WO1996040939A2 - Expression of functional vertebrate phospholipases in yeast - Google Patents

Expression of functional vertebrate phospholipases in yeast Download PDF

Info

Publication number
WO1996040939A2
WO1996040939A2 PCT/US1996/010002 US9610002W WO9640939A2 WO 1996040939 A2 WO1996040939 A2 WO 1996040939A2 US 9610002 W US9610002 W US 9610002W WO 9640939 A2 WO9640939 A2 WO 9640939A2
Authority
WO
WIPO (PCT)
Prior art keywords
receptor
phospholipase
cell
heterologous
yeast
Prior art date
Application number
PCT/US1996/010002
Other languages
French (fr)
Other versions
WO1996040939A3 (en
Inventor
Jeremy I. Paul
James R. Broach
Original Assignee
Cadus Pharmaceutical Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cadus Pharmaceutical Corporation filed Critical Cadus Pharmaceutical Corporation
Priority to JP50214497A priority Critical patent/JP2001507201A/en
Priority to EP96918448A priority patent/EP0832248A2/en
Priority to AU61108/96A priority patent/AU6110896A/en
Publication of WO1996040939A2 publication Critical patent/WO1996040939A2/en
Publication of WO1996040939A3 publication Critical patent/WO1996040939A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4722—G-proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters

Definitions

  • This invention relates to functional expression of heterologous phospholipases in yeast, the recombinant yeast cells, and methods for using the engineered cells, including, inter alia, the identification of agonists and antagonists of signal transduction pathways which involve phospholipases.
  • Eukaryotic phospholipases are known to be involved in cellular signal transduction processes important in regulation of cellular growth, differentiation and secretory events in numerous cell types.
  • the binding of agonists to certain cell surface receptors leads to the generation of a variety of signaling molecules which include phospholipid derived second messengers.
  • the phospholipid-derived second messengers mediate both transient and sustained responses and are implicated in a wide variety of physiological responses including growth regulation, immune modulation and neurotransmission.
  • membrane lipids serve as substrates for the variety of different phospholipases that are responsible for the generation of phospholipid derived second messengers.
  • phosphatidylinositols the substrate for phospholipase C enzymes, see below
  • phosphatidylcholine the substrate for phospholipase C enzymes, see below
  • phosphatidylcholine the substrate for phospholipase C enzymes, see below
  • phosphatidylcholine the substrate for phospholipase C enzymes, see below
  • phosphatidylcholine phosphatidylcholine
  • phosphatidylethanolamine phosphatidylethanolamine
  • sphingolipids e.g. sphingomyelin, sphingosine, sphingosine phosphate and sphingosine phosphocholine. See Dicheva and Irvine (1995) Cell 80:269-278 for a recent review.
  • phospholipase activities known to be responsible for the generation of phospholipid second messengers, namely phospholipase A (including phospholipases Ai and A2), phospholipase B, phospholipase C, phospholipase D and sphingomyelinase.
  • phospholipase A including phospholipases Ai and A2
  • phospholipase B including phospholipases Ai and A2
  • phospholipase C phospholipase C
  • phospholipase D phospholipase D
  • sphingomyelinase sphingomyelinase
  • PLAi and PLA2 catalyze the release of fatty acids, in particular arachidonic acid (AA), from the sn ⁇ and snl positions of 1,2-diacylglycerol, 3- phosphocholines, generating AA and lysophosphorylcholine (lyso-PC) respectively.
  • AA arachidonic acid
  • AA has at least four known metabolic fates, namely, generation of proinflammatory eicosanoids (leukotrienes and prostaglandins), reincorporation into existing membrane phospholipids, reincorporation into soluble phospholipid metabolic pathways, and direct secretion from cells.
  • lyso-PC serves as the precursor for the production of lipid second messengers like platelet activating factor (PAF).
  • PAF platelet activating factor
  • cDNA and genomic clones encoding the pancreatic form of PLA2 have been isolated from a variety of eukaryotic sources including bovine (Tanaka et al. 1987), rat (Ohara, O. et al. 1986 and 1990; and Kusunoki, et al. 1990), dog (Kerfelec et al. 1986),and pig (Seilhamer et al. 1986).
  • cPLA.2 cellular PLA2
  • cPLA.2 cellular PLA2
  • the 85kDa gene product encoded by these cDNAs is expressed in cells types involved in the inflammatory response (neutrophils, platelets, monocytes and macrophages) and its expression is regulated by, for example, tumor necrosis factor, IL-1, TGF- ⁇ , MCSF and glucocorticoids.
  • PLB Phospholipase B
  • PLB isoforms have several catalytic properties including the release of fatty acids from the sn ⁇ and sn2 positions of phospholipids (as with PLAj and PLA2), the release of fatty acids from lysopholipids, and in the yeast Saccharomyces cerevisiae, acyltransferase activity that catalyzes the synthesis of phospholipids from lysophospholipids (Kuwabara et al. 1989; Gassama-Diagne 1989; and Lee et al. 1994). Genomic clones for PLB-like enzymes have been isolated from several sources including S. cerevisiae (Lee et al. 1994) and Penicillium notatum (Masuda et al. 1991).
  • PLC Phospholipase C enzymes
  • PLC- ⁇ , - ⁇ , - ⁇ , and - ⁇ catalyze the hydrolysis of phosphatidylinositol (4,5) bisphosphate (PIP2) to form two second messengers, inositol 1,4,5-trisphosphate (IP3) which is involved in the mobilization of intracellular stores of calcium, and diacylglycerol (DAG), which binds to and activates selected isoforms of protein kinase C (PKC; E.C. 2.7.1.37).
  • Phospholipase D catalyzes the hydrolysis of phosphatidylcholines to yield phosphatidic acid (PA) and free choline (see Bishop, Pachter and Pai 1992; and Cook and Wakelam, 1992a).
  • PA or its lyso derivative, lyso- PA may function to stimulate hydrolysis of polyphosphoinositides, activation of PKC, inhibition of adenylyl cyclase and stimulation of DNA synthesis (Moolenaar et al, 1986; Murayama and Ui, 1987, Van Corven et al, 1989; and Plevin et al, 1991b. refs in Cook and Wakelam, 1992b), as well as activate kinases directly in a manner similar to DAG (Eppand and Stafford, 1990, and Bocckina and Exton, 1990, refs in Cook and Wakelam, 1992b).
  • phosphatidic acid formed by the action of PLD can be converted to DAG by the action of phosphatidic acid phosphohydrolase (E.C. 3.1.3.4), and thus serve as a secondary reservoir for the production of DAG by PLC-independent mechanisms (Bonser et al, 1989 cited in Divechia and Irvine 1995, review; and Cook and Wakelam, 1992b).
  • cDNA clones for phospholipase D have been isolated from a number of different species including Arcanobacterium haemolyticum (Cuevas, W.A., and J.G.L.
  • Phospholipase C enzymes are intracellular enzymatic mediators of a wide variety of cellular responses to extracellular stimuli. Binding of hormones, growth factors, neurotransmitters, and other agonists to specific cell surface receptors initiates the activation of PLC isozymes, which in turn result in the production of at least two well characterized active second messengers, inositol- 1,4,5-trisphophate (l.,4,5-IP3) and sn- ⁇ ,2- diacylglycerol (DAG).
  • PLC Phospholipase C enzymes
  • 1,4,5-IP3 binds to a specific family of intracellular receptors localized on modified portions of the endoplasmic reticulum that bears homology to the ryanodine receptor family of intracellular calcium channels (the IP3 receptor family, reviewed in Berridge, 1993). In addition to functioning as the IP3 receptor, these receptors also function as IP3-sensitive calcium channels which cause release of intracellular stores of calcium upon liganding with IP3.
  • PLC protein kinase C
  • MAPK Mitogen Activated Protein Kinase
  • JNK Jun Kinase
  • DAG forms a complex with phosphatidylserine and calcium and activates protein kinase C (PKC) isozymes, which in turn activate signaling pathways by direct phosphorylation of a variety of substrates which include adenylyl cyclases and RAF-1 (PJ. Parker et al, 1986; Coussens et al. 1986a, and Kolch et al. 1993).
  • PLCs The division of PLCs into four classes, ⁇ , ⁇ , ⁇ , ⁇ , ⁇ , originally corresponded to immunologically distinct proteins of 56 kDa, 150 kDa, 145 kDa, and 85 kDa purified from bovine brain (PLC- ⁇ , - ⁇ , and - ⁇ ) and other tissues including liver, seminal vesicles or uterus (PLC- ⁇ ). (Described in Suh et al. 1986; and summarized in A.J. Morris et al 1990).
  • PI phosphatidyl inositol
  • PIP phosphatidyl inositol 4-monophosphate
  • PIP2 phosphatidyl inositol- 4,5,bisphosphate
  • these immunologically distinct isozymes are distinguishable in several regards, not the least of which is that they are all unique gene products encoded by different genes, as discussed in further detail below. At the enzymatic level, these enzymes differ with respect to both their catalytic properties and their modes of regulation.
  • polyphosphoinositides are the preferred substrates for the PLC- ⁇ and - ⁇ classes at low or physiological intracellular calcium concentrations, while PLC- ⁇ isozymes prefer PI and PIP2 at physiological intracellular calcium concentrations.
  • the modes of regulation of PLC isozymes also differ considerably with respect to one another.
  • the PLC- ⁇ isozymes are activated in response to ligand binding to G-protein coupled receptors and are directly stimulated by G ⁇ and G ⁇ components of heterotrimeric G-proteins.
  • PLC- ⁇ isozymes are activated directly by phosphorylation via receptor and non-receptor tyrosine kinases.
  • PLC- ⁇ regulation While little is known about the regulation of PLC- ⁇ activity in vivo or in vitro, recent studies of PLC- ⁇ regulation suggest that it may be regulated by a novel class of regulatory proteins (pl22-RhoGAP) that show similarity to the GTPase activating protein homology region of bcr, display GAP activity towards RhoA, and bind to and directly stimulate PLC- ⁇ 1 (Homma, Y., and Y. Emori, 1995).
  • pl22-RhoGAP novel class of regulatory proteins
  • PLC- ⁇ cDNA clones have been isolated from a variety of sources including rat basophilic leukemia cells (Bennett et al. 1988), mouse lymphocytes (Hempel and DeFranco, 1991), and bovine tissue (Hirano et al, GenBank Accession number D 16235).
  • PLC- ⁇ encoding cDNAs encoding subtypes - ⁇ l-4 (Suh et al 1988; Bahk et al. 1994; Park et al. 1992; Lee et al. 1993; and Kim et al. 1993) have been reported.
  • PLC- ⁇ encoding cDNAs Two PLC- ⁇ encoding cDNAs have been reported, which correspond to PLC- ⁇ l and - ⁇ 2 subtypes (Emori et al. 1989; Suh, et al, 1988; and Burgess et al. 1990). Three PLC- ⁇ encoding cDNAs encoding subtypes PLC- ⁇ 1-3 have been published (reviewed in Cook and Wakelam, 1992b and Boyer et al, 1994).
  • PLC- ⁇ , - ⁇ ,and - ⁇ isozymes share considerable sequence homology, however, in two regions, variously referred to as the X and Y regions (Rhee et al, 1989) or regions I and II (Meldrum, et al. 1991).
  • the X region is approximately 150 amino acid residues in length, while the Y region is approximately 260 residues in length.
  • the X regions share approximately 50% identity, while the Y regions share approximately 40% identity in pairwise comparisons amongst PLC- ⁇ , - ⁇ , and - ⁇ isozymes. Based on the high degree of conservation of these two domains among the PLC- ⁇ , - ⁇ ,and - ⁇ isozymes, it has been argued that these regions contribute to the catalytic activity of these enzymes.
  • An additional feature of the spacer region between the X and Y regions is that in PLC- ⁇ , and - ⁇ classes, these regions are separated by 50-100 residues rich in serine, threonine and acidic residues with no particular homology to known regulatory motifs, while in the PLC- ⁇ class the X and Y regions are separated by more than 400 residues.
  • This region of the PLC- ⁇ isoforms encodes two src homology 2 (SH2) domains and one src homology 3 (SH3) domain, which are not present in either PLC- ⁇ or - ⁇ enzymes.
  • SH2 domains are involved in regulation of PLC- ⁇ activation by receptor and non-receptor tyrosine kinases.
  • PLC- ⁇ encodes neither the highly conserved X or Y regions found in all other PLC isoforms nor SH2 or SH3 domains found in PLC- ⁇ isoforms.
  • Yeast PLC In addition to the mammalian PLC- ⁇ isoforms discussed in the preceding sections, various PLCs have been isolated from several other organisms. Of considerable importance in this regard is the molecular cloning of the gene (PLC1) encoding a protein with homology to the PLC class of phospholipases from the yeast Saccharomyces cerevisiae (Yoko-O et al. 1993; Payne and Fitzgerald-Hayes, 1993; and Flick and Thorner, 1993).
  • Sequence analysis of the independently identified clones reveals first that all three clones are from the same genetic locus and that the protein coded for by this gene most resembles mammalian PLC- ⁇ isozymes both with respect to size of the enzyme encoded by it and with respect to structural features such as the relative distance between the X and Y domains, the size of the carboxyl terminal extension beyond the Y domain, and the absence of SH2 and SH3 domains between the X and Y motifs (this last point is to be expected as yeast show no evidence of phosphotyrosine modification by biochemical analyses).
  • yeast secretory pathway A wide variety of foreign proteins have been produced in S. cerevisiae, that remain in the yeast cytoplasm or are directed through the yeast secretory pathway (Kingsman et al. TIBTECH 5, 53 (1987). These proteins include, as examples, insulin-like growth factor receptor (Steube et al. Eur. J. Biochem. 198, 651 (1991), influenza virus hemagglutinin (Jabbar et al. Proc. Natl. Acad. Sci. 82, 2019 (1985), rat liver cytochrome P-450 (Oeda et al. DNA 4, 203 (1985) and functional mammalian antibodies (Wood et al. Nature 314, 446 (1985).
  • insulin-like growth factor receptor Steube et al. Eur. J. Biochem. 198, 651 (1991
  • influenza virus hemagglutinin Jabbar et al. Proc. Natl. Acad. Sci. 82, 2019 (19
  • yeast secretory pathway Use of the yeast secretory pathway is preferred since it increases the likelihood of achieving faithful folding, glycosylation and stability of the foreign protein.
  • expression of heterologous proteins in yeast often involves fusion of the signal sequences encoded in the genes of yeast secretory proteins (e.g., ⁇ -factor pheromone or the SUC2 [invertase] gene) to the coding region of foreign protein genes.
  • yeast expression vectors have been designed to permit the constitutive or regulated expression of foreign proteins.
  • Constitutive promoters are derived from highly expressed genes such as those encoding glycolytic enzymes like phosphoglycerate kinase (PGK1) or alcohol dehydrogenase I (ADH1) and regulatable promoters have been derived from a number of genes including the galactokinase (GAL1) gene.
  • PGK1 phosphoglycerate kinase
  • ADH1 alcohol dehydrogenase I
  • GAL1 galactokinase
  • supersecreting yeast mutants can be derived; these strains secrete mammalian proteins more efficiently and are used as "production" strains to generate large quantities of biologically ac' /e mammalian proteins in yeast (Moir and Davidow, Meth. in Enzymol. 194, 491 (1991).
  • Yoko-o et al. ((1993) Proc. Natl. Acad. Sci. USA 90:1804) claim to achieve complementation of a yeast PLC defect with an uncoupled rat PLC ⁇ l .
  • Yoko-o et al. report the cloning of PLC from S. cerevisiae by PCR methodology using primers designed to incorporate sequences from two conserved amino acid sequences found in the X-region of mammalian PLC enzymes After cloning the gene, they proceeded to make gene disruptions at the PLC1 locus.
  • Heterozygous diploid transformant (PLCl/plcl ::HIS3) were sporulated and tetrad analyses were performed.
  • TY1 background all four spores were found to be viable at a range of temperatures including 18°C, 30°C, and 37°C.
  • TY4 background Yoko-o et al. observed lethality at 30°Cin tetrad analyses. These phenotypes are in contradiction to those described herein, and those reported by Flick and Thorner in the art, where conditional lethality at 37°C is observed. This is important because it is not possible to measure complementation of a growth defect under the nonselective conditions of the Yoko-o et al experiments.
  • Arkinstall et al ((1995) Mol. Cell. Biol. 15:1431) expressed a mammalian platelet- derived growth factor ⁇ receptor and PLC ⁇ 2 in Schizosaccharomyces pombe. Arkinstall et al. found that in cells coexpressing the mouse PDGF ⁇ receptor and PLC ⁇ 2, levels of [-1H]inositol phosphates in radioactively labeled yeast cells were increased. Coexpression of c-src was also found to result in phospholipid hydrolysis. Because these experiments only measure the immediate biochemical consequence of phospholipase C ⁇ stimulation, this work also fails to teach the functional integration of a mammalian PLC ⁇ into a yeast cell.
  • Figure 1 is a graphic representation showing human phospholipases and G ⁇ l6 complementation of the plcl growth defect on high salt medium: S. cerevisiae strain CY1630 (MAT ⁇ plcl ⁇ l::His3 ade2-101 his3 ⁇ 200 leu2 ⁇ l lys2-801 trpl ⁇ l ura3-52) transformed with plasmids carrying each of the following as described in the text was streaked out in sectors 1-6: (1) Gallp-rat PLC- ⁇ l and GPAlp-G ⁇ l6; (2) CUPl-human PLC- ⁇ 2 and no G protein; (3) CUPl-human PLC- ⁇ 2 and GPAlp-G ⁇ i2-Q205L; (4) CUPl-human PLC- ⁇ 2 and GPAlp-G ⁇ S-Q227L; (5) CUPl-human PLC- ⁇ 2 and GPAlp-G ⁇ l6; (6) No PLC and GPA1-G ⁇ l6.
  • (+) represents growth and (-) represents no
  • the present invention relates to the functional expression of mammalian phospholipases in yeast cells.
  • the use of the engineered yeast cells in identifying potential inhibitors or activators of the mammalian phospholipase, or of other proteins which belong to a phospholipase signal transduction pathway, i.e., proteins which are naturally or artificially "coupled” to the mammalian phospholipase in the engineered yeast cell is also within the scope of the invention.
  • the term “coupled” here means that inhibition or inactivation of the coupled protein results in inhibition or activation (not necessarily respectively) of the phospholipase.
  • coupled is meant to include both "natural” coupling of heterologous signaling molecules into a yeast signal transduction pathway and “artificial” coupling of heterologous signaling molecules into a yeast pathway in a manner not normally operative in yeast cells. Functional expression of human phospholipases is especially desirable.
  • the yeast cells of the subject invention are characterized as including a heterologous gene encoding a heterologous phospholipase C (PLC), e.g., a polypeptide having a phospholipase C activity.
  • PLC is a mammalian PLC such as a human PLC.
  • the PLC can be a phospholipase selected from the group consisting of PLC ⁇ 's, PLC ⁇ 's, PLC ⁇ 's and PLC ⁇ 's.
  • Preferred PLC's are of the ⁇ subtype, such as PLC ⁇ l, PLC ⁇ 2, PLC ⁇ 3 and PLC ⁇ 4.
  • the heterologous phospholipase C can be constutitively activated. This may occur by way of mutations to the PLC itself which result in a higher level of activity, relative to the wild- type protein, in the absence of signaling to the PLC.
  • the constitutive activation of the PLC can occur due to overexpression and/or consitutively activating mutations to upstream regulators of the PLC, such as receptors, G proteins and the like.
  • the recombinant cell is characterized by the ability of the heterologous PLC to hydrolyze phosphatidylinositol 4,5-bisphosphate.
  • the yeast cell has a loss-of-fun ⁇ ion mutation to an endogenous phospholipase gene, giving it a first detectable phenotype, and the heterologous PLC complements the loss-of-function mutation and confers a second detectable phenotype on the cell.
  • the heterologous PLC is functionally integrated in a phospholipase-dependent signal pathway of the cell.
  • the heterlogous PLC may complement a loss-of-function mutation of an endogenous phospholipase gene of the yeast cell, e.g., the heterologous PLC may complement the plcl ⁇ mutation.
  • Expression of the heterologous PLC may confer a phenotype to the host cell which is detectably different than the phenotype of the host cell in the absence of the heterologous PLC protein. For instance, complementation of a loss-of-function mutation, such as the plcl .
  • the heterologous PLC can rescue/overcome such phenotypes as temperature- sensitivity and/or salt sensitivity.
  • the heterolgous PLC via a phospholipase-dependent signal pathway, can modulate such downstream effectors as calcium mobilization and/or PKC activity.
  • the recombinant cell may also be engineered to include a reporter gene construct containing a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the phospholipase-dependent signal pathway, expression of the reporter gene providing the detectable signal.
  • reporter genes encode a gene product that gives rise to a detectable signal, such as color, fluorescence, luminescence, cell viability relief of a cell nutritional requirement, cell growth, or drug resistance.
  • the reporter gene encodes a gene product selected from the group consisting of chloramphenicol acetyl transferase, beta- galactosidase, luciferase, fluorescent protein, and alkaline phosphatase.
  • the reporter gene encodes a gene product which confers the ability to grow in the presence of a selective agent, e.g., canavanine.
  • the yeast cell further comprises a heterologous regulatory protein which is coupled to the phospholipase signaling pathway, e.g., the regulatory protein modulates the activity of the heterologous PLC or is modulated by the PLC activity.
  • exemplary regulatory proteins include, for example, G-protein heterotrimers; G ⁇ subunits; G ⁇ subunits; proteins known to interact functionally with PLC substrates (e.g., profilin, gelsolin, cofilin, and alpha-actinin); and other effectors whose activity is dependent on PLC activity (i.e., IP 3 receptors/calcium channels, and IP 3 or calcium sensitive enzyme activities such as PKC or calcium/calmodulin kinase (CaM kinase)).
  • the yeast cell comprises a heterologous receptor or ion channel or other surface protein capable of transducing signals via the phospholipase- dependent signal pathway, e.g., which is known to couple to PLC activity either directly or via a regulatory protein.
  • This aspect of the invention provides for more general readout systems to assay modulation of the activity of a variety of different cellular signaling components which effect phospholipase C activation.
  • the host cell further comprises a heterologous gene encoding a heterologous G-protein coupled receptor.
  • Preferred G-protein coupled receptors include chemoattractant peptide receptors, neuropeptide receptords, cytokine, light receptors, neurotransmitter receptors, cyclic AMP receptors, and polypeptide hormone receptors.
  • the receptor may be any one of: an ⁇ lA-adrenergic receptor, an ⁇ lB-adrenergic receptor, an ⁇ lC-adrenergic receptor, an M j AChR receptor, an M 3 AChR receptor, an M 5 AChR receptor, a D dopamine receptor, a D 3 dopamine receptor, an Al adenosine receptor, a 5HTl-like receptor, a 5HT Id-like receptor, a 5HTld beta receptor, a substance K (neurokinin A) receptor, a f- Met-Leu-Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor,
  • the receptor protein is a receptor tyrosine kinase.
  • the recombinant cells are further engineered to include an expressible recombinant gene encoding a heterologous test polypeptide. In preferred embodiments, such cells are provided as mixed culture collectively expressing a variegated population of test polypeptides.
  • the present invention also relates to a rapid, reliable and effective assay for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of a phospholipase.
  • the subject assay enables rapid screening of large numbers of test compounds to identifying those compounds which modulate, e.g., agonize or antagonize, phospholipase bioactivity.
  • the assay is characterized by the use of the recombinant cells described herein as engineered to express heterologous phospholipase activities which produce, in the engineered cell, a detection signal.
  • the ability of particular test compounds contacted with the instant cells to modulate the phospholipase activity can be scored for by detecting up or down-regulation of the detection signal. For example, second messenger generation via the heterologous phospholipase activity can be measured directly.
  • an assay for identifying a modulator of a phospholipase C activity comprising the steps of: (i) contacting the cell of claim 1 with a test compound under conditions appropriate for detecting an intracellular signal transduced via the phospholipase-dependent signal pathway; and (ii) measuring a level of signal transduced by the phospholipase-dependent signal pathway in the presence of the test compound.
  • a statistically significant difference in the level of signal in the presence of the test compound indicates that the test compound is a modulator of the heterologous phospholipase C activity.
  • the intracellular signal can be detected, for example, by expression of a reporter gene operably linked to transcriptional regulatory elements sensitive to the phospholipase- dependent signal pathway.
  • the intracellular signal is detected by measuring products of the hydrolysis of phosphatidylinositol 4,5-bisphosphate; by measuring Ca 2+ mobilization; and/or by measuring the activation of a protein kinase such as PKC.
  • the intracellular signal can be detected by measuring a change in phenotype conferred by the heterologous phospholipase, such as a change in temperature sensitivity or NaCl sensitivity.
  • the assay makes use the ability of a heterologous PLC to complement a loss-of-function mutation to an endogenous phospholipase activity.
  • This embodiment of the subject assay generally includes the steps of: (i) contacting the cell with a test compound under conditions appropriate for detecting one or both of the phenotypes of the loss-of-function mutation or the complemented phenotype; and (ii) measuring the level or degree of one or both of these phenotype in the presence of the test compound.
  • the ability of the test compound to alter the phenotype, relative to the absence of test compound or phospholipase C can be used to identify test compounds that are modulators of the heterologous phospholipase C activity.
  • the assay utilizes a cell which is further engineered with a reporter gene construct which is sensitive to a phospholipase-dependent signal pathway from a heterologous PLC activity.
  • Such assay formats generally include the steps of: (i) contacting the cell with a test compound under conditions appropriate for expression of the reporter gene; (ii) detecting expression of the reporter gene in the presence of the test compound; and (iii) comparing the level of reporter gene expression in the presence of the test compound to the level of reporter gene expression in the absence of the test compound or the absence of the heterologous phospholipase C.
  • a statistically significant difference in the level of reporter gene expression in the presence of the test compound, relative to the absence of test compound or phospholipase C indicates that the test compound is a modulator of the heterologous phospholipase C activity.
  • Still another embodiment of the assay provides a differential screening format for identifying an agent which selectively inhibits a non-mammalian phospholipase C relative to a mammalian phospholipase.
  • Such assay formats can include the steps of: (i) providing a first yeast cell containing a non-mammalian phospholipase gene; (ii) providing a second yeast cell expressing a mammalian phospholipase gene; (iii) contacting each of the first and second yeast cells with a test compound; and (iv) detecting or quantitating the activity of the phospholipases of the first and second cell in the presence of the test compound.
  • Such differential screening format can be used to identify inhibitors which are selective for phospholipases of mammalian pathogens relative to the host mammalian phospholipase.
  • the mammalian PLC can be a human PLC
  • the non-mammalian PLC can be derived from a human fungal pathogen, e.g.
  • a pathogen which causes a mycosis selected from a group consisting of candidiasis, aspergillosis, mucormycosis, blastomycosis, geotrichosis, cryptococcosis, chromoblastomycosis, penicilliosis, conidiosporosis, nocaidiosis, coccidioidomycosis, histoplasmosis, maduromycosis, rhinosporidosis, monoliasis, para-actinomycosis, and sporotrichosis.
  • the phospholipase of the first cell can be cloned from a human pathogen selected from a group consisting of Candida albicans, Candida stellatoidea, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida pseudotropicalis, Candida quillermondii, Candida rugosa, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus nidulans, Aspergillus terreus, Rhizopus arrhizus, Rhizopus oryzae, Absidia corymbifera, Absidia ramosa, and Mucor pusillus.
  • a human pathogen selected from a group consisting of Candida albicans, Candida stellatoidea, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida pseudotropicalis, Candida quillermondii, Candida rugosa, Aspergillus fumigatus, Asper
  • the assay can be carried out, e.g., repeated, for a library of at least 100 different test compounds, though more preferably at least 10 3 , IO 4 , IO 5 , IO 6 , or IO 7 different (variegated) compounds.
  • the test compound can be, to illustrate, peptides, nucleic acids, carbohydrates, small organic molecules, natural product extracts, synthetic compounds, or a mixture of combinatorial compounds.
  • Phospholipases C are a family of enzymes which hydrolyze the sn-3 phosphodiester bond in membrane phospholipids producing diacylglycerol and a phosphorylated polar head group. Mammalian PLC enzymes exhibit specificity for the polar head group which is hydrolyzed, i.e., phosphatidylcholine, phosphatidylinositol, etc.
  • PLC activation in cell proliferation is evident from the fact that the hydrolysis of PtdIns(4,5)P 2 is one of the early events that follow the interaction of many growth factors and mitogens with their respective receptors.
  • the importance of PLC activation is not restricted to proliferation; it is one of the most common transmembrane signaling events elicited by receptors that regulate many other cellular processes, including differentiation, metabolism, secretion, contraction, and sensory perception.
  • PLC- mediated transmembrane signaling events include, for example, signaling via receptor tyrosine kinases and G protein coupled receptors.
  • the diacylglycerol released may be further metabolized to free arachidonic acid by sequential actions of diglycerol lipase and monoglycerol lipase.
  • phospholipases may be further metabolized to free arachidonic acid by sequential actions of diglycerol lipase and monoglycerol lipase.
  • C are not only important enzymes in the generation of second messenger molecules, but may serve an important role in making arachidonic acid available for eicosanoid biosynthesis in select tissues.
  • the present invention is based on the development of yeast strains which express a functional, heterologous phospholipase and makes available a rapid, effective assay for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of the heterologous phospholipase.
  • the present invention provides a convenient format for discovering drugs which can be useful to modulate cellular function, as well as to understand the pharmacology of compounds that specifically interact with phospholipases.
  • Signal transduction is the process by which chemical signals are relayed from the cellular environment to cellular targets via the cell membrane, and may occur through one or more mechanisms, such as phosphorylation, activation of ion channels, effector enzyme activation via guanine nucleotide binding protein intermediates, activation of phospholipase, and/or direct activation (or inhibition) of a transcriptional factor.
  • a “mammalian phospholipase” is a protein which is either identical to an phospholipase occurring naturally in a mammal, or is a mutant which is substantially homologous with such a mammalian phospholipase and more similar in sequence to it than to the yeast phospholipase.
  • Related terms, such as “primate phospholipase”, or “human phospholipase” are analogously defined.
  • a mammalian phospholipase is "functionally homologous" to a yeast protein if, either alone, or in concert with other exogenous proteins, or after being modified by a drug, it is able to provide an phospholipase activity within the engineered yeast cell. It is not necessary that it be as efficient as the yeast protein, however, it is desirable that it have at least 10% of the activity of the analogous yeast protein.
  • an “activator” or “agonist” of a phospholipase is a substance which causes the phospholipase to become more enzymatically active, e.g., elevates the rate at which phospholipid hydroylsis occurs under particular conditions.
  • the mode of action of the activator may be direct, e.g., through binding the phospholipase, or indirect, e.g., through binding another molecule which otherwise interacts with the phospholipase.
  • an "inhibitor or antagonist" of an phospholipase is a substance which causes the enzyme to become less active, and thereby reduces the rate or production of the hydrolytic second messengers to a detectable degree. The reduction may be complete or partial, and due to a direct or an indirect effect.
  • phospholipase-dependent signal pathway refers to a signal transduction pathway including a phospholipase activity as a step in the transduction of the intracellular signal.
  • a signal transduction pathway is meant to include components of a pathway whose activity is modulated by a phospholipase, whether their activity is directly modulated by the phospholipase or indirectly modulated by the phospholipase or its second messengers. This term also includes components of the pathway which are "upstream" of the phospholipase which regulate an activity of the phospholipase.
