WO1997002841A1 - Therapie genetique utilisant le gene ts derive de la souche vhh-6a ou le polypeptide correspondant - Google Patents

Therapie genetique utilisant le gene ts derive de la souche vhh-6a ou le polypeptide correspondant Download PDF

Info

Publication number
WO1997002841A1
WO1997002841A1 PCT/US1996/011222 US9611222W WO9702841A1 WO 1997002841 A1 WO1997002841 A1 WO 1997002841A1 US 9611222 W US9611222 W US 9611222W WO 9702841 A1 WO9702841 A1 WO 9702841A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cells
vector
disease state
ras
Prior art date
Application number
PCT/US1996/011222
Other languages
English (en)
Inventor
John C. Araujo
Jay Doniger
Leonard J. Rosenthal
Original Assignee
Georgetown University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Georgetown University filed Critical Georgetown University
Priority to AU64081/96A priority Critical patent/AU6408196A/en
Publication of WO1997002841A1 publication Critical patent/WO1997002841A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16511—Roseolovirus, e.g. human herpesvirus 6, 7
    • C12N2710/16522—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • AAV-2 human adeno-associated virus type 2
  • AAV is a parvovirus, but unlike other parvoviruses, AAV grows efficiently only in cells co-infected by a helper virus.
  • Helper viruses include adenoviruses, herpes virus and pox viruses.
  • AAV is integrated into the host-cell chromosome and there is little or no gene expression from the integrated provirus. Carter, in Handbook of Parvoviruses , Vol . I, CRC Press, 1989, pp. 155-68 and pp. 255-82.
  • the rep gene is required for AAV-2 DNA replication.
  • the gene is located on the left half of the AAV genome. It is expressed by overlapping mRNA species transcribed from two promoters, named p5 and pl9. Laughlin et al . , Proc . Nat ' l Acad . Sci . USA 76: 5567 (1979); Carter, in Handbook of Parvoviruses, Vol, I, CRC Press 1990, pp. 227-54) . At least four overlapping Rep proteins expressed from the rep gene have been identified. Mendelson et al . , J . Virol . 60: 823 (1986); Trempe et al . , Virology 161: 18 (1987).
  • Rep78 and Rep68 are gene products transcribed from the p5 promoter and Rep52 and Rep40 are gene products transcribed from the pl9 promoter.
  • the AAV-2 rep genes affect transcription as well.
  • the AAV gene mediates both complex positive and negative regulator effects. See Carter et al . , (1990), supra , at pp. 227-54.
  • rep activates expression of AAV genes. Tratschin et al . , Mol . Cell . Biol . 6: 2883 (1986); Labow et al . , J . Virol . 60: 251 (1986); Trempe and Carter, J . Virol . 62: 68 (1988) .
  • AAV-2 rep down-regulates expression from a variety of heterologous promoters, including the human immunodeficiency virus type 1 (HIV-l) long terminal repeat (LTR) .
  • HBV-l human immunodeficiency virus type 1
  • LTR long terminal repeat
  • down-regulation of HIV LTR by AAV-rep does not involve known transcription control elements Spl, or NF-&B. Thompson et al .
  • the AAV-2 _Rep68/78 gene has been shown to suppress transformation by bovine papillomavirus and activated EJ-Harvey-ras gene.
  • Activated H-ras. has been identified in many human malignancies, including carcinomas of the bladder, lung, breast, and urinary tract, as well as melanomas.
  • Der et al. Proc. Natl. Acad. Sci., USA 79: 3637-40 (1982); Goldfarb et al . , Nature 296: 404-09 (1982); Krontiris et al .
  • HSV-1 herpes simplex virus type l (HSV-1) infected cell protein 4 (ICP4) acts as either a repressor or transactivator of HSV-1 genes.
  • HSV-1 herpes simplex virus type l
  • ICP4 infected cell protein 4
  • ICP4 protein suppresses the HSV-l ⁇ 0 and ⁇ 4 genes, the latter encoding ICP4, by binding to a specific motif, ATCGTC ⁇ C ⁇ G ⁇ , within their promoters. DeLuca et al . , 1988, supra; Muller, J. Virol. 61: 858-65 (1987); Roberts et al . , J. Virol. 62: 4307-20 (1988); Kristie et al . , Proc. Nat'l Acad.
  • the E2 gene of BPV-1 can also transactivate and repress transcription by binding to the ACC ⁇ 6 GGT motif, the BPV-1 enhancer element.
  • E2R an N-terminal truncation of E2, and E8E2, a fusion protein expressed from a spliced message, both contain the DNA binding domain of E2 but lack the transactivating domain.
  • E2R or 2E8 block the binding of full length E2 and thus, repress transcription.
  • a unique component of HHV-6 strain U1102 contains an open reading frame (ORF) encoding a 490 amino acid protein which has 24% identity to the first common 490 amino acids of the nonstructural proteins Rep 78 and 68 of the human parvovirus AAV-2. Thomson et al . , 1991, supra .
  • ORF open reading frame
  • HHV-6 ts and AAV-2 Rep68/78 suppress transcription of the same promoters, H-ras and HIV-l, but not MSVLTR.
  • HHV-6 gene complemented replication of a rep-deficient AAV-2 genome.
  • AAV-rep was shown to inhibit CAT activity from constructs where the CAT gene was downstream of the HIV LTR promoter in both fibroblast and T-cell lines.
  • HHV-6 gene product activated CAT activity expressed from the same constructs, but such activation occurred only in the fibroblast cell line and not in T-cells.
  • HHV-6 rep is therefore believed to be a multifunctional regulatory protein with properties related to, but distinct from, those of AAV-2 rep.
  • Ts protein could act by binding to nucleic acid sequences, other proteins, or both.
  • mutation studies indicate that the TAR region, particularly the "Bulge,” is critical. Araujo et al . , (1995), supra . Because TAR is downstream of the mRNA start site, ts binding to RNA or DNA could be involved. Additionally, binding to cellular transcription factor(s) probably occurs. Both the HIV-l tat protein and cellular nuclear proteins including a 140 kDa protein TRP185, and 44 kDa TRBP bind to TAR. Rounseville et al . , J . Virol . 66: 1688-94 (1992); Wu et al . , Genes Dev.
  • the sites of action of the ts gene product are sequence motifs that are fairly similar to each other in the case of the H-ras and LTR promoters.
  • the fact that two promoters from unrelated organisms are both transcriptionally regulated by the ts gene product by interaction with homologous sequences suggests that the ts-recognized sequences have regulatory functions of their own, and that gene expression regulation employing those functions are likely found elsewhere. This idea is made more likely by the fact that the motifs discussed above are found within TAR, a regulatory region itself.
  • the site of action of the AAV-2 rep gene product and the ts gene product may be similar, both interacting with a region within the TAR sequences of LTR.
  • Ts interacts with the H-ras promoter in a region that appears to contain nucleotide motifs homologous to motifs in the TAR region.
  • Summary of the Invention It is an object of the present invention to provide a vector for use in gene therapy that contains the HHV-6 ts gene. It is another object of the present invention to provide for use of the HHV-6 ts gene , or a fragment thereof, in the treatment of disease states associated with oncogenic transformation or lentivirus infection. It is still another object of the present invention to treat disease states associated with oncogenic transformation or lentivirus infection with at least a portion of the HHV-6 ts gene.
  • a method of gene therapy comprising the steps of (A) providing a construct containing a polynucleotide sequence encoding the ts protein and (B) delivering the vector to cells of a subject at risk of a disease state associated with oncogenic transformation or lentivirus infection, such that upon expression of said polynucleotide sequence in said cells the disease state is treated.
