide hybridizeε to the mRNA in vivo and blocks translation of the mRNA molecule into CCII polypeptide. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of CCII.

The antagonistε may be employed in a compoεition with a pharmaceutically acceptable carrier, e.g., aε hereinafter described.

The antagonists may be employed for instance to treat certain auto-immune diseases, atherosclerosis, chronic inflammatory and infectious diseaseε, histamine and IgE-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, cancers, silicoεiε, sarcoidosis, rheumatoid arthritis, shock, hyper- eosinophilic syndrome and fibrosis in the asthmatic lung, cystic fibrosis, malignant diseases, psoriasis, diapedesis and urinary and kidney stoneε.

Compoεitions

The invention also relates to compositionε compriεing the polynucleotide or the polypeptides discussed above or the agonists or antagonists. Thus, the polypeptides of the preεent invention may be employed in combination with a non-εterile or εterile carrier or carrierε for uεe with cellε, tiεsues or organisms, such aε a pharmaceutical carrier εuitable for adminiεtration to a εubject. Such compoεitions comprise, for instance, a media additive or a therapeutically effective amount of a polypeptide of the invention and a pharmaceutically acceptable carrier or excipient. Such carrierε may include, but are not limited to, εaline, buffered εaline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration.

Kits

The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compoεitions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.

Administration

Polypeptides of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.

The pharmaceutical compositionε may be administered in any effective, convenient manner including, for instance, administration by topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneouε, intranasal or intradermal routes among others.

The pharmaceutical compositions generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications. In general, the compositions are administered in an amount of at least about 10 μg/kg body weight. In most caseε they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most caseε, dose is from about 10 μg/kg to about 1 mg/kg body weight, daily. It will be appreciated that optimum dosage will be determined by standard methodε for each treatment modality and indication, taking into account the indication, its severity, route of administration, complicating conditions and the like.

Gene therapy

The CCII polynucleotides, polypeptides, agonistε and antagonists that are polypeptideε may be employed in accordance with the present invention by expression of such polypeptideε in vivo, in treatment modalities often referred to as "gene therapy."

Thus, for example, cells from a patient may be engineered with a polynucleotide, such as a DNA or RNA, encoding a polypeptide ex vivo, and the engineered cells then can be provided to a patient to be treated with the polypeptide. For example, cells may be engineered ex vivo by the uεe of a retroviral plaεmid vector containing RNA encoding a polypeptide of the present invention. Such methods are well-known in the art and their use in the present invention will be apparent from the teachings herein.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by procedures known in the art. For example, a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above. The retroviral expression construct then may be isolated and introduced into a packaging cell iε transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention εuch that the packaging cell now produceε infectiouε viral particleε containing the gene of interest. These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention.

Retroviruseε from which the retroviral plaεmid vectorε herein above mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosiε viruε, retroviruεeε such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis viruε, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

Such vectors well include one or more promoters for expressing the polypeptide. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter,- and the human cytomegalovirus (CMV) promoter described in Miller et al., Biotechniques 7: 980-990 (1989), or any other promoter (e.g., cellular promoterε εuch aε eukaryotic cellular promoters including, but not limited to, the histone, RNA polymerase III, and β-actin promoters) . Other viral promoters which may be employed include, but are not limited to, adenoviruε promoterε, thymidine kinaεe (TK) promoterε, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention will be placed under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such aε the adenoviral major late promoter; or heterologouε promoterε, εuch as the cytomegalovirus (CMV) promoter,- the respiratory syncytial viruε (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter,- heat shock promoters,- the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs herein above described) ,- the β-actin promoter,- and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.

The retroviral plasmid vector iε employed to tranεduce packaging cell lines to form producer cell lines. Exampleε of packaging cellε which may be tranεfected include, but are not limited to, the PE501, PA317, Y-2, Y-AM, PA12, T19-14X, VT-19-17- H2, YCRE, YCRIP, GP+E-86, GP+envAml2, and DAN cell lineε aε deεcribed in Miller, A., Human Gene Therapy l: 5-14 (1990) . The vector may be transduced into the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP04 precipitation. In one alternative, the retroviral plaεmid vector may be encapεulated into a liposome, or coupled to a lipid, and then administered to a host.