  • the term "functional integration” as used herein refers to the ability of an exogenous phospholipase to function in a phospholipase-dependent signal transduction pathway such that a distal effect of a phospholipase activity can be determined, i.e., an activity regulated by the products produced from phospholipase dependent phospholipid hydrolysis. Such distal signaling effects can be observed in yeast expressing either a functional or mutant phospholipase.
  • Another example of functional integration is complementation by a heterologous phospholipase C of one of the pleiotropy of effects seen in phospholipase loss- of-function yeast strains (e.g., reduced growth or NaCl sensitivity).
  • Another assay of functional complementation is the ability of the heterologous phospholipase to modulate gene transcription.
  • Yet another assay of functional integration is the reconstitution of regulated phospholipase activity, i.e., phospholipase activity requiring stimulation, for example phospholipase activity upon receptor-ligand activation or upon activation by a G protein subunit or subunits.
  • This term can also include functional integration of a phospholipase into an endogenous yeast pathway or a chimeric pathway including components not naturally found in yeast cells.
  • modulation of a phospholipase activity in its various grammatical forms, as used herein, designates induction and/or potentiation, as well as inhibition of one or more signal transduction pathways involving of a phospholipase. Such modulation may involve effects of a compound directly on a phospholipase, or on a component of a signal transduction pathway involving a phospholipase, for example upstream regulatory elements, or downstream elements, including substrates.
  • substantially homologous when used in connection with amino acid sequences, refers to sequences which are substantially identical to or similar in sequence, giving rise to a homology in conformation and thus to similar biological activity. The term is not intended to imply a common evolution of the sequences.
  • substantially homologous sequences are at least 50%), more preferably at least 80%, identical in sequence, at least over any regions known to be involved in the desired activity. Most preferably, no more than five residues, other than at the termini, are different.
  • the divergence in sequence, at least in the aforementioned regions is in the form of "conservative modifications".
  • recombinant cells include any cells that have been modified by the introduction of heterologous DNA.
  • Control cells include cells that are substantially identical to the recombinant cells, but do not express one or more of the proteins encoded by the heterologous DNA, e.g., do not include or express one or more of the exogenous phospholipase, regulatory protein, test polypeptide, or the reporter gene construct.
  • heterologous DNA or “heterologous nucleic acid” is meant to include DNA that does not occur naturally as part of the genome in which it is present or DNA which is found in a location or locations in the genome that differs from that in which it occurs in nature.
  • Heterologous DNA is not endogenous to the cell into which it is introduced, but has been obtained from another cell, i.e., is exogenous to the cell.
  • such DNA encodes RNA and proteins that are not normally produced by the cell in which it is expressed.
  • Heterologous DNA may also be referred to as foreign DNA.
  • heterologous DNA any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which is expressed is herein encompassed by the term heterologous DNA.
  • heterologous DNA include, but are not limited to, DNA that encodes a phospholipase, test polypeptides, regulatory proteins, reporter genes, transcriptional and translational regulatory sequences, or selectable or traceable marker proteins, such as a protein that confers drug resistance.
  • recombinant protein refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. That is, the polypeptide is expressed from a heterologous nucleic acid.
  • a “heterologous phospholipase” refers to a non-yeast phospholipase enzyme, having a phospholipase activity.
  • phospholipase C in the presence of calcium, can convert phosphatidyl inositol (PI), phosphatidyl inositol 4-monophosphate (PIP) or phosphatidyl inositol (4,5) biphosphate (PIP2) into at least inositol 1,4,5 triphosphate (IP3) and diacylglycerol (DAG).
  • PI phosphatidyl inositol
  • PIP3 phosphatidyl inositol
  • DAG diacylglycerol
  • an "endogenous, mutant phospholipase gene” as used herein refers to a yeast phospholipase gene that encodes an endogenous, mutant or impaired yeast phospholipase protein.
  • an endogenous, mutant phospholipase may have a deletion, insertion, point mutation or other mutation that results in a conditional impairment or a constitutive impairment, making them ideal for selection or complementation studies.
  • An example of an endogenous, mutant phospholipase gene is a deletion mutant in the S. cerevisiae PLC1 locus (plcl).
  • plcl strains are sensitive to high osmolarity (0.5M NaCl or 1.2M sorbitol) at 30°C and do not grow well in the presence of carbon sources other than glucose (i.e. glycerol/ethanol, raffinose, and galactose).
  • plcl strains have a temperature sensitive phenotype; at temperatures above 35°C, plcl strains do not grow, while at temperatures below 35°C, they grow, albeit slower than wildtype strains.
  • a "loss of function" mutation is one which leads to a change in the activity of a phospholipase gene. Such a mutation may alter one or more of the coding sequence, the transcription, or the translation of an endogenous yeast phospholipase. Such a mutation will lead to the lack of expression of a yeast phospholipase, or the expression of an inactive yeast phospholipase or a phospholipase of reduced activity.
  • a "reporter gene construct” is a nucleic acid that includes a “reporter gene” operatively linked to a transcriptional regulatory sequences. Transcription of the reporter gene is controlled by these sequences. The activity of at least one or more of these control sequences is directly or indirectly regulated by a signal transduction pathway involving a phospholipase, e.g., is directly or indirectly regulated by a second messenger produced by the phospholipase activity.
  • the transcriptional regulatory sequences can include a promoter and other regulatory regions, such as enhancer sequences, that modulate the activity of the promoter, or regulatory sequences that modulate the activity or efficiency of the RNA polymerase that recognizes the promoter, or regulatory sequences that are recognized by effector molecules, including those that are specifically induced upon activation of a phospholipase.
  • modulation of the activity of the promoter may be effected by altering the RNA polymerase binding to the promoter region, or, alternatively, by interfering with initiation of transcription or elongation of the mRNA.
  • Such sequences are herein collectively referred to as transcriptional regulatory elements or sequences.
  • the construct may include sequences of nucleotides that alter the stability or rate of translation of the resulting mRNA in response to PLC second messages, thereby altering the amount of reporter gene product.
  • a heterologous regulatory protein refers to a protein that regulates or is coupled to a heterologous phospholipase. Such a regulatory protein may be upstream or downstream of a phospholipase and is capable of modulating the activity of a phospholipase or being modulated by the phospholipase.
  • a preferred regulatory protein is a GTP binding protein (G protein), which as used herein refers to heterotrimeric G proteins, G protein subunits thereof, e.g.
  • a regulatory protein as used herein may also be a receptor that modulates a signal transduction pathway involving a phospholipase.
  • preferred regulatory receptors are those that directly activate a phospholipase, such as the G protein coupled receptors, receptor tyrosine kinases (RTK's), receptors that activate phospholipases via the activation of a non-receptor kinases, such as those that signal via src kinases and the like.
  • Other regulatory proteins can bind PIP 2 , the preferred substrate for many PLC isozymes (e.g. profilin, cofilin, gelsolin, and alpha- actinin) as discussed in Homma and Emori, 1995 and references therein. Regulatory proteins are discussed in further detail below.
  • cell surface receptor refers to molecules that occur on the surface of cells, interact with the extracellular environment, and transmit or transduce the information regarding the environment intracellularly in a manner that ultimately modulates transcription of specific promoters, resulting in transcription of specific genes.
  • extracellular signals include a molecule or a change in the environment that is transduced intracellularly via cell surface proteins that interact, directly or indirectly, with the signal.
  • An extracellular signal or effector molecule includes any compound or substance that in some manner specifically alters the activity of a cell surface protein. Examples of such signals include, but are not limited to, molecules such as ions, acetylcholine, growth factors, and hormones, that bind to cell surface and/or intracellular receptors and ion channels and modulate the activity of such receptors and channels.
  • Extracellular signals also include as yet unidentified substances that modulate a signal transduction pathway involving a phospholipase, and thereby influence intracellular functions. Such extracellular signals are potential pharmacological agents that may be used to treat specific diseases by modulating phospholipase activity.
  • the present invention relates to recombinant yeast cells expressing a heterologous phospholipase and the methods of using these cells to identify compounds capable of modulating the signal transduction activity of such phospholipases.
  • the subject assay is characterized by the use of recombinant cells which express a heterologous phospholipase protein whose signal transduction activity can be modulated in the recombinant cell so as to generate a detectable signal.
  • these cells may (optionally) also express one or more of: (i) an expressible recombinant gene encoding an exogenous test polypeptide from a polypeptide library, (ii) a regulatory protein coupled to a phospholipase activity, and (iii) a reporter construct.
  • the functional expression of a mammalian phospholipase in yeast provides for the design of inexpensive screens useful in the identification of modulators of the enzyme, the activity which is required for the generation of a central signaling molecule in mammalian cells. Any chemical entity, or combination of chemical entities, whether natural or synthetic, may be screened for the ability to modulate the mammalian phospholipase.
  • modulators may act directly on the enzyme to alter the activity of the enzyme, e.g., they can competitively, noncompetitively, and/or allosterically potentiate or inhibit the enzyme's activity, or may affect the ability of a regulatory protein to alter phospholipase activity.
  • the engineered cell is used to screen for drugs which, like G ⁇ or in some cases G ⁇ , can directly activate the phospholipase, or increase the activity of a partially activated phospholipase. In certain embodiments a chimeric G ⁇ or G ⁇ may be expressed for this purpose.
  • the engineered cell is used to screen for drugs which inhibit mammalian phospholipase. In this situation, the phospholipase must first be activated. This can be done by engineering the cell to express G ⁇ or G ⁇ , as appropriate.
  • the cell may be engineered to co-express both a G protein and a G protein coupled receptor, or any other protein which regulates the activity of the phospholipase, and the receptor stimulated either by externally added ligand or by a co-expressed ligand.
  • the ligand is a known activator used merely to stimulate activation of the phospholipase, and the drugs are screened for inhibition of this phospholipase.
  • the engineered cell is used to screen for drugs which inhibit or activate phospholipase indirectly, e.g., by their action upon a regulatory protein, for example, a G protein-coupled receptor.
  • the receptor activates the G protein subunits which act on the phospholipase.
  • a compatible G protein-coupled receptor and a compatible G protein would be provided with the mammalian phospholipase in the same yeast cell.
  • test compounds to modulate the signal transduction activity of the target phospholipase can be scored for by detecting up or down-regulation of the detection signal.
  • second messenger generation e.g. phospholipid hydrolysis, Ca + mobilization or PKC activation
  • a reporter gene can provide a convenient readout.
  • a statistically significant change in the detection signal can be used to facilitate identification of those compounds which are effectors of the target phospholipase.
  • the assay may be repeated and modified by the introduction of a step in which the recombinant cell is first contacted with a known activator of the phospholipase, and the test compound can be assayed for its ability to inhibit the activity of the phospholipase, e.g., to identify phospholipase antagonists.
  • the cell can be engineered with an activated phospholipase.
  • test compounds can be screened for members which potentiate the response to a known activator of the phospholipase.
  • a phsopholipase or a phospholipase regulatory protein may be constituatively active to facilitate screening for inhibitors of an activated phospholipase.
  • constituatively active forms of the heterotrimeric Gq family members such as GI 1 and G16 have been described, such as G ⁇ qQ209L and G ⁇ 16Q212L.
  • a constituatively actived form of a phospholipase activating receptor may be expressed, such as an ⁇ lB-adrenergic receptor which has been mutated to render it constituatively active (Perez et al.
  • the subject reagent cells can be used to perform differential screening assays, e.g., which can be used to identify a compound that selectively effects a non-mammalian (e.g. non-human) phospholipase.
  • Such compounds by selective inhibition, can be used for treating or preventing a pathogen infection (e.g. viral, fungal, bacterial or protozoan) in a mammal (e.g. human).
  • a pathogen infection e.g. viral, fungal, bacterial or protozoan
  • Preferred heterologous phospholipase enzymes for performing differential screening assays against a mammalian phospholipase include phospholipases from viral, fungal or protozoan pathogens.
  • fungal pathogens include fungi that cause Candidiasis, Aspergillosis, Mucormycosis, Blastomycosis, Geotrichosis, Cryptococcosis, Chromoblastomycosis, Coccidioidomycosis, Conidiosporosis, Histoplasmosis, Maduromycosis, Rhinosporidosis, Nocaidiosis, Para-actinomycosis, Penicilliosis, Monoliasis, and Sporotrichosis.
  • the ability of a compound to modulate the activity of one phospholipase and not another phospholipase may be measured.
  • compounds which are agonists or antagonists of PLC ⁇ and not PLC ⁇ or are capable of modulating PLC ⁇ 2 and not PLC ⁇ 3 may be selected.
  • compounds which are capable of modulating a heterologous phospholipase while not affecting another member of a signal transduction protein which may or may not be a member of a phospholipase pathway, such as PKC may be tested.
  • the intracellular signal that is transduced can be initiated by the specific interaction of an extracellular signal, particularly a ligand, with a cell surface receptor which is coupled to the phospholipase.
  • This interaction sets in motion a cascade of intracellular events, the ultimate consequence of which is a rapid and detectable change in the transcription or translation of a gene.
  • transcriptional regulatory sequences that are responsive to the phospholipase-dependent intracellular signals and operatively linking the selected promoters to reporter genes, whose transcription, translation or ultimate activity is readily detectable and measurable
  • the transcription based assay provides a rapid indication of whether a specific test compound influences intracellular transduction. Expression of the reporter gene, thus, provides a valuable screening tool for the development of compounds that act as agonists or antagonists of phospholipase activities.
  • Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation and are thus ideal for assays in which a heterologous phospholipase is functionally integrated into a signal transduction pathway.
  • a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on 2nd messengers generated by the phospholipase activity.
  • the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transduction activity of the target phospholipase, with the level of expression of the reporter gene providing the phospholipase-dependent detection signal.
  • the amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, specific mRNA expressio may be detected using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity. The amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks the target phospholipase. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the target phospholipase.
  • the gene product of the reporter is detected by an intrinsic activity associated with that product.
  • the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or luminescence.
  • the reporter or marker gene provides a selective growth advantage, e.g., the reporter gene may enhance cell viability, relieve a cell nutritional requirement, and/or provide resistance to a drug.
  • second messenger generation can be measured directly in the detection step, such as mobilization of intracellular calcium or phospholipid metabolism are quantitated, for instance, the products of phospholipid hydrolysis IP3 or DAG could be measured
  • one of the downstream effects of PLC activation in mammalian cells is Ca " * ⁇ mobilization; because the teachings of the present invention demonstrate that a mammalian phospholipase can be functionally integrated into a yeast cell, it is likely that this effect may be expected in yeast cells expressing functional, recombinant PLCs.
  • mammalian PLC is known to modulate PKC via its second messenger products (including DAG) functional expression of mammalian PLCs in yeast may be expected to couple to other signal pathway effectors including IP3-receptor, CaM kinase, calmodulin, PKA and PKC, or other proteins which interact with the phospholipases.
  • DAG second messenger products
  • the host yeast cell of the present invention may be of any species which is cultivable and in which an exogenous phospholipase can be modulated. Suitable species include Kluyverei lactis, Schizosaccharomyces pombe, and Ustilaqo maydis; Saccharomyces cerevisiae is preferred. Other yeast which can be used in practicing the present invention are Neurospora crassa, Aspergillus niger, Aspergillus nidulans, Pichia pastoris, Candida tropicalis, and Hansenula polymorpha.
  • yeast includes not only yeast in a strictly taxonomic sense, i.e., unicellular organisms, but also yeast-like multicellular fungi or filamentous fungi.
  • reporter constructs can provide a selectable or screenable trait upon transcriptional activation (or inactivation) in response to a signal transduction pathway coupled to the target receptor
  • the reporter gene may be an unmodified gene already in the host cell pathway, such as the genes responsible for growth arrest in yeast. It may be a host cell gene that has been operably linked to a "phospholipase-responsive" promoter. Alternatively, it may be a heterologous gene that has been so linked. Suitable genes and promoters are discussed below. Accordingly, it will be understood that to achieve selection or screening, the host cell must have an appropriate phenotype. For example, introducing a pheromone-responsive chimeric HIS3 gene into a yeast that has a wild-type HIS3 gene would frustrate genetic selection. Thus, to achieve nutritional selection, an auxotrophic strain will be desired.
  • Inactivation with respect to genes of the host cell, means that production of a functional gene product is prevented or inhibited. Inactivation may be achieved by deletion of the gene, mutation of the promoter so that expression does not occur, or mutation of the coding sequence so that the gene product is inactive. Inactivation may be partial or total.
  • yeast genetics The field of yeast genetics is advanced and techniques for disrupting yeast genes are known in the art. For example, transplacement may be used to replace the endogenous yeast phospholipase gene with a modified form, as described by Flick and Thorner in art.
  • a plcAl::HlS3 mutation can be created by replacing the internal Pvul ⁇ fragment of PLCl (nucleotides +1069 to +1482) with HIS3, as follows.
  • the 3.7-kb Eco RV fragment containing most of PLCl can be inserted into Ec ⁇ RV-digested YCp50 to (Rose et al. 1987. Gene. 60:237) to yield pJFlO, which can be cleaved with Pvull and ligated with the
  • HIS3 has replaced residues 357 to 494 of Plclp.
  • the plcl l::HIS3 allele can be introduced into yeast cells by DNA mediated transformation
  • a plclA2::LEU2 mutation can be created by replacing the Hpal-Clal segment of PLCl (nucleotides +277 to +2333) with LEU2, as follows.
  • pJF58 which consists of a 4.3-kb Hindlll fragment containing PLCl inserted in pUC19 can be digested with Hpal and Clal and incubated with the Klenow fragment of E. coli DNA polymerase I.
  • the resulting 5.4-kb linearized vector can be gel purified and ligated with a 2.2 kb SaR-Xhol fragment containing LEU2 that can be excised from pJJ283 (Jones and Prakash, supra) and converted to flush ends by treatment with Klenow enzyme, yielding pJF96.
  • the plcl A2::LEU2 allele which is almost a complete deletion of the PLCl gene, can be introduced into S. cerevisiae by DNA- mediated transformation of the Ieu2/leu2 diploid strain, YPH501, using HmrflH-digested pJF96 and selecting for leucine prototrophy.
  • any mutants generated will have a selectable phenotype, such as, for example, cessation of growth at 37°C, or failure to grow on a particular carbon source, will exhibit sensitivity to hypertonic stress (e.g., to salt or sorbitol), or will fail to grow on medium lacking a nitrogen source.
  • a yeast cell expressing an endogenous mutant PLC will be capable of growth under one set of experimental conditions and will fail to grow or exhibit growth impairment under a second set of experimental conditions, i.e., would be conditionally lethal.
  • “Complementation” with respect to genes of the host cell, means that at least partial function of inactivated gene of the host cell is supplied by an exogenous nucleic acid.
  • yeast cells can be “mammalianized”, and even “humanized”, by complementation of receptor and signal transduction proteins with mammalian homologs.
  • inactivation of a yeast phospholipase gene can be complemented, as described in the appended examples, by expression of a human phospholipase gene.
  • PLC- ⁇ agonists can be identified in a screen for compounds that stimulate growth of plcl A yeast strains expressing PLC- ⁇ 2 but not expressing any G ⁇ q family G ⁇ -subunit under non-permissive growth conditions, plcl A strains expressing wildtype yeast PLCl could serve as an appropriate counterscreening strain.
  • PLC- ⁇ antagonists could be screened for in two formats.
  • plcl ⁇ yeast strains whose growth under non-permissive conditions is not dependent upon co-expression of G ⁇ q subunits (i.e. strains expressing mammalian PLC- ⁇ l, - ⁇ 2, or - ⁇ 3 on high copy plasmids) could be screened for compounds that block growth at 37°C or on 0.5M NaCl at 30°C but not at 30°C.
  • An additional counterscreen for this format would be to screen for compounds that block growth of the plcl A strains but not of PLCl strains under non-permissive conditions. This counterscreen would serve to distinguish between compounds that act on fungal and mammalian PLC isoforms as opposed to those that act on one or the other or both.
  • plcl A yeast strains whose growth under non- permissive conditions is dependent upon co-expression of G ⁇ q subunits could be screened for loss of complementation when contacted with compounds.
  • This screen could in theory detect compounds that act either by inhibiting PLC-isoforms directly or by blocking the interaction between PLC- ⁇ isoforms and G ⁇ q subunits or by blocking the activation of G ⁇ q subunits.
  • functional complementation in screening it may be possible to construct yeast strains in which the activation or inhibition of signaling components downstream of PLC- ⁇ can be scored appropriately configured strains.
  • strains expressing both mammalian PLC- ⁇ isoforms and PKC may be used to screen for compounds that modulate the activity of either PLC- ⁇ isoforms, PKC isoforms, or both.
  • CDK2 X61622 1.3e-137 cdc28 P00546 Elled ⁇ e et al. (1991 ) CDK3 X66357 1.3e-137 cdc28 P00546 Meyerson et al. (1992)
  • VDAC1 L06132 9.8e-15 porl P04840 Blachlv-Dvson E. et al. (1993)
  • VDAC2 L06328 2.8e-21 porl P04840 Blachlv-Dvson E. et al. (1993)
  • ligating a polynucleotide coding sequence into a gene construct such as an expression vector
  • hosts either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells)
  • eukaryotic yeast, avian, insect or mammalian
  • prokaryotic bacterial cells
  • Similar procedures, or modifications thereof, can be employed to prepare recombinant reagent cells of the present invention by tissue-culture technology in accord with the subject invention.
  • the vector be capable of replication in the host cell. It may be a DNA which is integrated into the host genome, and thereafter is replicated as a part of the chromosomal DNA, or it may be DNA which replicates autonomously, as in the case of a plasmid. In the latter case, the vector will include an origin of replication which is functional in the host. In the case of an integrating vector, the vector may include sequences which facilitate integration, e.g., sequences homologous to host sequences, or encoding integrases.
  • YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incorporated by reference herein).
  • These vectors can replicate in E. coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid.
  • drug resistance markers such as ampicillin can be used.
  • Suitable promoters include the promoters for metallothionein, 3 -phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255, 2073 (1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Req. 7, 149 (1968); and Holland et al.
  • Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO Publn. No. 73,657.
  • promoters which have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3 -phosphate dehydrogenase, as well as enzymes responsible for maltose and galactose utilization.
  • promoters that are active in only one of the two haploid mating types may be appropriate in certain circumstances.
  • the pheromone promoters MFal and MF ⁇ l are of particular interest.
  • Phospholipases As set out above, one aspect of the present invention encompasses the functional expression of a heterologous phospholipase in a yeast cell.
  • a preferred phospholipase is phospholipase C.
  • Preferred PLCs for carrying out the subject screening assays include any isotype of any of the four classes of phospholipases C (e.g. ⁇ , ⁇ .4, ⁇ 1&2 > or ⁇ l-3)-
  • the phospholipases may be recombinant forms of vertebrate (e.g. mammalian, such as bovine, porcine, caprine, laprine, feline, canine, rodent, human or non-human primate), invertebrate (e.g.
  • PLC Genbank Accession number XI 4034
  • PLCl Genebank Accession number M372308
  • PLC ⁇ 2 Genebank Accession number M95678; see also Park et al. J. Biol. Chem. 1992. 267:16048
  • PLC ⁇ 3 Genebank Accession number Z37566
  • the heterologous phospholipase need not be a naturally occurring protein, rather, it may be a mutant form of a phospholipase.
  • the mutant is substantially homologous to a naturally occurring phospholipase, or a mutant known to be functional.
  • the structural gene encoding the phospholipase may be the wild-type mammalian gene, or a modified gene. "Silent" modifications may be made to improve expression, by, e.g., (1) eliminating secondary structures in the corresponding mRNA, or (2) substituting codons preferred by yeast for codons that are not so preferred, or to facilitate cloning, e.g., by introducing, deleting or modifying restriction sites.
  • the gene may also be modified so that a mutant phospholipase is encoded.
  • Analysis of yeast codon usage indicates that there exists a preferred codon set consisting of the most abundant isoaccepting tRNAs present in yeast and that this preferred set (25 out of the 61 possible coding triplets) is the same for all yeast proteins (Bennetzen and Hall (1981) J. Biol. Chem. 257, 3026-3031).
  • the rapid translation rate required for abundant proteins is believed to provide the selective pressure for the existence of the preferred set of codons.
  • As the extent of biased codon usage in specific genes correlates directly with the level of gene expression Hoekma et al. (1987) Mol. Cell. Biol.
  • the yeast cells of the present invention can be further engineered to express one or more regulatory proteins which regulate an exogenous phospholipase.
  • Preferred regulatory proteins are G-protein coupled receptors, G proteins, receptor tyrosine kinases, and/or non-receptor kinases.
  • Examples of other regulatory proteins are proteins which bind to phospholipase substrates and influence the activity of a phospholipase, such as profillin. Phospholipase regulatory proteins are described in detail below.
  • G proteins One family of signal transduction cascades found in eukaryotic cells utilizes heterotrimeric "G proteins.” Transduction of growth signals by G protein-coupled receptors has been demonstrated to include phospholipase-dependent pathways. For example, ⁇ -type PLC isoforms are activated by the heterotrimeric G protein subfamily Gq. The ⁇ -subunits of Gq / l l/ 16' t0 further illustrate, specifically regulate PLC- ⁇ l and PLC- ⁇ 3, and the ⁇ / ⁇ -subunits of the Gi subfamily interact with PLC- ⁇ 2. Agonist interaction with specific G protein- coupled receptors causes the dissociation of Gq proteins into G ⁇ and G ⁇ / ⁇ subunits and the exchange of GDP bound to G ⁇ for GTP.
  • G protein signaling systems include three components: a receptor , a GTP-binding protein (G protein), and an intracellular target protein.
  • the G proteins which consist of alpha ( ⁇ ), beta ( ⁇ ) and gamma ( ⁇ ) subunits, are complexed with the nucleotide guanosine diphosphate (GDP) and are in contact with receptors.
  • GDP nucleotide guanosine diphosphate
  • the receptor changes conformation and this alters its interaction with the G protein. This spurs the ⁇ subunit to release GDP, and the more abundant nucleotide guanosine triphosphate (GTP), replaces it, thus activating the G protein.
  • GTP nucleotide guanosine triphosphate
  • the activated state lasts until the GTP is hydrolyzed to GDP by the intrinsic GTPase activity of the ⁇ subunit.
  • the enzyme in turn converts an inactive precursor molecule into an active "second messenger," which may diffuse through the cytoplasm, triggering a metabolic cascade.
  • the G ⁇ converts the GTP to GDP, thereby inactivating itself.
  • the inactivated G ⁇ may then reassociate with the G ⁇ complex.
  • Hundreds, if not thousands, of receptors transduce signals through heterotrimeric G proteins, of which at least 17 distinct forms have been isolated.
  • G protein coupled receptors are comprised of a single protein chain that is threaded through the plasma membrane seven times. Such receptors are often referred to as seven transmembrane receptors (STRs).
  • transmembrane domain receptors that have been reported in the literature to be coupled to phosphoinositide metabolism in cells and accordingly suitable for generating the subject reagent cell: an ⁇ lA-adrenergic receptor, an ⁇ lB-adrenergic receptor, an ⁇ lC-adrenergic receptor, an M j ACh receptor, an M3 ACh receptor, an M5 ACh receptor, a D 2 dopamine receptor, a D 3 dopamine receptor, an Al adenosine receptor, a 5HTl-like receptor, a 5HTld- like receptor, a 5HTld beta receptor, a substance K (neurokinin A) receptor, a f-Met-Leu-Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a growth hormone-
  • yeast Specific human G protein-coupled receptors for which genes have been isolated and for which expression vectors could be constructed include those listed herein and others known in the art.
  • the gene would be operably linked to a promoter functional in the cell to be engineered and to a signal sequence that also functions in the cell.
  • suitable promoters include those derived from Ste2, Ste3 and gall genes.
  • Suitable signal sequences include those of Ste2, Ste3 and of other genes which encode proteins secreted by yeast cells.
  • the yeast genome is preferably modified so that it is unable to produce the yeast analog of the recombinant receptor in functional form.
  • PLC- ⁇ enzymes are activated in response to ligand binding to G-protein coupled receptors by hormones, neurotransmitters, small molecules and other agonists. This occurs via a pertussis toxin insensitive mechanism mediated by members of the Gq family of G ⁇ subunits as well as via a pertussis toxin sensitive mechanism mediated by G-protein complexes containing G ⁇ subunits of the Gi or Go family.
  • Gq family members all members of the Gq family (q, 11, 14, 15, and 16) have been demonstrated both in vitro and in cell culture systems to directly stimulate the catalytic activity of PLC- ⁇ 1, - ⁇ 2, and - ⁇ 3 and - ⁇ 4 enzymes (A.J.
  • PLC- ⁇ isoforms are sensitive to stimulation directly by GjV subunits.
  • G ⁇ subunits derived from G ⁇ i or G ⁇ O-containing heterotrimers could contribute to the pertussis toxin sensitivity of PLC- ⁇ stimulation observed in whole cell systems in the past.
  • Certain of the regions of PLC- ⁇ isozymes that are required for activation by G ⁇ or G ⁇ ⁇ subunits have been characterized.
  • deletion mutations have shown that residues at the carboxyl terminus of PLC- ⁇ 1 (Wu et al, 1993) are crucial for interaction with G ⁇ subunits, while residues at the amino terminus appear to be essential for interaction with G ⁇ subunits, perhaps through binding of G ⁇ subunits to a presumptive pleckstrin homology present in the amino terminal 150 residues of PLC- ⁇ 2 (Inglese et al. 1995, and references therein).
  • the G ⁇ subunit may be modified to improve coupling. These modifications often will take the form of mutations which, relative to interaction with the receptor or G ⁇ complex, increase the resemblance of the G ⁇ subunit to the yeast G ⁇ while decreasing its resemblance to the receptor-associated G ⁇ . For example, a residue may be changed so as to become identical to the corresponding yeast G ⁇ residue, or to at least belong to the same exchange group of that residue. After modification, the modified G ⁇ subunit might or might not be "substantially homologous" to the foreign and/or the yeast G ⁇ subunit.
  • the modifications are preferably concentrated in regions of the G ⁇ which are likely to be involved in one or both of receptor binding and G ⁇ binding.
  • the modifications will take the form of replacing one or more segments of the receptor-associated G ⁇ with the corresponding yeast G ⁇ segment(s), thereby forming a chimeric G ⁇ subunit.
  • segment refers to three or more consecutive amino acids.
  • point mutations may be sufficient.
  • This chimeric G ⁇ subunit will interact with the endogenous receptor and the yeast
  • G ⁇ complex thereby permitting signal transduction to occur via a pathway which includes the heterologous phospholipase. While use of the endogenous yeast G ⁇ is preferred, if a foreign or chimeric G ⁇ capable of transducing the signal to the recombinant phospholipase may be used instead.
  • Certain phospholipase such as PLC- ⁇ enzymes, are activated directly in response to phosphorylation of key tyrosine residues by both receptor and non-receptor tyrosine kinases (Summarized in Cook and Wakelam, 1992b).
  • receptors which mediate PLC ⁇ activation include those for epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor, platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), nerve growth factor (NGF), and erbB2 which have intrinsic tyriosine kinase activity (Kumjian et al. (1991) J Biol. Chem.
  • MIRRs multisubunit immune recognition receptors
  • membrane immunoglobulin M and CD40 in B lymphocytes
  • T-cell antigen receptor Park et al. 1991. Proc. Natl. Acad. Sci. USA 88:5453; Weiss and Liftman. 1994. Cell 76:253
  • high-affinity immunoglobulin E receptor in basophilic leukemia cells
  • PLC- ⁇ isozymes bind to specific autophosphorylated tyrosine residues within the kinase domains of these PTKs via the SH2 domains present in the spacer region between the PLC X and Y regions and the PLCs themselves become substrates for tyrosine phosphorylation.