  • the vector is chosen from the group consisting of a viral vector, a lipidic vector, a plasmid, and an ex vivo transformed cell.
  • the vector can be delivered before, during or after development of the disease state.
  • the disease state is a cancer, including cancer associated with a member of the ras gene family and those associated with viruses, such as the papilloma viruses, HTLV-1, HIV and lentiviruses that contain an LTR-like sequence, including human lentiviruses.
  • viruses such as the papilloma viruses, HTLV-1, HIV and lentiviruses that contain an LTR-like sequence, including human lentiviruses.
  • a vector that comprises a polynucleotide sequence encoding the ts protein and that is suitable for gene therapy such that upon delivery of said construct to cells of a subject at risk of a disease state associated with oncogenic transformation or lentivirus infection expression of the polynucleotide sequence is effected in said cells, treating the disease state.
  • the vector is appropriately formulated for delivery to a subject, and thus can serve as a therapeutic agent.
  • a method of characterizing a disease state comprising the steps of administering a ts protein to a cell affected by the disease state and determining whether the ts protein can treat the disease state.
  • the disease state can be imparted on the cell by transforming the cell with a disease gene.
  • the administering step comprises transforming the cell with a ts gene.
  • a method of gene therapy comprising the step of a administering a therapeutic composition comprising a ts protein or polynucleotide sequence encoding the ts protein to a subject at risk for a disease state associated with oncogenic transformation or lentivirus infection.
  • the polynucleotide sequence encoding the ts protein may comprise at least a transcription-suppressing portion of the HHV-6 ts gene, and may include the entire HHV-6 ts gene.
  • transcription-suppressing polypeptides and polynucleotides encoding them are provided.
  • Figure 1 shows the location of the fragments used to test suppression of H-ras transformation on the HHV-6 genome. Specifically, the locations of HD12, ZVH14, and ED9 fragments within HHV-6 are indicated. ts2.6 is a subfragment of HD12. The ts protein is designated as a filled box with arrow indicating the direction of transcription. Jpnl repeats are shown as a hatched box. Only relevant SacII sites within HD12 are shown.
  • Figures 2A-B depict the HHV-6 ts protein.
  • Figure 2A shows the amino acid sequence of the HHV-6 ts protein compared to the amino acid sequence of AAV-2 Rep 68/78.
  • Figure 2B is a schematic comparison of HHV-6 to AAV-2 Rep 68/78 showing regions of alignment (solid rectangles) as identified by MACAW software.
  • Figure 3 shows the effect of selected HHV-6 fragments on H-ras transformation.
  • pEJ-H-ras with or without pZVH14 or pHD12 was transfected into NIH 3T3 cells.
  • dishes Fourteen days post-transfection, dishes (four for each experimental condition) were stained and counted for transformed foci (the total number of transformed foci for all four dishes is shown) .
  • a schematic of the H-ras reporter is shown with its four exons (shaded rectangles) and endogenous promoter (solid rectangle) . Data shown are representative of three experiments.
  • Figures 4A-C shows the effect of the ts gene on H- ras transformation.
  • Figure 4A is a schematic presentation of ts2.6.
  • Horizontal arrows indicate location of ORFs greater than 75 amino acids within ts2.6.
  • the 180 amino acid ORF is the N-terminal end of a 1121 amino acid ORF within HD12. ORFs on different levels are in different reading frames.
  • Vertical arrows represent the positions of translation termination linkers inserted into the suppressor protein within ts2.6.
  • Figure 4B is a Northern blot analysis of total RNA extracted from transiently transfected cells and probed with the StyI fragment within ts (See Figure 1) . Shown at the left are the sizes of molecular weight markers and at the right, the calculated size of the observed transcript.
  • Figure 4C shows only that wild-type ts constructs suppressed H-ras transformation.
  • pEJ-H-ras was transfected alone or with increasing amounts of ts constructs as depicted in Figure 2.
  • the data are representative of two experiments.
  • Figures 5A-B show the effect of the ts gene on transcription of the H-ras gene.
  • Figure 5A depicts the effect of pHD12 or pts2.6 on H-ras transformation when H- ras is expressed from the MSV LTR promoter.
  • pMSVLTR-ras was transfected alone or with increasing amounts of pHD12 or pts2.6. At fourteen days post-transfection, dishes (four per experimental condition) were stained and transformed foci were counted.
  • FIG. 5B A schematic of the reporter pMSVLTR-ras with its four exons (shaded rectangles) and heterologous MSV LTR promoter (solid box) also is shown. Data are representative of three indepen ⁇ dent experiments.
  • Figure 5B the effect of pHD12 on CAT expression from the endogenous H-ras promoter. pHD12 was co-transfected with prasCATl or pMSVLTR-CAT. The amount of each plasmid DNA used is shown below the graph. CAT activity was measured in extracts prepared at 48 hours post-transfection.
  • Figures 6A-B show the effect of pHD12 on expression from the HIV-l LTR promoter.
  • Figure 6A is a schematic depiction of the HIV-l LTR promoter showing its genetic elements and the LTR wild-type and upstream mutant constructs used. Point mutations are designated by vertical arrows and deletions by dashed lines.
  • Figure 6B shows the effect of ts on HIV-l LTR CAT expression.
  • CD- 12 or upstream LTR mutant construct DNA was electroporated into 12D7 cells alone (shaded bar) or with the indicated concentrations of pRc-ts DNA (filled bar) .
  • CAT activity was assayed from extracts made 24 hours post-electroporation. Data shown are representative of a minimum of two experiments for each HIV-l LTR CAT construct.
  • Figures 7A-B show the relation between HIV-l TAR and ts suppression.
  • Figure 7A depicts the TAR mRNA structure expressed from wild-type (CD-12) and TAR mutant CAT constructs. Relevant wild-type and mutated TAR sequences are shown below. Deleted bases are indicated by the dashed line.
  • Figure 7B illustrates the effect of TAR mutations on ts suppression of HIV-l LTR expression.
  • CD- 12, TM29-CAT, or TM26-CAT was electroporated into 12D7 cells alone (shaded bar) or with the indicated concentra ⁇ tions of pRc-ts DNA (filled bar) .
  • CAT activity was assayed from extracts made 24 hours post-electroporation. Data shown are representative of a minimum of two experiments for each HIV-l LTR CAT construct.
  • Figure 8 schematically depicts the relationship of HHV-6A ts protein (solid rectangle) to AAV-2 Rep proteins (shaded rectangle) .
  • the line indicates the region of the Rep68 splice and the open rectangle indicates the translation from an alternate reading frame caused by the ins42 linker insertion.
  • Figures 9A-B depict data relating to suppression of transformation.
  • Figure 9A shows that stable ts sense and antisense cell lines were established by transfection of NIH 3T3 cells with pRc-ts and pRc-ts(A), respectively, followed by selection with G418. These cell lines and parental NIH 3T3 were transfected with pEJ-H-ras (containing the H-ras gene expressed by its endogenous promoter) or pMSVLTR-ras (containing the H-ras gene expressed by the MSVLTR promoter) . Two weeks later dishes were stained and scored.