The producer cell line will generate infectious retroviral vector particles, which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed to tranεduce eukaryotic cellε, either in vitro or in vivo. The tranεduced eukaryotic cellε will expreεε the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblaεtε, myoblaεts, keratinocytes, endothelial cellε, and bronchial epithelial cellε. EXAMPLES

The present invention is further described by the following examples. The exampleε are provided solely to illustrate the invention by reference to specific embodiments. These exemplificationε, while illuεtrating certain εpecific aεpectε of the invention, do not portray the limitations or circumscribe the εcope of the diεcloεed invention.

Certain termε uεed herein are explained in the foregoing gloεεary.

All exampleε were carried out uεing εtandard techniqueε, which are well known and routine to those of skill in the art, except where otherwise deεcribed in detail. Routine molecular biology techniqueε of the following exampleε can be carried out as described in standard laboratory manualε, εuch aε Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed. ; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) , herein referred to as "Sambrook."

All parts or amounts set out in the following examples are by weight, unless otherwiεe εpecified.

Unleεε otherwiεe εtated εize εeparation of fragments in the examples below was carried out using standard techniques of agarose and polyacrylamide gel electrophoresiε ("PAGE") in Sambrook and numerous other references such as, for instance, by Goeddel et al. , Nucleic Acids Res. 8: 4057 (1980). Unless described otherwise, ligations were accomplished using standard buffers, incubation temperatures and times, approximately equimolar amounts of the DNA fragments to be ligated and approximately 10 units of T4 DNA ligase ("ligase") per 0.5 μg of DNA.

Example 1 Expression and purification of human CCII using bacteria

The DNA sequence encoding human CCII in the deposited polynucleotide was amplified using PCR oligonucleotide primers specific to the amino acid carboxyl terminal sequence of the human CCII protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning were added to the 5' and 3' sequences respectively.

The 5' oligonucleotide primer had the sequence 5' CGCC

CATGGCAGCAGAACCACTGA 3' (SEQ ID NO:3) containing the underlined

Ncol restriction site, which encodes a start AUG, followed by 16 nucleotides of the human CCII coding sequence set out in Figure 1

(SEQ ID N0:1) beginning with the first base of the second codon.

The 3' primer had the sequence 5' CGC AAG CTT AGCCAGGCGGCTTTA 3' (SEQ ID NO:10) the underlined Hind III restriction site followed by 15 nucleotides complementary to 15 nucleotides of the CCII non- coding sequence set out in Figure 1 (SEQ ID NO:l) , including the stop codon.

The restrictionε εiteε were convenient to restriction enzyme siteε in the bacterial expreεεion vectorε pQE-9, which were used for bacterial expresεion in theεe examples. (Qiagen, Inc. Chatsworth, CA) . pQE-9 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori") , an IPTG inducible promoter, a ribosome binding site ("RBS"), a 6- His tag and restriction enzyme sites.

The amplified human CCII DNA and the vector pQE-9 both were digested with Ncol and Hindlll, and the digeεted DNAs then were ligated together. Insertion of the CCII DNA into the Ncol/Hindlll restricted vector placed the CCII coding region downstream of and operably linked to the vector's IPTG-inducible promoter and in- frame with an initiating AUG appropriately positioned for translation of CCII.

The ligation mixture was transformed into competent E. coli cells using standard procedures. Such procedures are described in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) . E. coli strain MΪ5/rep4, containing multiple copies of the plasmid pREP4, which expresses lac represεor and confers kanamycin resistance ("Kanr") , was used in carrying out the illustrative example deεcribed here. Thiε strain, which iε only one of many that are εuitable for expressing CCII, is available commercially from Qiagen.

Transformantε were identified by their ability to grow on LB plates in the presence of ampicillin. Plasmid DNA was isolated from resistant colonies and the identity of the cloned DNA was confirmed by restriction analysiε .

Clones containing the desired constructs were grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ug/ml) and kanamycin (25 ug/ml) .