  • Phosphorylation of specific tyrosine residues (Tyr783 and Tyr 1254 on PLC- ⁇ l and Tyr753 and Tyr759 on PLC- ⁇ 2) by the receptor associated tyrosine kinase activities in turn increases the catalytic activity of PLC- ⁇ isozymes which results in increased production of 1,4,5-IP3 and *yw-l,2-diacylglycerol (DAG).
  • profilin-bound PIP 2 was found to be resistant to cleavage by PLC- ⁇ l except when the PLC- ⁇ l had been activated by tyrosine phosphorylation.
  • Other exemplary molecules which may regulate a phospholipase include profilin, gelsonin, cofilin, alpha-actin, and villin. The binding sites for PtdIns(4,5)P 2 on gelsolin and villin have recently been identified (Janmey et al.,(1992) J. Biol Chem 267:11818).
  • PLC- ⁇ regulation may be regulated by a novel class of regulatory proteins (pl22-RhoGAP) that show similarity to the GTPase activating protein homology region of bcr, display GAP activity towards RhoA, and bind to and directly stimulate PLC- ⁇ 1 (Homma, Y., and Y. Emori, 1995)
  • pl22-RhoGAP novel class of regulatory proteins
  • Other reports suggest that rho can regulate PtdIns(4,5)P 2 levels (Chong et al. (1994) Cell 79:507).
  • PLCs such as PLC ⁇ l (Bernstein and Ross) have a GAP-like activity for certain Gq family members. This activity serves to down regulate the activity of both the Gq and the PLC itself.
  • IP3 receptors include: IP3 receptors, calcium channels, DAG protein kinase C (PKC), PKA3 (cAMP dependent protein kinase catalytic subunit), SOK1 (suppressor of PKA overexpression), CMD1 (calmodulin, CMK1 (Calcium/calmodulin dependent protein kinase), and CMK2 (calmodulin dependent protein kinase).
  • PKC DAG protein kinase C
  • PKA3 cAMP dependent protein kinase catalytic subunit
  • SOK1 uppressor of PKA overexpression
  • CMD1 calmodulin
  • CMK1 Calcium/calmodulin dependent protein kinase
  • CMK2 calmodulin dependent protein kinase
  • the assay is characterized by the use of recombinant cells to sample a variegated compound library for phospholipase agonists and/or antagonists.
  • the reagent cells express a mammalian phospholipase capable of producing a detectable signal in the reagent cell.
  • the reagent cell also produces the test compound which is being screened.
  • the reagent cell can produce a test polypeptide, a test nucleic acid and/or a test carbohydrate which is screened for its ability to modulate the mammalian phospholipase activity.
  • a culture of such reagent cells will collectively provide a variegated library of potential phospholipase effectors and those members of the library which either agonize or antagonize the phospholipase function can be selected and identified.
  • the reagent cell can be used to detect agents which directly alter the activity of the mammalian phospholipase, or which act on some target upstream or downstream of the mammalian phospholipase.
  • the test compound is exogenously added.
  • the test compound is contacted with the reagent cell.
  • Exemplary compounds which can be screened for activity include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries. In such embodiments, both compounds which agonize or antagonize the phospholipase function can be selected and identified.
  • the reagent cell can be used to detect agents which directly alter the activity of the mammalian phospholipase, or which act on some target upstream or downstream of the mammalian phospholipase.
  • test compound is produced by cells which are cocultured with the reagent cells expressing a mammalian phospholipase.
  • intracellular second messenger generation can be measured directly.
  • Exemplary assays for the direct measurement of phospholipase generated second messengers are provided below; other assays for the measurement of second messengers generated in a signal transduction pathway involving a phospholipase will be apparent to those of skill in the art and may be substituted for the assays described below.
  • the phospholipase enzymatic activity can be measured in yeast cell extracts. In other embodiments measurements of a detecting a phospholipase activity are made using intact yeast cells.
  • Inositol lipids can be extracted and analyzed using standard lipid extraction techniques. DAG can also be measured using thin-layer chromatography. Water soluble derivatives of all three inositol lipids (IPj, IP 2 , IP3) can also be quantitated using radiolabelling techniques or HPLC.
  • the mobilization of intracellular calcium or the influx of calcium from outside the cell can be measured using standard techniques.
  • the choice of the appropriate calcium indicator, fluorescent, bioluminescent, metallochromic, or Ca ++ -sensitive microelectrodes depends on the cell type and the magnitude and time constant of the event under study (Borle (1990) Environ Health Perspect 84:45-56).
  • Ca ++ detection cells could be loaded with the Ca ⁇ sensitive fluorescent dye fura-2 or indo-1, using standard methods, and any change in Ca "1-1" measured using a fluorometer.
  • the other product of PIP2 breakdown, DAG can also be produced from phosphatidyl choline. The breakdown of this phospholipid in response to receptor-mediated signaling can also be measured using a variety of radiolabelling techniques.
  • the activation of phospholipase A2 can easily be quantitated using known techniques, including, for example, the generation of arachadonate in the cell.
  • the assay it may be desirable to screen for changes in cellular phosphorylation.
  • the ability of compounds to modulate phospholipase activation could be screened using colony immunoblotting (Lyons and Nelson (1984) Proc. Natl. Acad. Sci. USA 81:7426-7430) using anti-phosphotyrosine.
  • Reagents for performing such assays are commercially available, for example, phosphotyrosine specific antibodies which measure increases in tyrosine phosphorylation and phospho-specific antibodies can be purchased (New England Biolabs, Beverly, MA).
  • Tests for phosphorylation could be useful to measure the phosphorylation of proteins in response to the modulation of a phospholipase activity; it is noted that protein phosphorylation need not be directly affected by the modulation in phospholipase activity, but rather may amplify signals generated by the phospholipase.
  • Multi-kinase cascades allow not only signal amplification but also signal divergence to multiple effectors that are often cell-type specific, allowing a growth factor to stimulate mitosis of one cell and differentiation of another.
  • MAP kinase pathway that appears to mediate both mitogenic, differentiation and stress responses in different cell types. Stimulation of growth factor receptors results in Ras activation followed by the sequential activation of c-Raf, MEK, and p44 and p42 MAP kinases (ERK1 and ERK2). Activated MAP kinase then phosphorylates many key regulatory proteins, including p90RSK and Elk-1 that are phosphorylated when MAP kinase translocates to the nucleus. Homologous pathways exist in mammalian and yeast cells. For instance, an essential part of the S.
  • cerevisiae pheromone signaling pathway is comprised of a protein kinase cascade composed of the products of the STE11, STE7, and FUS3/KSS1 genes (the latter pair are distinct and functionally redundant). Accordingly, phosphorylation and/or activation of members of this kinase cascade can be detected and used to assay phospholipase modulation.
  • Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation.
  • a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on phospholipase signaling.
  • the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to phospholipase signal modulation, with the level of expression of the reporter gene providing the receptor-dependent detection signal. If only one transcriptional regulatory element is included it must be a regulatable promoter.
  • At least one the selected transcriptional regulatory elements must be indirectly or directly regulated by the activity of the heterologous phospholipase whereby activity of the phospholipase can be monitored via transcription of the reporter genes.
  • Many reporter genes and transcriptional regulatory elements are known to those of skill in the art and others may be identified or synthesized by methods known to those of skill in the art.
  • a reporter gene includes any gene that expresses a detectable gene product, which may be RNA or protein. Preferred reporter genes are those that are readily detectable.
  • the reporter gene may also be included in the construct in the form of a fusion gene with a gene that includes desired transcriptional regulatory sequences or exhibits other desirable properties.
  • reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other enzyme detection systems, such as beta-galactosidase; firefly luciferase (deWet et al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase (Engebrecht and Silverman (1984), PNAS 1: 4154-4158; Baldwin et al. (1984), Biochemistry 23: 3663-3667); alkaline phosphatase (Toh et al. (1989) Eur. J. Biochem.
  • CAT chloramphenicol acetyl transferase
  • Transcriptional control elements which may be included in a reporter gene construct include, but are not limited to, promoters, enhancers, and repressor and activator binding sites. Suitable transcriptional regulatory elements may be derived from the transcriptional regulatory regions of genes whose expression is rapidly induced, generally within minutes, after modulation of a phospholipase.
  • genes include those which are responsive to the second messengers generated upon phospholipase activation, such as Ca """1" , cAMP, and others.
  • One such gene is c-fos, an immediate early gene (see, Sheng et al. (1990) Neuron 4: 477-485).
  • Immediate early genes are genes that are rapidly induced upon binding of a ligand to a cell surface protein.
  • the characteristics of preferred genes from which the transcriptional control elements are derived include, but are not limited to, low or undetectable expression in quiescent cells, rapid induction at the transcriptional level within minutes of extracellular simulation, induction that is transient and independent of new protein synthesis, subsequent shut-off of transcription requires new protein synthesis, and mRNAs transcribed from these genes have a short half-life. It is not necessary for all of these properties to be present.
  • the amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable.
  • specific mRNA expression may be detected using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity.
  • the gene product of the reporter is detected by an intrinsic activity associated with that product.
  • the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or luminescence.
  • the amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks heterologuos DNA, such as the phospholipase. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the phospholipase.
  • the reporter or marker gene provides a selection method such that cells in which the peptide is a ligand for the receptor have a growth advantage. For example the reporter could enhance cell viability, e.g., by relieving a cell nutritional requirement, and/or provide resistance to a drug.
  • the reporter gene could encode a gene product which confers the ability to grow in the presence of a selective agent, e.g., canavanine.
  • a selective agent e.g., canavanine.
  • use of the S. cerevisiae plcl A allele as an endogenous mutant phospholipase C gene provides a readout system, whereby functional complementation (i.e. detection of the second detectable phenotype rather than the first detectable phenotype) can be detected or quantitated by cell growth.
  • functional complementation i.e. detection of the second detectable phenotype rather than the first detectable phenotype
  • growth systems suffer from their "quantal" nature.
  • a transcriptionally based readout may be preferred because it is rapid (i.e. hours instead of days) and affords greater flexiblity both in terms of types of readout and dynamic range of the readout.
  • a transcriptionally based readout may be preferred because it is rapid (i.e. hours instead of days) and affords greater flexiblity both in terms of types of readout and dynamic range of the readout.
  • by placing the bacterial gene encoding lacZ under the control of the promoter sensitive to signals generated upon activation of a phospholipase pathway can be detected in less than an hour by monitoring the ability of permeabilized yeast to produce color from a chromogenic substrate. The rapidity of such a readout would, in itself, be advantageous. And such a readout would be necessary to monitor phospholipase activity under conditions where the yeast do not grow.
  • a transcriptional readout can be developed by identifying genes/promoters that are positively or negatively regulated by the PLCl locus (i.e. promoters that are up or down- regulated in PLCl vs. plcl A strains or in plcl A strains expressing human PLC- ⁇ 2 plus G ⁇ 16). These promoters can then be linked to a reporter gene. Alternatively, the reporter gene can be expressed in response to a downstream phospholipase C signal molecule, such as IP3, DAG, increased intracellular calcium levels or increased PKC activity.
  • a transcriptional based readout can be constructed using yeast expressing mammalian PLC enzymes in the following manner.
  • CREB is a transcription factor whose activity is regulated by phosphorylation at a particular serine (SI 33).
  • SI 33 serine
  • phospho-CREB binds to a recognition sequence known as a CRE (cAMP Responsive Element) found to the 5' of promotors known to be responsive to elevated cAMP levels.
  • CRE cAMP Responsive Element
  • a transcriptional-based readout can be constructed in plcl ⁇ yeast strains expressing a mammalian PLC enzyme, regulatory proteins (G ⁇ and/or G ⁇ ), if necessary, and/or a reporter gene (i.e.
  • lacZ whose expression is driven by a basal promoter containing one or more CREs in the following manner.
  • Changes in the intracellular concentration of Ca + ⁇ (a result of alterations in the activity of the recombinant PLC) will result in changes in the level of expression of the reporter gene if: a) CREB is also co-expressed in the cell, and b) either the endogenous yeast CaM kinase will phosphorylate CREB in response to increases in calcium or if an exogenously expressed CaM kinase IV is present in the same cell.
  • the promoter is activated upon activation of the phospholipase, in which case, for selection, the expression of the marker gene should result in a benefit to the cell.
  • a preferred marker gene is the imidazoleglycerol phosphate dehydratase gene (HIS3). If a phospholipase responsive promoter is operably linked to a beneficial gene, the cells will be useful in screening or selecting for phospholipase activators. If it is linked to a deleterious gene, the cells will be useful in screening or selecting for inhibitors.
  • the promoter may be one which is repressed by phospholipase, thereby preventing expression of a product that is deleterious to the cell.
  • a phospholipase- repressed promoter one screens for agonists by linking the promoter to a deleterious gene, and for antagonists, by linking it to a beneficial gene.
  • Repression may be achieved by operably linking a phospholipase-induced promoter to a gene encoding mRNA that is antisense to at least a portion of the mRNA encoded by the marker gene (whether in the coding or flanking regions), so as to inhibit translation of that mRNA.
  • Repression may also be obtained by linking a phospholipase induced promoter to a gene encoding a DNA-binding repressor protein, and incorporating a suitable operator site into the promoter or other suitable region of the marker gene.
  • suitable positively selectable (beneficial) genes include the following: URA3, LYS2, HIS3, LEU2, TRP1; ADE1,2,3, 4,5, 7,8; ARGl, 3, 4, 5, 6, 8; HIS1, 4, 5; ILV1, 2, 5; THR1, 4; TRP2, 3, 4, 5; LEW, 4; MET2,3,4,8,9,14,16,19; URA1, 2,4,5, 10; H0M3,6; ASP3; CHOI; ARO 2, 7; CYS3; OLE1; IN01,2,4; PR01,3 Countless other genes are potential selective markers. The above are involved in well-characterized biosynthetic pathways.
  • the imidazoleglycerol phosphate dehydratase (IGP dehydratase) gene (HIS3) is preferred because it is both quite sensitive and can be selected over a broad range of expression levels.
  • the cell is auxotrophic for histidine (requires histidine for growth) in the absence of activation. Activation leads to synthesis of the enzyme and the cell becomes prototrophic for histidine (does not require histidine). Thus the selection is for growth in the absence of histidine. Since only a few molecules per cell of IGP dehydratase are required for histidine prototrophy, the assay is very sensitive.
  • Suitable genes include: URA3 (orotidine-5'-phosphate decarboxylase; inhibits growth on 5-fluoroorotic acid), LYS2 (2-aminoadipate reductase; inhibits growth on ⁇ -aminoadipate as sole nitrogen source), CYH2 (encodes ribosomal protein L29; cycloheximide-sensitive allele is dominant to resistant allele), CAN1 (encodes arginine permease; null allele confers resistance to the arginine analog canavanin), and other recessive drug-resistant markers.
  • the marker gene may also be a screenable gene.
  • the screened characteristic may be a change in cell morphology, metabolism or other screenable features.
  • Suitable markers include beta-galactosidase (Xgal, C12FDG, Salmon-gal, Magenta-Gal (latter two from Biosynth Ag)), alkaline phosphatase, horseradish peroxidase, exo-glucanase (product of yeast exbl gene; nonessential, secreted); luciferase; bacterial green fluorescent protein; (human placental) secreted alkaline phosphatase (SEAP); and chloramphenicol transferase (CAT).
  • a preferred screenable marker gene is beta-galactosidase; yeast cells expressing the enzyme convert the colorless substrate Xgal into a blue pigment. Again, the promoter may be receptor-induced or receptor-inhibited.
  • the present invention also facilitates the detection of inhibitors or activators of proteins other than phospholipase provided that the yeast cell expresses or is engineered to express the protein of interest in such a manner that it is functionally "coupled", directly or indirectly, to the phospholipase.
  • yeast cells can also be used in more general readout systems for modulation of the activity of a variety of different cellular signalling components which regulate phospholipase activation, such as receptors, which are known to couple to phospholipases, either directly, (e.g. the PDGF receptor) or via a regulatory protein (e.g.
  • a G- protein coupled receptor or tyrosine kinase coupled receptor a G-protein heterotrimer
  • G ⁇ subunit a G ⁇ subunit
  • G ⁇ subunit another protein known to interact functionally with a known phospholipase substrate (e.g., profilin, gelsolin, cofilin, and alpha-actin); and other effectors whose activity is dependent on phospholipase C activity (i.e., IP3 receptors/calcium channels, other potential IP3 sensitive calcium channels, and other calcium sensitive enzyme activities such as PKC or CaM kinase).
  • phospholipase substrate e.g., profilin, gelsolin, cofilin, and alpha-actin
  • effectors whose activity is dependent on phospholipase C activity (i.e., IP3 receptors/calcium channels, other potential IP3 sensitive calcium channels, and other calcium sensitive enzyme activities such as PKC or CaM kinase).
  • the yeast cells of the present invention may be used to identify drugs which modulate the activity of a mammalian G protein-coupled receptor.
  • the yeast cell is engineered to express a mammalian G protein-coupled receptor.
  • Exemplary compounds which can be screened for activity include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries.
  • peptide class One class of potential modulators of particular interest is the peptide class.
  • the term "peptide” is used herein to refer to a chain of two or more amino acids, with adjacent amino acids joined by peptide (-NHCO-) bonds.
  • the peptides of the present invention include oligopeptides, polypeptides, and proteins.
  • the peptides of the present invention are 2 to 200, more preferably 5 to 50, amino acids in length.
  • the minimum peptide length is chiefly dictated by the need to obtain sufficient potency as an activator or inhibitor.
  • the maximum peptide length is only a function of synthetic convenience once an active peptide is identified.
  • Synthetic peptides are also of interest.
  • peptides based on the calmodulin-binding domain of calmodulin-dependent phospholipases could serve as modulators of phospholipase activity.
  • peptides or molecules of any structure which inhibit the interaction between the phospholipase and known endogenous modulators of phospholipase activity are of interest.
  • Known endogenous phospholipase modulators include Ca2+, Ca2+/calmodulin, protein kinase C, protein kinase A, Gas, Gai, G ⁇ , and adenosine.
  • the yeast cells When peptide drugs are being assayed, the yeast cells may be engineered to express the peptides, rather than being exposed to the peptides simply by adding the peptides to the culture medium.
  • Peptide libraries are systems which simultaneously display, in a form which permits interaction with a target, a highly diverse and numerous collection of peptides. These peptides may be presented in solution (Houghten 1991), or on beads (Lam 1991), chips (Fodor 1991), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull 1992) or on phage (Scott, Devlin, Cwirla, Felici, Ladner '409).
  • the screening is for binding in vitro to an artificially presented target, not for activation or inhibition of a cellular signal transduction pathway in a living cell. While a cell surface receptor may be used as a target, the screening will not reveal whether the binding of the peptide caused an allosteric change in the conformation of the receptor.
  • Ladner, USP 5,096,815 describes a method of identifying novel proteins or polypeptides with a desired DNA binding activity.
  • Semi-random (“variegated") DNA encoding a large number of different potential binding proteins is introduced, in expressible form, into suitable host cells.
  • the target DNA sequence is incorporated into a genetically engineered operon such that the binding of the protein or polypeptide will prevent expression of a gene product that is deleterious to the cell under selective conditions. Cells which survive the selective conditions are thus cells which express a protein which binds the target DNA. While it is taught that yeast cells may be used for testing, bacterial cells are preferred.
  • the interactions between the protein and the target DNA occur only in the cell, not in the periplasm, and the target is a nucleic acid, not a protein.
  • Yeast have been engineered to express foreign polypeptide variants to be tested as potential antagonists of mammalian receptors.
  • Libraries encoding mutant glucagon molecules were generated through random misincorporation of nucleotides during synthesis of oligonucleotides containing the coding sequence of mammalian glucagon. These libraries were expressed in yeast and culture broths from transformed cells were used in testing for antagonist activity on glucagon receptors present in rat hepatocyte membranes (Smith et al. 1993).
  • the yeast cells are engineered to express a peptide library.
  • a "peptide library” is a collection of peptides of many different sequences (typically more than 1000 different sequences), which are prepared essentially simgrowthultaneously, in such a way that, if tested simultaneously for some activity, it is possible to characterize the "positive" peptides.
  • the peptide library of the present invention takes the form of a yeast cell culture, in which essentially each cell expresses one, and usually only one, peptide of the library. While the diversity of the library is maximized if each cell produces a peptide of a different sequence, it is usually prudent to construct the library so there is some redundancy. Moreover, each sequence should be produced at assayable levels.
  • the peptides of the library are encoded by a mixture of DNA molecules of different sequence. Each peptide-encoding DNA molecule is ligated with a vector DNA molecule and the resulting recombinant DNA molecule is introduced into a yeast cell. Since it is a matter of chance which peptide-encoding DNA molecule is introduced into a particular cell, it is not predictable which peptide that cell will produce. However, based on a knowledge of the manner in which the mixture was prepared, one may make certain statistical predictions about the mixture of peptides in the peptide library.
  • the peptides of the library will have at least one, and usually more than one, variable residue.
  • a variable residue may vary among any of two to any of all twenty of the genetically encoded amino acids; the range of possibilities may be different, if desired, for each of the variable residues of the peptide.
  • the frequency of occurrence of the allowed amino acids at particular residue positions may be the same or different.
  • the peptide may also have one or more constant residues.
  • the DNAs are synthesized a base at a time.
  • a suitable mixture of nucleotides is reacted with the nascent DNA, rather than the pure nucleotide reagent of conventional polynucleotide synthesis.
  • the second method provides more exact control over the amino acid variation.
  • trinucleotide reagents are prepared, each trinucleotide being a codon of one (and only one) of the amino acids to be featured in the peptide library.
  • a mixture is made of the appropriate trinucleotides and reacted with the nascent DNA.
  • the cytoplasm of the yeast cell is bounded by a lipid bilayer called the plasma membrane. Between this plasma membrane and the cell wall is the periplasmic space.
  • Peptides secreted by yeast cells cross the plasma membrane through a variety of mechanisms and thereby enter the periplasmic space.
  • the secreted peptides are then free to interact with other molecules that are present in the periplasm or displayed on the outer surface of the plasma membrane.
  • the peptides then either undergo re-uptake into the cell, diffuse through the cell wall into the medium, or become degraded within the periplasmic space.
  • the peptide library may be secreted into the periplasm by one of two distinct mechanisms, depending on the nature of the expression system to which they are linked.
  • the peptide may be structurally linked to a yeast signal sequence, such as that present in the ⁇ -factor precursor, which directs secretion through the endoplasmic reticulum and Golgi apparatus. Since this is the same route that the receptor protein follows in its journey to the plasma membrane, opportunity exists in cells expressing both the receptor and the peptide library for a specific peptide to interact with the receptor during transit through the secretory pathway. This has been postulated to occur in mammalian cells exhibiting autocrine activation.
  • Such interaction would likely yield activation of the linked pheromone response pathway during transit, which would still allow identification of those cells expressing a peptide agonist.
  • An alternative mechanism for delivering peptides to the periplasmic space is to use the ATP-dependent transporters of the STE6/MDR1 class. This transport pathway and the signals that direct a protein or peptide to this pathway are not as well characterized as is the endoplasmic reticulum-based secretory pathway. Nonetheless, these transporters apparently can efficiently export certain peptides directly across the plasma membrane, without the peptides having to transit the ER/Golgi pathway.
  • the present invention does not require periplasmic secretion, or, if such secretion is provided, any particular secretion signal or transport pathway.
  • agents identified in the subject assay can be formulated in pharmaceutical preparations for in vivo administration to an animal, preferably a human.
  • the subject compounds selected in the subject, or a pharmaceutically acceptable salt thereof may accordingly be formulated for administration with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof.
  • a biologically acceptable medium such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof.
  • a biologically acceptable medium includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. The use of such media for pharmaceutically active substances is known in the art.
  • Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable "deposit formulations". Based on the above, such pharmaceutical formulations include, although not exclusively, solutions or freeze-dried powders of the compound in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered media at a suitable pH and isosmotic with physiological fluids. In preferred embodiment, the compound can be disposed in a sterile preparation for topical and/or systemic administration.
  • excipients such as, but not exclusively, mannitol or glycine may be used and appropriate buffered solutions of the desired volume will be provided so as to obtain adequate isotonic buffered solutions of the desired pH.
  • Similar solutions may also be used for the pharmaceutical compositions of compounds in isotonic solutions of the desired volume and include, but not exclusively, the use of buffered saline solutions with phosphate or citrate at suitable concentrations so as to obtain at all times isotonic pharmaceutical preparations of the desired pH, (for example, neutral pH).
  • All expression plasmids are based upon the shuttle vectors originally described by Sikorski and Hieter (R.S. Sikorski and P.Hieter (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27).
  • the expression plasmids with the GPAl promoter (Cadus 1127), the PGK promoter (Cadus 1447) and the CUPl promoter (Cadus 1725 and 1728) have been described elsewhere (Cadus published Patent Application WO 94/23025 entitled "Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor).
  • G -subunits Construction of Low Copy Expression Plasmids
  • the following full length G-protein encoding inserts G ⁇ S, G ⁇ i2, G ⁇ i3, G ⁇ q, G ⁇ l 1,
  • G ⁇ l6, G ⁇ OA, G ⁇ OB, G ⁇ l 2, GNAZ, and activated alleles (GTPase-deficient) of G ⁇ S, G ⁇ i2, G ⁇ q, and G ⁇ l 6 were amplified by polymerase chain reaction using VENT polymerase, with cloning sites added to the 5' and 3' ends of the coding regions. In all cases, the restriction site added to the 5' end of the gene encoded a novel Ncol compatible overhang, while the restriction site added to the 3' end of the gene encoded a novel Xhol compatible overhang.
  • Cadus 1127 is a low copy plasmid (CEN6 ARS4) in which heterologous gene expression is driven by the GPAl promoter (-1400 to +1 of the native GPAl locus).
  • CEN6 ARS4 low copy plasmid
  • a novel Ncol site has been engineered into this vector such that the initiator methionine (at position +1) is embedded in this site (CCATGG). All G-protein expression cassettes were constructed as described below for G ⁇ l 6.
  • Template 100 ng
  • primers 1 uM final concentrations
  • lOx reaction buffer 2 mM MgSO4.
  • Template was denatured at 94°C for 30 seconds in the presence of primers followed byaddition of lul per lOOul reaction volume of VENT polymerase.
  • the amplified product was purified by gel electrophoresis, cut with BsmBI and Xhol, and ligated to Ncol / Xhol cut and phosphatase treated Cadus 1127 vector DNA. Recombinant clones were identified by colony PCR using primers flanking the inserted G ⁇ l 6 sequences, confirmed by restriction digestion, and validated by dideoxynucleotide sequencing of the PCR product.
  • G ⁇ q and Gal l expressing plasmids were prepared in a similar fashion using the following oligonucleotide primer pairs for amplification:
  • G -subunits - High Copy Expression Plasmids Full length G-protein encoding inserts were amplified by polymerase chain reaction using VENT polymerase as described above, with cloning sites added to the 5' and 3' ends of the coding regions. In all cases, the restriction site added to the 5' end of the gene encoded a novel Ncol compatible overhang, while the restriction site added to the 3' end of the gene encoded a novel Xhol compatible overhang. PCR products were gel purified, restricted with the appropriate endonucleases, and cloned into Ncol/Xhol cut Cadus 1447.
  • Cadus 1447 is a high copy plasmid (2 micron origin of replication) in which heterologous gene expression is driven by the phosphoglycerol kinase (PGK) promoter.
  • PGK phosphoglycerol kinase
  • a novel Ncol site is present at the initiator methionine, and a unique Xhol site is downstream from it.
  • G-proteins cloned in this manner include G ⁇ S, G ⁇ q, Gal l, Gal6, GaOA, GaOB, Gal2, GNAZ, and activated alleles (GTPase-deficient) of G ⁇ S, G ⁇ i2, G ⁇ q, and G ⁇ l 6.
  • Rat PLC- ⁇ 1 (Suh et al., (1988)) was cloned into Cadus 1725 (CUPp LEU2 CEN ARS AmpR) and Cadus 1728 (CUPp LEU2 2 micron origin AmpR).
  • CUPp LEU2 CEN ARS AmpR Cadus 1725
  • Cadus 1728 Cadus 1728
  • ATG initiator methionine codon
  • the resulting plasmid, Cadus 1642 (Rat PLC- ⁇ 1), was cleaved with ApaLI and ligated to a duplex adapter encoding the amino terminal seven residues of rat PLC- ⁇ 1 with yeast codon bias.
  • the ligation mixture was treated with polynucleotide kinase, cleaved with BamHI and a 3.8 kb fragment with the entire coding region of rat PLC- ⁇ 1 was isolated by gel electrophoresis. This 3.8 kb PLC- ⁇ 1 fragment was then ligated to Ncol - BamHI cut Cadus 1725 and Cadus 1728. Plasmids containing inserts in the correct orientation were identified by colony PCR and verified by restriction analysis and double-stranded DNA sequencing using Sequenase V2.0 (U.S. Biochemicals).
  • Oligo D was treated with polynucleotide kinase prior to annealing to oligo C and ligation to EcoRI-blunt/Eco47III cut Cadus 1680. Following ligation, the ligation mixture was treated with polynucleotide kinase to phosphorylate the Ncol overhang at the 5' end of the gene and the 3.8 kb fragment with the entire coding region of human PLC- ⁇ 2 was purified by gel electrophoresis. This 3.8 kb fragment has Ncol compatible overhangs at both termini, and was ligated to Ncol cut/ shrimp alkaline phosphatase treated Cadus 1725 and 1728. Plasmids containing insert in the correct orientation were identified by colony PCR and verified by restriction analysis and double-stranded DNA sequencing using Sequenase V2.0.
  • S.cerevisiae strain CY 2954 (plcl*l::HIS3 ade2-101 his3*200 leu2*l lys2-801 trpl *l ura3-52 [CUP RAT PLCbetal LEU2 2mu-ori REP3 AmpR], GPAlp TRPl CEN6 ARS4 AmpR] was deposited with the American Type Culture Collection (Rockville, Maryland) on June 5, 1995 and has been designated with the ATCC Accession Number: 74343.
  • GAL1 promoter driven PLC- 1 does not complement the plcl mutant phenotype
  • Phospholipase-C ⁇ dependent hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) to form inositol 1,4,5, trisphosphate (IP3) and diacylglycerol (DAG) is stimulated by both G ⁇ and G ⁇ subunits of heterotrimeric G-proteins. Stimulation of PLC- ⁇ activity by G ⁇ subunits is restricted to members of the Gq family that includes Gq, -11, -14, -15, and -16. G ⁇ subunits belonging to other families (-s, -i, and -12/13) do not stimulate PLC- ⁇ dependent hydrolysis of PIP2 .
  • agonist dependent stimulation of IP3 and calcium mobilization have been shown to be partially sensitive to pertussis toxin. This observation initially lead to speculation that Gi or Go could stimulate PLC- ⁇ activity. More recently the pertussis toxin sensitive component of agonist dependent IP3 production has been shown to be due to the ability of G ⁇ subunits to stimulate PLC- ⁇ isoforms directly.
  • Cadus yeast strains CY1901, CY1903 and CY1904 (all CY1630 derivatives containing the plcl ⁇ l::HIS3 allele) contain, respectively, Cadus plasmids 1443 (no PLC), 1637 (GALlp-rat PLC- ⁇ l) or 1639 (GALlp-PLCl)(See Strain List, Table 2).