  • Figure 9B depicts the same cell lines that were transfected with prasCATl (containing the chloramphenicol acetylase (CAT) gene expressed by the endogenous H-ras promoter) or pMSVLTR- CAT (containing the chloramphenicol acetylase gene expressed by the MSVLTR promoter) . Forty eight hours later, extracts were made and tested for the level of CAT activity. The percent of acetylated chloramphenicol is indicated above each lane.
  • prasCATl containing the chloramphenicol acetylase (CAT) gene expressed by the endogenous H-ras promoter
  • pMSVLTR- CAT containing the chloramphenicol acetylase gene expressed by the MSVLTR promoter
  • Figure IOA and Figure 10B depict data from a comparison of stable 12D7 cell lines, which were transfected with HIV-l LTR-CAT (containing the CAT gene expressed by the HIV-l promoter) or TM26-CAT (containing CAT expressed by the TM26 TAR mutant HIV-l promoter) .
  • Figure 11 depicts data relating to HHV-6 ts suppressed Papillomavirus-Induced Transformation.
  • pBPV with or without pts2.6 was transfected into NIH 3T3 cells. Three weeks post-transfection, dishes (four for each experimental condition) were stained and counted for transformed foci. The total number of transformed foci for all four dishes is shown.
  • Figures 12A-C depict data relating to reproducible suppression of H-ras and Papillomavirus Transformation in Stable ts NIH 3T3 Cell Lines. Additional ts cell lines were established and transfected with pEJ-H-ras ( Figure 12A) , pBPV-69T ( Figure 12B) , or MSVLTRras ( Figure 12C) , as described previously.
  • Figures 13 A-C illustrate growth characteristics of NIH 3T3 cells expression ts protein. Stable ts expressing 3T3-ts-l, 2, 3, 4, and 5 cell lines were established by transfection of NIH 3T3 cells with pRc-ts, followed by selection with G418 and clonal isolation.
  • Figure 13 A is a Southern blot analysis. DNA was extracted from 3T3-ts cell lines, digested with Hindlll , separated by agarose gel electrophoresis, transferred to GeneScreen, and probed with 32 P-labeled ts Hindlll fragment DNA. The position of the expected 1.8 kbp ts Hindlll fragment is indicated.
  • Figure 13B is a Western blot analysis.
  • Protein extracts of NIH 3T3 and 3T3-ts cell lines were separated by 4-20% SDS-PAGE electrophoresis and Western blotted using anti-ts rabbit polyclonal serum, Ab-679.
  • As a positive control in vitro transcribed and translated ts protein was produced employing pET14b-ts (ts cloned into the pET14b bacterial expression vector; Novagen) as the template.
  • the ts/antibody complex was detected by the "Western Light" chemiluminescent detection system (TROPIX, Inc.) employing goat anti-rabbit IgG conjugated to alkaline phosphatase.
  • Figure 13C depicts the growth curves.
  • Figure 14 demonstrates that retroviral ts NIH 3T3 cell lines are resistant to transformation by H-ras.
  • Cell lines were established by infecting NIH 3T3 cells with LNCX or LNCts retrovirus, followed by G418 selection. These cell lines and parental NIH 3T3 were transfected with pEJ-H-ras and analyzed as described for Figure 13.
  • Figures 15A-D illustrate that bovine and human papillomavirus promoters were suppressed in ts expressing cell lines.
  • pl066 Fig. 15A
  • p805-88 Fig. 15B
  • pCHC6CAT Fig 15. C
  • pURR16CAT Fig. 15D
  • Figures 15A-D also comprise a schematic representation of the promoter CAT constructs. The arrow designates the transcription start site.
  • the present invention relates to methods, vectors and constructs that utilize a portion of the HHV-6 genome to make a polypeptide that can be used for treating disease states associated with oncogenic transformation or lentivirus infection, including human lentiviruses. Such diseases include cancer.
  • This protein called the "transcription suppression" or ts protein, has an amino acid sequence as set forth in Figure 2A.
  • HHV-6 strain U1102 contains a 1,473 base pair ts gene. Both a 12 kbp HHV-6 Hindlll fragment and a SacIIJPpuMI subfragment containing ts suppress H-ras transformation. Araujo et al . , J. Virol . 69: 4933-40 (1995).
  • cancers associated with viruses such as papilloma viruses, HTLV-1, HIV and lentiviruses that contain an LTR-like sequence.
  • viruses such as papilloma viruses, HTLV-1, HIV and lentiviruses that contain an LTR-like sequence.
  • the term "treat” in its various grammatical forms herein refers to preventing, curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a disease state or progression.
  • the ts gene will be administered to subject at risk for the disease state.
  • Such subjects include those already suffering from the disease, as well as subjects who, by virtue of genetic predisposition, viral infection or exposure to environmental factors, such as radiation or chemical mutagens, could develop the disease state.
  • Suitable subjects include humans and other animals that can suffer from disease states caused by oncogenic transformation or lentivirus infection.
  • cattle which are susceptible to the bovine papilloma virus, can be treated according to the present invention.
  • the ts protein employed in the present invention can have the amino acid sequence set forth in Figure 2A. Changes in the amino acid sequence are contemplated in the present invention, however. For example, the ts protein can be altered by changing the DNA encoding the protein.
  • amino acid substitutions include the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamate; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; valine to isoleucine or leucine.
  • variants and fragments of the ts protein can be used in the present invention.
  • Variants include analogs, derivatives, muteins and mimetics of the natural ts protein that retain the ability to cause the beneficial results described herein.
  • Fragments of the ts protein refer to portions of the amino acid sequence of the ts polypeptide that also retain this ability.
  • the variants and fragments can be generated directly from the ts protein itself by chemical modification by proteolytic enzyme digestion, or by combinations thereof. Additionally, methods of synthesizing polypeptides directly from amino acid residues also exist.
  • Non-peptide compounds that mimic the binding and function of the ts protein can be produced by the approach outlined in Saragovi et al . , Science 253: 792-95 (1991) .
  • Mimetics are peptide-containing molecules which mimic elements of protein secondary structure. See, for example, Johnson et al . ,”Peptide Turn Mimetics” in BIOTECHNOLOGY AND PHARMACY, Pezzuto et al . , Eds., (Chapman and Hall, New York, 1993) .
  • peptide mimetics The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions
  • appropriate mimetics can be considered to be the equivalent of the ts protein itself.
  • variants and fragments are created by recombinant techniques employing genomic or cDNA cloning methods.
  • Site-specific and region-directed mutagenesis techniques can be employed. See CURRENT PROTOCOLS IN MOLECULAR BIOLOGY vol. 1, ch. 8 (Ausubel et al . eds., J. Wiley & Sons 1989 & Supp. 1990-93); PROTEIN ENGINEERING (Oxender & Fox eds., A. Liss, Inc. 1987).
  • linker-scanning and PCR-mediated techniques can be employed for mutagenesis. See PCR TECHNOLOGY (Erlich ed.
  • cells are co ⁇ transformed with a construct containing ts-encoding sequences and a known disease-causing gene.
  • a reduction in disease phenotype in the cells suggests that the disease-causing gene can be treated with ts therapy.
  • cells that already display the disease phenotype can be transformed with the ts-containing construct to determine whether the ts protein reduce the disease phenotype.