The O/N culture was used to inoculate a large culture, at a dilution of approximately 1:100 to 1:250. The cells were grown to an optical density at 600nm ("OD600") of between 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside ("IPTG") was then added to a final concentration of 1 mM to induce transcription from lac repressor senεitive promoterε, by inactivating the lad repreεεor. Cells subsequently were incubated further for 3 to 4 hours. Cells then were harvested by centrifugation and disrupted, by standard methodε. Inclusion bodies were purified from the disrupted cellε uεing routine collection techniqueε, and protein was solubilized from the inclusion bodies into 8M urea. The 8M urea solution containing the solubilized protein was passed over a PD-10 column in 2X phosphate buffered saline ("PBS") , thereby removing the urea, exchanging the buffer and refolding the protein. The protein was purified by a further step of chromatography to remove endotoxin. Then, it was sterile filtered. The sterile filtered protein preparation was εtored in 2X PBS at a concentration of 95 microgramε per mL.

Analysis of the preparation by εtandard methodε of polyacrylamide gel electrophoreεiε revealed that the preparation contained about 80% monomer CCII having the expected molecular weight of, approximately, lo kDa. Example 2 Cloning and expression of human CCII in a baculovirus expression syεtem

The cDNA sequence encoding the full length human CCII protein, in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

The 5' primer has the sequence 5' CGC GGA TCC CGC AGC AGA ACC ACT G 3' (SEQ ID NO:5) containing the underlined BamHI restriction enzyme site followed by 16 baεeε of the εequence of CCII of Figure 1 (SEQ ID NO:l) . Inserted into an expression vector, as deεcribed below, the 5 ' end of the amplified fragment encoding human CCII provideε an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as deεcribed by Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is appropriately located in the vector portion of the construct. The 3' primer has the sequence 5' CGC GGT ACC AGC CAG GCG GCT TTA 3' (SEQ ID NO:6) containing the underlined Asp7l8 reεtriction εite followed by nucleotideε complementary to 15 nucleotideε of the CCII non-coding sequence set out in Figure 1 (SEQ ID N0:1) .

The amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with BamHI and Asp718 and again iε purified on a 1% agarose gel. Thiε fragment iε deεignated herein F2.

The vector pA2-GP iε uεed to express the CCII protein in the baculovirus expression system, using standard methods, such as those described in Summers et al, A MANUAL OF METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE PROCEDURES, Texas Agricultural Experimental Station Bulletin No. 1555 (1987) . This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction siteε. The signal peptide of AcMNPV gp67, including the N-terminal methionine, iε located just upstream of a BamHI site. The polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter and is followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin εequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate viable virus that express the cloned polynucleotide.

Many other baculovirus vectors could be used in place of pA2- GP, such as pAc373, pVL941 and pAcIMl provided, as those of skill readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required. Such vectors are described in Luckow et al., Virology 170: 31-39, among others.

The plasmid is digested with the restriction enzymes BamHI and Asp718 and then is dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is then isolated from a 1% agaroεe gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "V2".

Fragment F2 and the dephoεphorylated plaεmid V2 are ligated together with T4 DNA ligase. E.coli HB101 cells are transformed with ligation mix and spread on culture plates. Bacteria are identified that contain the plasmid with the human CCII gene by digeεting DNA from individual colonieε uεing BamHI and Aεp718 and then analyzing the digeεtion product by gel electrophoreεiε. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pBacCCII.

5 μg of the plasmid pBacCCII is co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). l g of BaculoGold™ viruε DNA and 5 μg of the plasmid pBacCCII are mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaitherεburg, MD) . Afterwardε 10 μl Lipofectin pluε 90 μl Grace'ε medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with l ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27'C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum iε added. The plate is put back into an incubator and cultivation is continued at 27^*C for four days.

After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaitherεburg) iε uεed to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay" of this type can also be found in the user'ε guide for insect cell culture and baculovirology diεtributed by Life Technologies Inc. , Gaithersburg, page 9-10) .

Four days after serial dilution, the virus iε added to the cellε. After appropriate incubation, blue εtained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruseε iε then reεuεpended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm disheε. Four dayε later the εupernatantε of theεe culture diεheε are harvested and then they are stored at 4'C. A clone containing properly inserted CCII is identified by DNA analysiε including reεtriction mapping and εequencing. This iε deεignated herein aε V-CCII.

Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-CCII at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3) . Six hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaitherεburg). 42 hours later, 5 μC± of 35S-methionine and 5 μC± 35S cysteine (available from Amersham) are added. The cells are further incubated for 16- hourε and then they are harveεted by centrifugation, lyεed and the labeled proteinε are visualized by SDS-PAGE and autoradiography.

Baculovirus infected SF-9 cell supernatant was acidified with acetic acid to pH 5 and passed through a Perseptive Biosystems HS50 cation exchange resin in 20 mM acetic acid/sodium acetate buffer pH 5 with a 20 mM to 1.5 H NaCl εalt gradient in the same buffer. Fractions containing protein were confirmed by microsequencing after transfer onto a Problot membrane. Fractions are pooled and diluted 1:10 into 20 mM acetic acid/acetate buffer pH 5.0 and passed through Perseptive Biosystemε CM20 cation exchange reεin with a 20 mM to 2 M salt gradient. Fractionε containing the protein as judged by SDS-PAGE were pooled, and sized onto a Pharmacia Sepharose 12 column in the same buffer containing 250 mM NaCl.

Example 3 Expresεion of CCII in COS cellε

The expreεεion plaεmid, CCII HA, iε made by cloning a cDNA encoding CCII into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.).

The expression vector pcDNAI/amp contains: (1) an E.coli origin of replication effective for propagation in E. coli and other prokaryotic cell; (2) an ampicillin reεiεtance gene for selection of plasmid-containing prokaryotic cells,- (3) an SV40 origin of replication for propagation in eukaryotic cells,- (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.

A DNA fragment encoding the entire CCII precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expresεion is directed by the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al., Cell 37: 767 (1984) . The fuεion of the HA tag to the target protein allowε easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is aε followε.

The CCII cDNA of the deposit clone is amplified uεing primerε that contained convenient reεtriction εiteε, much as described above regarding the construction of expresεion vectors for expresεion of CCII in E. coli and S. fugiperda.

To facilitate detection, purification and characterization of the expresεed CCII, one of the primerε containε a hemagglutinin tag ("HA tag") aε described above.

Suitable primers include that following, which are used in this example. The 5' primer, 5' CGCGGATCCACCATGGCAGCAGAACCA 3' (SEQ ID NO:7) contains the underlined BamHI site, an AUG start codon and 12 codons thereafter. The 3' primer, containing the underlined Xba I site, the hexapeptide hemaglutinin tag (bold) and last 15 bp of 3' coding sequence (at the 3' end) has the following sequence 5' CGCTCT'AGATCJsAGCGTAGTCTGGGACGTCGTATGGGTACrTCTTCCrGATCTT 3' (SEQ ID NO:8) . The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with and then ligated. The ligation mixture iε transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analyεiε and gel εizing for the preεence of the CCII-encoding fragment.

For expression of recombinant CCII, COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Laboratory Press, Cold Spring Harbor, New York (1989) .

Cells are incubated under conditions for expresεion of CCII by the vector.

Expression of the CCII HA fusion protein is detected by radiolabelling and immunoprecipitation, using methodε deεcribed in, for example Harlow et al., ANTIBODIES: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1988) . To this end, two days after transfection, the cells are labeled by incubation in media containing 35S-cysteine for 8 hours. The cells and the media are collected, and the cells are washed and the lysed with detergent-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above. Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size iε εeen in the cell lysate, which is not seen in negative controls.

Example 4 Tissue distribution of CCII expresεion Northern blot analysis is carried out to examine the levels of expression of CCII in human tissues, using methods described by, among others, Sambrook et al, cited above. Total cellular RNA samples are isolated with RNAzol™ B syεtem (Biotecx Laboratorieε, Inc. 6023 South Loop Eaεt, Houston, TX 77033).

About 10μg of Total RNA is isolated from tissue samples. The RNA is size resolved by electrophoresiε through a 1% agaroεe gel under strongly denaturing conditions. RNA is blotted from the gel onto a nylon filter, and the filter then is prepared for hybridization to a detectably labeled polynucleotide probe.