  • CY1904 While all three strains grow at 30°C on both synthetic complete and rich media, CY1904, harboring a GALlp-PLCl expression cassette on a 2 micron plasmid, grows better than either CY1901 (empty vector) or CY1903 (harboring a GALlp-rat PLC- ⁇ l expression cassette on a 2 micron plasmid). At non-permissive temperatures (>35°C), CY1901 and CY1903 failed to form colonies after 3 days in culture, while CY1904 forms large colonies.
  • CY1901, CY1903, and CY1904 (all haploid strains) were transformed by lithium acetate transformation procedures (Clontech, as per manufacturer's recommendations) with a panel of low-copy number (CEN ARS) G ⁇ subunit expression plasmids coding for the following genes under the transcriptional control of the GPAl upstream promoter: Cadus plasmid 1127 (empty vector), 1179 (GPAl), 1181 (G ⁇ S), 1606 (G ⁇ i2), 1617 (G ⁇ l6), 1753 (G ⁇ l6-Q209L GTPase " activated allele), 1685 (G ⁇ q), and 1749 (G ⁇ q-Q209L GTPase " activated allele)(See Strain List, Table 1).
  • a second potential difficulty presented with the GALl promoter relates to the inability of plcl strains to utilitize galactose as a carbon source. If galactose utilization is compromised in these strains, then induction of galactose sensitive promoters like GALlp and GALl Op would also be compromised. To circumvent both of these potential problems, the mammalian PLC- ⁇ isozymes were expressed from an inducible promoter whose activation is not dependent on carbon sources other than glucose. Unlike other high level constitutive promoters (i.e.
  • PGK or ADH1 has not been associated with cellular toxicity. This sort of toxicity has, in fact been reported in the literature by Flick and Thorner (1993) with respect to overexpression of the yeast PLCl gene from the GALl promoter in the presence of galactose. Flick and Thorner report that the growth of wildtype strains of yeast that contained the PLCl gene under the control of the GALl promoter was compromised when the GALl promoter was induced on galactose but not when it was repressed on glucose-containing media.
  • Yeast Strain CY1630 was transformed with each of these plasmids, as well as other PLC constructs in which PLC isozymes are driven by the GALlp or ADH1 promoters, in the presence or absence of plasmids expressing various G ⁇ subunits.
  • this particular hybrid subunit is functionally expressed in yeast (i.e. it couples to yeast G ⁇ subunits and supresses activation of the pheromone response pathway in gpal- strains).
  • yeast G ⁇ subunits couples to yeast G ⁇ subunits and supresses activation of the pheromone response pathway in gpal- strains.
  • the structural determinants involved in effector activation by G ⁇ subunits are thought to map to residues in the carboxyl terminal portions of G ⁇ subunits (Berlot and Bourne (1992); Rarick et al. (1992); Artemeyer et al.(1993)).
  • Y1630 ( plcl) derivatives See Strain List, Table 2) harboring combinations of mammalian PLC- ⁇ isozymes and G ⁇ subunits were first colony purified and then duplicate sibs of each co-transformation assayed for growth at 30oC and 37oC in the presence or absence of lOOuM CuSO4.
  • all plcl strains including those containing plasmids encoding rat PLC- ⁇ l, grew at 30oC, albeit less well than strains CY1633 (PLCl) or CY1904 (plcl ⁇ l::HIS3 [GALlp-PLCl]).
  • CY1630 derivatives co-transformed with a low copy (CEN ARS) plasmid encoding CUP-human PLC- ⁇ 2 and a low copy (CEN ARS) plasmid encoding the G ⁇ l6-Bam allele grew at both 30oC and at 37oC.
  • growth of CY1630 derivatives at 37oC in this assay was not due to expression of the G ⁇ l6-Bam allele alone as strains containing the G ⁇ subunit variant alone in the absence of rat or human PLC- ⁇ isozymes did not support growth at 37oC.
  • strains expressing human PLC- ⁇ 2 and activated forms of G ⁇ q (Q209L) or G ⁇ l 6 (Q212L) grew robustly at both 30oC and 37oC while strains harboring human PLC- ⁇ 2 and an activated form of G ⁇ S (Q227L) failed to support growth at 37oC. 3
  • Human PLC- ⁇ 3 has been found to complement the temperature-sensitive and NaCl sensitive phenotypes associated with the plcl genotype in yeast in a G-protein independent fashion. These conclusions are based on the finding that expression of the human PLC- ⁇ 3 in yeast strains with the plcl background under the control of the CUP promoter on either high or low copy plasmids, results in growth on 0.5M NaCl or at elevated temperatures, independent of the co-expression of G ⁇ subunits of the Gq family (i.e. q, 11, 14, 15, or 16).
  • the characteristics of the human PLC- ⁇ 3 isoform expressed in yeast resemble those of rat PLC- ⁇ l in exhibiting G-protein independent growth under non-permissive conditions, as distinct from the G-protein dependent growth phenotype of the human PLC- ⁇ 2 isoform.
  • Epidermal growth factor increases sn-1,2,- diacylglycerol levels and activates phospholipase D-catalysed phosphatidylcholine breakdown in Swiss 3T3 cells in the absence of inositol-lipid hydrolysis. Biochem. J., 285, 247-253.
  • Lysophosphatidate-induced cell proliferation identification and dissection of signalling pathways mediated by G proteins.
  • Emori Y., Homma, Y., Sorimachi, H., Kawasaki, H., Nakanishi, O., Suzuki, K., & Takenawa, T. (1989).
  • Protein kinase C stimulates adenylate cyclase activity in prolactin-secreting rat adenoma pituicytes by inactivating the inhibitory GTP-binding protein G j . Eur. J. Biochem, 183, 397-406.
  • Dog and rat pancreatic phospholipases A-2 Complete amino acid sequences deduced from complementary DNAs. J. Biochem., 99, 733-739. Park, D., Jhon, D.-Y., Kriz, R., Knopf, J., & Rhee, S. G. (1992). Cloning, Sequencing,
  • Pancreatic phospholipase A2 Isolation of the human gene and cDNAs from porcine pancreas and human lung. DNA, 5(6), 519-527.
  • NK-1 Human substance P receptor
  • cDNA for the human ⁇ 2 ⁇ adrenergic receptor A protein with multiple membrane spanning domains and a chromosomal location shared with the PDGF receptor gene. Proc. Natl. Acad. Sci. USA 84,
  • Neote K. DiGregorio, D., Mak, J.Y., Horuk, R., and Schall, T. J. (1993) Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor. Cell 72, 415-425. Ogawa-Y. Nakao-K. Arai-H. Nakagawa-O. Hosoda-K. Suga-S.
  • MOLECULE TYPE cDNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Endocrinology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Yeast cells comprising a heterologous phospholipase C protein and methods for their use in drug screening assays to identify a modulator (i.e. agonist or antagonist) of a phospholipase C are described.

Description

Expression of Functional Vertebrate Phospholipases in Yeast
Cross Reference to Related Applications
This invention is a Continuation-in Part of U.S.S.N 08/431,632, filed on June 7,
1995.
Field of the Invention
This invention relates to functional expression of heterologous phospholipases in yeast, the recombinant yeast cells, and methods for using the engineered cells, including, inter alia, the identification of agonists and antagonists of signal transduction pathways which involve phospholipases.
Background of the Invention Eukaryotic phospholipases are known to be involved in cellular signal transduction processes important in regulation of cellular growth, differentiation and secretory events in numerous cell types. The binding of agonists to certain cell surface receptors leads to the generation of a variety of signaling molecules which include phospholipid derived second messengers. The phospholipid-derived second messengers mediate both transient and sustained responses and are implicated in a wide variety of physiological responses including growth regulation, immune modulation and neurotransmission. Studies over the last two decades indicate that membrane lipids serve as substrates for the variety of different phospholipases that are responsible for the generation of phospholipid derived second messengers. These include phosphatidylinositols (the substrate for phospholipase C enzymes, see below), phosphatidylcholine, phosphatidylethanolamine, sphingolipids (e.g. sphingomyelin, sphingosine, sphingosine phosphate and sphingosine phosphocholine). See Dicheva and Irvine (1995) Cell 80:269-278 for a recent review.
There are at least five distinct types of phospholipase activities known to be responsible for the generation of phospholipid second messengers, namely phospholipase A (including phospholipases Ai and A2), phospholipase B, phospholipase C, phospholipase D and sphingomyelinase. The distinguishing feature of each of these phospholipases is the substrate bond cleaved, and hence the second messengers derived from a given phospholipid substrate.
PLAi and PLA2 (E.C.3.1.1.4) catalyze the release of fatty acids, in particular arachidonic acid (AA), from the sn\ and snl positions of 1,2-diacylglycerol, 3- phosphocholines, generating AA and lysophosphorylcholine (lyso-PC) respectively. AA, in turn, has at least four known metabolic fates, namely, generation of proinflammatory eicosanoids (leukotrienes and prostaglandins), reincorporation into existing membrane phospholipids, reincorporation into soluble phospholipid metabolic pathways, and direct secretion from cells. In addition, lyso-PC serves as the precursor for the production of lipid second messengers like platelet activating factor (PAF). cDNA and genomic clones encoding the pancreatic form of PLA2 have been isolated from a variety of eukaryotic sources including bovine (Tanaka et al. 1987), rat (Ohara, O. et al. 1986 and 1990; and Kusunoki, et al. 1990), dog (Kerfelec et al. 1986),and pig (Seilhamer et al. 1986). In addition to the pancreatic PLA2 isoform, a variety of cellular PLA2 (cPLA.2) isoforms have been isolated from a wide variety of mammalian tissues and cell types including brain (Gray and Strickland, 1982), liver (De Winter et al. 1982), spleen (Teramoto et al. 1983), macrophages (Trotter and Smith (1986) Neurochem. Res. 11:349-361), leukocytes (Traynor and Authi 1981), and others (for a review see Ban Den Bosch, 1980). Clones for human (Clark et al. 1991; Sharp et al 1991) and murine (Clark et al. 1991) cPLA2 gene products have been isolated and characterized. The 85kDa gene product encoded by these cDNAs is expressed in cells types involved in the inflammatory response (neutrophils, platelets, monocytes and macrophages) and its expression is regulated by, for example, tumor necrosis factor, IL-1, TGF-β, MCSF and glucocorticoids.
Phospholipase B (PLB) has been described in a variety of eukaryotic species from fungi to mammals. PLB isoforms have several catalytic properties including the release of fatty acids from the sn\ and sn2 positions of phospholipids (as with PLAj and PLA2), the release of fatty acids from lysopholipids, and in the yeast Saccharomyces cerevisiae, acyltransferase activity that catalyzes the synthesis of phospholipids from lysophospholipids (Kuwabara et al. 1989; Gassama-Diagne 1989; and Lee et al. 1994). Genomic clones for PLB-like enzymes have been isolated from several sources including S. cerevisiae (Lee et al. 1994) and Penicillium notatum (Masuda et al. 1991).
Phospholipase C enzymes (PLC; E.C. 3.1.4.3), of which there are at least four subfamilies known as PLC-α, -β, -γ, and -δ (For reviews, see Rhee et al. 1989, and Cook and Wakelam 1992b) catalyze the hydrolysis of phosphatidylinositol (4,5) bisphosphate (PIP2) to form two second messengers, inositol 1,4,5-trisphosphate (IP3) which is involved in the mobilization of intracellular stores of calcium, and diacylglycerol (DAG), which binds to and activates selected isoforms of protein kinase C (PKC; E.C. 2.7.1.37). This class of enzymes, and second messengers generated by them have been demonstrated to be linked to receptor tyrosine kinases, G-protein coupled receptors and to MIRRs like the T-cell antigen receptor, the B-cell antigen receptor and immunoglobulin Fc receptors. Phospholipase D (PLD; E.C. 3.1.4.4) catalyzes the hydrolysis of phosphatidylcholines to yield phosphatidic acid (PA) and free choline (see Bishop, Pachter and Pai 1992; and Cook and Wakelam, 1992a). While neither PA nor free choline has been shown to function as a second messenger directly, it has been reported recently that PA or its lyso derivative, lyso- PA, may function to stimulate hydrolysis of polyphosphoinositides, activation of PKC, inhibition of adenylyl cyclase and stimulation of DNA synthesis (Moolenaar et al, 1986; Murayama and Ui, 1987, Van Corven et al, 1989; and Plevin et al, 1991b. refs in Cook and Wakelam, 1992b), as well as activate kinases directly in a manner similar to DAG (Eppand and Stafford, 1990, and Bocckina and Exton, 1990, refs in Cook and Wakelam, 1992b). In addition, phosphatidic acid formed by the action of PLD can be converted to DAG by the action of phosphatidic acid phosphohydrolase (E.C. 3.1.3.4), and thus serve as a secondary reservoir for the production of DAG by PLC-independent mechanisms (Bonser et al, 1989 cited in Divechia and Irvine 1995, review; and Cook and Wakelam, 1992b). cDNA clones for phospholipase D have been isolated from a number of different species including Arcanobacterium haemolyticum (Cuevas, W.A., and J.G.L. Songer, 1993), Corynebacterium pseudotuberculosis (unpublished, GenBank Accession numbers L16586, L16587), Vibrio damsela (unpublished, GenBank Accession number L16584) and human (Tsang et al. 1993)
Phospholipase C enzymes Phospholipase C enzymes (PLC; E.C. 3.1.4.3) are intracellular enzymatic mediators of a wide variety of cellular responses to extracellular stimuli. Binding of hormones, growth factors, neurotransmitters, and other agonists to specific cell surface receptors initiates the activation of PLC isozymes, which in turn result in the production of at least two well characterized active second messengers, inositol- 1,4,5-trisphophate (l.,4,5-IP3) and sn-\,2- diacylglycerol (DAG). 1,4,5-IP3 binds to a specific family of intracellular receptors localized on modified portions of the endoplasmic reticulum that bears homology to the ryanodine receptor family of intracellular calcium channels (the IP3 receptor family, reviewed in Berridge, 1993). In addition to functioning as the IP3 receptor, these receptors also function as IP3-sensitive calcium channels which cause release of intracellular stores of calcium upon liganding with IP3.
Increases in intracellular calcium, in turn, result in the transient or sustained activation of a variety of cellular signaling pathways which include but are not limited to activation of protein kinase C (PKC) isoforms, transcriptional activation through the Mitogen Activated Protein Kinase (MAPK) and Jun Kinase (JNK) pathways, and mitogenesis. DAG, on the other hand, forms a complex with phosphatidylserine and calcium and activates protein kinase C (PKC) isozymes, which in turn activate signaling pathways by direct phosphorylation of a variety of substrates which include adenylyl cyclases and RAF-1 (PJ. Parker et al, 1986; Coussens et al. 1986a, and Kolch et al. 1993).
The division of PLCs into four classes, α, β, γ, δ, originally corresponded to immunologically distinct proteins of 56 kDa, 150 kDa, 145 kDa, and 85 kDa purified from bovine brain (PLC-β, -γ, and -δ) and other tissues including liver, seminal vesicles or uterus (PLC-α). (Described in Suh et al. 1986; and summarized in A.J. Morris et al 1990). All of these enzymes have similar catalytic properties in that they hydrolyze phosphatidyl inositol (PI), phosphatidyl inositol 4-monophosphate (PIP) and phosphatidyl inositol- 4,5,bisphosphate (PIP2) in a calcium dependent manner, but not phosphatidylcholine, phosphatidylserine or phosphatidylethanolamine. However, these immunologically distinct isozymes are distinguishable in several regards, not the least of which is that they are all unique gene products encoded by different genes, as discussed in further detail below. At the enzymatic level, these enzymes differ with respect to both their catalytic properties and their modes of regulation. With respect to divalent cation requirements for activity, for example, polyphosphoinositides are the preferred substrates for the PLC-β and -δ classes at low or physiological intracellular calcium concentrations, while PLC-γ isozymes prefer PI and PIP2 at physiological intracellular calcium concentrations. The modes of regulation of PLC isozymes also differ considerably with respect to one another. The PLC-β isozymes are activated in response to ligand binding to G-protein coupled receptors and are directly stimulated by Gα and Gβγ components of heterotrimeric G-proteins. PLC-γ isozymes, on the other hand, are activated directly by phosphorylation via receptor and non-receptor tyrosine kinases. While little is known about the regulation of PLC-α activity in vivo or in vitro, recent studies of PLC-δ regulation suggest that it may be regulated by a novel class of regulatory proteins (pl22-RhoGAP) that show similarity to the GTPase activating protein homology region of bcr, display GAP activity towards RhoA, and bind to and directly stimulate PLC-δ 1 (Homma, Y., and Y. Emori, 1995).
Cloning of PLC isozymes
Molecular cloning studies have resulted in the identification of at least ten genes encoding distinct PLC isozymes. Several PLC-α cDNA clones have been isolated from a variety of sources including rat basophilic leukemia cells (Bennett et al. 1988), mouse lymphocytes (Hempel and DeFranco, 1991), and bovine tissue (Hirano et al, GenBank Accession number D 16235). Four PLC-β encoding cDNAs encoding subtypes -βl-4 (Suh et al 1988; Bahk et al. 1994; Park et al. 1992; Lee et al. 1993; and Kim et al. 1993) have been reported. Two PLC-γ encoding cDNAs have been reported, which correspond to PLC-γl and -γ2 subtypes (Emori et al. 1989; Suh, et al, 1988; and Burgess et al. 1990). Three PLC-δ encoding cDNAs encoding subtypes PLC-δ 1-3 have been published (reviewed in Cook and Wakelam, 1992b and Boyer et al, 1994).
Sequence Comparisons ofPLCs The overall primary structural identity between PLC-β isoforms is quite low (< 30% identity), in part explaining the differences in size among the different isozymes and the lack of immunological cross-reactivity observed with antisera and monoclonal antibodies developed against the various purified isozymes. PLC-β, -γ,and -δ isozymes share considerable sequence homology, however, in two regions, variously referred to as the X and Y regions (Rhee et al, 1989) or regions I and II (Meldrum, et al. 1991). The X region is approximately 150 amino acid residues in length, while the Y region is approximately 260 residues in length. Between classes, the X regions share approximately 50% identity, while the Y regions share approximately 40% identity in pairwise comparisons amongst PLC-β, -γ, and -δ isozymes. Based on the high degree of conservation of these two domains among the PLC-β, -γ,and -δ isozymes, it has been argued that these regions contribute to the catalytic activity of these enzymes. An additional feature of the spacer region between the X and Y regions is that in PLC-β, and -δ classes, these regions are separated by 50-100 residues rich in serine, threonine and acidic residues with no particular homology to known regulatory motifs, while in the PLC-γ class the X and Y regions are separated by more than 400 residues. This region of the PLC-γ isoforms encodes two src homology 2 (SH2) domains and one src homology 3 (SH3) domain, which are not present in either PLC-β or -δ enzymes. As discussed below, the SH2 domains are involved in regulation of PLC-γ activation by receptor and non-receptor tyrosine kinases.
Sequence analysis of the PLC-α cDNA clones from a rat basophilic leukemia cell line reveals considerable sequence divergence of this class of phospholipase C isozymes from the PLC-β, -γ,and -δ isozymes. PLC-α encodes neither the highly conserved X or Y regions found in all other PLC isoforms nor SH2 or SH3 domains found in PLC-γ isoforms.
Yeast PLC In addition to the mammalian PLC-β isoforms discussed in the preceding sections, various PLCs have been isolated from several other organisms. Of considerable importance in this regard is the molecular cloning of the gene (PLC1) encoding a protein with homology to the PLC class of phospholipases from the yeast Saccharomyces cerevisiae (Yoko-O et al. 1993; Payne and Fitzgerald-Hayes, 1993; and Flick and Thorner, 1993). Sequence analysis of the independently identified clones reveals first that all three clones are from the same genetic locus and that the protein coded for by this gene most resembles mammalian PLC-δ isozymes both with respect to size of the enzyme encoded by it and with respect to structural features such as the relative distance between the X and Y domains, the size of the carboxyl terminal extension beyond the Y domain, and the absence of SH2 and SH3 domains between the X and Y motifs (this last point is to be expected as yeast show no evidence of phosphotyrosine modification by biochemical analyses). Flick and Thorner (1993) overexpressed and purified this enzyme from yeast and demonstrated an associated phospholipase C activity with divalent cation requirement and substrate preferences that resemble those of mammalian PLC-δ isozymes. Finally, genetic analysis of S. cerevisiae strains with deletions at the PLC1 locus (plcJΔ) reveal a variety of conditionally lethal phenotypes associated with the pic 1 Δ genotype, such as, sensitivity to high osmolarity, poor growth on carbon sources other than glucose (i.e. galactose, raffinose, glycerol/ethanol), temperature sensitive growth at elevated temperatures (>35°C) and finally, chromosome missegregation (Flick and Thorner, 1993, and Payne and Fitzgerald-Hayes, 1993).
Expression of Foreign Proteins in Yeast Cells
A wide variety of foreign proteins have been produced in S. cerevisiae, that remain in the yeast cytoplasm or are directed through the yeast secretory pathway (Kingsman et al. TIBTECH 5, 53 (1987). These proteins include, as examples, insulin-like growth factor receptor (Steube et al. Eur. J. Biochem. 198, 651 (1991), influenza virus hemagglutinin (Jabbar et al. Proc. Natl. Acad. Sci. 82, 2019 (1985), rat liver cytochrome P-450 (Oeda et al. DNA 4, 203 (1985) and functional mammalian antibodies (Wood et al. Nature 314, 446 (1985). Use of the yeast secretory pathway is preferred since it increases the likelihood of achieving faithful folding, glycosylation and stability of the foreign protein. Thus, expression of heterologous proteins in yeast often involves fusion of the signal sequences encoded in the genes of yeast secretory proteins (e.g., α-factor pheromone or the SUC2 [invertase] gene) to the coding region of foreign protein genes.
A number of yeast expression vectors have been designed to permit the constitutive or regulated expression of foreign proteins. Constitutive promoters are derived from highly expressed genes such as those encoding glycolytic enzymes like phosphoglycerate kinase (PGK1) or alcohol dehydrogenase I (ADH1) and regulatable promoters have been derived from a number of genes including the galactokinase (GAL1) gene. In addition, supersecreting yeast mutants can be derived; these strains secrete mammalian proteins more efficiently and are used as "production" strains to generate large quantities of biologically ac' /e mammalian proteins in yeast (Moir and Davidow, Meth. in Enzymol. 194, 491 (1991). T ; following two reviews of the field are incorporated herein by reference in their entireties: "The Molecular and Cellular Biology of the Yeast. Saccharomyces, Genome dynamics, Protein Synthesis, and Energetics." 1991. Edited by J.R.Broach, John Pringle and Elizabeth Jones. Cold Spring Harbor Laboratory Press; "Guide to Yeast Genetics and Molecular Biology" 1991. Methods in Enzymology vol. 194. Edited by Christine Guthrie and Gerald R. Fink, Academic Press.
Several groups have attempted to express phospholipases in yeasts. Yoko-o et al., ((1993) Proc. Natl. Acad. Sci. USA 90:1804) claim to achieve complementation of a yeast PLC defect with an uncoupled rat PLCδl . Yoko-o et al. report the cloning of PLC from S. cerevisiae by PCR methodology using primers designed to incorporate sequences from two conserved amino acid sequences found in the X-region of mammalian PLC enzymes After cloning the gene, they proceeded to make gene disruptions at the PLC1 locus. Heterozygous diploid transformant (PLCl/plcl ::HIS3) were sporulated and tetrad analyses were performed. In the TY1 background, all four spores were found to be viable at a range of temperatures including 18°C, 30°C, and 37°C. In the TY4 background, Yoko-o et al. observed lethality at 30°Cin tetrad analyses. These phenotypes are in contradiction to those described herein, and those reported by Flick and Thorner in the art, where conditional lethality at 37°C is observed. This is important because it is not possible to measure complementation of a growth defect under the nonselective conditions of the Yoko-o et al experiments. Thus, Yoko-o et al. do not observe functional integration of the rat PLCγ into the yeast cell. Arkinstall et al ((1995) Mol. Cell. Biol. 15:1431) expressed a mammalian platelet- derived growth factorβ receptor and PLCγ2 in Schizosaccharomyces pombe. Arkinstall et al. found that in cells coexpressing the mouse PDGFβ receptor and PLCγ2, levels of [-1H]inositol phosphates in radioactively labeled yeast cells were increased. Coexpression of c-src was also found to result in phospholipid hydrolysis. Because these experiments only measure the immediate biochemical consequence of phospholipase Cγ stimulation, this work also fails to teach the functional integration of a mammalian PLCγ into a yeast cell.
Brief Description of the Figures
Figure 1 is a graphic representation showing human phospholipases and Gαl6 complementation of the plcl growth defect on high salt medium: S. cerevisiae strain CY1630 (MATα plclΔl::His3 ade2-101 his3Δ200 leu2Δl lys2-801 trplΔl ura3-52) transformed with plasmids carrying each of the following as described in the text was streaked out in sectors 1-6: (1) Gallp-rat PLC-βl and GPAlp-Gαl6; (2) CUPl-human PLC- β2 and no G protein; (3) CUPl-human PLC-β2 and GPAlp-Gαi2-Q205L; (4) CUPl-human PLC-β2 and GPAlp-GαS-Q227L; (5) CUPl-human PLC-β2 and GPAlp-Gαl6; (6) No PLC and GPA1-Gαl6. In the figure the symbol (+) represents growth and (-) represents no growth.
Summary of the Invention The present invention relates to the functional expression of mammalian phospholipases in yeast cells. The use of the engineered yeast cells in identifying potential inhibitors or activators of the mammalian phospholipase, or of other proteins which belong to a phospholipase signal transduction pathway, i.e., proteins which are naturally or artificially "coupled" to the mammalian phospholipase in the engineered yeast cell is also within the scope of the invention. The term "coupled" here means that inhibition or inactivation of the coupled protein results in inhibition or activation (not necessarily respectively) of the phospholipase. The term coupled is meant to include both "natural" coupling of heterologous signaling molecules into a yeast signal transduction pathway and "artificial" coupling of heterologous signaling molecules into a yeast pathway in a manner not normally operative in yeast cells. Functional expression of human phospholipases is especially desirable.
In general, the yeast cells of the subject invention are characterized as including a heterologous gene encoding a heterologous phospholipase C (PLC), e.g., a polypeptide having a phospholipase C activity. In preferred embodiments, the PLC is a mammalian PLC such as a human PLC. For example, the PLC can be a phospholipase selected from the group consisting of PLCα's, PLCβ's, PLCδ's and PLCγ's. Preferred PLC's are of the β subtype, such as PLCβl, PLCβ2, PLCβ3 and PLCβ4. In certain embodiments, the heterologous phospholipase C can be constutitively activated. This may occur by way of mutations to the PLC itself which result in a higher level of activity, relative to the wild- type protein, in the absence of signaling to the PLC. In other embodiments, the constitutive activation of the PLC can occur due to overexpression and/or consitutively activating mutations to upstream regulators of the PLC, such as receptors, G proteins and the like.
In certain embodiments, the recombinant cell is characterized by the ability of the heterologous PLC to hydrolyze phosphatidylinositol 4,5-bisphosphate. In other embodiments, the yeast cell has a loss-of-funαion mutation to an endogenous phospholipase gene, giving it a first detectable phenotype, and the heterologous PLC complements the loss-of-function mutation and confers a second detectable phenotype on the cell.
In preferred embodiments, the heterologous PLC is functionally integrated in a phospholipase-dependent signal pathway of the cell. For example, the heterlogous PLC may complement a loss-of-function mutation of an endogenous phospholipase gene of the yeast cell, e.g., the heterologous PLC may complement the plcl Δ mutation. Expression of the heterologous PLC may confer a phenotype to the host cell which is detectably different than the phenotype of the host cell in the absence of the heterologous PLC protein. For instance, complementation of a loss-of-function mutation, such as the plcl . mutation, by the heterologous PLC can rescue/overcome such phenotypes as temperature- sensitivity and/or salt sensitivity. In certain embodiments, the heterolgous PLC, via a phospholipase-dependent signal pathway, can modulate such downstream effectors as calcium mobilization and/or PKC activity. Moreover, in those embodiments wherein the phospholipase-dependent signal pathway modulates gene expression, the recombinant cell may also be engineered to include a reporter gene construct containing a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the phospholipase-dependent signal pathway, expression of the reporter gene providing the detectable signal. Exemplary reporter genes encode a gene product that gives rise to a detectable signal, such as color, fluorescence, luminescence, cell viability relief of a cell nutritional requirement, cell growth, or drug resistance. In preferred embodiments, the reporter gene encodes a gene product selected from the group consisting of chloramphenicol acetyl transferase, beta- galactosidase, luciferase, fluorescent protein, and alkaline phosphatase. In other embodiments, the reporter gene encodes a gene product which confers the ability to grow in the presence of a selective agent, e.g., canavanine.
In another embodiment the yeast cell further comprises a heterologous regulatory protein which is coupled to the phospholipase signaling pathway, e.g., the regulatory protein modulates the activity of the heterologous PLC or is modulated by the PLC activity. Exemplary regulatory proteins include, for example, G-protein heterotrimers; G α subunits; Gβγ subunits; proteins known to interact functionally with PLC substrates (e.g., profilin, gelsolin, cofilin, and alpha-actinin); and other effectors whose activity is dependent on PLC activity (i.e., IP3 receptors/calcium channels, and IP3 or calcium sensitive enzyme activities such as PKC or calcium/calmodulin kinase (CaM kinase)). In another embodiment the yeast cell comprises a heterologous receptor or ion channel or other surface protein capable of transducing signals via the phospholipase- dependent signal pathway, e.g., which is known to couple to PLC activity either directly or via a regulatory protein. This aspect of the invention provides for more general readout systems to assay modulation of the activity of a variety of different cellular signaling components which effect phospholipase C activation. In a preferred embodiment, the host cell further comprises a heterologous gene encoding a heterologous G-protein coupled receptor. Preferred G-protein coupled receptors include chemoattractant peptide receptors, neuropeptide receptords, cytokine, light receptors, neurotransmitter receptors, cyclic AMP receptors, and polypeptide hormone receptors. For example, the receptor may be any one of: an αlA-adrenergic receptor, an αlB-adrenergic receptor, an αlC-adrenergic receptor, an Mj AChR receptor, an M3 AChR receptor, an M5 AChR receptor, a D dopamine receptor, a D3 dopamine receptor, an Al adenosine receptor, a 5HTl-like receptor, a 5HT Id-like receptor, a 5HTld beta receptor, a substance K (neurokinin A) receptor, a f- Met-Leu-Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a growth hormone-releasing hormone (GHRH) receptor, a vasoactive intestinal peptide receptor, an oxytocin receptor, a SSTR3 receptor, an Luetinizing hormone/chorionic gonadotropin (LH/CG) receptor, a thromboxane A2 receptor, a platelet-activating factor (PAF) receptor, a C5a anaphylatoxin receptor, an Interleukin 8 (IL-8) IL-8RA receptor, an IL-8RB receptor, a mip-1/RANTES receptor, a metabotropic glutamate mGluRl-5 receptor, an ATP receptor, an amyloid protein precursor receptor, a bradykinin receptor, a gonadotropin-releasing hormone receptor, a cholecystokinin receptor, an antidiuretic hormone receptor, an adrenocorticotropic hormone II receptor, LTB4, LTD4 tachykinin receptor, thyrotropin releasing hormone receptor, and oxytocin receptor. In other embodiments, the the receptor protein is a receptor tyrosine kinase. In yet another embodiment, the recombinant cells are further engineered to include an expressible recombinant gene encoding a heterologous test polypeptide. In preferred embodiments, such cells are provided as mixed culture collectively expressing a variegated population of test polypeptides.