  • HHV-6 HHV-6 gene is responsible for transformation suppression. Because this gene acts at the level of transcription, as demonstrated with both the H-ras promoter and LTR promoter, the gene is designated "ts" (for transcription suppression.
  • ts for transcription suppression.
  • a construct was made which contained the 2.6 kb subfragment of HD12, designated pts2.6, and included the ts gene under control of its endogenous promoter. This construct was obtained by first ligating the 4 kb SacII fragment of pHD12 into the unique SacII site of the pBluescript SK+ (pBS) (Stratagene) . A pBS/HD12-Sac I clone, with the SacII fragment in the appropriate orientation was then digested at the Smal site (within the multiple cloning site of pBS) and the PpumI site
  • the ts gene also was cloned in both the sense and antisense orientations into the mammalian expression vector, pRc- RSV (Invitrogen) using a 1,803 bp PCR amplified sequence; the PCR primers, AAAAAAAGCTTCTTGGGAGGCGCAAACGG and AAAAAAAGCTTCAGCACCCTTGATGATGC, containedflankingHindlll restriction enzyme sites which were used for cloning.
  • NIH 3T3 cells were maintained as subconfluent monolayers in Dulbecco's Modified Eagle's Medium (Mediatech) supplemented with 7% calf serum (Hyclone) , penicillin (100 units/ml) and streptomycin (100 ⁇ g/ml) .
  • Cells were transfected by the calcium phosphate method as described by Chen et al . , Mol . Cell Biol . 7: 2745-52 (1987), with minor modifications. Briefly, 5 x IO 4 cells were seeded into 6 well (35mm) plates and transfected with a total of 9 ⁇ g/well of plasmid including carrier pBS, all previously purified by double banding in CsCl.
  • pts2.6 contained the 1473 bp coding region for the ts including 615 bp upstream of the putative translation initiation codon and 507 bp downstream of the stop codon.
  • TTL translation termination linker
  • the three TTL mutants of the pts2.6 plasmid were: (1) pts2.6/TTL-25, constructed by insertion of the translation termination oligodeoxynucleotide 5'- CTAGCTAGCTAG (New England Biolabs) into the filled Ncol site within codon 26 of the ts gene; (2) pts2.6/TTL-125, constructed by insertion of the linker into the filled Pad site within codon 126; and (3) pts2.6/TTL-245, constructed by insertion of the linker into the filled
  • the TTL mutation placed after codon 125 terminates translation only in ts .
  • pts2.6 and its TTL mutant constructs were used to demonstrate that the protein was required for suppression of transformation.
  • Transient transfections of ⁇ IH 3T3 cells employing pHD12, pts2.6, or the TTL mutant constructs were performed to demonstrate that the ts transcript was expressed.
  • the expected transcript (approximately 1.8 kb) was detected by Northern blot analysis using an internal 1.1 kbp Styl fragment of the ts gene as the probe (see Figure 4B) .
  • Northern blot analysis was performed by extracting total cellular RNA isolated from NIH 3T3 cells 24 hours post- transfection by lysis in guanidine thiocyanate.
  • the transcript was identified after transfection by ts plasmids including HD12, pts2.6, and all TTL mutants.
  • RNA from NIH 3T3 cells transfected with pBS alone showed no ts transcripts.
  • the ts gene exerts its suppressor effect either on the endogenous H-ras promoter or directly on the H-ras p21 protein. To distinguish between these possibilities, a construct containing the murine osteosarcoma virus
  • MSV murine osteosarcoma virus
  • LTR long terminal repeat
  • transient transfections were carried out employing constructs containing the CAT gene under the control of the H-ras or MSV LTR promoter ( Figure 5B) .
  • pMSVLTR-CAT and prasCATl contained the CAT gene expressed by the MSV ⁇ LTR or the endogenous ras promoter (Ishii et al., Science 232: 1410-43 (1986)), respectively.
  • NIH 3T3 cells were transfected by the calcium phosphate method (Chen, (1987) supra) with 5 ⁇ g of the reporter CAT plasmid prasCATl or pMSVLTR-CAT in the presence or absence of 10 ⁇ g pHDl2.
  • Extracts were prepared 48 hours post-transfection and the protein levels determined. Extracts (15 ⁇ g) were incubated in 52 ⁇ l reactions in 0.25 M Tris (pH 7.75) with 0.2 ⁇ Ci R e ⁇ labeled chloramphenicol and 0.1 mM Acetyl Coenzyme A, for 3 hours at 37°C. After autoradiography, spots were cut out, counted, and the percentage of acetylated chloramphenicol was calculated.
  • the endogenous H-ras promoter contains six Spl- binding sites, several other transcriptional regulatory elements, but no TATA box element.
  • Honkawa et al . Mol . Cell . Biol . 7 : 2933-40 (1987); Ishii et al . , Science 232: 1410-43 (1986); Ishii et al . , Science 232: 1378-81 (1985); Lee et al . , J. Mol . Biol . 220: 599-611 (1991); Lu et al . , J. Biol . Chem . 269: 5391-402 (1994); Nagase et al . , Gene 94: 249-53 (1990).
  • H-ras promoter construct Different multiple transcription start point regions have been reported depending on the H-ras promoter construct being studied. While mutational studies have indicated that Spl-binding sites and other transcriptional regulatory elements were important for H-ras transcription, the relative effect of a particular mutation was sensitive to the promoter construct within which it occurred. Therefore, studies for defining the critical elements within the H-ras promoter and/or transcription initiation complex that respond to HHV-6A ts would be very difficult to interpret.
  • the HIV-l LTR promoter contains defined transcriptional regulatory elements, including Spl site(s) that are required for both basal and activated transcription. Furthermore, the AAV-2 Rep68/78 gene has been demonstrated to suppress transcription by the HIV-l promoter. Antoni et al . , J.
  • HIV-l promoter was chosen to elucidate the transcriptional regulatory elements required for ts suppression.
  • the effect of ts on the HIV-l promoter was analyzed in a CD4+ human T-cell line, 12D7, the natural host for both HIV-l and HHV-6.
  • Cell line 12D7 is a clonal derivative of A3.01 CEM cells. Kashanchi et al . , J.
  • the cells were maintained in RPMI 1640 (Sigma) supplemented with 10% fetal calf serum (Gibco BRL) , penicillin (100 units/ml) and streptomycin (100 ⁇ g/ml) .
  • Cells were electroporated by the method of Kashanchi et al . , Nucl . Acids Res . 20: 4673-74 (1992). After electroporation, cells were cultured at 37°C, 8% C0 2 for 20 hours. Harvested cells were extracted for CAT assays.
  • pRc-ts was used with ts under the control of a strong promoter for human cells; pRc-ts(A), the anti-sense construct was used as a negative control.
  • ts consistently suppressed CAT activity expressed from the wild-type HIV-l promoter construct, CD-12 ( Figure 6A) in a dose dependent manner ( Figures 6B and 7B) ; the range of suppression by 20 ⁇ g of pRC-ts was between 70 and 97%.
  • LTR N1Spldel -CAT contained a deletion of all three Spl sites as well as a second deletion of one of the two NFKB sites
  • LTR Sp ⁇ m -CAT had double point mutations in each of the Spl sites ( Figure 6A) .
  • CD-23, -52, and -54 deletion CAT constructs contain -117 to +80, -65 to +80, and -48 to +80 of the HIV-l LTR. See Ensoli et al . , EMBO J. 8: 3019-27 (1989).
  • TM29 and TM26 were examined for their effect on ts suppression. See Rounseville et al . , J. Virol . 66: 1688-94 (1992).
  • TM29- CAT is deleted in the "Bulge” sequence and TM26-CAT has transversion base substitutions in all of the nucleotides of both the "Bulge” and "Loop" sequences ( Figure. 7A) .
  • CAT expression from either TM29- or TM26-CAT was never suppressed by pRc-ts in repeated experiments ( Figure 7B) . Therefore, TAR is one of the critical element(s) for ts suppression.