Aε a probe to detect mRNA that encodeε CCII, the antiεenεe strand of the coding region of the cDNA insert in the deposited clone is labeled to a high specific activity. The cDNA iε labeled by primer extension, using the Prime-It kit, available from Stratagene. The reaction is carried out using 50 ng of the cDNA, following the standard reaction protocol as recommended by the supplier. The labeled polynucleotide is purified away from other labeled reaction components by column chromatography using a Select-G-50 column, obtained from 5-Prime - 3-Prime, Inc. of 5603 Arapahoe Road, Boulder, CO 80303.

The labeled probe is hybridized to the filter, at a concentration of 1,000,000 cpm/ml, in a small volume of 7% SDS, 0.5 M NaP04, pH 7.4 at 65°C, overnight.

Thereafter the probe solution is drained and the filter is washed twice at room temperature and twice at 60'C with 0.5 x SSC, 0.1% SDS. The filter then iε dried and expoεed to film at -70^*C overnight with an intensifying screen.

Autoradiography showε that mRNA for CCII is abundant in [breast lymph node cells] .

Example 5 Gene therapeutic expresεion of human CCII

Fibroblaεtε are obtained from a εubject by skin biopsy. The resulting tisεue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask iε turned upεide down, closed tight and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted - the chunks of tisεue remain fixed to the bottom of the flaεk - and freεh media iε added (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin) . The tissue is then incubated at 37"C for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblastε emergeε. The monolayer is trypsinized and scaled into larger flasks.

A vector for gene therapy is digested with reεtriction enzymeε for cloning a fragment to be expresεed. The digeεted vector is treated with calf intestinal phosphataεe to prevent self-ligation. The dephosphorylated, linear vector is fractionated on an agarose gel and purified.

CCII cDNA capable of expressing active CCII, is isolated. The ends of the fragment are modified, if necessary, for cloning into the vector. For instance, 5" overhanging may be treated with DNA polymerase to create blunt ends. 3' overhanging ends may be removed using SI nuclease. Linkers may be ligated to blunt ends with T4 DNA ligase.

Equal quantities of the Moloney murine leukemia virus linear backbone and the CCII fragment are mixed together and joined using T4 DNA ligase. The ligation mixture is used to transform E. Coli and the bacteria are then plated onto agar-containing kanamycin. Kanamycin phenotype and restriction analysis confirm that the vector has the properly inserted gene.

Packaging cells are grown in tisεue culture to confluent denεity in Dulbecco'ε Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin. The vector containing the CCII gene is introduced into the packaging cells by standard techniques. Infectious viral particles containing the CCII gene are collected from the packaging cells, which now are called producer cells.

Fresh media is added to the producer cells, and after an appropriate incubation period media is harvested from the plates of confluent producer cellε. The media, containing the infectiouε viral particleε, iε filtered through a Millipore filter to remove detached producer cellε. The filtered media then iε uεed to infect fibroblaεt cellε. Media iε removed from a εub-confluent plate of fibroblaεtε and quickly replaced with the filtered media. Polybrene (Aldrich) may be included in the media to facilitate transduction. After appropriate incubation, the media is removed and replaced with fresh media. If the titer of viruε is high, then virtually all fibroblasts will be infected and no selection iε required. If the titer iε low, then it is necesεary to use a retroviral vector that has a selectable marker, such as neo or his, to select out transduced cells for expanεion.

Engineered fibroblasts then may be injected into rats, either alone or after having been grown to confluence on microcarrier beads, such as cytodex 3 beads. The injected fibroblastε produce CCII product, and the biological actionε of the protein are conveyed to the host.

It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.