The present invention also relates to a rapid, reliable and effective assay for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of a phospholipase. The subject assay enables rapid screening of large numbers of test compounds to identifying those compounds which modulate, e.g., agonize or antagonize, phospholipase bioactivity. In general, the assay is characterized by the use of the recombinant cells described herein as engineered to express heterologous phospholipase activities which produce, in the engineered cell, a detection signal. The ability of particular test compounds contacted with the instant cells to modulate the phospholipase activity can be scored for by detecting up or down-regulation of the detection signal. For example, second messenger generation via the heterologous phospholipase activity can be measured directly.
Alternatively, the use of a reporter gene can provide a convenient readout. In any event, a statistically significant change in the detection signal can be used to facilitate identification of those compounds which are effectors of the phospholipase transducing activity. In one embodiment, there is provided an assay for identifying a modulator of a phospholipase C activity, comprising the steps of: (i) contacting the cell of claim 1 with a test compound under conditions appropriate for detecting an intracellular signal transduced via the phospholipase-dependent signal pathway; and (ii) measuring a level of signal transduced by the phospholipase-dependent signal pathway in the presence of the test compound. A statistically significant difference in the level of signal in the presence of the test compound, e.g., increase or decrease relative to the absence of test compound, indicates that the test compound is a modulator of the heterologous phospholipase C activity. The intracellular signal can be detected, for example, by expression of a reporter gene operably linked to transcriptional regulatory elements sensitive to the phospholipase- dependent signal pathway. In other embodiments, the intracellular signal is detected by measuring products of the hydrolysis of phosphatidylinositol 4,5-bisphosphate; by measuring Ca2+ mobilization; and/or by measuring the activation of a protein kinase such as PKC. In yet other embodiments, the intracellular signal can be detected by measuring a change in phenotype conferred by the heterologous phospholipase, such as a change in temperature sensitivity or NaCl sensitivity.
In a preferred embodiment, the assay makes use the ability of a heterologous PLC to complement a loss-of-function mutation to an endogenous phospholipase activity. This embodiment of the subject assay generally includes the steps of: (i) contacting the cell with a test compound under conditions appropriate for detecting one or both of the phenotypes of the loss-of-function mutation or the complemented phenotype; and (ii) measuring the level or degree of one or both of these phenotype in the presence of the test compound. By comparing this measurement with a similar measurement made in the absence of the test compound or the absence of the heterologous phospholipase C, the ability of the test compound to alter the phenotype, relative to the absence of test compound or phospholipase C, can be used to identify test compounds that are modulators of the heterologous phospholipase C activity.
In yet another embodiment, the assay utilizes a cell which is further engineered with a reporter gene construct which is sensitive to a phospholipase-dependent signal pathway from a heterologous PLC activity. Such assay formats generally include the steps of: (i) contacting the cell with a test compound under conditions appropriate for expression of the reporter gene; (ii) detecting expression of the reporter gene in the presence of the test compound; and (iii) comparing the level of reporter gene expression in the presence of the test compound to the level of reporter gene expression in the absence of the test compound or the absence of the heterologous phospholipase C. A statistically significant difference in the level of reporter gene expression in the presence of the test compound, relative to the absence of test compound or phospholipase C, indicates that the test compound is a modulator of the heterologous phospholipase C activity.
Still another embodiment of the assay provides a differential screening format for identifying an agent which selectively inhibits a non-mammalian phospholipase C relative to a mammalian phospholipase. Such assay formats can include the steps of: (i) providing a first yeast cell containing a non-mammalian phospholipase gene; (ii) providing a second yeast cell expressing a mammalian phospholipase gene; (iii) contacting each of the first and second yeast cells with a test compound; and (iv) detecting or quantitating the activity of the phospholipases of the first and second cell in the presence of the test compound. A statistically greater decrease in the phospholipase activity of the first cell, relative to the second cell, indicates that the test compound selectively inhibits the non-mammalian phospholipase C. Such differential screening format can be used to identify inhibitors which are selective for phospholipases of mammalian pathogens relative to the host mammalian phospholipase. For instance, the mammalian PLC can be a human PLC, and the non-mammalian PLC can be derived from a human fungal pathogen, e.g. a pathogen which causes a mycosis selected from a group consisting of candidiasis, aspergillosis, mucormycosis, blastomycosis, geotrichosis, cryptococcosis, chromoblastomycosis, penicilliosis, conidiosporosis, nocaidiosis, coccidioidomycosis, histoplasmosis, maduromycosis, rhinosporidosis, monoliasis, para-actinomycosis, and sporotrichosis. In preferred embodiments, the phospholipase of the first cell can be cloned from a human pathogen selected from a group consisting of Candida albicans, Candida stellatoidea, Candida tropicalis, Candida parapsilosis, Candida krusei, Candida pseudotropicalis, Candida quillermondii, Candida rugosa, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus nidulans, Aspergillus terreus, Rhizopus arrhizus, Rhizopus oryzae, Absidia corymbifera, Absidia ramosa, and Mucor pusillus.
In any of the subject drug screening assays described herein, the assay can be carried out, e.g., repeated, for a library of at least 100 different test compounds, though more preferably at least 103, IO4, IO5, IO6, or IO7 different (variegated) compounds. The test compound can be, to illustrate, peptides, nucleic acids, carbohydrates, small organic molecules, natural product extracts, synthetic compounds, or a mixture of combinatorial compounds.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A
Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986).
Detailed Description of the Invention
Phospholipases C (PLC) are a family of enzymes which hydrolyze the sn-3 phosphodiester bond in membrane phospholipids producing diacylglycerol and a phosphorylated polar head group. Mammalian PLC enzymes exhibit specificity for the polar head group which is hydrolyzed, i.e., phosphatidylcholine, phosphatidylinositol, etc. Hydrolysis of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] by specific PLC enzymes generates two second messenger molecules; diacylglycerol, a co-factor required for activation of protein kinase C, and inositol 1,4,5-trisphosphate (IP3), a soluble second messenger molecule which promotes the release of Ca2+ from intracellular stores (Berridge, (1987) Ann. Rev. Biochem 56:159-193).
The importance of PLC activation in cell proliferation is evident from the fact that the hydrolysis of PtdIns(4,5)P2 is one of the early events that follow the interaction of many growth factors and mitogens with their respective receptors. However, the importance of PLC activation is not restricted to proliferation; it is one of the most common transmembrane signaling events elicited by receptors that regulate many other cellular processes, including differentiation, metabolism, secretion, contraction, and sensory perception. Such PLC- mediated transmembrane signaling events include, for example, signaling via receptor tyrosine kinases and G protein coupled receptors.
Moreover, the diacylglycerol released may be further metabolized to free arachidonic acid by sequential actions of diglycerol lipase and monoglycerol lipase. Thus, phospholipases
C are not only important enzymes in the generation of second messenger molecules, but may serve an important role in making arachidonic acid available for eicosanoid biosynthesis in select tissues.
The present invention is based on the development of yeast strains which express a functional, heterologous phospholipase and makes available a rapid, effective assay for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of the heterologous phospholipase. As described herein, the present invention provides a convenient format for discovering drugs which can be useful to modulate cellular function, as well as to understand the pharmacology of compounds that specifically interact with phospholipases.
Before further description of the invention, certain terms employed in the specification, examples and appended claims are, for convenience, collected here.
"Signal transduction" is the process by which chemical signals are relayed from the cellular environment to cellular targets via the cell membrane, and may occur through one or more mechanisms, such as phosphorylation, activation of ion channels, effector enzyme activation via guanine nucleotide binding protein intermediates, activation of phospholipase, and/or direct activation (or inhibition) of a transcriptional factor.
A "mammalian phospholipase" is a protein which is either identical to an phospholipase occurring naturally in a mammal, or is a mutant which is substantially homologous with such a mammalian phospholipase and more similar in sequence to it than to the yeast phospholipase. Related terms, such as "primate phospholipase", or "human phospholipase", are analogously defined. A mammalian phospholipase is "functionally homologous" to a yeast protein if, either alone, or in concert with other exogenous proteins, or after being modified by a drug, it is able to provide an phospholipase activity within the engineered yeast cell. It is not necessary that it be as efficient as the yeast protein, however, it is desirable that it have at least 10% of the activity of the analogous yeast protein.
An "activator" or "agonist" of a phospholipase is a substance which causes the phospholipase to become more enzymatically active, e.g., elevates the rate at which phospholipid hydroylsis occurs under particular conditions. The mode of action of the activator may be direct, e.g., through binding the phospholipase, or indirect, e.g., through binding another molecule which otherwise interacts with the phospholipase.
Conversely, an "inhibitor or antagonist" of an phospholipase is a substance which causes the enzyme to become less active, and thereby reduces the rate or production of the hydrolytic second messengers to a detectable degree. The reduction may be complete or partial, and due to a direct or an indirect effect.
The term "phospholipase-dependent signal pathway" as used herein refers to a signal transduction pathway including a phospholipase activity as a step in the transduction of the intracellular signal. Such a signal transduction pathway is meant to include components of a pathway whose activity is modulated by a phospholipase, whether their activity is directly modulated by the phospholipase or indirectly modulated by the phospholipase or its second messengers. This term also includes components of the pathway which are "upstream" of the phospholipase which regulate an activity of the phospholipase.
The term "functional integration" as used herein refers to the ability of an exogenous phospholipase to function in a phospholipase-dependent signal transduction pathway such that a distal effect of a phospholipase activity can be determined, i.e., an activity regulated by the products produced from phospholipase dependent phospholipid hydrolysis. Such distal signaling effects can be observed in yeast expressing either a functional or mutant phospholipase. Another example of functional integration is complementation by a heterologous phospholipase C of one of the pleiotropy of effects seen in phospholipase loss- of-function yeast strains (e.g., reduced growth or NaCl sensitivity). Another assay of functional complementation is the ability of the heterologous phospholipase to modulate gene transcription. Yet another assay of functional integration is the reconstitution of regulated phospholipase activity, i.e., phospholipase activity requiring stimulation, for example phospholipase activity upon receptor-ligand activation or upon activation by a G protein subunit or subunits. This term can also include functional integration of a phospholipase into an endogenous yeast pathway or a chimeric pathway including components not naturally found in yeast cells.
The term "modulation of a phospholipase activity" in its various grammatical forms, as used herein, designates induction and/or potentiation, as well as inhibition of one or more signal transduction pathways involving of a phospholipase. Such modulation may involve effects of a compound directly on a phospholipase, or on a component of a signal transduction pathway involving a phospholipase, for example upstream regulatory elements, or downstream elements, including substrates.
The term "substantially homologous", when used in connection with amino acid sequences, refers to sequences which are substantially identical to or similar in sequence, giving rise to a homology in conformation and thus to similar biological activity. The term is not intended to imply a common evolution of the sequences. Typically, "substantially homologous" sequences are at least 50%), more preferably at least 80%, identical in sequence, at least over any regions known to be involved in the desired activity. Most preferably, no more than five residues, other than at the termini, are different. Preferably, the divergence in sequence, at least in the aforementioned regions, is in the form of "conservative modifications".
The terms "protein", "polypeptide" and "peptide" are used interchangeably herein.
As used herein, "recombinant cells" include any cells that have been modified by the introduction of heterologous DNA. . Control cells include cells that are substantially identical to the recombinant cells, but do not express one or more of the proteins encoded by the heterologous DNA, e.g., do not include or express one or more of the exogenous phospholipase, regulatory protein, test polypeptide, or the reporter gene construct.
As used herein, the terms "heterologous DNA" or "heterologous nucleic acid" is meant to include DNA that does not occur naturally as part of the genome in which it is present or DNA which is found in a location or locations in the genome that differs from that in which it occurs in nature. Heterologous DNA is not endogenous to the cell into which it is introduced, but has been obtained from another cell, i.e., is exogenous to the cell. Generally, although not necessarily, such DNA encodes RNA and proteins that are not normally produced by the cell in which it is expressed. Heterologous DNA may also be referred to as foreign DNA. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which is expressed is herein encompassed by the term heterologous DNA. Examples of heterologous DNA include, but are not limited to, DNA that encodes a phospholipase, test polypeptides, regulatory proteins, reporter genes, transcriptional and translational regulatory sequences, or selectable or traceable marker proteins, such as a protein that confers drug resistance.
The terms "recombinant protein", "heterologous protein" and "exogenous protein" are used interchangeably throughout the specification and refer to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. That is, the polypeptide is expressed from a heterologous nucleic acid.
A "heterologous phospholipase" refers to a non-yeast phospholipase enzyme, having a phospholipase activity. For example, phospholipase C, in the presence of calcium, can convert phosphatidyl inositol (PI), phosphatidyl inositol 4-monophosphate (PIP) or phosphatidyl inositol (4,5) biphosphate (PIP2) into at least inositol 1,4,5 triphosphate (IP3) and diacylglycerol (DAG).
An "endogenous, mutant phospholipase gene" as used herein refers to a yeast phospholipase gene that encodes an endogenous, mutant or impaired yeast phospholipase protein. For example, an endogenous, mutant phospholipase may have a deletion, insertion, point mutation or other mutation that results in a conditional impairment or a constitutive impairment, making them ideal for selection or complementation studies. An example of an endogenous, mutant phospholipase gene is a deletion mutant in the S. cerevisiae PLC1 locus (plcl). These mutants have several phenotypic differences from wildtype PLC1 strains, plcl strains are sensitive to high osmolarity (0.5M NaCl or 1.2M sorbitol) at 30°C and do not grow well in the presence of carbon sources other than glucose (i.e. glycerol/ethanol, raffinose, and galactose). Finally, plcl strains have a temperature sensitive phenotype; at temperatures above 35°C, plcl strains do not grow, while at temperatures below 35°C, they grow, albeit slower than wildtype strains.
A "loss of function" mutation is one which leads to a change in the activity of a phospholipase gene. Such a mutation may alter one or more of the coding sequence, the transcription, or the translation of an endogenous yeast phospholipase. Such a mutation will lead to the lack of expression of a yeast phospholipase, or the expression of an inactive yeast phospholipase or a phospholipase of reduced activity.
As used herein, a "reporter gene construct" is a nucleic acid that includes a "reporter gene" operatively linked to a transcriptional regulatory sequences. Transcription of the reporter gene is controlled by these sequences. The activity of at least one or more of these control sequences is directly or indirectly regulated by a signal transduction pathway involving a phospholipase, e.g., is directly or indirectly regulated by a second messenger produced by the phospholipase activity. The transcriptional regulatory sequences can include a promoter and other regulatory regions, such as enhancer sequences, that modulate the activity of the promoter, or regulatory sequences that modulate the activity or efficiency of the RNA polymerase that recognizes the promoter, or regulatory sequences that are recognized by effector molecules, including those that are specifically induced upon activation of a phospholipase. For example, modulation of the activity of the promoter may be effected by altering the RNA polymerase binding to the promoter region, or, alternatively, by interfering with initiation of transcription or elongation of the mRNA. Such sequences are herein collectively referred to as transcriptional regulatory elements or sequences. In addition, the construct may include sequences of nucleotides that alter the stability or rate of translation of the resulting mRNA in response to PLC second messages, thereby altering the amount of reporter gene product. As used herein, a "heterologous regulatory protein" refers to a protein that regulates or is coupled to a heterologous phospholipase. Such a regulatory protein may be upstream or downstream of a phospholipase and is capable of modulating the activity of a phospholipase or being modulated by the phospholipase. A preferred regulatory protein is a GTP binding protein (G protein), which as used herein refers to heterotrimeric G proteins, G protein subunits thereof, e.g. α, β and γ subunits, or a functional heterodimer (e.g. βγ). A regulatory protein as used herein may also be a receptor that modulates a signal transduction pathway involving a phospholipase. Examples of preferred regulatory receptors are those that directly activate a phospholipase, such as the G protein coupled receptors, receptor tyrosine kinases (RTK's), receptors that activate phospholipases via the activation of a non-receptor kinases, such as those that signal via src kinases and the like. Other regulatory proteins can bind PIP2, the preferred substrate for many PLC isozymes (e.g. profilin, cofilin, gelsolin, and alpha- actinin) as discussed in Homma and Emori, 1995 and references therein. Regulatory proteins are discussed in further detail below.
As used herein, "cell surface receptor" refers to molecules that occur on the surface of cells, interact with the extracellular environment, and transmit or transduce the information regarding the environment intracellularly in a manner that ultimately modulates transcription of specific promoters, resulting in transcription of specific genes.
As used herein, "extracellular signals" include a molecule or a change in the environment that is transduced intracellularly via cell surface proteins that interact, directly or indirectly, with the signal. An extracellular signal or effector molecule includes any compound or substance that in some manner specifically alters the activity of a cell surface protein. Examples of such signals include, but are not limited to, molecules such as ions, acetylcholine, growth factors, and hormones, that bind to cell surface and/or intracellular receptors and ion channels and modulate the activity of such receptors and channels. Extracellular signals also include as yet unidentified substances that modulate a signal transduction pathway involving a phospholipase, and thereby influence intracellular functions. Such extracellular signals are potential pharmacological agents that may be used to treat specific diseases by modulating phospholipase activity.
I. Overview of Assay In vitro testing is a preferred methodology in that it permits the design of high- throughput screens: small quantities of large numbers of compounds can be tested in a short period of time and at low expense. Optimally, animals are reserved for the latter stages of compound evaluation and are not used in the discovery phase; the use of whole animals is labor-intensive and extremely expensive. Microorganisms, to a much greater extent than mammalian cells and tissues, can be easily exploited for use in rapid drug screens. Yeast provide a particularly attractive test system; extensive analysis of this organism has revealed the conservation of structure and function of a variety of proteins active in basic cellular processes in both yeast and higher eukaryotes.
As set out above, the present invention relates to recombinant yeast cells expressing a heterologous phospholipase and the methods of using these cells to identify compounds capable of modulating the signal transduction activity of such phospholipases. In general, the subject assay is characterized by the use of recombinant cells which express a heterologous phospholipase protein whose signal transduction activity can be modulated in the recombinant cell so as to generate a detectable signal. As described below, these cells may (optionally) also express one or more of: (i) an expressible recombinant gene encoding an exogenous test polypeptide from a polypeptide library, (ii) a regulatory protein coupled to a phospholipase activity, and (iii) a reporter construct.
The functional expression of a mammalian phospholipase in yeast provides for the design of inexpensive screens useful in the identification of modulators of the enzyme, the activity which is required for the generation of a central signaling molecule in mammalian cells. Any chemical entity, or combination of chemical entities, whether natural or synthetic, may be screened for the ability to modulate the mammalian phospholipase. These modulators may act directly on the enzyme to alter the activity of the enzyme, e.g., they can competitively, noncompetitively, and/or allosterically potentiate or inhibit the enzyme's activity, or may affect the ability of a regulatory protein to alter phospholipase activity.
In one embodiment, the engineered cell is used to screen for drugs which, like Gα or in some cases Gβγ, can directly activate the phospholipase, or increase the activity of a partially activated phospholipase. In certain embodiments a chimeric Gα or Gβγ may be expressed for this purpose. In a second embodiment, the engineered cell is used to screen for drugs which inhibit mammalian phospholipase. In this situation, the phospholipase must first be activated. This can be done by engineering the cell to express Gα or Gβγ, as appropriate. Alternatively, the cell may be engineered to co-express both a G protein and a G protein coupled receptor, or any other protein which regulates the activity of the phospholipase, and the receptor stimulated either by externally added ligand or by a co-expressed ligand. In either case, the ligand is a known activator used merely to stimulate activation of the phospholipase, and the drugs are screened for inhibition of this phospholipase.
In a third embodiment, the engineered cell is used to screen for drugs which inhibit or activate phospholipase indirectly, e.g., by their action upon a regulatory protein, for example, a G protein-coupled receptor. The receptor activates the G protein subunits which act on the phospholipase. In this case, a compatible G protein-coupled receptor and a compatible G protein would be provided with the mammalian phospholipase in the same yeast cell.
The ability of particular test compounds to modulate the signal transduction activity of the target phospholipase can be scored for by detecting up or down-regulation of the detection signal. For example, second messenger generation (e.g. phospholipid hydrolysis, Ca + mobilization or PKC activation) via a phospholipase-dependent signal pathway can be measured directly. Alternatively, the use of a reporter gene can provide a convenient readout. In any event, a statistically significant change in the detection signal can be used to facilitate identification of those compounds which are effectors of the target phospholipase. By this method, test compounds which modulate phospholipase signaling can be screened. If the test compound does not appear to induce the activity of the phospholipase, the assay may be repeated and modified by the introduction of a step in which the recombinant cell is first contacted with a known activator of the phospholipase, and the test compound can be assayed for its ability to inhibit the activity of the phospholipase, e.g., to identify phospholipase antagonists. Alternatively, the cell can be engineered with an activated phospholipase. In yet other embodiments, test compounds can be screened for members which potentiate the response to a known activator of the phospholipase. In yet another embodiment a phsopholipase or a phospholipase regulatory protein may be constituatively active to facilitate screening for inhibitors of an activated phospholipase. For example, constituatively active forms of the heterotrimeric Gq family members, such as GI 1 and G16 have been described, such as Gα qQ209L and Gα 16Q212L.
Overexpression these GTPase deficient activated alleles of Gα was found to constitutively elevate basal phospholipase C activity, leading to persistent activation of cJun NH2-terminal kinases (Heasley et al. 1996 Mol. Cell. Biol. 16:648; Heasley et al. 1996. J Biol. Chem. 271 :349; Qian et al. 1994 J Biol. Chem. 1994. 269:17417). In still a further embodiment a constituatively actived form of a phospholipase activating receptor may be expressed, such as an α lB-adrenergic receptor which has been mutated to render it constituatively active (Perez et al. 1996. Mol. Pharmacol. 49:112) or an altered form of the formylmethionylleucylphenylalanine receptor (Amatruda et al. 1995. J. Biol. Chem. 270:28010). In other embodiments the phospholipase itself may be expressed in a constituatively activated form.
In a further embodiment, the subject reagent cells can be used to perform differential screening assays, e.g., which can be used to identify a compound that selectively effects a non-mammalian (e.g. non-human) phospholipase. Such compounds, by selective inhibition, can be used for treating or preventing a pathogen infection (e.g. viral, fungal, bacterial or protozoan) in a mammal (e.g. human). Preferred heterologous phospholipase enzymes for performing differential screening assays against a mammalian phospholipase include phospholipases from viral, fungal or protozoan pathogens. Examples of fungal pathogens include fungi that cause Candidiasis, Aspergillosis, Mucormycosis, Blastomycosis, Geotrichosis, Cryptococcosis, Chromoblastomycosis, Coccidioidomycosis, Conidiosporosis, Histoplasmosis, Maduromycosis, Rhinosporidosis, Nocaidiosis, Para-actinomycosis, Penicilliosis, Monoliasis, and Sporotrichosis.
In a further embodiment of a differential screen, the ability of a compound to modulate the activity of one phospholipase and not another phospholipase may be measured.
For example, compounds which are agonists or antagonists of PLCβ and not PLCγ or are capable of modulating PLCβ2 and not PLCβ3 may be selected. In yet another embodiment compounds which are capable of modulating a heterologous phospholipase while not affecting another member of a signal transduction protein which may or may not be a member of a phospholipase pathway, such as PKC may be tested. In developing the recombinant cells assays, it was recognized that a frequent result of the activation of a phospholipase signaling pathway was the transcriptional activation or inactivation of specific genes, i.e., the activation of a phospholipase often ultimately leads to a rapid and detectable change in the transcription or translation of a gene. Thus, transcription of genes controlled by phospholipase-responsive transcriptional elements often reflects the activity of the surface protein by virtue of transduction of an intracellular signal.
To illustrate, the intracellular signal that is transduced can be initiated by the specific interaction of an extracellular signal, particularly a ligand, with a cell surface receptor which is coupled to the phospholipase. This interaction sets in motion a cascade of intracellular events, the ultimate consequence of which is a rapid and detectable change in the transcription or translation of a gene. By selecting transcriptional regulatory sequences that are responsive to the phospholipase-dependent intracellular signals and operatively linking the selected promoters to reporter genes, whose transcription, translation or ultimate activity is readily detectable and measurable, the transcription based assay provides a rapid indication of whether a specific test compound influences intracellular transduction. Expression of the reporter gene, thus, provides a valuable screening tool for the development of compounds that act as agonists or antagonists of phospholipase activities.
Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation and are thus ideal for assays in which a heterologous phospholipase is functionally integrated into a signal transduction pathway. Accordingly, in practicing one embodiment of the assay, a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on 2nd messengers generated by the phospholipase activity. Typically, the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transduction activity of the target phospholipase, with the level of expression of the reporter gene providing the phospholipase-dependent detection signal. The amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, specific mRNA expressio may be detected using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity. The amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks the target phospholipase. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the target phospholipase.
As described in further detail below, in preferred embodiments the gene product of the reporter is detected by an intrinsic activity associated with that product. For instance, the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or luminescence.
In other preferred embodiments, the reporter or marker gene provides a selective growth advantage, e.g., the reporter gene may enhance cell viability, relieve a cell nutritional requirement, and/or provide resistance to a drug.
In other embodiments, second messenger generation can be measured directly in the detection step, such as mobilization of intracellular calcium or phospholipid metabolism are quantitated, for instance, the products of phospholipid hydrolysis IP3 or DAG could be measured For example, one of the downstream effects of PLC activation in mammalian cells is Ca"*^ mobilization; because the teachings of the present invention demonstrate that a mammalian phospholipase can be functionally integrated into a yeast cell, it is likely that this effect may be expected in yeast cells expressing functional, recombinant PLCs. Similarly, as mammalian PLC is known to modulate PKC via its second messenger products (including DAG) functional expression of mammalian PLCs in yeast may be expected to couple to other signal pathway effectors including IP3-receptor, CaM kinase, calmodulin, PKA and PKC, or other proteins which interact with the phospholipases.
II. Host Cells
The host yeast cell of the present invention may be of any species which is cultivable and in which an exogenous phospholipase can be modulated. Suitable species include Kluyverei lactis, Schizosaccharomyces pombe, and Ustilaqo maydis; Saccharomyces cerevisiae is preferred. Other yeast which can be used in practicing the present invention are Neurospora crassa, Aspergillus niger, Aspergillus nidulans, Pichia pastoris, Candida tropicalis, and Hansenula polymorpha. The term "yeast", as used herein, includes not only yeast in a strictly taxonomic sense, i.e., unicellular organisms, but also yeast-like multicellular fungi or filamentous fungi.
The choice of appropriate host cell will also be influenced by the choice of detection signal. For instance, reporter constructs, as described below, can provide a selectable or screenable trait upon transcriptional activation (or inactivation) in response to a signal transduction pathway coupled to the target receptor The reporter gene may be an unmodified gene already in the host cell pathway, such as the genes responsible for growth arrest in yeast. It may be a host cell gene that has been operably linked to a "phospholipase-responsive" promoter. Alternatively, it may be a heterologous gene that has been so linked. Suitable genes and promoters are discussed below. Accordingly, it will be understood that to achieve selection or screening, the host cell must have an appropriate phenotype. For example, introducing a pheromone-responsive chimeric HIS3 gene into a yeast that has a wild-type HIS3 gene would frustrate genetic selection. Thus, to achieve nutritional selection, an auxotrophic strain will be desired.
"Inactivation", with respect to genes of the host cell, means that production of a functional gene product is prevented or inhibited. Inactivation may be achieved by deletion of the gene, mutation of the promoter so that expression does not occur, or mutation of the coding sequence so that the gene product is inactive. Inactivation may be partial or total.
Accordingly, in certain embodiments it may be desirable to disrupt an endogenous yeast phospholipase to facilitate screening for an activity of a heterologous phospholipase.
The field of yeast genetics is advanced and techniques for disrupting yeast genes are known in the art. For example, transplacement may be used to replace the endogenous yeast phospholipase gene with a modified form, as described by Flick and Thorner in art. In the case of yeast PLCl, a plcAl::HlS3 mutation can be created by replacing the internal Pvulϊ fragment of PLCl (nucleotides +1069 to +1482) with HIS3, as follows. The 3.7-kb Eco RV fragment containing most of PLCl can be inserted into EcσRV-digested YCp50 to (Rose et al. 1987. Gene. 60:237) to yield pJFlO, which can be cleaved with Pvull and ligated with the
2.1-kb Pvull fragment of pJJ215 that contains HIS3 (Jones and Prakash. 1990 Yeast 6:363).
In the resulting plasmid (pJF18), HIS3 has replaced residues 357 to 494 of Plclp. The plcl l::HIS3 allele can be introduced into yeast cells by DNA mediated transformation
(Rothstein. 1983. Methods Enzymol. 101:202) of two different his3/his3 diploid strains,
YPH501 (Sikorski and Heiter. 1989 Genetics 122:19) and W303 (Thomas and Rothstein
1989. Cell 56:619), using EcoRV-digested pJF18 and selecting for histidine prototrophy.
A plclA2::LEU2 mutation can be created by replacing the Hpal-Clal segment of PLCl (nucleotides +277 to +2333) with LEU2, as follows. pJF58, which consists of a 4.3-kb Hindlll fragment containing PLCl inserted in pUC19 can be digested with Hpal and Clal and incubated with the Klenow fragment of E. coli DNA polymerase I. The resulting 5.4-kb linearized vector can be gel purified and ligated with a 2.2 kb SaR-Xhol fragment containing LEU2 that can be excised from pJJ283 (Jones and Prakash, supra) and converted to flush ends by treatment with Klenow enzyme, yielding pJF96. The plcl A2::LEU2 allele, which is almost a complete deletion of the PLCl gene, can be introduced into S. cerevisiae by DNA- mediated transformation of the Ieu2/leu2 diploid strain, YPH501, using HmrflH-digested pJF96 and selecting for leucine prototrophy.
Transplacement of the resident PLCl locus by the mutant allele on only one homolog in each of the diploid transformants can be confirmed by restriction enzyme digestion and Southern blot hybridization analysis (Sambrook et al. 1989. Molecular cloning: a laboratory manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). The phenotype of asci from sporulated cultures of heterozygous plclA/PLCl diploids may be determined as in the art.
Ideally, any mutants generated will have a selectable phenotype, such as, for example, cessation of growth at 37°C, or failure to grow on a particular carbon source, will exhibit sensitivity to hypertonic stress (e.g., to salt or sorbitol), or will fail to grow on medium lacking a nitrogen source. In preferred embodiments a yeast cell expressing an endogenous mutant PLC will be capable of growth under one set of experimental conditions and will fail to grow or exhibit growth impairment under a second set of experimental conditions, i.e., would be conditionally lethal.
"Complementation", with respect to genes of the host cell, means that at least partial function of inactivated gene of the host cell is supplied by an exogenous nucleic acid. For instance, yeast cells can be "mammalianized", and even "humanized", by complementation of receptor and signal transduction proteins with mammalian homologs. To illustrate, inactivation of a yeast phospholipase gene can be complemented, as described in the appended examples, by expression of a human phospholipase gene.