  • TAR mutant constructs TM29- and TM26-CAT were insensitive to ts suppression, demonstrating that the downstream TAR element was critical. Because the transversion mutations within the TAR "Bulge” and “Loop” of TM26 would not be expected to significantly alter the three dimensional structure of the TAR containing RNA, changes to the primary structure are probably more important.
  • the observation that ts suppress both the H-ras and HIV-l LTR promoters but not MSVLTR may be due to a common binding site for ts protein. An indication of such a site comes from studies which identified the Rep binding site, (GCTC) 3 within the AAV-2 inverted terminal repeat. See Chiorini et al . , J . Virol .
  • HIV-l LTR mutant constructs CD-23, CD-52, or CD-54 lacking the NRE exhibited equal or greater ts suppression of basal expression.
  • NIH 3T3 cells were stably transfected with pRc-ts containing the ts gene under control of the Rous sarcoma virus (RSV) long terminal repeat (LTR) using the following methodology:
  • RSV Rous sarcoma virus
  • LTR long terminal repeat
  • pRc-ts and pRc-ts(A) constructs contain the ts gene cloned into pRc-RSV (Invitrogen) under the control of the RSV promoter in the sense and antisense orientations, respectively, as described in Araujo et al . , (1995) , supra .
  • pET14b-ts was constructed by cloning a 1509 bp PCR amplified product, synthesized with GGGAGGCGCAAACCATATG and AAGGATCCGTGGTCTTTTAAGATCTG primers, into the Ndel and BamHl sites of the bacterial expression vector, pET14b (Novagen) .
  • pLNCts was constructed by subcloning the Hindlll fragment containing ts from pRc-ts into the Hindlll site of the retroviral vector, PLNCX. Miller et al . , Biotechniques 7 : 980-90 (1989) .
  • pCHC6-CAT containing CAT expressed by the HCMV immediate early promoter, as provided by Dr. Francis Kern.
  • pBPV-69T contains the 69% transforming region of BPV-l. Lowy et al . , Nature 287: 72-74 (1980).
  • the BPV-1 CAT constructs pl066 and p805-88 contain the E6 and E2 promoters, respectively. Spalholz et al .
  • pURR16CAT contains the CAT gene under the control of the HPV-16 E6 promoter.
  • the initiating ATG of the E6 gene was mutated by PCR to AGTG, creating a PstI site.
  • the PstI fragment containing bp 7004-7103 of HPV-16 was cloned into the PstI site of pBLCAT3. Luckow et al . , Nucleic Acids Res . 15: 5490 (1987).
  • NIH 3T3 cells were maintained as a subconfluent monolayer in Dulbecco's modified Eagle's medium
  • Transient transfections were performed by the calcium phosphate method as described in Chen (1987) , supra .
  • 3T3-pRc, 3T3-ts and 3T3-ts-(A) colonies were isolated and maintained in culture media supplemented with 200 ⁇ g/ml geneticin.
  • pLNCX is a retroviral vector carrying the HCMV "immediate early" promoter for expression in mammalian cells and a neomycin resistance marker. (Miller et al . , (1980) , supra .
  • pLNCX and pLNCts were transfected into GP+E 86 ecotropic packaging cells. Supernatants, containing LNCX, LNCts and LNCtsTTL 125 retrovirus, were harvested 2 days post-transfection and used to infect PA137 a photropic packaging cells.
  • Clonal producer populations were selected by G418: the titer of each of 50 producer clones for each retrovirus was assayed by determining the frequency of G418 resistance of infected NIH 3T3 cells. The 3 highest titer producer clones (> 10 6 infectious particles/ml) for each retrovirus were selected for further use. Furthermore, four 3T3-LNCts and one 3T3-LNCX independently derived colonies were isolated to develop into cell lines.
  • cells were transfected with 1 ⁇ g of pBPV-69T plus indicated amounts of pts2.6 or pts2.6/TTL constructs. When necessary, the total amount of plasmid DNA was adjusted to 5 ⁇ g with pBluescript (Stratagene) DNA.
  • Protein was separated by 4-20 % SDS-PAGE, transferred to the PVDF Immobilon-P membrane (Millipore) , Western blotted with Ab-679, anti-ts serum (1:5,000), and detected with the "Western-Light" chemiluminescent detection system (TROPIX) employing goat anti-rabbit IgG conjugated to alkaline phosphatase.
  • TROPIX "Western-Light" chemiluminescent detection system
  • NIH 3T3 or ts expressing cells were transfected with one of the reporter CAT plasmid prasCATl (20 ⁇ g) , pMSVLTR-CAT (20 ⁇ g) , pCHC6-CAT (5 ⁇ g) , pl066 (20 ⁇ g) , p80588 (20 ⁇ g) , or pURR16CAT (20 ⁇ g) . After 48 hours, extracts were prepared and the protein levels were determined.
  • Extracts 10 ⁇ g for prasCATl, pMSVLTR-CAT and pCHC6-CAT, and 20 ⁇ g for pl066, p805-88, and pURR16CAT were incubated in 52 ⁇ l reaction mixtures in 0.25 M Tris (pH 7.75) with 0.05 pCi of 14 C-labeled chloramphenicol and 0.02 mM acetyl coenzyme A for 3 hours at 37°C. Acetylated chloramphenicol species were separated by thin layer chromatography. After autoradiography, spots were cut out and counted, and the percent acetylated chloramphenicol was calculated.
  • 3T3-ts-l yielded 10% of EJ-H-ras induced foci compared to NIH 3T3 or 3T3-ts(A)-l (Fig. 9A) .
  • no reduction of foci was observed in 3T3-ts-l after transfection with pMSVLTR-ras.
  • Figures IOA and B depict data from a comparison of cell lines expressing vector alone (12D7/RC-1) , wild-type ts
  • H-ras is elevated in a number of human cancers. See Varmus, Rev . Genet . 18: 553-612 (1984). As discussed above, activated H-ras has been identified in many human malignancies, including carcinomas of the (1) bladder (2) lung (3) breast and (4) urinary tract, as well as melanomas. Furthermore, over 95% of human cervical cancer is associated with the retention and expression of the E6 and E7 genes of human papillomavirus (HPV) . Accordingly, therapies that would lead to the attenuation of the H-ras gene or HPV E6 and E7 will control or cure a significant number of human cancers.
  • HPV human papillomavirus
  • pts2.6 was a ⁇ effective in suppressing BPV transformation ( Figure 11) as it was for H-ras, discussed above (see Figure 4C) .
  • TTL mutations in pts2.6 eliminated the ability of ts to suppress papillomavirus transformation, confirming the functional role of the ts gene.
  • BPV-1 promoters p89 or p2443, which express mRNAs that encode the E5 gene were tested.
  • 3T3-ts cell lines were transfected with plasmids containing the CAT gene under control of p89 (pl066) or p2443 (p805-88) .
  • p89 construct CAT activity was lower in the three 3T3-ts cell lines relative to NIH 3T3 cells by 56 to 82%.
  • p2443 construct CAT activity was lower by 73 to 89% (Fig. 15A and B) .
  • the suppression of BPV-1 transformant by ts was due to suppression of transcription.
  • ts suppression was demonstrated because similar levels of CAT activity were observed in NIH 3T3 and 3T3-ts cell lines after transfection with either pCHC6CAT, where CAT was expressed from the HCMV immediate early promoter (Fig. 15C) or pMSVLTR-CAT (data not shown) . Ts was also tested for its ability to suppress human papillomavirus type 16 (HPV-16) expression.
  • HPV-16 human papillomavirus type 16
  • An HPV 16 p97 CAT construct (pURR16CAT) was tested for expression of CAT activity after transfection in the 3T3-ts cell lines. As in the case of the BPV-1 promoter CAT constructs, the three 3T3-ts cell lines exhibited 70 to 88% less CAT activity (Fig. 15D) than did NIH 3T3 cells after transfection with pURRl6CAT.
  • the plasmid, pRc-ts that was shown above both to suppress H-ras and BPV transformation and to establish 3T3-ts cell lines, is constructed utilizing an 1,803 bp PCR amplified ts sequence with terminal Hindlll sites provided by the PCR primers. This Hindlll ts fragment is isolated from pRc-ts, gel purified, and cloned into the Hindlll site of the retroviral vector construct, pLNCX. Miller et al . , Biotechnique ⁇ 7 : 980-990 (1989).