Numerous modifications and variations of the present invention are posεible in light of the above teachingε and, therefore, are within the scope of the appended claimε.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Ni, Jian (ii) TITLE OF INVENTION: CHEMOTACTIC CYTOKINE II (iii) NUMBER OF SEQUENCES: 10

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN, CECCHI,

STEWART & OLSTEIN

(B) STREET: 6 BECKER FARM ROAD

(C) CITY: ROSELAND

(D) STATE: NJ

(E) COUNTRY: USA

(F) ZIP: 07068

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.30

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: US

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Ferraro, Gregory D

(B) REGISTRATION NUMBER: 36,134

(C) REFERENCE/DOCKET NUMBER: 325800-524

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 201-994-1700

(B) TELEFAX: 201-994-1744

(2) INFORMATION FOR SEQ ID Nθ:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 532 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 145..438

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

CGAGGCAGCT CTCTCCTCCT TCCCCGCTGC T ATAAACCT CAGCCCTGAG GCTCCAGCTC 60

ACTCTACCCC ATCTCCTTGC CGGGTCAGCC CTGACAAAGG TCAGCTAGCC CCTTGAGGAC 120

ATCAGCTTTG GCCTCAGGGT CCTA ATG GCA GCA GAA CCA CTG ACA GAG CTA 171

Met Ala Ala Glu Pro Leu Thr Glu Leu

1 5

GAG GAG TCC ATT GAG ACC GTG GTC ACC ACC TTC TTC ACC TTT GCA AGG 219 Glu Glu Ser lie Glu Thr Val Val Thr Thr Phe Phe Thr Phe Ala Arg 10 15 20 25 CAG GAG GGC CGG AAG GAT AGC CTC AGC GTC AAC GAG TTC AAA GAG CTG 267 Gin Glu Gly Arg Lys Asp Ser Leu Ser Val Asn Glu Phe Lys Glu Leu 30 35 40

GTT ACC CAG CAG TTG CCC CAT CTG CTC AAG GAT GTG GGC TCT CTT GAT 315 Val Thr Gin Gin Leu Pro His Leu Leu Lys Asp Val Gly Ser Leu Asp 45 50 55

GAG AAG ATG AAG AGC TTG GAT GTG AAT CAG GAC TCG GAG CTC AAG TTC 363 Glu Lys Met Lys Ser Leu Asp Val Asn Gin Asp Ser Glu Leu Lys Phe 60 65 70

AAT GAG TAC TGG AGA TTG ATT GGG GAG CTG GCC AAG GAA ATC AGG AAG 411 Asn Glu Tyr Trp Arg Leu lie Gly Glu Leu Ala Lys Glu lie Arg Lys 75 80 85

AAG AAA GAC CTG AAG ATC AGG AAG AAG TAAAGCCGCC TGGCTGAGAT 458

Lys Lys Asp Leu Lys lie Arg Lys Lys 90 95

GGGGTGGGCA GGGCAGAGGT GATTCAGGGC CGAGCAGAAC CGCACTCTTT CCCAAATAAA 518

GTTTCCTCCT TGAA 532

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 98 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Ala Ala Glu Pro Leu Thr Glu Leu Glu Glu Ser lie Glu Thr Val 1 5 10 15

Val Thr Thr Phe Phe Thr Phe Ala Arg Gin Glu Gly Arg Lys Asp Ser 20 25 30

Leu Ser Val Asn Glu Phe Lys Glu Leu Val Thr Gin Gin Leu Pro His 35 40 45

Leu Leu Lys Asp Val Gly Ser Leu Asp Glu Lys Met Lys Ser Leu Asp 50 55 60

Val Asn Gin Asp Ser Glu Leu Lys Phe Asn Glu Tyr Trp Arg Leu lie 65 70 75 80

Gly Glu Leu Ala Lys Glu lie Arg Lys Lys Lys Asp Leu Lys lie Arg 85 90 95

Lys Lys

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CGCCCATGGC AGCAGAACCA CTGA 24

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CGCGGATCCC GCAGCAGAAC CACTG 25

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CGCGGATCCC GCAGCAGAAC CACTG 25

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CGCGGTACCA GCCAGGCGGC TTTA 24

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CGCGGATCCA CCATGGCAGC AGAACCA 27

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 54 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8 : CGCTCTAGAT CAAGCGTAGT CTGGGACGTC GTATGGGTAC TTCTTCCTGA TCTT 54

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 89 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9 :