The complementation of the plcl A ts phenotype observed with human PLC-β2 and Gαq family members can be used in a screening format to identify a variety of agonists and antagonists directed to these functionally interacting proteins. PLC-β agonists can be identified in a screen for compounds that stimulate growth of plcl A yeast strains expressing PLC-β2 but not expressing any Gαq family Gα-subunit under non-permissive growth conditions, plcl A strains expressing wildtype yeast PLCl could serve as an appropriate counterscreening strain. PLC-β antagonists could be screened for in two formats. In the first format, plclΔ yeast strains whose growth under non-permissive conditions is not dependent upon co-expression of Gαq subunits (i.e. strains expressing mammalian PLC-βl, -β2, or -β3 on high copy plasmids) could be screened for compounds that block growth at 37°C or on 0.5M NaCl at 30°C but not at 30°C. An additional counterscreen for this format would be to screen for compounds that block growth of the plcl A strains but not of PLCl strains under non-permissive conditions. This counterscreen would serve to distinguish between compounds that act on fungal and mammalian PLC isoforms as opposed to those that act on one or the other or both. In the second format, plcl A yeast strains whose growth under non- permissive conditions is dependent upon co-expression of Gαq subunits (i.e. strains expressing PLC-β2 on a low copy plasmid) could be screened for loss of complementation when contacted with compounds. This screen could in theory detect compounds that act either by inhibiting PLC-isoforms directly or by blocking the interaction between PLC-β isoforms and Gαq subunits or by blocking the activation of Gαq subunits. As a final example of the use of functional complementation in screening, it may be possible to construct yeast strains in which the activation or inhibition of signaling components downstream of PLC-β can be scored appropriately configured strains. For example, strains expressing both mammalian PLC-β isoforms and PKC may be used to screen for compounds that modulate the activity of either PLC-β isoforms, PKC isoforms, or both.
Other complementations for use in the subject assay can be constructed without any undue experimentation. Indeed, numerous examples of yeast genetic complementation with mammalian signal transduction proteins have been described in the art. For example, the following table includes a list of some of the human genes which have been found to complement of yeast genes (see also Tuendreich et al. 1994. Hum. Mol. Gen. 3:1509)
Table 2. Sequence similarity between Human cDNAs that complement S. cerevisiae mutants and their correlate yeast proteins
GenBank BLASTX Yeast SwissProt
Human Gene Accession # P-value Mutant Accession # Reference
ARF5 M57567 1.0E-91 arG P19146 Lee FJ. et al. (1992)
ARF5 M57567 1.4e-91 arfl PI 1076 Lee FJ. et al. (1992)
ARF6 M57763 3.1e-85 arf2 P19146 Lee FJ. et al. (1992)
ARF6 M57763 4.0e-84 arfl PI 1076 Lee FJ. et al. (1992)
Calmodulin D45887 7.7e-63 cmdl P06787 Davis TN. et al. (1989)
CBS L14577 9.4e-116 cys4 P32582 Kruεer WD. et al. (1994)
CCNDl M64349 Not Detected clnl P20437 Xionε et al. (1991 )
CCND1 M64349 Not Detected cln2 P20438 Xionε et al. (1991 )
CCNDl M64349 Not Detected cln3 P13365 Xiong et al. (1991)
CDC2 X05360 2.0e-130 cdc28 P00546 Ninomiva-Teuji et al. (1991)
CDC34 L22005 5.1e-38 cdc34 PI 4682 Plon et al. (1993)
CDK2 X61622 1.3e-137 cdc28 P00546 Elledεe et al. (1991 ) CDK3 X66357 1.3e-137 cdc28 P00546 Meyerson et al. (1992)
CHK D 10704 2.8e-20 ckil P20485 Hosaka et al. (1992)
CKS1 X54941 8.7e-23 cksl P20486 Richardson HE et al. (1990)
CKS2 X54942 6.9e-14 cksl P20586 Richardson et al. (1990)
CSBP1 L32563 7.2e-117 ' hogl P32485 Kumar et al. (1995)
CYC1 X06994 1.2e-98 cycl P00044 Tanaka Y. et al. (1988)
Cyclin E M73812 Not clnl P20437 Lew PJ. et al. (1991) Detected
Cyclin E M73812 Not cln2 P20438 Lew PJ. et al. (1993) Detected
Cyclin E M73812 Not cln3 PI3365 Lew PJ. et al. (1991) Detected
DHODH M94065 1.4e-5 ural P28272 Minet M. et al. (1992) eIF-2 alpha M85294 8.3e-24 gcn2 PI 5442 Pever TE et al. (1993) eIF-5A (eIF-4D) M23419 1.6e-69 tif51B PI921 1 Schwelberger HG. et al. (1993) eIF-5A (eIF-4D) M23419 1.7e-70 tif51A P23301 Schwelberger HG. et al. (1993)
FLRN M59849 1.3e-120 nopl PI 5646 Jansen RP. et al. (1992)
G25K M35543 2.3e-108 cdc42 P19073 Munemitsu S. et al. (1990)
G25K M35543 Not cdc24 PI 1433 Munemitsu S. et al. (1990) Detected
GALK2 M84443 1.5e-64 gall P04385 Lee PT. et al. (1993)
GALT M96264 2.5e-85 gal7 P08431 Fridovich-Keil JL. et al. (1993)
GART X54199 2.0e-248 ade5, 7 P07244 Schild P. et al. (1990)
GART X54199 4.8e-12 ade8 P04161 Schil P. et al. (1990)
GBE1 L07956 7.0e-290 glc3 P32775 Thon VJ et al. (1993)
GOS8 L 13463 1.4e-l get2 PI 1972 Siderovski P et al. (1996)
GSPT1 XI 7644 6.3e-165 get2 P05453 Hoshino S. et al. (1989)
HAP2 M59079 2.2e-23 hap2 P06774 Becker PM et al. (1991) hFKB12 M80199 9.0e-43 rbpl P20081 Koltin Y. et al. (1991)
H-GRF55 S62035 6.2e-29 cdc25 P04821 Schweighoffer F. et al. (1991)
HHR6A M74524 1.2e-73 rad6 P06104 Koken MH et al. (1991 )
HHR6B M74525 6.7e-74 rad6 P06104 Koken MH. et al. (1991)
HMGCR Ml 1058 1.0e-145 hmg2 P12684 Basson ME. et al. (1988) HMGCR Ml 1058 4.6e-160 hmgl P13683 Basson ME. et al. (1988) hRPB7.0 Z47727 3.9e-13 rpclO P40422 Shpakovski GV et al. (1995) hRPB7.6 Z47728 3.9e-13 blO P22139 Shpakovski GV et al. (1995) hRPB17 Z49199 1.0e-23 φb8 P20436 Shpakovski GV et al. (1995) hRPB14.4 Z27113 2.8e-40 rpo26 P20435 Shpakovski GV et al. (1995)
LIG1 M36067 2.3e-168 cdc9 P04819 Barnes DE. et al. (1990)
MGMT M29971 1.9e-8 mgt-1 P26188 Xiac . et al. (1995)
MSS1 D11094 8.4e-211 cim5 P33299 Ghislain M. et al. (1993)
MTTFl X64269 Not abf2 002486 Parisi MA. et al. (1993) Detected
NF1 M89914 1.5e-38 ira2 P19158 Ballester R. et al. (1990)
NMT M86707 9.7e-122 nmtl P14783 Duronio RJ. et al. (1992)
OAT M12267 9.7e-133 car2 P07991 Dougherty KM. et al. (1993)
Oxidoreductase S90469 6.7e-83 ncprl PI 6603 Eugster HP. et al. (1002
PDE4A M37744 Not pdel P22434 McHale et al. (1991) Detected
PDE4A M37744 6.4e-15 pde2 P06776 McHale et al. (1991)
PDE7 L 12052 Not pdel P22434 Michaeli T. et al. (1993) Detected
PFKM M26066 1.9e-192 pfk P16861 Heinisch JJ. et al. (1993)
PYCR1 M77836 4.9e-21 pro3 P32263 Dougherty KH. et al. (1993)
RCC1 D00591 1.4e-13 srml P34760 Clark KL. et al. (1991) (Pφ20)
SEC13r L09260 2.1e-116 sec 13 004491 Shaywitz DA. et al. (1995) snRMP Dl J03798 l. le-20 smdl 003260 Rvmond BC. et al. (1993)
SPT4 T50643 6.0e-19 sρt4 P32914 Hartzog G. et al. (1996. submitted)
TOPI J03250 6.1e-195 topi P04786 Bjornsti MA. et al. (1989)
TYMK L16991 4.1e-47 cdc8 P06776 Su JY. et al. (1991)
UBCEP1 M24507 4.5e-46 ubi3 P04839 Monia BP.et al. (1990)
VDAC1 L06132 9.8e-15 porl P04840 Blachlv-Dvson E. et al. (1993)
VDAC2 L06328 2.8e-21 porl P04840 Blachlv-Dvson E. et al. (1993)
XPD X52221 2.9e-293 rad3 P06839 Guzder SN. et al. (1995) Methods for introducing heterologous DNA into eukaryotic cells are well known in the art and any such method may be used. In addition, cDNA encoding various phospholipases and other of the recombinant proteins described herein are known to those of skill in the art, or may be cloned by any method known to those of skill in the art. Generally, ligating a polynucleotide coding sequence into a gene construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells), are standard procedures used in producing other well-known proteins, including sequences encoding exogenous receptor and peptide libraries. Similar procedures, or modifications thereof, can be employed to prepare recombinant reagent cells of the present invention by tissue-culture technology in accord with the subject invention.
In general, it will be desirable that the vector be capable of replication in the host cell. It may be a DNA which is integrated into the host genome, and thereafter is replicated as a part of the chromosomal DNA, or it may be DNA which replicates autonomously, as in the case of a plasmid. In the latter case, the vector will include an origin of replication which is functional in the host. In the case of an integrating vector, the vector may include sequences which facilitate integration, e.g., sequences homologous to host sequences, or encoding integrases.
A number of vectors exist for the expression of recombinant proteins in yeast. For instance, YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expression vehicles useful in the introduction of genetic constructs into S. cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Academic Press, p. 83, incorporated by reference herein). These vectors can replicate in E. coli due the presence of the pBR322 ori, and in S. cerevisiae due to the replication determinant of the yeast 2 micron plasmid. In addition, drug resistance markers such as ampicillin can be used.
Moreover, it will be understood that the expression of a gene in a yeast cell requires a promoter which is functional in yeast. Suitable promoters include the promoters for metallothionein, 3 -phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255, 2073 (1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Req. 7, 149 (1968); and Holland et al. Biochemistry 17, 4900 (1978)), such as enolase, gly ceraldehyde-3 -phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phospho-fructokinase, glucose-6-phosphate isomerase, 3 -phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phospho-glucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO Publn. No. 73,657. Other promoters, which have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3 -phosphate dehydrogenase, as well as enzymes responsible for maltose and galactose utilization. Finally, promoters that are active in only one of the two haploid mating types may be appropriate in certain circumstances. Among these haploid-specific promoters, the pheromone promoters MFal and MFαl are of particular interest.
III. Phospholipases As set out above, one aspect of the present invention encompasses the functional expression of a heterologous phospholipase in a yeast cell. A preferred phospholipase is phospholipase C. Preferred PLCs for carrying out the subject screening assays include any isotype of any of the four classes of phospholipases C (e.g. α, βι.4, γ 1&2 > or δl-3)- The phospholipases may be recombinant forms of vertebrate (e.g. mammalian, such as bovine, porcine, caprine, laprine, feline, canine, rodent, human or non-human primate), invertebrate (e.g. insect), bacterial, non-bacterial or viral phospholipases. Preferred phospholipases of the present invention are mammalian, with particularly preferred phospholipases being of human origin. Several human PLCs have also been cloned. For example, PLC (Genbank Accession number XI 4034), PLCl (Genbank Accession number M37238), PLCβ2 (Genbank Accession number M95678; see also Park et al. J. Biol. Chem. 1992. 267:16048) and PLCβ3 (Genbank Accession number Z37566), see also Ohta, Matsui, Nazawa, Lagercrantz et al. (Genomics (1995) 20:467:472); PLCβ4 (Genbank Accession number L41349) see also Alvarez et al. (1995) Genomics 29:53); PLCγl (Genbank Accession number U09117) see also Cheng et al (1995) J. Biol. Chem 270:5495); PLCγ (Genbank Accession number M34667) see also Burgess et al. (1990) Mol Cell Biol. 10:4770) and PLCα (Genbank accession number D16234) see also Hirano et al. (1994) Biochem Biophys Res. Commun 204:375.
Moreover, the heterologous phospholipase need not be a naturally occurring protein, rather, it may be a mutant form of a phospholipase. Preferably, the mutant is substantially homologous to a naturally occurring phospholipase, or a mutant known to be functional. Moreover, the structural gene encoding the phospholipase may be the wild-type mammalian gene, or a modified gene. "Silent" modifications may be made to improve expression, by, e.g., (1) eliminating secondary structures in the corresponding mRNA, or (2) substituting codons preferred by yeast for codons that are not so preferred, or to facilitate cloning, e.g., by introducing, deleting or modifying restriction sites. The gene may also be modified so that a mutant phospholipase is encoded. Analysis of yeast codon usage indicates that there exists a preferred codon set consisting of the most abundant isoaccepting tRNAs present in yeast and that this preferred set (25 out of the 61 possible coding triplets) is the same for all yeast proteins (Bennetzen and Hall (1981) J. Biol. Chem. 257, 3026-3031). The rapid translation rate required for abundant proteins is believed to provide the selective pressure for the existence of the preferred set of codons. As the extent of biased codon usage in specific genes correlates directly with the level of gene expression (Hoekma et al. (1987) Mol. Cell. Biol. 7, 2914-2924), experimental strategies aimed at the expression of heterologous genes in yeast exploit the codon bias that has been described for that organism (Sharp et al. (1986) Nuc. Acids Res. 14, 5125-5143). For instance, as described in details in the Exemplification, the amino terminal seven residues of PLC-β 1 and the amino terminal 21 residues of human PLC-β2 can be mutated using synthetic oligonucleotides to effect these changes. The nucleotide sequence of each construct may be subsequently verified by dideoxynucleotide sequencing methods on both DNA strands. Other desirable, conservative amino acid substitutions not specifically cited here may be made to the phsopholipase sequence without any diminishment of wild type protein activity.
IV. Other Regulatory Proteins
In certain embodiments, the yeast cells of the present invention can be further engineered to express one or more regulatory proteins which regulate an exogenous phospholipase. Preferred regulatory proteins are G-protein coupled receptors, G proteins, receptor tyrosine kinases, and/or non-receptor kinases. Examples of other regulatory proteins are proteins which bind to phospholipase substrates and influence the activity of a phospholipase, such as profillin. Phospholipase regulatory proteins are described in detail below.
A. G Protein-Coupled Receptors
One family of signal transduction cascades found in eukaryotic cells utilizes heterotrimeric "G proteins." Transduction of growth signals by G protein-coupled receptors has been demonstrated to include phospholipase-dependent pathways. For example, β-type PLC isoforms are activated by the heterotrimeric G protein subfamily Gq. The α-subunits of Gq/l l/16' t0 further illustrate, specifically regulate PLC-βl and PLC-β3, and the β/γ-subunits of the Gi subfamily interact with PLC-β2. Agonist interaction with specific G protein- coupled receptors causes the dissociation of Gq proteins into Gα and G β/γ subunits and the exchange of GDP bound to Gα for GTP. The resulting GTP-bound Gα subunit then activates certain PLC isoforms, such as PLCβ's, by binding to the enzyme. G protein signaling systems include three components: a receptor , a GTP-binding protein (G protein), and an intracellular target protein.
In their resting state, the G proteins, which consist of alpha (α), beta (β) and gamma (γ) subunits, are complexed with the nucleotide guanosine diphosphate (GDP) and are in contact with receptors. When a ligand engages the receptor, the receptor changes conformation and this alters its interaction with the G protein. This spurs the α subunit to release GDP, and the more abundant nucleotide guanosine triphosphate (GTP), replaces it, thus activating the G protein. The G protein then dissociates to separate the α subunit from the still complexed β and γ subunits. The activated state lasts until the GTP is hydrolyzed to GDP by the intrinsic GTPase activity of the α subunit. Either the Gα subunit, or the Gβγ complex, depending on the pathway, interacts with an effector such as a phospholipase. In the instance of phospholipases, the enzyme in turn converts an inactive precursor molecule into an active "second messenger," which may diffuse through the cytoplasm, triggering a metabolic cascade. Over time, the Gα converts the GTP to GDP, thereby inactivating itself. The inactivated Gα may then reassociate with the Gβγ complex. Hundreds, if not thousands, of receptors transduce signals through heterotrimeric G proteins, of which at least 17 distinct forms have been isolated. Although the greatest variability has been seen in the α subunit, several different β and γ structures have been reported. There are, additionally, several different G protein-dependent effectors. Most G protein coupled receptors are comprised of a single protein chain that is threaded through the plasma membrane seven times. Such receptors are often referred to as seven transmembrane receptors (STRs). The following is a partial list of seven transmembrane domain receptors that have been reported in the literature to be coupled to phosphoinositide metabolism in cells and accordingly suitable for generating the subject reagent cell: an αlA-adrenergic receptor, an αlB-adrenergic receptor, an αlC-adrenergic receptor, an Mj ACh receptor, an M3 ACh receptor, an M5 ACh receptor, a D2 dopamine receptor, a D3 dopamine receptor, an Al adenosine receptor, a 5HTl-like receptor, a 5HTld- like receptor, a 5HTld beta receptor, a substance K (neurokinin A) receptor, a f-Met-Leu-Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a growth hormone-releasing hormone (GHRH) receptor, a vasoactive intestinal peptide receptor, an oxytocin receptor, a SST3 receptor, an Lutinizing hormone/chorionic gonadotropin (LH/CG) receptor, a thromboxane A2 receptor, a platelet-activating factor (PAF) receptor, a C5a anaphylatoxin receptor, an Interleukin 8 (IL-8), IL-8A receptor, an IL-8B receptor, a mip- 1 /RANTES receptor, a metabotropic glutamate mGlul-5 receptor, an ATP receptor, an amyloid protein precursor receptor, a bradykinin receptor, a gonadotropin-releasing hormone receptor, a cholecystokinin receptor, an antidiuretic hormone receptor, an adrenocorticotropic hormone II receptor, LTB4 receptor, LTD4 receptor, tachykinin receptor, thyrotropin releasing hormone receptor, vasopressin receptor and oxytocin receptor Cloning references for exemplary G protein coupled recepotors are provided in Table 1.
TABLE 1 HUMAN G PROTEIN-COUPLED SEVEN TRANSMEMBRANE RECEPTORS: REFERENCES FOR CLONING
RECEPTOR REFERENCE αiA_ac-lrenergic receptor Bruno et al. (1991) αjB-adrenergic receptor Ramarao et al. (1992) muscarinic receptors: Mj AChR, M2 AChR, Bonner et al (1987) M3 AChR, Peralta et al. (1987)
M5 AChR Bonner et al. (1988)
D2 dopamine Grandy et al. (1989)1 D3 dopamine Sokoloffetal. (1990)
Al adenosine Libert etal. (1992)
5-HTla Kobilka etal. (1987) Fargin etal. (1988)
5-HTlb Hamblin etal. (1992) Mochizuki etal. (1992)
5HTl-like Levy etal. (1992a)
5-HTld Levy etal. (1992b)
5HTld-like Hambln and Metcalf (1991)
5HTldbeta Demchyshyn et al. (1992) substance K (neurokinin A) Gerard, etal. (1991); Takeda etal. (1991) f-Met-Leu-Phe Boulay etal. (1991) Murphy & McDermott (1991) DeNardin etal. (1992) angiotensin II type 1 Furuta etal. (1992) mas proto-oncogene Young etal. (1986) endothelin ETA Hayzer etal. (1992) Hosoda etal. (1991) endothelin ETB Nakamuta etal. (1991) Ogawa etal. (1991) thrombin Vu etal. (1991) growth hormone-releasing hormone (GHRH) Mayo (1992) vasoactive intestinal peptide (VIP) Sreedharan etal. (1991) oxytocin Kimura etal. (1992) somatostatin Yamada etal. (1992a) SSTR3 Yamada etal. (1992b)
Leutenizing hormone/chorionic gonadotrophin Minegish etal. (1990) thromboxane A2 Hirata etal. (1991) platelet-activating factor (PAF) Kunz etal. (1992)
C5a anaphylatoxin Boulay etal. (1991) Gerard and Gerard (1991)
IL-8RA Holmes etal. (1991)
IL-8RB Murphy and Tiffany (1991)
MIP-1 /RANTES Neote etal. (1993) Murphy et al., in press metabotropic glutamate mGluRl-6 Tanabe et al. (1992)
ATP Julius, David (unpub.) amyloid protein precursor Kan et al. (1987) Mita et al. (1988) Lemaire et al. (1989) bradykinin Hess et al. (1992) gonadotropin-releasing hormone Chi et al. (1993) cholecystokinin Pisegna et al. (1992) antidiuretic hormone receptor Birnbaumer et al. (1992) adrenocorticotropic hormone II Mountjoy et al. (1992)
Specific human G protein-coupled receptors for which genes have been isolated and for which expression vectors could be constructed include those listed herein and others known in the art. Thus, the gene would be operably linked to a promoter functional in the cell to be engineered and to a signal sequence that also functions in the cell. For example in the case of yeast, suitable promoters include those derived from Ste2, Ste3 and gall genes. Suitable signal sequences include those of Ste2, Ste3 and of other genes which encode proteins secreted by yeast cells. As appropriate, the yeast genome is preferably modified so that it is unable to produce the yeast analog of the recombinant receptor in functional form.
B. G protein subunits
PLC-β enzymes are activated in response to ligand binding to G-protein coupled receptors by hormones, neurotransmitters, small molecules and other agonists. This occurs via a pertussis toxin insensitive mechanism mediated by members of the Gq family of Gα subunits as well as via a pertussis toxin sensitive mechanism mediated by G-protein complexes containing Gα subunits of the Gi or Go family. With respect to activation of PLC-β enzymes by Gq family members, all members of the Gq family (q, 11, 14, 15, and 16) have been demonstrated both in vitro and in cell culture systems to directly stimulate the catalytic activity of PLC-β 1, -β2, and -β3 and -β4 enzymes (A.J. Morris et al 1990, and references therein; Sternweis and Smrka, 1992; Wu et al. 1992; and Lee et al. 1992). Members of other Gα subunit families (Gi, Go, Gt, Gz), on the other hand, do not directly stimulate PLC-β activity. The observation that in some cell types stimulation of PLC-β enzymes is sensitive to pertussis toxin treatment is now understood to be due to the direct effect of Gβγ subunits on PLC-β isozymes (summarized in Boyer et al. 1994; and Clapham and Neer, 1993). Recent work from a number of laboratories has demonstrated that PLC-β isoforms (in particular PLC-β2 and -β3) are sensitive to stimulation directly by GjV subunits. Thus, Gβγ subunits derived from Gαi or GαO-containing heterotrimers could contribute to the pertussis toxin sensitivity of PLC-β stimulation observed in whole cell systems in the past. Certain of the regions of PLC-β isozymes that are required for activation by Gα or Gβ γ subunits have been characterized. For instance, deletion mutations have shown that residues at the carboxyl terminus of PLC-β 1 (Wu et al, 1993) are crucial for interaction with Gα subunits, while residues at the amino terminus appear to be essential for interaction with Gβγ subunits, perhaps through binding of Gβγ subunits to a presumptive pleckstrin homology present in the amino terminal 150 residues of PLC-β2 (Inglese et al. 1995, and references therein). In certain embodiments of the invention it may be desirable to express both a phospholipase and one or more exogenous G protein subunits, for example, a G protein α subunit. If the exogenous G α subunit is not adequately coupled to the endogenous yeast Gβγ or G protein coupled receptor, the Gα subunit may be modified to improve coupling. These modifications often will take the form of mutations which, relative to interaction with the receptor or Gβγ complex, increase the resemblance of the Gα subunit to the yeast Gα while decreasing its resemblance to the receptor-associated Gα. For example, a residue may be changed so as to become identical to the corresponding yeast Gα residue, or to at least belong to the same exchange group of that residue. After modification, the modified Gα subunit might or might not be "substantially homologous" to the foreign and/or the yeast Gα subunit.
The modifications are preferably concentrated in regions of the Gα which are likely to be involved in one or both of receptor binding and Gβγ binding. In some embodiments, the modifications will take the form of replacing one or more segments of the receptor-associated Gα with the corresponding yeast Gα segment(s), thereby forming a chimeric Gα subunit. (For the purpose of the appended claims, the term "segment" refers to three or more consecutive amino acids.) In other embodiments, point mutations may be sufficient.
This chimeric Gα subunit will interact with the endogenous receptor and the yeast
Gβγ complex, thereby permitting signal transduction to occur via a pathway which includes the heterologous phospholipase. While use of the endogenous yeast Gβγ is preferred, if a foreign or chimeric Gβγ capable of transducing the signal to the recombinant phospholipase may be used instead.
C. Tyrosine Kinases
Certain phospholipase, such as PLC-γ enzymes, are activated directly in response to phosphorylation of key tyrosine residues by both receptor and non-receptor tyrosine kinases (Summarized in Cook and Wakelam, 1992b). Examples of receptors which mediate PLCγ activation include those for epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor, platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), nerve growth factor (NGF), and erbB2 which have intrinsic tyriosine kinase activity (Kumjian et al. (1991) J Biol. Chem. 266:3973; Margolsis et al. 1989. Cell 57:1101; Meisenhelder et al. 1989. Cell 57:1109; Mohammadi et al. 1991. Mol. Cell. Biol. 11 :5068; Stephens et al. 1994. Neuron 12:691). Other receptor systems which are devoid of intrinsic enzymatic activity are also linked to PLC. These include receptors for a range of cytokines (Boulton et al. 1994. J Biol. Chem. 269:11648), erythropoietin (Res et al. 1994. J Biol. Chem. 269:19633), and thrombin (Guinebault et al. 1993. Biochem J. 292:851), as well as multisubunit immune recognition receptors (MIRRs) such as membrane immunoglobulin M and CD40 in B lymphocytes (Coggeshall, et al. 1992. Proc. Natl. Acad. Sci. USA 89:5660; Ren et al. 1994. J. Exp. Med 179:673), the T-cell antigen receptor (Park et al. 1991. Proc. Natl. Acad. Sci. USA 88:5453; Weiss and Liftman. 1994. Cell 76:253), the high-affinity immunoglobulin E receptor in basophilic leukemia cells (Li et al. 1992. Mol. Cell. Biol. 12:3176; Park et al. 1991. J Biol. Chem. 266:24237), and the immunoglobulin G receptor in monocytic cells (Liao et al. 1993. Biochem. Biophys. Res. Commun. 191:1028). When the receptor has no intrinsic tyrosine kinase activity, non-receptor protein tyrosine kinases coupled to the receptor mediate the response, such as members of the Src and Syk/ZAP70 family, including lyn, syk and fyn (Liao et al. supra; Rhee et al. 1992. Adv. Second Messenger Phosphoprotein Res. 26:35-61; Weiss and Liftman, supra).
PLC-γ isozymes bind to specific autophosphorylated tyrosine residues within the kinase domains of these PTKs via the SH2 domains present in the spacer region between the PLC X and Y regions and the PLCs themselves become substrates for tyrosine phosphorylation. Phosphorylation of specific tyrosine residues (Tyr783 and Tyr 1254 on PLC-γl and Tyr753 and Tyr759 on PLC-γ2) by the receptor associated tyrosine kinase activities in turn increases the catalytic activity of PLC-γ isozymes which results in increased production of 1,4,5-IP3 and *yw-l,2-diacylglycerol (DAG).
D. Other Regulatory Proteins
Yet other regulatory proteins may be coexpressed with a heterologous phospholipase in yeast cells. Recent work has also focused on the interaction between cytoskeletal elements and polyphosphoinositides. For example PtdIns(4,5)P2 has been found to bind to profilin. (Vojtek et al. (1991) Cell 66:497). PIP -binding proteins are known to bind actin and to regulate its assembly in vivo, suggesting a possible role for PIP2 hydrolysis by PLC enzymes in the regulation of cytoskeletal organization, volume regulation, and in other cellular functions related to the state of cytoskeletal assembly. Furthermore, Goldschmidt-Clermont et al. (1991) Science 251:1231 demonstrated a role for profilin in regulating PI turnover in vivo by showning that profilin-bound PIP2 was found to be resistant to cleavage by PLC-γl except when the PLC-γl had been activated by tyrosine phosphorylation. Other exemplary molecules which may regulate a phospholipase include profilin, gelsonin, cofilin, alpha-actin, and villin. The binding sites for PtdIns(4,5)P 2 on gelsolin and villin have recently been identified (Janmey et al.,(1992) J. Biol Chem 267:11818).
Recent studies of PLC-δ regulation suggest that it may be regulated by a novel class of regulatory proteins (pl22-RhoGAP) that show similarity to the GTPase activating protein homology region of bcr, display GAP activity towards RhoA, and bind to and directly stimulate PLC-δ 1 (Homma, Y., and Y. Emori, 1995) Other reports suggest that rho can regulate PtdIns(4,5)P2 levels (Chong et al. (1994) Cell 79:507).
Also some PLCs such as PLCβl (Bernstein and Ross) have a GAP-like activity for certain Gq family members. This activity serves to down regulate the activity of both the Gq and the PLC itself.
Other exemplary regulatory proteins include: IP3 receptors, calcium channels, DAG protein kinase C (PKC), PKA3 (cAMP dependent protein kinase catalytic subunit), SOK1 (suppressor of PKA overexpression), CMD1 (calmodulin, CMK1 (Calcium/calmodulin dependent protein kinase), and CMK2 (calmodulin dependent protein kinase).
V. Drue Screening
In certain embodiments, the assay is characterized by the use of recombinant cells to sample a variegated compound library for phospholipase agonists and/or antagonists. In preferred embodiments, the reagent cells express a mammalian phospholipase capable of producing a detectable signal in the reagent cell.
In certain embodiments, the reagent cell also produces the test compound which is being screened. For instance, the reagent cell can produce a test polypeptide, a test nucleic acid and/or a test carbohydrate which is screened for its ability to modulate the mammalian phospholipase activity. In such embodiments, a culture of such reagent cells will collectively provide a variegated library of potential phospholipase effectors and those members of the library which either agonize or antagonize the phospholipase function can be selected and identified. Moreover, it will be apparent that the reagent cell can be used to detect agents which directly alter the activity of the mammalian phospholipase, or which act on some target upstream or downstream of the mammalian phospholipase. In other embodiments, the test compound is exogenously added. In such embodiments the test compound is contacted with the reagent cell. Exemplary compounds which can be screened for activity include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries. In such embodiments, both compounds which agonize or antagonize the phospholipase function can be selected and identified. Moreover, it will be apparent that the reagent cell can be used to detect agents which directly alter the activity of the mammalian phospholipase, or which act on some target upstream or downstream of the mammalian phospholipase.
In still other embodiments, the test compound is produced by cells which are cocultured with the reagent cells expressing a mammalian phospholipase.
A. Screening and Selection: Assays of Second Messenger Generation
When screening for bioactivity of peptides, intracellular second messenger generation can be measured directly. Exemplary assays for the direct measurement of phospholipase generated second messengers are provided below; other assays for the measurement of second messengers generated in a signal transduction pathway involving a phospholipase will be apparent to those of skill in the art and may be substituted for the assays described below.
In one embodiment, the phospholipase enzymatic activity can be measured in yeast cell extracts. In other embodiments measurements of a detecting a phospholipase activity are made using intact yeast cells.
Certain receptors stimulate the activity of phospholipase C which stimulates the breakdown of phosphatidylinositol 4,5, bisphosphate to 1,4,5-IP3 (which mobilizes intracellular Ca++) and diacylglycerol (DAG) (which activates protein kinase C). Inositol lipids can be extracted and analyzed using standard lipid extraction techniques. DAG can also be measured using thin-layer chromatography. Water soluble derivatives of all three inositol lipids (IPj, IP2, IP3) can also be quantitated using radiolabelling techniques or HPLC.