  • This vector system will be employed because (i) it contains the neomycin phosphotransferase gene expressed from the retroviral LTR as a selectable marker, (ii) it contains a Hindlll cloning site for high expression in human cells of an inserted gene from the human cytomegalovirus immediate early promoter, (iii) it yields high-titer virus stocks after introduction into retroviral packaging cells, and (iv) it avoids homologous overlap with viral DNA sequences present in the packaging cells preventing unwanted helper virus production.
  • the antisense-ts construct, pLNCts(A) are constructed.
  • pLNCts and pLNCts(A) are transfected into GP+E 86 ecotropic packaging cells. Markowitz et al . , J. Virol . 62: 1120-1124 (1988). After 2 days, supernatants containing sense and antisense ts retrovirus are used to infect PA317 amphotropic packaging cells. Miller et al . , Mol . Cell . Biol . 6: 2895-2902 (1986) . This "transinfection" method is chosen because it results in high titers due to more efficient expression by an integrated provirus. Hwang et al . , J. Virol . 50: 417-424 (1984). Clonal producer populations will be selected by G418-resistance.
  • the highest producing clones are be determined by quantitative analysis of G418 resistant NIH 3T3 colonies subsequent to infection by producer stocks. Fifty producer clones are be screened for each construct to assure the establishment of high titer producer clones. The chosen producer clones are tested to make sure that they are not also producing helper virus. EXAMPLE 9: SUPPRESSION OF H-.RAS TRANSFORMATION IN TS
  • Ts expressing NIH 3T3 cell lines also were established by retroviral infection employing LNCts followed by G418 selection.
  • NIH 3T3 cells were infected with the LNCX vector.
  • 3T3-LNCts-l, ts-2, ts-3, and ts-4 cells exhibited 93 to 98% fewer transformed foci than did 3T3- LNCX-1 cells (Fig. 14) .
  • ts can be effectively transferred by a high efficiency retroviral infection system.
  • EXAMPLE 10 VECTORS FOR USE WITH TS GENE THERAPY
  • the present invention is amenable for use with a variety of vectors for gene therapy.
  • the invention includes construction of a vector containing the gene encoding the ts protein, and administering such a vector to the target site.
  • Such gene therapy will enhance the efficacy of traditional chemotherapy, which is administered according to established protocols.
  • a recombinant vector containing the gene encoding ts can be achieved by any of the methods well-known in the art for the insertion of exogenous DNA into a vector. See, e . g. , Maniatis et al . , Molecular Cloning (Cold Spring Harbor Press 2d ed. 1989) . In addition, the prior art teaches various methods of introducing exogenous genes into cells in vivo . See Rosenberg et al . , Science 242: 1575-1578 (1988) and Wolff et al . , Proc . Nat ' l Acad . Sci . USA 86: 9011-9014 (1989) .
  • the routes of delivery include systemic administration and administration in situ .
  • Well-known techniques include systemic administration with cationic liposomes, and administration in situ with viral vectors. Any one of the known gene delivery methodologies is suitable for the introduction of a recombinant vector containing the ts gene according to the invention.
  • a listing of present-day vectors suitable for the purpose of this invention is set forth in Hodgson, Bio /Technology 13 : 222 (1995).
  • liposome-mediated gene transfer is a suitable method for the introduction of a recombinant vector containing the gene encoding ts according to the invention.
  • a cationic liposome such as DC- Chol/DOPE liposome
  • Liposomes transfer genes to the target cells by fusing with the plasma membrane.
  • liposome-DNA complex has no inherent mechanism to deliver the DNA to the nucleus. As such, the most of the lipid and DNA gets shunted to cytoplasmic waste systems and destroyed.
  • liposomes as a gene therapy vector is that liposomes contain no proteins. which thus minimizes the potential of host immune responses.
  • Viral vector-mediated gene transfer also is a suitable method for the introduction of a recombinant vector containing the gene encoding ts .
  • Appropriate viral vectors include adenovirus vectors and adeno- associated virus vectors, retrovirus vectors and herpesvirus vectors.
  • Adenovirus vectors can be used to introduce the gene encoding ts according to the invention.
  • Adenoviruses are linear, double stranded DNA viruses complexed with core proteins and surrounded by capsid proteins.
  • the common serotypes 2 and 5 which are not associated with any human malignancies, are typically the base vectors.
  • the virus becomes a replication deficient vector capable of transferring the exogenous DNA to differentiated, non-proliferating cells.
  • the adenovirus fiber interacts with specific receptors on the cell surface, and the adenovirus surface proteins interact with the cell surface integrins.
  • the virus penton-cell integrin interaction provides the signal that brings the exogenous gene-containing virus into a cytoplasmic endosome.
  • the adenovirus breaks out of the endosome and moves to the nucleus, the viral capsid falls apart, and the exogenous DNA enters the cell nucleus where it functions, in an epichromosomal fashion, to express the exogenous gene.
  • adenoviral vectors for gene therapy can be found in Berkner, Biotechniques 6 : 616-29 (1988) and Trapnell, Advanced Drug Delivery Rev . 12 : 185-99 (1993).
  • Adenovirus-derived vectors are characterized by their ability to accommodate exogenous DNA of 7.5 kb, relative stability, wide host range, low pathogenicity in man, and high titers (IO 4 to IO 5 plaque forming units per cell) . See Stratford-Perricaudet et al . , Proc . Nat ' l Acad . Sci . USA 89: 2581 (1992).
  • Adeno-associated virus (AAV) vectors can be used also to introduce the gene encoding ts according to the invention.
  • AAV is a linear single- stranded DNA parvovirus that is endogenous to many mammalian species.
  • AAV has a broad host range despite the limitation that AAV is a defective parvovirus which is dependent totally on either adenovirus or herpesvirus for its reproduction in vivo .
  • the use of AAV as a vector for the introduction into target cells of exogenous DNA is well-known in the art. See, e . g . , Lebkowski et al . , Mole . & Cell . Biol . 8:3988 (1988) .
  • the capsid gene of AAV is replaced by a desired DNA fragment, and transcomplementation of the deleted capsid function is used to create a recombinant virus stock.
  • the recombinant viru ⁇ uncoats in the nucleus and integrates into the host genome.
  • Another suitable virus-based gene delivery mechanism is retroviral vector-mediated gene transfer.
  • retroviral vectors are well-known in the art. See Breakfield et al . , Mole . Neuro . Biol . 1:339 (1987) and Shih et al . , in Vaccines 85: 177 (Cold Spring Harbor Press 1985) .
  • retroviral vectors and retroviral vector-producing cell lines can be used to introduce DNA encoding ts .
  • Appropriate retroviral vectors include Moloney Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus. These vectors include replication-competent and replication-defective retroviral vectors. In addition, amphotropic and xenotropic retroviral vectors can be used.
  • retroviral vectors can be introduced to a tumor directly or in the form of free retroviral vector producing-cell lines.