Met Pro Ser Glu Leu Glu Lys Ala Leu Ser Asn Leu lie Asp Val Tyr 1 5 10 15

His Asn Tyr Ser Asn lie Gin Gly Asn His His Ala Leu Tyr Lys Asn 20 25 30

Asp Phe Lys Lys Met Val Thr Thr Glu Cys Pro Gin Phe Val Gin Asn 35 40 45 lie Asn lie Glu Asn Leu Phe Arg Glu Leu Asp lie Asn Ser Asp Asn 50 55 60

Ala lie Asn Phe Glu Glu Phe Leu Ala Met Val He Lys Val Gly Val 65 70 75 80

Ala Ser His Lys Asp Ser His Lys Glu 85

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: CGCAAGCTTA GCCAGGCGGC TTTA 24

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consiεting of:

(a) a polynucleotide having at leaεt a 70% identity to a polynucleotide encoding a polypeptide compriεing an amino acid sequence set forth in SEQ ID NO:2;

(b) a polynucleotide which is complementary to the polynucleotide of (a) ; and

(c) a polynucleotide comprising at least 15 bases of the polynucleotide of (a) or (b) .

2. The polynucleotide of Claim l wherein the polynucleotide iε DNA.

3. The polynucleotide of Claim 1 wherein the polynucleotide iε RNA.

4. The polynucleotide of Claim l wherein the polynucleotide is genomic DNA.

5. The polynucleotide of Claim 2 which encodes a polypeptide comprising amino acid 1 to 98 of SEQ ID NO:2.

6. An isolated polynucleotide comprising a member selected from the group consisting of:

(a) a polynucleotide which encodes a mature polypeptide having the amino acid sequence expresεed by the human cDNA contained in ATCC Deposit No. 97405;

(b) a polynucleotide which is complementary to the polynucleotide of (a) ; and

(c) a polynucleotide comprising at least 15 bases of the polynucleotide of (a) or (b) .

7. The polynucleotide of claim 1 comprising the sequence as set forth in SEQ ID N0:1 from nucleotide 1 to nucleotide 532.

8. The polynucleotide of claim 1 comprising the sequence as set forth in SEQ ID N0:1 from nucleotide 145 to nucleotide 438.

9. A vector compriεing the DNA of Claim 2.

10. A hoεt cell compriεing the vector of Claim 9.

11. A process for producing a polypeptide comprising: expressing from the host cell of Claim 10 the polypeptide encoded by said DNA.

12. A procesε for producing a cell which expreεses a polypeptide compriεing genetically engineering the cell with the vector of Claim 9.

13. A polypeptide comprising a member selected from the group consisting of:

(a) a polypeptide having an amino acid sequence set forth in SEQ ID NO:2; and

(b) a polypeptide which is at leaεt 70% identical to the polypeptide of (a) .

14. The polypeptide of Claim 13 wherein the polypeptide compriεeε amino acid 1 to amino acid 98 of SEQ ID NO:2.

15. A compound which inhibitε activation of the polypeptide of claim 13.

16. A compound which activateε the polypeptide of claim 13.

17. A method for the treatment of a patient having need of CCII compriεing: administering to the patient a therapeutically effective amount of the polypeptide of claim 13.

18. The method of Claim 17 wherein said therapeutically effective amount of the polypeptide is administered by providing to the patient DNA encoding said polypeptide and expresεing εaid polypeptide in vivo.

19. A method for the treatment of a patient having need to inhibit a CCII polypeptide compriεing: adminiεtering to the patient a therapeutically effective amount of the compound of Claim 15.

20. A proceεs for diagnosing a disease or a susceptibility to a diseaεe related to an under-expression of the polypeptide of claim 13 comprising: determining a mutation in a nucleic acid sequence encoding said polypeptide.

21. A diagnostic process comprising: analyzing for the presence of the polypeptide of claim 13 in a sample derived from a host.

22. A method for identifying compounds which bind to and inhibit activation of the polypeptide of claim 13 comprising: contacting a cell expressing on the surface thereof a receptor for the polypeptide, said receptor being asεociated with a εecond component capable of providing a detectable signal in response to the binding of a compound to said receptor, with an analytically detectable CCII polypeptide and a compound under conditionε to permit binding to the receptor; and determining whether the compound bindε to and inhibitε the receptor by detecting the abεence of a εignal generated from the interaction of CCII with the receptor.