The mobilization of intracellular calcium or the influx of calcium from outside the cell can be measured using standard techniques. The choice of the appropriate calcium indicator, fluorescent, bioluminescent, metallochromic, or Ca++-sensitive microelectrodes depends on the cell type and the magnitude and time constant of the event under study (Borle (1990) Environ Health Perspect 84:45-56). As an exemplary method of Ca++ detection, cells could be loaded with the Ca^sensitive fluorescent dye fura-2 or indo-1, using standard methods, and any change in Ca"1-1" measured using a fluorometer. The other product of PIP2 breakdown, DAG can also be produced from phosphatidyl choline. The breakdown of this phospholipid in response to receptor-mediated signaling can also be measured using a variety of radiolabelling techniques.
The activation of phospholipase A2 can easily be quantitated using known techniques, including, for example, the generation of arachadonate in the cell.
In certain embodiments of the assay, it may be desirable to screen for changes in cellular phosphorylation. The ability of compounds to modulate phospholipase activation could be screened using colony immunoblotting (Lyons and Nelson (1984) Proc. Natl. Acad. Sci. USA 81:7426-7430) using anti-phosphotyrosine. Reagents for performing such assays are commercially available, for example, phosphotyrosine specific antibodies which measure increases in tyrosine phosphorylation and phospho-specific antibodies can be purchased (New England Biolabs, Beverly, MA). Tests for phosphorylation could be useful to measure the phosphorylation of proteins in response to the modulation of a phospholipase activity; it is noted that protein phosphorylation need not be directly affected by the modulation in phospholipase activity, but rather may amplify signals generated by the phospholipase. Multi-kinase cascades allow not only signal amplification but also signal divergence to multiple effectors that are often cell-type specific, allowing a growth factor to stimulate mitosis of one cell and differentiation of another.
One such cascade is the MAP kinase pathway that appears to mediate both mitogenic, differentiation and stress responses in different cell types. Stimulation of growth factor receptors results in Ras activation followed by the sequential activation of c-Raf, MEK, and p44 and p42 MAP kinases (ERK1 and ERK2). Activated MAP kinase then phosphorylates many key regulatory proteins, including p90RSK and Elk-1 that are phosphorylated when MAP kinase translocates to the nucleus. Homologous pathways exist in mammalian and yeast cells. For instance, an essential part of the S. cerevisiae pheromone signaling pathway is comprised of a protein kinase cascade composed of the products of the STE11, STE7, and FUS3/KSS1 genes (the latter pair are distinct and functionally redundant). Accordingly, phosphorylation and/or activation of members of this kinase cascade can be detected and used to assay phospholipase modulation.
B. Complementation
Techniques to assay for complementation of a mutant endogenous yeast gene are well known in the art; numerous assays exist for the selection of auxotrophs. For example, as described in detail herein, conditional PLCl mutations lead to a pleitropy of phenotypes expressed in yeast under nonpermissive conditions and have been complemented by functional expression of mammalian PLCs. In one embodiment of the present assay it will be possible to test for agonists and or antagonists of a functionally integrated, exogenous phospholipase by observing reversion to the original mutant phenotype. For example, yeast may cease to display a temperature or NaCl sensitive phenotype upon expression of a mammalian PLC, and may revert to a temperature or NaCl sensitive phenotype upon treatment with an antagonist of the exogenous PLC.
C. Screening and Selection Using Reporter Gene Constructs
Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation. Accordingly, in practicing one embodiment of the assay, a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on phospholipase signaling. Typically, the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to phospholipase signal modulation, with the level of expression of the reporter gene providing the receptor-dependent detection signal. If only one transcriptional regulatory element is included it must be a regulatable promoter. At least one the selected transcriptional regulatory elements must be indirectly or directly regulated by the activity of the heterologous phospholipase whereby activity of the phospholipase can be monitored via transcription of the reporter genes. Many reporter genes and transcriptional regulatory elements are known to those of skill in the art and others may be identified or synthesized by methods known to those of skill in the art.
A reporter gene includes any gene that expresses a detectable gene product, which may be RNA or protein. Preferred reporter genes are those that are readily detectable. The reporter gene may also be included in the construct in the form of a fusion gene with a gene that includes desired transcriptional regulatory sequences or exhibits other desirable properties.
Examples of reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other enzyme detection systems, such as beta-galactosidase; firefly luciferase (deWet et al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase (Engebrecht and Silverman (1984), PNAS 1: 4154-4158; Baldwin et al. (1984), Biochemistry 23: 3663-3667); alkaline phosphatase (Toh et al. (1989) Eur. J. Biochem. 182: 231-238, Hall et al. (1983) J. Mol. Appl. Gen. 2: 101), human placental secreted alkaline phosphatase (Cullen and Malim (1992) Methods in Enzymol. 216:362-368). Transcriptional control elements which may be included in a reporter gene construct include, but are not limited to, promoters, enhancers, and repressor and activator binding sites. Suitable transcriptional regulatory elements may be derived from the transcriptional regulatory regions of genes whose expression is rapidly induced, generally within minutes, after modulation of a phospholipase. Examples of such genes include those which are responsive to the second messengers generated upon phospholipase activation, such as Ca"""1", cAMP, and others. One such gene is c-fos, an immediate early gene (see, Sheng et al. (1990) Neuron 4: 477-485). Immediate early genes are genes that are rapidly induced upon binding of a ligand to a cell surface protein. The characteristics of preferred genes from which the transcriptional control elements are derived include, but are not limited to, low or undetectable expression in quiescent cells, rapid induction at the transcriptional level within minutes of extracellular simulation, induction that is transient and independent of new protein synthesis, subsequent shut-off of transcription requires new protein synthesis, and mRNAs transcribed from these genes have a short half-life. It is not necessary for all of these properties to be present.
The amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, specific mRNA expression may be detected using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity. In preferred embodiments, the gene product of the reporter is detected by an intrinsic activity associated with that product. For instance, the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or luminescence.
The amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks heterologuos DNA, such as the phospholipase. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the phospholipase. In other preferred embodiments, the reporter or marker gene provides a selection method such that cells in which the peptide is a ligand for the receptor have a growth advantage. For example the reporter could enhance cell viability, e.g., by relieving a cell nutritional requirement, and/or provide resistance to a drug. For example the reporter gene could encode a gene product which confers the ability to grow in the presence of a selective agent, e.g., canavanine. For example,use of the S. cerevisiae plcl A allele as an endogenous mutant phospholipase C gene provides a readout system, whereby functional complementation (i.e. detection of the second detectable phenotype rather than the first detectable phenotype) can be detected or quantitated by cell growth. However, growth systems suffer from their "quantal" nature. Other readout systems, which provide a different detectable phenotype when the endogenous, mutant phospholipase C is complemented by the expression of heterologous phospholipase C may be more sensitive in a given range or may be more convenient for automation. For example, a transcriptionally based readout may be preferred because it is rapid (i.e. hours instead of days) and affords greater flexiblity both in terms of types of readout and dynamic range of the readout. For example, by placing the bacterial gene encoding lacZ under the control of the promoter sensitive to signals generated upon activation of a phospholipase pathway can be detected in less than an hour by monitoring the ability of permeabilized yeast to produce color from a chromogenic substrate. The rapidity of such a readout would, in itself, be advantageous. And such a readout would be necessary to monitor phospholipase activity under conditions where the yeast do not grow.
A transcriptional readout can be developed by identifying genes/promoters that are positively or negatively regulated by the PLCl locus (i.e. promoters that are up or down- regulated in PLCl vs. plcl A strains or in plcl A strains expressing human PLC-β2 plus Gα 16). These promoters can then be linked to a reporter gene. Alternatively, the reporter gene can be expressed in response to a downstream phospholipase C signal molecule, such as IP3, DAG, increased intracellular calcium levels or increased PKC activity.
For example, a transcriptional based readout can be constructed using yeast expressing mammalian PLC enzymes in the following manner. CREB is a transcription factor whose activity is regulated by phosphorylation at a particular serine (SI 33). When this serine residue is phosphorylated, "phospho-CREB", binds to a recognition sequence known as a CRE (cAMP Responsive Element) found to the 5' of promotors known to be responsive to elevated cAMP levels. Upon binding of phosphorylated CREB to a CRE, transcription from this promoter is increased. Phosphorylation of CREB is seen in response to both increased cAMP levels and increased intracellular calcium levels. Increased cAMP levels result in activation of protein kinase A, which in turn phosphorylates CREB and leads to binding to CRE and transcriptional activation. Increased intracellular calcium levels results in activation of calcium/calmodulin responsive kinases (CaM kinases). Phosphorylation of CREB by CaM kinase IV is effectively the same as phosphorylation of CREB by PKA, and results in transcriptional activation of CRE containing promotors. Therefore, a transcriptional-based readout can be constructed in plclΔ yeast strains expressing a mammalian PLC enzyme, regulatory proteins (G α and/or Gβγ), if necessary, and/or a reporter gene (i.e. lacZ) whose expression is driven by a basal promoter containing one or more CREs in the following manner. Changes in the intracellular concentration of Ca+÷ (a result of alterations in the activity of the recombinant PLC) will result in changes in the level of expression of the reporter gene if: a) CREB is also co-expressed in the cell, and b) either the endogenous yeast CaM kinase will phosphorylate CREB in response to increases in calcium or if an exogenously expressed CaM kinase IV is present in the same cell. In other words, stimulation of PLC activity will result in phosphorylation of CREB and increased transcription from the CRE-lacZ construct, while inhibition of PLC activity will result in decreased transcription from the CRE-lacZ construct. In one embodiment, the promoter is activated upon activation of the phospholipase, in which case, for selection, the expression of the marker gene should result in a benefit to the cell. A preferred marker gene is the imidazoleglycerol phosphate dehydratase gene (HIS3). If a phospholipase responsive promoter is operably linked to a beneficial gene, the cells will be useful in screening or selecting for phospholipase activators. If it is linked to a deleterious gene, the cells will be useful in screening or selecting for inhibitors.
Alternatively, the promoter may be one which is repressed by phospholipase, thereby preventing expression of a product that is deleterious to the cell. With a phospholipase- repressed promoter, one screens for agonists by linking the promoter to a deleterious gene, and for antagonists, by linking it to a beneficial gene. Repression may be achieved by operably linking a phospholipase-induced promoter to a gene encoding mRNA that is antisense to at least a portion of the mRNA encoded by the marker gene (whether in the coding or flanking regions), so as to inhibit translation of that mRNA. Repression may also be obtained by linking a phospholipase induced promoter to a gene encoding a DNA-binding repressor protein, and incorporating a suitable operator site into the promoter or other suitable region of the marker gene.
In yeast, suitable positively selectable (beneficial) genes include the following: URA3, LYS2, HIS3, LEU2, TRP1; ADE1,2,3, 4,5, 7,8; ARGl, 3, 4, 5, 6, 8; HIS1, 4, 5; ILV1, 2, 5; THR1, 4; TRP2, 3, 4, 5; LEW, 4; MET2,3,4,8,9,14,16,19; URA1, 2,4,5, 10; H0M3,6; ASP3; CHOI; ARO 2, 7; CYS3; OLE1; IN01,2,4; PR01,3 Countless other genes are potential selective markers. The above are involved in well-characterized biosynthetic pathways. The imidazoleglycerol phosphate dehydratase (IGP dehydratase) gene (HIS3) is preferred because it is both quite sensitive and can be selected over a broad range of expression levels. In the simplest case, the cell is auxotrophic for histidine (requires histidine for growth) in the absence of activation. Activation leads to synthesis of the enzyme and the cell becomes prototrophic for histidine (does not require histidine). Thus the selection is for growth in the absence of histidine. Since only a few molecules per cell of IGP dehydratase are required for histidine prototrophy, the assay is very sensitive.
In appropriate assays, so-called counterselectable or negatively selectable genes may be used. Suitable genes include: URA3 (orotidine-5'-phosphate decarboxylase; inhibits growth on 5-fluoroorotic acid), LYS2 (2-aminoadipate reductase; inhibits growth on α-aminoadipate as sole nitrogen source), CYH2 (encodes ribosomal protein L29; cycloheximide-sensitive allele is dominant to resistant allele), CAN1 (encodes arginine permease; null allele confers resistance to the arginine analog canavanin), and other recessive drug-resistant markers. The marker gene may also be a screenable gene. The screened characteristic may be a change in cell morphology, metabolism or other screenable features. Suitable markers include beta-galactosidase (Xgal, C12FDG, Salmon-gal, Magenta-Gal (latter two from Biosynth Ag)), alkaline phosphatase, horseradish peroxidase, exo-glucanase (product of yeast exbl gene; nonessential, secreted); luciferase; bacterial green fluorescent protein; (human placental) secreted alkaline phosphatase (SEAP); and chloramphenicol transferase (CAT). Some of the above can be engineered so that they are secreted (although not β-galactosidase). A preferred screenable marker gene is beta-galactosidase; yeast cells expressing the enzyme convert the colorless substrate Xgal into a blue pigment. Again, the promoter may be receptor-induced or receptor-inhibited.
D. Detection of Inhibition or Activation of Proteins Other Than Phospholipase
The present invention also facilitates the detection of inhibitors or activators of proteins other than phospholipase provided that the yeast cell expresses or is engineered to express the protein of interest in such a manner that it is functionally "coupled", directly or indirectly, to the phospholipase.
For example, the yeast cells can also be used in more general readout systems for modulation of the activity of a variety of different cellular signalling components which regulate phospholipase activation, such as receptors, which are known to couple to phospholipases, either directly, (e.g. the PDGF receptor) or via a regulatory protein (e.g. a G- protein coupled receptor or tyrosine kinase coupled receptor); a G-protein heterotrimer; a G α subunit; a Gβγ subunit; another protein known to interact functionally with a known phospholipase substrate (e.g., profilin, gelsolin, cofilin, and alpha-actin); and other effectors whose activity is dependent on phospholipase C activity (i.e., IP3 receptors/calcium channels, other potential IP3 sensitive calcium channels, and other calcium sensitive enzyme activities such as PKC or CaM kinase).
In a preferred embodiment the yeast cells of the present invention may be used to identify drugs which modulate the activity of a mammalian G protein-coupled receptor. In this embodiment, the yeast cell is engineered to express a mammalian G protein-coupled receptor.
E. Test Compounds
Exemplary compounds which can be screened for activity include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries.
One class of potential modulators of particular interest is the peptide class. The term "peptide" is used herein to refer to a chain of two or more amino acids, with adjacent amino acids joined by peptide (-NHCO-) bonds. Thus, the peptides of the present invention include oligopeptides, polypeptides, and proteins. Preferably, the peptides of the present invention are 2 to 200, more preferably 5 to 50, amino acids in length. The minimum peptide length is chiefly dictated by the need to obtain sufficient potency as an activator or inhibitor. The maximum peptide length is only a function of synthetic convenience once an active peptide is identified.
Synthetic peptides are also of interest. By way of example, peptides based on the calmodulin-binding domain of calmodulin-dependent phospholipases could serve as modulators of phospholipase activity. In addition, peptides or molecules of any structure which inhibit the interaction between the phospholipase and known endogenous modulators of phospholipase activity are of interest. Known endogenous phospholipase modulators include Ca2+, Ca2+/calmodulin, protein kinase C, protein kinase A, Gas, Gai, Gβγ, and adenosine.
When peptide drugs are being assayed, the yeast cells may be engineered to express the peptides, rather than being exposed to the peptides simply by adding the peptides to the culture medium. Peptide libraries are systems which simultaneously display, in a form which permits interaction with a target, a highly diverse and numerous collection of peptides. These peptides may be presented in solution (Houghten 1991), or on beads (Lam 1991), chips (Fodor 1991), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull 1992) or on phage (Scott, Devlin, Cwirla, Felici, Ladner '409). Many of these systems are limited in terms of the maximum length of the peptide or the composition of the peptide (e.g., Cys excluded). Steric factors, such as the proximity of a support, may interfere with binding. Usually, the screening is for binding in vitro to an artificially presented target, not for activation or inhibition of a cellular signal transduction pathway in a living cell. While a cell surface receptor may be used as a target, the screening will not reveal whether the binding of the peptide caused an allosteric change in the conformation of the receptor.
Ladner, USP 5,096,815 describes a method of identifying novel proteins or polypeptides with a desired DNA binding activity. Semi-random ("variegated") DNA encoding a large number of different potential binding proteins is introduced, in expressible form, into suitable host cells. The target DNA sequence is incorporated into a genetically engineered operon such that the binding of the protein or polypeptide will prevent expression of a gene product that is deleterious to the cell under selective conditions. Cells which survive the selective conditions are thus cells which express a protein which binds the target DNA. While it is taught that yeast cells may be used for testing, bacterial cells are preferred. The interactions between the protein and the target DNA occur only in the cell, not in the periplasm, and the target is a nucleic acid, not a protein.
Substitution of random peptide sequences for functional domains in cellular proteins permits some determination of the specific sequence requirements for the accomplishment of function. Though the details of the recognition phenomena which operate in the localization of proteins within cells remain largely unknown, the constraints on sequence variation of mitochondrial targeting sequences and protein secretion signal sequences have been elucidated using random peptides (Lemire et al., J. Biol. Chem. 264, 20206 (1989) and Kaiser et al. Science 235, 312 (1987), respectively).
Yeast have been engineered to express foreign polypeptide variants to be tested as potential antagonists of mammalian receptors. Libraries encoding mutant glucagon molecules were generated through random misincorporation of nucleotides during synthesis of oligonucleotides containing the coding sequence of mammalian glucagon. These libraries were expressed in yeast and culture broths from transformed cells were used in testing for antagonist activity on glucagon receptors present in rat hepatocyte membranes (Smith et al. 1993).
In one embodiment, the yeast cells are engineered to express a peptide library. A "peptide library" is a collection of peptides of many different sequences (typically more than 1000 different sequences), which are prepared essentially simgrowthultaneously, in such a way that, if tested simultaneously for some activity, it is possible to characterize the "positive" peptides. The peptide library of the present invention takes the form of a yeast cell culture, in which essentially each cell expresses one, and usually only one, peptide of the library. While the diversity of the library is maximized if each cell produces a peptide of a different sequence, it is usually prudent to construct the library so there is some redundancy. Moreover, each sequence should be produced at assayable levels. The peptides of the library are encoded by a mixture of DNA molecules of different sequence. Each peptide-encoding DNA molecule is ligated with a vector DNA molecule and the resulting recombinant DNA molecule is introduced into a yeast cell. Since it is a matter of chance which peptide-encoding DNA molecule is introduced into a particular cell, it is not predictable which peptide that cell will produce. However, based on a knowledge of the manner in which the mixture was prepared, one may make certain statistical predictions about the mixture of peptides in the peptide library.
It is convenient to speak of the peptides of the library as being composed of constant and variable residues. If the nth residue is the same for all peptides of the library, it is said to be constant. If the nth residues varies, depending on the peptide in question, the residue is a variable one. The peptides of the library will have at least one, and usually more than one, variable residue. A variable residue may vary among any of two to any of all twenty of the genetically encoded amino acids; the range of possibilities may be different, if desired, for each of the variable residues of the peptide. Moreover, the frequency of occurrence of the allowed amino acids at particular residue positions may be the same or different. The peptide may also have one or more constant residues.
There are two principal ways in which to prepare the required DNA mixture. In one method, the DNAs are synthesized a base at a time. When variation is desired, at a base position dictated by the Genetic Code, a suitable mixture of nucleotides is reacted with the nascent DNA, rather than the pure nucleotide reagent of conventional polynucleotide synthesis.
The second method provides more exact control over the amino acid variation. First, trinucleotide reagents are prepared, each trinucleotide being a codon of one (and only one) of the amino acids to be featured in the peptide library. When a particular variable residue is to be synthesized, a mixture is made of the appropriate trinucleotides and reacted with the nascent DNA.
Once the necessary "degenerate" DNA is complete, it must be joined with the DNA sequences necessary to assure the expression of the peptide, as discussed in more detail elsewhere, and the complete DNA construct must be introduced into the yeast cell.
VI. Periplasmic Secretion
The cytoplasm of the yeast cell is bounded by a lipid bilayer called the plasma membrane. Between this plasma membrane and the cell wall is the periplasmic space.
Peptides secreted by yeast cells cross the plasma membrane through a variety of mechanisms and thereby enter the periplasmic space. The secreted peptides are then free to interact with other molecules that are present in the periplasm or displayed on the outer surface of the plasma membrane. The peptides then either undergo re-uptake into the cell, diffuse through the cell wall into the medium, or become degraded within the periplasmic space.
The peptide library may be secreted into the periplasm by one of two distinct mechanisms, depending on the nature of the expression system to which they are linked. In one system, the peptide may be structurally linked to a yeast signal sequence, such as that present in the α-factor precursor, which directs secretion through the endoplasmic reticulum and Golgi apparatus. Since this is the same route that the receptor protein follows in its journey to the plasma membrane, opportunity exists in cells expressing both the receptor and the peptide library for a specific peptide to interact with the receptor during transit through the secretory pathway. This has been postulated to occur in mammalian cells exhibiting autocrine activation. Such interaction would likely yield activation of the linked pheromone response pathway during transit, which would still allow identification of those cells expressing a peptide agonist. An alternative mechanism for delivering peptides to the periplasmic space is to use the ATP-dependent transporters of the STE6/MDR1 class. This transport pathway and the signals that direct a protein or peptide to this pathway are not as well characterized as is the endoplasmic reticulum-based secretory pathway. Nonetheless, these transporters apparently can efficiently export certain peptides directly across the plasma membrane, without the peptides having to transit the ER/Golgi pathway. We anticipate that at least a subset of peptides can be secreted through this pathway by expressing the library in context of the a- factor prosequence and terminal tetrapeptide. The possible advantage of this system is that the receptor and peptide do not come into contact until both are delivered to the external surface of the cell. Thus, this system strictly mimics the situation of an agonist or antagonist that is normally delivered from outside the cell. Use of either of the described pathways is within the scope of the invention.
The present invention does not require periplasmic secretion, or, if such secretion is provided, any particular secretion signal or transport pathway.
VII. Pharmaceutical Preparations of Identified Agents
After identifying certain test compounds as potential modulators of the target phospholipase activity, the practioner of the subject assay will continue to test the efficacy and specificity of the selected compounds both in vitro and in vivo. Whether for subsequent in vivo testing, or for administration to an animal as an approved drug, agents identified in the subject assay can be formulated in pharmaceutical preparations for in vivo administration to an animal, preferably a human.
The subject compounds selected in the subject, or a pharmaceutically acceptable salt thereof, may accordingly be formulated for administration with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof. The optimum concentration of the active ingredient(s) in the chosen medium can be determined empirically, according to procedures well known to medicinal chemists. As used herein, "biologically acceptable medium" includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the activity of the compound, its use in the pharmaceutical preparation of the invention is contemplated. Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable "deposit formulations". Based on the above, such pharmaceutical formulations include, although not exclusively, solutions or freeze-dried powders of the compound in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered media at a suitable pH and isosmotic with physiological fluids. In preferred embodiment, the compound can be disposed in a sterile preparation for topical and/or systemic administration. In the case of freeze-dried preparations, supporting excipients such as, but not exclusively, mannitol or glycine may be used and appropriate buffered solutions of the desired volume will be provided so as to obtain adequate isotonic buffered solutions of the desired pH. Similar solutions may also be used for the pharmaceutical compositions of compounds in isotonic solutions of the desired volume and include, but not exclusively, the use of buffered saline solutions with phosphate or citrate at suitable concentrations so as to obtain at all times isotonic pharmaceutical preparations of the desired pH, (for example, neutral pH).
The present invention is further illustrated by the following examples, which should not be construed as limiting in any way. The contents of all cited references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference. Exemplification
Example 1. Development of Yeast Strains and Complementation Assays
Methods
A. Yeast Plasmids Which Express G Proteins
Expression Plasmids
All expression plasmids are based upon the shuttle vectors originally described by Sikorski and Hieter (R.S. Sikorski and P.Hieter (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27). The expression plasmids with the GPAl promoter (Cadus 1127), the PGK promoter (Cadus 1447) and the CUPl promoter (Cadus 1725 and 1728) have been described elsewhere (Cadus published Patent Application WO 94/23025 entitled "Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor).
G -subunits - Construction of Low Copy Expression Plasmids The following full length G-protein encoding inserts: GαS, Gαi2, Gαi3, Gαq, Gαl 1,
Gαl6, GαOA, GαOB, Gαl 2, GNAZ, and activated alleles (GTPase-deficient) of GαS, Gα i2, Gαq, and Gαl 6 (Wu et al. (1992); Wu et al (1993); Park et al (1992) and references therein) were amplified by polymerase chain reaction using VENT polymerase, with cloning sites added to the 5' and 3' ends of the coding regions. In all cases, the restriction site added to the 5' end of the gene encoded a novel Ncol compatible overhang, while the restriction site added to the 3' end of the gene encoded a novel Xhol compatible overhang. PCR products were gel purified, restricted with the appropriate endonucleases, and cloned into Ncol/Xhol cut Cadus 1127 (construction of this plasmid is described in Cadus patent application WO94/23025). Cadus 1127 is a low copy plasmid (CEN6 ARS4) in which heterologous gene expression is driven by the GPAl promoter (-1400 to +1 of the native GPAl locus). A novel Ncol site has been engineered into this vector such that the initiator methionine (at position +1) is embedded in this site (CCATGG). All G-protein expression cassettes were constructed as described below for Gαl 6. Full length human Gαl 6 was amplified from Cadus plasmid 1127 with Vent polymerase (New England Biolabs) using 5' oligonucleotide KS9829 = 5' GGGCGTCTCACATGGCCCGCTCGCTGACC 3' (in which a BsmBl site encoding a Ncol overhang (CATG) has been introduced and is underlined) and 3' oligonucleotide KS9830 = 5' GGGCTCGAGCTGGGTCACAGCAGGTGGATC 3' (in which an Xhol site has been introduced following the termination codon (underlined). Template (100 ng) and primers (1 uM final concentrations) were added in the presence of lOx reaction buffer containing 2 mM MgSO4. Template was denatured at 94°C for 30 seconds in the presence of primers followed byaddition of lul per lOOul reaction volume of VENT polymerase. DNA was amplified in a two stage amplification protocol: Stage 1 = 2 cycles of 94°C/ 30 seconds followed by 55°C/30 seconds followed by 72°C/60 seconds; Stage 2 = 25 cycles of 94°C/ 30 seconds followed by 60°C/30 seconds followed by 72°C/ 60 seconds. The amplified product was purified by gel electrophoresis, cut with BsmBI and Xhol, and ligated to Ncol / Xhol cut and phosphatase treated Cadus 1127 vector DNA. Recombinant clones were identified by colony PCR using primers flanking the inserted Gαl 6 sequences, confirmed by restriction digestion, and validated by dideoxynucleotide sequencing of the PCR product. Gαq and Gal l expressing plasmids were prepared in a similar fashion using the following oligonucleotide primer pairs for amplification: Gαq - 5' oligonucleotide = KS A 14282 = 5' GGGCGTCTCACATGACTCTGGAGTCCATCATG 3' (encoding an Esp3I site at the 5' end which leaves an Ncol overhang following cleavage with Esp3I or BsmBI) and 3' oligonucleotide = KS A 14283 = 5'GGGCGTCTCCTCGAGGCACGGTTAGACCAG 3' (encoding an Esp3I site at the 3' end that leaves an Xhol compatible overhang following cleavage with Esp3I or BsmI). Gal l - 5' oligonucleotide = KS A14645 = 5'GGGGGTCTCCCATGACTCTGGAGT- CCATGATG3' (encoding a Bsal sites that creates an Ncol compatible overhang following cleavage with Bsal) and 3' oligonucleotide = KS A 14285 = 5' GGGCTCGAGG-AAGCCTGGCCCT 3' (encoding a Xhol site).
G -subunits - High Copy Expression Plasmids Full length G-protein encoding inserts were amplified by polymerase chain reaction using VENT polymerase as described above, with cloning sites added to the 5' and 3' ends of the coding regions. In all cases, the restriction site added to the 5' end of the gene encoded a novel Ncol compatible overhang, while the restriction site added to the 3' end of the gene encoded a novel Xhol compatible overhang. PCR products were gel purified, restricted with the appropriate endonucleases, and cloned into Ncol/Xhol cut Cadus 1447. Cadus 1447 is a high copy plasmid (2 micron origin of replication) in which heterologous gene expression is driven by the phosphoglycerol kinase (PGK) promoter. A novel Ncol site is present at the initiator methionine, and a unique Xhol site is downstream from it. G-proteins cloned in this manner include GαS, Gαq, Gal l, Gal6, GaOA, GaOB, Gal2, GNAZ, and activated alleles (GTPase-deficient) of GαS, Gαi2, Gαq, and Gαl 6.
Yeast Plasmids Which Express Phospholipase C Genes
PLC-βl
Rat PLC-β 1 (Suh et al., (1988)) was cloned into Cadus 1725 (CUPp LEU2 CEN ARS AmpR) and Cadus 1728 (CUPp LEU2 2 micron origin AmpR). In these expression vectors, a minimal CUPl promoter has been engineered to contain an initiator methionine codon (ATG) imbedded in an Ncol site, so that cloning into the Ncol cut vector introduces the gene of interest in frame into the Ncol site. The resulting plasmid, Cadus 1642 (Rat PLC-β 1), was cleaved with ApaLI and ligated to a duplex adapter encoding the amino terminal seven residues of rat PLC-β 1 with yeast codon bias. The sequences of these oligonucleotides are: Oligo A = 5' CATGGCTGGTGCTCAACCAGGTG 3' and Oligo B = 5' TGCACACCTGG- TTGAGCACCAGC 3'. Oligo B was kinased with polynucleotide kinase prior to annealing and ligation. Following ligation to ApaLI cut Cadus plasmid 1642, the ligation mixture was treated with polynucleotide kinase, cleaved with BamHI and a 3.8 kb fragment with the entire coding region of rat PLC-β 1 was isolated by gel electrophoresis. This 3.8 kb PLC-β 1 fragment was then ligated to Ncol - BamHI cut Cadus 1725 and Cadus 1728. Plasmids containing inserts in the correct orientation were identified by colony PCR and verified by restriction analysis and double-stranded DNA sequencing using Sequenase V2.0 (U.S. Biochemicals).
PLC-β2
Human PLC-β2 (Park et al., (1992) was cloned into Cadus plasmid 1725 (CUPp LEU2 CEN ARS AmpR) and Cadus 1728 (CUPp LEU2 2 micron origin AmpR). The resulting plasmid, Cadus 1680 (Human PLC-β2), was restricted with Eco47III and EcoRI to completion and then treated with T4 polymerase to fill in the EcoRI overhang. The EcoRI- blunt/Eco47III cut plasmid was then ligated to a duplex adapter encoding the amino terminal twenty-one residues of human PLC-β2 with yeast codon bias. The sequences of these are:
Oligo C = 5'CATGTCTTTGTTGAACCCAGTTTTGTTGCCACCAAAGGTTAAGGCTT- ACTTGTCTCAAGGTGAGC 3' and Oligo D = 5'GCTCACCTTGAGACAAGTAAGCCTTAACCTTTGGTGGCAACAAA- ACTGGGTTC AAC AAAGA3 ' .
Oligo D was treated with polynucleotide kinase prior to annealing to oligo C and ligation to EcoRI-blunt/Eco47III cut Cadus 1680. Following ligation, the ligation mixture was treated with polynucleotide kinase to phosphorylate the Ncol overhang at the 5' end of the gene and the 3.8 kb fragment with the entire coding region of human PLC-β2 was purified by gel electrophoresis. This 3.8 kb fragment has Ncol compatible overhangs at both termini, and was ligated to Ncol cut/ shrimp alkaline phosphatase treated Cadus 1725 and 1728. Plasmids containing insert in the correct orientation were identified by colony PCR and verified by restriction analysis and double-stranded DNA sequencing using Sequenase V2.0.