  • Suitable producer cells include fibroblasts, neurons, glial cells, keratinocytes, hepatocytes, connective tissue cells, ependymal cells, chromaffin cell ⁇ . See Wolff et al . , Proc . Nat ' l Acad . Sci . USA 84: 3344 (1989) .
  • Retroviral vectors generally are constructed such that the majority of its structural genes are deleted or replaced by exogenous DNA of interest, and such that the likelihood is reduced that viral proteins will be expressed. See Bender et al . , J . Virol . 61:1639 (1987) and Armento et al . , J . Virol . 61 : 1647 (1987).
  • the necessity for host cell replication for retroviral gene expression is not a problem with tumor cells, which are highly replicative, A few normal tissues that a replicative, such as endothelial cells that line the blood vessels that supply blood to the tumor, theoretically are most likely to be transduced by a retroviral vector.
  • a retroviral vector would integrate into white blood cells both in the tumor or in the blood circulating through the tumor.
  • retroviral vector to normal tissues, however, is limited.
  • the local administration to a tumor of a retroviral vector or retroviral vector producing cells will restrict vector propagation to the local region of the tumor, minimizing transduction, integration, expression and subsequent cytotoxic effect on surrounding cells that are mitotically active.
  • replicatively deficient and replicatively competent retroviral vectors can be used in the invention, subject to their respective advantages and disadvantages.
  • the direct injection of cell lines that produce replication-deficient vectors may not deliver the vector to a large enough area to completely eradicate the tumor, since the vector will be released only form the original producer cells and their progeny, and diffusion is limited.
  • Similar constraints apply to the application of replication deficient vectors to tumors that grow slowly, such as human breast cancers which typically have doubling times of 30 days versus the 24 hours common among human gliomas.
  • the much shortened survival-time of the producer cells probably no more than 7-14 days in the absence of immunosuppression, limits to only a portion of their replicative cycle the exposure of the tumor cells to the retroviral vector.
  • replication-defective retroviruses for treating tumors requires producer cells and is limited because each replication-defective retrovirus particle can enter only a single cell and cannot productively infect others thereafter. Because these replication- defective retroviruses cannot spread to other tumor cells, they would be unable to completely penetrate a deep, multilayered tumor in vivo . See Markert et al . , Neurosurg. 77: 590 (1992).
  • the injection of replication- competent retroviral vector particles or a cell line that produces a replication-competent retroviral vector virus may prove to be a more effective therapeutic because a replication competent retroviral vector will establish a productive infection that will transduce cells as long as it persists.
  • replicatively competent retroviral vectors may follow the tumor as it metastasizes, carried along and propagated by transduced tumor cells.
  • amphotropic and xenotropic retroviral vectors may be used in the invention.
  • Amphotropic virus have a very broad host range that includes most or all mammalian cells, as is well known to the art.
  • Xenotropic viruses can infect all mammalian cells except mouse cells.
  • amphotropic and xenotropic retroviruses from many species, including cows, sheep, pigs, dogs, cats, rats, and mice, inter alia can be used to provide retroviral vectors in accordance with the invention, provided the vectors can transfer genes into proliferating human cells in vivo.
  • Retroviral vector-containing cell ⁇ have been implanted into brain tumor ⁇ growing in human patient ⁇ . See Oldfield et al . , Hum . Gene Ther . 4 : 39 (1993). These retroviral vectors carried the HSV-1 thymidine kinase (HSV-tk) gene into the surrounding brain tumor cells, which conferred sensitivity of the tumor cells to the antiviral drug ganciclovir.
  • HSV-1 thymidine kinase HSV-1 thymidine kinase
  • Some of the limitations of current retroviral based cancer therapy, as described by Oldfield are: (1) the low titer of virus produced, (2) virus spread is limited to the region surrounding the producer cell implant, (3) possible immune response to the producer cell line, (4) possible insertional mutagenesis and transformation of retroviral infected cells, (5) only a single treatment regimen of pro-drug, ganciclovir, is possible because the "suicide" product kills retrovirally infected cells and producer cells and (6) the bystander effect is limited to cells in direct contact with retrovirally transformed cells. See Bi et al.. Human Gene Therapy 4 : 725 (1993) .
  • herpesvirus vector-mediated gene transfer Another suitable virus-based gene delivery mechanism is herpesvirus vector-mediated gene transfer. While much less is known about the use of herpesvirus vectors, replication-competent HSV-1 viral vectors have been described in the context of antitumor therapy. See Martuza et al . , Science 252 : 854 (1991).
  • known anchorage independent and tumorigenic human cancer derived cell lines either (i) containing an activated H-ras gene or (ii) from cervical cancer containing known HPV type E6 and E7 genes are tested to determine if the delivery of the ts gene to these cells will reverse or suppress their anchorage independence and tumorigenic phenotype.
  • Two human cell lines with activated H-ras genes that arise from different tissue types are studied initially to determine if ts gene therapy can be effective against H-ras-involved cancer. For example, Hs 578T cells, derived from a carcinoma of the breast, and T24 cells, derived from the primary tumor of a transitional cell bladder carcinoma, as well as three cervical cancer cell lines, are studied.
  • HeLa cells are obtained from an adenocarcinoma, and contain HPV 18 sequences.
  • CaSki and SiHa isolated respectively from an epidermoid and a squamous carcinoma, contain HPV 16 DNA (CaSki has high copy number whereas SiHa has a low copy number) . All cell lines can be obtained from the American Type Culture Collection.
  • each cell line is plated at a density of 10 s cells per 100mm dish, allowed to grow overnight, and infected with a multiplicity of infection of between 3 and 10. After 48 hours, the antibiotic G418 will be added to the cultures to select LNCts infected cells. The appropriate concentration of G418 for optimal selection of each cell line is pre ⁇ determined for each cell line studied using infection of LNCX virus. Antisense ts cell lines also are established as negative controls. The selected cell lines is examined by Southern and Northern blot analysis and/or RT-PCR to verify the presence and expression of the ts gene.
  • LNCts infected cells To determine whether the LNCts infected cells have lost their ability to grow in an anchorage dependent manner, 5 X 10 3 to 5 X 10 5 cells are seeded into agarose top agar. After 3 weeks of culture, the dishes will be assessed for the presence of colonies. For tumorigenicity studies, 10 7 selected cells will be injected dorsally into nu/nu mice (5 per cell line) . The animals will be examined weekly for the appearance of tumors. When tumors reach 1 cm in diameter, they will be excised; half the tissue will be fixed in formalin for histologic examination and half will be frozen for DNA, RNA, and protein analysis of ts sequences. Cell lines infected with either LNCX or LNCts(A) virus will be used as controls for the anchorage independence and tumorigenicity studies.

Abstract

Le gène suppresseur (ts) de la transcription de VHH-6 agit sur la transcription en bloquant l'expression du promoteur LTR du VIH et du gène H-ras, un gène chez lequel une activation de la mutation est associée avec de nombreux cancers humains. Le gène ts est introduit dans les cellules au moyen d'un vecteur acceptable sur le plan pharmaceutique et il agit comme agent préventif ou comme agent thérapeutique contre le cancer ou contre les infections virales.
PCT/US1996/011222 1995-07-10 1996-07-09 Therapie genetique utilisant le gene ts derive de la souche vhh-6a ou le polypeptide correspondant WO1997002841A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU64081/96A AU6408196A (en) 1995-07-10 1996-07-09 Genetic therapy employing the hhv-6a derived ts gene or polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US101095P 1995-07-10 1995-07-10
US60/001,010 1995-07-10

Publications (1)

Publication Number Publication Date
WO1997002841A1 true WO1997002841A1 (fr) 1997-01-30

Family

ID=21693952

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/011222 WO1997002841A1 (fr) 1995-07-10 1996-07-09 Therapie genetique utilisant le gene ts derive de la souche vhh-6a ou le polypeptide correspondant

Country Status (2)

Country Link
AU (1) AU6408196A (fr)
WO (1) WO1997002841A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009149910A1 (fr) * 2008-06-12 2009-12-17 Biopharm Technology Corporation Compositions anti-angiogéniques et leurs applications thérapeutiques
US7853795B2 (en) 2002-02-25 2010-12-14 Network Resonance, Inc. System, method and computer program product for guaranteeing electronic transactions

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CANCER RESEARCH, Volume 51, issued 01 July 1991, HERMONAT, "Inhibition of H-ras Expression by the Adeno-Associated Virus Rep78 Transformation Suppressor Gene Product", pages 3373-3377. *
JOURNAL OF VIROLOGY, Volume 69, Number 08, issued August 1995, ARAUJO et al., "Human Herpesvirus 6A TS Suppresses both Transformation by H-ras and Transcription by the H-ras and Human Immunodeficiency Virus Type 1 Promoters", pages 4933-4940. *
NATURE, Volume 351, issued 02 May 1991, THOMSON et al., "Acquisition of the Human Adeno-Associated Virus Type 2 Rep Gene by Human Herpesvirus Type-6", pages 78-80. *
SCIENCE, Volume 269, issued 25 August 1995, MARSHALL, "Gene Therapy's Growing Pains. With More than 100 Clinical Trials Started and Hundreds of Millions of Dollars at Stake, the Field is Struggling to Meet Expectations", pages 1050-1055. *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7853795B2 (en) 2002-02-25 2010-12-14 Network Resonance, Inc. System, method and computer program product for guaranteeing electronic transactions
WO2009149910A1 (fr) * 2008-06-12 2009-12-17 Biopharm Technology Corporation Compositions anti-angiogéniques et leurs applications thérapeutiques

Also Published As

Publication number Publication date
AU6408196A (en) 1997-02-10

Similar Documents

Publication Publication Date Title
AU784910B2 (en) Lentiviral triplex DNA, and vectors and recombinant cells containing lentiviral triplex DNA
EP0454781B1 (fr) Cellules de recombinaison pour des therapies d'infections et de troubles hyperproliferatifs et la preparation de ces cellules
US5837510A (en) Methods and polynucleotide constructs for treating host cells for infection or hyperproliferative disorders
JP4981231B2 (ja) レトロウイルスパッケージング細胞での発現のためのコドン最適化
Takada et al. Cytoplasmic retention of the p53 tumor suppressor gene product is observed in the hepatitis B virus X gene-transfected cells
Kashanchi et al. Involvement of transcription factor YB-1 in human T-cell lymphotropic virus type I basal gene expression
WO2002012514A2 (fr) Promoteur jet
Chen et al. Intra-and extracellular immunization against HIV-1 infection with lymphocytes transduced with an AAV vector expressing a human anti-gp120 antibody
AU696399B2 (en) Delivery system controlled through factors associated with HIV and cell
Wang et al. Activation of Bcl-2 promoter-directed gene expression by the human immunodeficiency virus type-1 Tat protein
EP0870018B1 (fr) Produits de synthese de vecteurs antitumoraux et procedes correspondants
KR100336551B1 (ko) 망막아종 단백질의 조직 특이적 발현
WO1997002841A1 (fr) Therapie genetique utilisant le gene ts derive de la souche vhh-6a ou le polypeptide correspondant
US20020055173A1 (en) Method for preparing adenovirus vectors, vectors so prepared, and uses thereof
WO1995027494A1 (fr) VECTEURS DE VIRUS HERPES DEFECTIFS ET DE VIRUS ADENO-ASSOCIES DEFECTIFS COMPORTANT p53 ET DESTINES AU TRAITEMENT DU CANCER
US7541343B2 (en) Inhibiting cellular proliferation by expressing yin yang-1
JPH11506325A (ja) Δｐ６２、その変異体、核酸配列及びこれらの使用
Kakidani et al. Suppressive effect of liposomes containing DNA coding for diphtheria toxin A-chain on cells transformed with bovine leukemia virus
CA2047363C (fr) Therapies a base de recombinaison pour les infections et troubles hyperproliferatifs
JP2003500050A (ja) 改善されたベクターの選択方法
AU2002308413B2 (en) Yin yang 1
Kim A simple human immunodeficiency virus vector system for selective infection of CD4 (+) cells and inducible expression of foreign genes
WO2001016167A2 (fr) INTERACTION DE LA β-CATENINE, TCF-4, ET DE L'APC DANS LA PREVENTION DU CANCER
RAMEZANI et al. Combinatorial Incorporation of Enhancer-Blocking Components of the Chicken-Globin 5 HS4 and Human T-Cell Receptor/BEAD-1 Insulators in Self-Inactivating Retroviral Vectors Reduces Their Genotoxic Potential
WO2004016228A2 (fr) Proteines htlv-i p30ii et p12i utilisees en tant que cibles therapeutiques chez des individus infectes par le virus htvl-i

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase

Ref country code: CA

122 Ep: pct application non-entry in european phase