Table 3 Yeast Strains
No. MAT Genotype NAME Pi GENE 1 P2 Name P2GENE
1630 α plcl*l::HIS3ade2-101 his3*2001eu2*l lys2-801 trpl*l ura3-52
1632 α PLCl ade2-101 his3*200 leu2*l lys2-801trpl*l ura3-52'
1633 α plcl*2::LEU2ade2-101 his3*2001eu2*l lys2-801 trpl*l ura3-52
1901 plcl*2::LEU2ade2-101 1443 URA32mu-ori his3*2001eu2*l lys2-801 REP3 AmpR PGKp trpl*l ura3-52
1902 α plcl*2::LEU2ade2-101 1460 URA3 CEN6 ARS4 his3*2001eu2*l lys2-801 AmpR PGKp trpl*l ura3-52
1903 plcl*2::LEU2ade2-101 GALlpPLClURA3 his3*2001eu2*l lys2-801 1637 2mu-ori AmpR trpl*lura3-52
1904 α plcl*2::LEU2ade2-101 1639 GALlpratPLC- his3*2001eu2*l lys2-801 betal URA3 CEN6 t l*l ura3-52 ARS4 AmpR
2099 α plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1127 TRP1 CEN6 ARS4 his3*2001eu2*l lys2-801 betal URA3 CEN6 AmpR GPAl p trpl*l ura3-51 ARS4 AmpR
2100 α plcl*2::LEU2ade2-101 J639 GALlpratPLC- 1179 TRP1 CEN6 ARS4 his3*2001eu2*l lys2-801 betal URA3 CEN6 AmpRGPAlp t l*l ura3-52 ARS4 AmpR GPAl
2101 plcl*2::LEu2ade2-101 1639 GALlpratPLC- 1181 TRP1 CEN6 ARS4 his3*200 leu2*a lys2-801 betal URA3 CEN6 AmpR GPAl pGaS trpl*l ura3-52 ARS4 AmpR
2102 α plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1606 trpl CEN6ARS4 his3*2001eu2*l lys2-801 betal URA3 CEN6 AmpR GPAl Pgα2 frpl*lura3-52 ARS4 AmpR
Figure imgf000056_0001
2954 α plcl*l::HIS3ade2-101 1922 CUP rat PLC- 1127 TRPlPAlpCEN6 his3*2001eu2*l lys2-801 betal LEU22mu-ori ARS4 AmpR trpl*l ura3-52 REP3 AmpR
2956 α plcl*l::HIS3ade2-101 1922 CUP rat PLC- 1855 GPAlp BamHI his3*2001eu2*l lys2-801 betal LEU22mu- GPA- trpl*l ura3-52 ori REP3 AmpR Gαl6TRPlCEN6 ARS4 AmpR
2958 plcl*l::HIS3ade-2-101 1961 LEU2 CEN6 ARSH4 1127 TRPl GPAlp α his3*2001eu2*l Iys2-801 AmpR CUP-PLC- CEN6 trpl*l ura3-52 beta2 ARS4 AmpR
2962 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1537 TRPl 2mu-ori α his3*2001eu2*l lys2-801 AmpR CUP-PLC- REP3 trpl*l ura3-52 beta AmpR PGKp- ratGαsQ227L
2964 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1617 GPAlp Human α his3*2001eu2*l lys2-801 AmpR CUP-PLC- 16 tτpl*l ura3-52 beta2 TRPl CEN6ARS4
AmpR
2966 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1685 GPA 1 pMurineGαq a his3*2001eu2*l lys2-801 AmpR CUP-PLC- TRPl CEN6ARS4 trpl*l ura3-52 beta2 AmpR f 1 ori
2968 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1752 GPAlp-Gαq- a his3*2001eu2*l lys2-801 AmpR CUP-PLC- Q209L trpl*l ura3-52 beta2 TRPl CEN6 ARS4
AmpR
2970 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1783 GPAlp-Gαl6- a his3*200 leu2*l lys2-801 AmpR CUP-PLC- Q212L trρl*l ura3-52 beta2 TRPl CEN6 ARS4
AmpR
2972 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1783 Murine Gαq a his3*2001eu2*l lys2-801 AmpR CUP-PLC- PGKp trpl*l ura3-52 beta2 TRPl 2mu ori
REP3
AmpR
2974 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1786 PGKp Human αl6 a his3*200ieu2*l lys2-801 AmpR CUP-PLC- TRPl 2mu ori trpl*l ura3-52 beta2 REP3 AmpR
2977 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1796 PGKp Human αl6- α his3*2001eu2*l lys2-801 AmpR CUP-PLC- !212L2muori trpl*l ura3-52 beta2 REP3
AmpR
2979 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1794 PGKp Murine Gα a his3*2001eu2*l lys2-801 AmpR CUP-PLCO 1- trpl*l ura3-52 beta2 Q209LTRP12mu ori
REPS AmpR
2981 plcl*l::HIS3ade2-101 1961 LEU2 CEN6 ARSH4 1850 PGKp Murine Gα a his3*2001eu2*l lys2-801 AmpR CUP-PLCO 11 t l*l ura3-52 beta2 TRPl 2mu-ori
REPS
AmpR f 1 ori 3222 plcl * l ::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1524 TRPl GPAlp-ratG α his3*200 1eu2* l lys2-801 AmpR CUP-PLC- αs- tφl*l ura3-52 beta2 Q227L CEN6
ARS4
AmpR
3226 plcl * l ::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1606 GPAlp Human α α his3*200 1eu2*l lys2-801 AmpR CUP-PLC- i2 tφl*l ura3-52 beta2 TRPl CEN6 ARS4
AmpR
3228 plcl *l::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1612 GPAlp Human α α his3*200 1eu2*l lys2-801 AmpR CUP-PLC- i3 trpl * l ura3-52 beta2 TRPl CEN6 ARS4
AmpR
3230 plcl * l::HIS3 ae2-101 1961 LEU2 CEN6 ARSH4 1622 GPAlp Murine α α his3*200 1eu2* l lys2-801 AmpR CUP-PLCO Oa trpl* l ura3-52 beta2 TRPl CEN6 ARS4
AmpR
3232 plcl * l ::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1623 GPAlp Murine α α his3*200 1eu2*a lys2-801 AmpR CUP-PLC- Ob trpl * l ura3-52 beta2 TRPl CEN6 ARS4
AmpR
Biological Deposit
S.cerevisiae strain CY 2964 (plcl*l ::HIS3 ade2-101 his3*200 leu2*l lys2-801 trpl*l ura3-52 [LEU2 CEN6 ARS4 AmpR CUP-PLC-beta2], [GPAlp Human alphalδ TRPl CEN6 ARS4 AmpR] was deposited with the American Type Culture Collection (Rockville, Maryland) on June 5, 1995 and has been designated with the ATCC Accession Number: 74345; and
S.cerevisiae strain CY 2954 (plcl*l::HIS3 ade2-101 his3*200 leu2*l lys2-801 trpl *l ura3-52 [CUP RAT PLCbetal LEU2 2mu-ori REP3 AmpR], GPAlp TRPl CEN6 ARS4 AmpR] was deposited with the American Type Culture Collection (Rockville, Maryland) on June 5, 1995 and has been designated with the ATCC Accession Number: 74343.
PLCl A Yeast Strains and Complementation Assays
Yeast Transformations All yeast transformation with the plcl A strains (Flick and Thorner (1993) were done using lithium acetate-based protocols and the Yeastmaker transformation kit (Clontech) according to the manufacturer's specifications. In general, strains were grown up overnight at 30°C to late log phase and diluted the next morning to an OD600 = 0.2-0.3. Following 5 hours of growth at 30°C, cells were washed once in water and resuspended in lithium acetate/TE such that the cells were concentrated 30-50 fold. To 100 ul of this suspension of cells, carrier DNA (100 ug), and plasmid DNA (0.1 - 0.5 ug) were added. Cells and DNA were then vortexed, PEG/lithium acetate/TE added, the suspension vortexed again, and the suspension incubated at 30°C for 30 minutes. DMSO was then addedto a final concentration of 10% was then added and the cells were heat shocked at 42°C for 15 minutes. Following cooling on ice, the cells were centrifuged, the PEG containing supernatant was decanted, the cells were resuspended in sterile TE and plated on selective plates.
Growth assays and alternative readouts
Standard media were used for the culture of yeast cells, and established procedures were used for genetic manipulations (Rose, M.D., Winston, F., and P. Heiter (1990) Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). All yeast strains were grown under selective conditions on synthetic medium supplemented with nutrients appropriate for selection and maintenance of insertional mutations and plasmids (Guthrie, C, and G.R. Fink (1991) Methods in Enzymology Volumel94. Guide to Yeast Genetics and Molecular Biology, Academic Press, Inc.). Strains to be tested for suppression of plcl A conditional lethal phenotypes were picked from single colonies from selective Synthetic Complete (SC) plates and were then streaked onto SC plates to single colonies and then grown for 48 to 72 hours under the following conditions.
Permissive growth conditions: SC / 2% Glucose / 30°C
Non-permissive growth conditions:
SC / 2% Glucose / 1.2 M Sorbitol / 30°C
SC / 2% Glucose / 0.5 M NaCl / 30°C
SC / 2% Glucose / 37°C SC / 2% Glucose / 12M Sorbitol / 37°C
SC / 2% Glucose / 0.5 M NaCl / 37°C The non-permissive conditions are listed above from least stringent to most stringent. Cell growth was monitored visually by light microscopy using a Nikon phase contrast microscope and were photographed using the UVP digital image processing system.
Results
GAL1 promoter driven PLC- 1 does not complement the plcl mutant phenotype
Initial attempts to complement the plcl ts and osmotic sensitivity phenotypes with mammalian PLC-β isozymes were carried out using a rat PLC-β 1 construct driven by the GAL1 promoter (the sequence of this construct was verified by dideoxynucleotide sequencing) in Cadus yeast strains CY1630 (plclΔl ::HIS3 ade2-101(Oc) his3-dl00 leu2-dl lys2-801 (Am) trpl-dl) and CY1633 (plclΔ2::HIS3 ade2-101(Oc) his3-dl00 leu2-dl lys2- 801 (Am) trpl-dl). In these experiments, no complementation was observed under conditions in which the GAL1 promoter was either repressed (in the presence of glucose) or when it was derepressed in the presence of low glucose and activated in the presence of galactose. In control experiments using a GAL1 promoter driven PLCl cassette (Cadus plasmid 1639) transformed into the same strain backgrounds (CY1630 and CY1633), both the temperature sensitive and osmotic sensitivity phenotypes were complemented. These negative results with the rat PLC-β 1 indicated that functional complementation of plcl phenotypes requires more than expression from the GAL1 promoter of the rat PLC-β 1 gene alone.
Complementation Analysis with Gx subunits
Phospholipase-C β dependent hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) to form inositol 1,4,5, trisphosphate (IP3) and diacylglycerol (DAG) is stimulated by both Gα and Gβγ subunits of heterotrimeric G-proteins. Stimulation of PLC-β activity by G α subunits is restricted to members of the Gq family that includes Gq, -11, -14, -15, and -16. Gα subunits belonging to other families (-s, -i, and -12/13) do not stimulate PLC-β dependent hydrolysis of PIP2 . In several cell types, agonist dependent stimulation of IP3 and calcium mobilization have been shown to be partially sensitive to pertussis toxin. This observation initially lead to speculation that Gi or Go could stimulate PLC-β activity. More recently the pertussis toxin sensitive component of agonist dependent IP3 production has been shown to be due to the ability of Gβγ subunits to stimulate PLC-β isoforms directly.
In an effort to recapitulate G-protein dependent regulation of PLC-β isoforms in yeast, a series of CY1630 derivatives were transformed with expression vectors coding for mammalian G-proteins and complementation of the plcl mutant phenotypes were scored. Cadus yeast strains CY1901, CY1903 and CY1904 (all CY1630 derivatives containing the plclΔl::HIS3 allele) contain, respectively, Cadus plasmids 1443 (no PLC), 1637 (GALlp-rat PLC-βl) or 1639 (GALlp-PLCl)(See Strain List, Table 2). While all three strains grow at 30°C on both synthetic complete and rich media, CY1904, harboring a GALlp-PLCl expression cassette on a 2 micron plasmid, grows better than either CY1901 (empty vector) or CY1903 (harboring a GALlp-rat PLC-βl expression cassette on a 2 micron plasmid). At non-permissive temperatures (>35°C), CY1901 and CY1903 failed to form colonies after 3 days in culture, while CY1904 forms large colonies.
CY1901, CY1903, and CY1904 (all haploid strains) were transformed by lithium acetate transformation procedures (Clontech, as per manufacturer's recommendations) with a panel of low-copy number (CEN ARS) Gα subunit expression plasmids coding for the following genes under the transcriptional control of the GPAl upstream promoter: Cadus plasmid 1127 (empty vector), 1179 (GPAl), 1181 (GαS), 1606 (Gαi2), 1617 (Gαl6), 1753 (Gαl6-Q209L GTPase" activated allele), 1685 (Gαq), and 1749 (Gαq-Q209L GTPase" activated allele)(See Strain List, Table 1). Following transformation into the strains listed above, isolated colonies were streaked to selective plates (-Ura, -Trp + glucose) and incubated at 30°C or at 37°C for up to 96 hours. While all strains containing all combinations of PLC expression vectors (1443, 1637, and 1639) and G-protein expression vectors grew under permissive conditions (30°C), only those strains expressing the yeast PLCl gene under the control of the GALl promoter grew at 37°C. Induction of the GALl promoter by growth on low glucose/high galactose plates did not result in rescue of the ts phenotypes of CY1901 or CY1903 derivatives, either. Even at times up to 96 hours post- plating, there was no evidence of growth under non-permissive conditions for strains harboring vectors expressing rat PLC-βl from the GALl promoter. These results indicate that plasmids encoding the rat PLC-βl driven by the GALl promoter are not capable of complementing the ts defect in plcl strains of yeast.
CUP-PLC- expression vectors
One possible explanation for the negative results described in the previous section is a lack of expression or an inappropriate level of expression of rat PLC-βl from the GALl promoter. A second potential difficulty presented with the GALl promoter relates to the inability of plcl strains to utilitize galactose as a carbon source. If galactose utilization is compromised in these strains, then induction of galactose sensitive promoters like GALlp and GALl Op would also be compromised. To circumvent both of these potential problems, the mammalian PLC-β isozymes were expressed from an inducible promoter whose activation is not dependent on carbon sources other than glucose. Unlike other high level constitutive promoters (i.e. PGK or ADH1), has not been associated with cellular toxicity. This sort of toxicity has, in fact been reported in the literature by Flick and Thorner (1993) with respect to overexpression of the yeast PLCl gene from the GALl promoter in the presence of galactose. Flick and Thorner report that the growth of wildtype strains of yeast that contained the PLCl gene under the control of the GALl promoter was compromised when the GALl promoter was induced on galactose but not when it was repressed on glucose-containing media.
Four novel PLC-β constructs were made; two encoding the rat PLC-βl gene and two encoding the human PLC-β2 gene each under the control of the CUPl promoter. In these constructs, the nucleotide sequences of amino terminal regions of rat PLC-βl and human PLC-β2 were altered to reflect a bias towards yeast codon usage instead of mammalian codon usage. The amino terminal seven residues of PLC-βl and the amino terminal 21 residues of human PLC-β2 were mutated using synthetic oligonucleotides to effect these changes. The nucleotide sequence of each construct subsequently was verified by dideoxynucleotide sequencing methods on both DNA strands.
Yeast Strain CY1630 was transformed with each of these plasmids, as well as other PLC constructs in which PLC isozymes are driven by the GALlp or ADH1 promoters, in the presence or absence of plasmids expressing various Gα subunits. Initial experiments tested for complementation of the temperature sensitive (ts) phenotype associated with the plcl genotype by human PLC-β2 and rat PLC-βl in the presence of a hybrid Gα subunit composed of the amino terminal 60% of the yeast GPAl subunit and the carboxyl terminal 40% of the human Gαl 6 subunit (Gαl6-Bam) This hybrid construct was chosen over a variety of other human Gα subunits for two reasons. First, in independent experiments it had been demonstrated that this particular hybrid subunit is functionally expressed in yeast (i.e. it couples to yeast Gβγ subunits and supresses activation of the pheromone response pathway in gpal- strains). Second, the structural determinants involved in effector activation by Gα subunits are thought to map to residues in the carboxyl terminal portions of Gα subunits (Berlot and Bourne (1992); Rarick et al. (1992); Artemeyer et al.(1993)).
Y1630 ( plcl) derivatives (See Strain List, Table 2) harboring combinations of mammalian PLC-β isozymes and Gα subunits were first colony purified and then duplicate sibs of each co-transformation assayed for growth at 30oC and 37oC in the presence or absence of lOOuM CuSO4. At 48 hours post-plating, all plcl strains, including those containing plasmids encoding rat PLC-βl, grew at 30oC, albeit less well than strains CY1633 (PLCl) or CY1904 (plclΔl::HIS3 [GALlp-PLCl]). At non-permissive temperatures, several differences could be observed between strains harboring mammalian PLC-β isozymes and those harboring empty vector by 48 hours post-plating. First, strains containing high copy versions (2 micron based) of rat-PLC-βl grew at 37oC regardless of the promoter driving expression of the PLC-β isozyme, while strains containing empty vector did not. CY1630 derivatives containing Cadus plasmid 1640 (ADHlp-rat PLC-βl) or Cadus plasmid 1922 (CUP-human PLC-βl) formed small colonies within 48 hours at 37oC, while CY1630 derivatives containing Cadus 1443 (empty vector) did not.
Second, CY1630 derivatives co-transformed with a low copy (CEN ARS) plasmid encoding CUP-human PLC-β2 and a low copy (CEN ARS) plasmid encoding the Gαl6-Bam allele grew at both 30oC and at 37oC. Third, growth of CY1630 derivatives at 37oC in this assay was not due to expression of the Gαl6-Bam allele alone as strains containing the Gα subunit variant alone in the absence of rat or human PLC-β isozymes did not support growth at 37oC.
Finally, growth of CY1630 derivatives expressing mammalian PLC isozymes was unaffected by the addition of lOOuM CuSO4 at 30oC, while at 37oC growth in the presence of copper was less than growth in the absence of copper. This apparent inhibition of growth in the presence of copper at non-permissive temperatures may reflect toxicity due to overexpression of phospholipase C enzymatic activity by analogy with the observations made by Flick and Thorner on overexpression of PLCl. These data represent the first demonstration to our knowledge that expression of mammalian PLC-β isozymes in yeast could functionally complement defects in the PLCl allele of S. cerevisiae. These data also demonstrate that members of the G-protein regulated PLC-β family of phospholipase C enzymes can functionally replace members of the PLC-delta family in yeast.
In an extension of these initial observations, a series of CY1630 derivatives were constructed in which different combinations of mammalian PLC-β isozymes and mammalian Gα subunits were co-expressed. The table of yeast strains (Table 2) lists the combinations tested in growth complementation assays. Strains containing any combination of Gq family members (wildtype alleles of q, 11, 16 as well as GTPase-deficient alleles of q and 16) and PLC-β2 supported growth under non-permissive conditions. Gα subunits from the GαS and Gαi families, on the hand, did not support growth of plclΔ strains under restrictive conditions. The Figure shows representative data. plclΔ strains expressing PLC-βl under the control of the CUP promoter grow under restrictive conditions regardless of the presence or absence of Gα subunits.
Complementation of the temperature sensitive and NaCl-sensitive phenotype associated with the plcl genotype was observed in two sets of circumstances. In PLCA strains containing high copy plasmids encoding either rat PLC-βl (Plasmid 1922) or human
PLC-β2 (Plasmid 1964), growth at 37oC did not require co-expression of a mammalian Gα subunit. These strains, therefore, display G-protein independent complementation of the ts defect. In strains containing low copy plasmids encoding the human PLC-β2 allele (Plasmid 1961), growth at 37oC required co-expression of a Gα subunit from the Gq family, plcl strains containing human PLC-β2 and Gq, -11, or -16, either on low or high copy number plasmids, all grew at 37oC. Furthermore, strains expressing human PLC-β2 and activated forms of Gαq (Q209L) or Gαl 6 (Q212L) grew robustly at both 30oC and 37oC while strains harboring human PLC-β2 and an activated form of GαS (Q227L) failed to support growth at 37oC. 3
Example 2. Complementation of the yeast plcl mutation by human PLC- 3
Human PLC-β3 has been found to complement the temperature-sensitive and NaCl sensitive phenotypes associated with the plcl genotype in yeast in a G-protein independent fashion. These conclusions are based on the finding that expression of the human PLC-β3 in yeast strains with the plcl background under the control of the CUP promoter on either high or low copy plasmids, results in growth on 0.5M NaCl or at elevated temperatures, independent of the co-expression of Gα subunits of the Gq family (i.e. q, 11, 14, 15, or 16). In this respect the characteristics of the human PLC-β3 isoform expressed in yeast resemble those of rat PLC-βl in exhibiting G-protein independent growth under non-permissive conditions, as distinct from the G-protein dependent growth phenotype of the human PLC-β2 isoform.
REFERENCES Arkinstall, S., Payton, M., & Maundrell, K. (1995). Activation of Phospholipase C gamma in Schizosaccharomyces pombe by Coexpression of Receptor or Nonreceptor Tyrosine Kinases. MCB, 15(3), 1431-1438.
Artemyer, N. O., Mills, J. S., Thornburg, K. R., Knapp, D. R., Schey, K. L., & Hamm, H. E. (1993). A site on transducin alpha subunit of interaction with the polycationic region of cGMP phosphodiesterase inhibitory subunit. .
Bahk, Y.-Y., Lee, Y.-H., Ryu, S.-H., Suh, P.-G., Lee, T. G., & Seo, J. (1994). J. Biol. Chem., 269, 8240-8245.
Bennett, C. F., Balcarek, J. M., Varichio, A., & Crooke, S. T. (1988). Nature, 334(268). Berlot, C. H., & Bourne, H. R. (1992). Indentification of effector-activating residues of Gα S. Cell, 68, 911-922.
Berridge, M. J. (1993). Inositol trisphosphate and calcium signalling. Nature, 361(January 28), 315-325. Berstein, G., Blank, J. L., Jhon, D.-Y., Exton, J. H., Rhee, S. G., & Ross, E. M. (1992). Phospholipase C-bl Is a GTPase-Activating Protein for G /J J , Its Physiologic Regulator. Cell, 70(August 7), 411-418.
Bhak, M. J. K. Y. Y., Min, D. S., Lee, S. J., Ryu, S. H., & Suh, P. G. (1993). Biochem. Biophys. Res. Cornmun., 194, 706-712.
Bishop, W. R., Pachter, J. A., & Pai, J.-K. (1992). Regulation of Phospholipid Hydrolysis and Second Messenger Formation By Protein Kinase C. Advan. Enzyme Regul., 32, 177-192.
Bonser, R. W., Thompson, N. T., Randall, R. W., & Garland, L. G. (1989). Phospholipase D activation is functionally linked to superoxide generation in the human neutrophil. Biochem J, 264, 617-620.
Bosch, B. D. (1980). Biochim. Biophys. Acta, 604, 191-246. Boyer, J. L., Paterson, A., & Harden, T. K. (1994). G-Protein-Mediated Regulation of Phospholipase C. TCM, 4(2), 88-95. Burgess, W. H., Dionne, C. A., Kaplow, J. M., Mudd, R., Firesel, R., Zilberstein, A.,
Schlessinger, J., & Jaye, M. (1990). Characterization and cDNA cloning of phospholipase C- gamma, a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. MCB, 10, 4770-4777.
Clapham, D. E. (1995). Calcium Signaling. Cell, 80(January 27), 259-268. Clapham, D. E., & Neer, E. J. (1993). New roles for G-protein beta gamma-dimers in transmembrane signalling. Nature, 365(September 30), 403-406.
Clark, J. D. (1991). Cell, 65, 1043-1051.
Cook, J. T., & Wakelam, M. J. (1992a). Epidermal growth factor increases sn-1,2,- diacylglycerol levels and activates phospholipase D-catalysed phosphatidylcholine breakdown in Swiss 3T3 cells in the absence of inositol-lipid hydrolysis. Biochem. J., 285, 247-253.
Cook, S. J., & Wakelam, M. J. (1992b). Phospholipases C and D in Mitogenic Signal Transduction. Rev. Physiol. Biochem. Pharmacol, 119, 13-45.
Corven, E. J. V., Groenik, A., Jalink, K., Eichoholtz, T., & Moolenaar, W. H. (1989). Lysophosphatidate-induced cell proliferation: identification and dissection of signalling pathways mediated by G proteins. Cell, 59, 45-54.
Coussens, L., parker, P. J., Rhee, L., Yang-Feng, T. L., Chen, E., Waterfield, M. D., Francke, U., & Ullrich, A. (1986a). The Complete Primary Structure of Protein Kinase C - the Major Phorbol Ester Reception. Science, 233, 853 - 8596. Coussens, L., Parker, P. J., Rhee, L., Yang-Feng, T. L., Chen, E., Waterfield, M. D.,
Francke, U., & Ullrich, A. (1986b). Multiple, Distinct Forms of Bovine and Human Protein Kinase C Suggest Diversity in Cellular Signaling Pathways. Science, 233, 859-866. Cuevas, W. A., & Songer, J. G. (1993). Arcanobacterium haemolyticum phospholipase D is genetically and functionally similar to Corynebacterium pseudotuberculosis phospholipase D. Infect. Immun, 61, 4310-4316.
DeWinter (1982). Biochim. Biophys. Acta, 712, 332-341. Divecha, N., & Irvine, R. F. (1995). Phospholipid Signaling. Cell, 80(January 27),
269-278.
Emori, Y., Homma, Y., Sorimachi, H., Kawasaki, H., Nakanishi, O., Suzuki, K., & Takenawa, T. (1989). A second type of rat phosphoinositide-specific phospholipase C containing a src-related sequence not essential for phosphoinositide-hydrolyzing activity. JBC, 264, 21885-21890.
Flick, J. S., & Thorner, J. (1993). Genetic and Biochemical Characterization of a Phosphatidylinositol- Specific Phospholipase C in Saccharomyces cerevisiae. MCB, 13(9), 5861-5876.
Gassama-Diagne, A., Fauvel, J., & Chap, H. (1989). J. Biochem, 264, 9470-9475. Gordeladze, J. O., Bjoro, T., Torjesen, P. A., Ostberg, B. C, Haug, E., & Gautivik, K.
M. (1989). Protein kinase C stimulates adenylate cyclase activity in prolactin-secreting rat adenoma
Figure imgf000066_0001
pituicytes by inactivating the inhibitory GTP-binding protein Gj. Eur. J. Biochem, 183, 397-406.
Gray, & Stickland (1982). Can. J. Biochim, 60, 108-117. Guthrie, C, & Fink, G. R. (1991). Guide to Yeast Genetics and Molecular Biology. Methods in Enzymology, 194.
Hempel, W. M., & DeFranco, A. L. (1991). Expression of phospholipase C isozymes by murine B lymphocytes. J. Immunol., 146, 3717-3720.
Homma, Y., & Emori, Y. (1995). A dual functional signal mediator showing RhoGAP and phospholipase C-delta stimulating activities. EMBO J, 14(2), 286-91.
Inglese, J., Koch, W. J., Touhara, K., & Lefkowitz, R. J. (1995). Gβ gamma interactions with PH domains and Ras-MAPK signaling pathways. TIBS, 20, 151-156.
Iniguez-Lluhi, J., Kleuss, C, & Gilman, A. G. .Ishizaki, J., Ohara, O., Nakamura, E., Tamaki, M., Ono, T., Kanda, A., Yoshida, N., Teraoka, H., Tojo, H., & Okamoto, M. (1989). cDNA cloning and sequence determination of rat membrane-associated phospholipase A2. Biochem. Biophys. Res. Commun., 162, 1030-1036.
Jiang, H., Wu, D., & Simon, M. I. (1994). Activation of phospholipase C-β4 by heterotrimeric GTP-binding proteins. JBC, 269(10), 7593-7596.
Kerfelec, B., LaForge, K. S., Puigserver, A., & Scheele, G. (1986). Primary structures of canine pancreatic lipase and phospholipase A-2 messenger RNAs. Pancreas, 1, 430-437. Kolch, W., Heidecker, G., Kochs, G., Hummel, R., Vahidi, H., Mischak, H., Finkenzeller, G., Marme, D., & Rapp, U. R. (1993). Protein Kinase Ca activates RAF-1 direct phosphorylation. Nature, 364, 249-252.
Kusunoki, C, Satoh, S., Kobayashi, M., & Niwa, M. (1990). Structure of genomic DNA for rat platelet phospholipase A2. Biochim. Biophys. Acta., 1087(1), 95-97.
Kuwabara, Y., Maruyama, M., Watanabe, Y., & Tanaka, S. (1989). J. Biochem., 104, 236-241.
Lee (1994). J. Biol. Chem., 269, 19725-19730.
Lee, C. H., Park, D., Wu, D., Rhee, S. G., & Simon, M. I. (1992). Members of the Gqα Subunit Gene Family Activated Phospholipase C β Isozymes. JBC, 267(23), 16044- 16047.
Lee, C. W., Lee, K. H., Lee, S. B., Park, D., & Rhee, S. G. (1994). Regulation of phospholipase C-beta 4 by ribonucleotides and the alpha subunit of Gq. JBC, 269(41), 25335-25338. Lee, H.-H., Park, D.-J., Lee, S.-B., Yoo, O.-J., & Rhee, S. G. (1993). JBC, 268, 6654-
6661.
Meldrum, E., Parker, P. J., & Carozzi, A. (1991). The Ptdlns-Plc superfamily and signal transduction. Biochem. Biophys. Acta, 1092, 49-71.
Moolenaar, W. H., Kruijer, W., Tilley, B. C, Verlaan, I., Bierman, A. J., & DeLatt, S. W. (1986). Growth factor-like action of phosphatidic acid. Nature, 323, 171-173.
Morris, A. J., Waldo, G. L., Boyer, J. L., Helper, J. R., Downes, C. P., & Harden, T. K. (1990). Regulation of Phospholipase C. Soc. Gen. Physiol Ser, 45, 61-75.
Ohara, O., Ishizaki, J., Nakano, T., Arita, H., & Teraoka, H. (1990). A simple and sensitive method for determining transcription initiation site: identification of two transcription initiation sites in rat group II phospholipase A2 gene. Nucleic Acids Res., 18(23), 6997-7002.
Ohara, O., Tamaki, M., Nakamura, E., Tsuruta, Y., Fujii, Y., Shin, M., Teraoka, H., & Okamoto, M. (1986). Dog and rat pancreatic phospholipases A-2: Complete amino acid sequences deduced from complementary DNAs. J. Biochem., 99, 733-739. Park, D., Jhon, D.-Y., Kriz, R., Knopf, J., & Rhee, S. G. (1992). Cloning, Sequencing,
Expression, and Gq -independent Activation of Phospholipase C-β2. JBC, 267(23), 16048- 16055.
Parker, P. J., Coussens, L., Totty, N., Rhee, L., Young, S., Chen, E., Stabel, S., Waterfield, M. D., & Ullrich, A. (1986). The Complete Primary Structure of Protein Kinase C-the Major Phorbol Ester Receptor. Science, 233, 853-859. Payne, W. E., & Fitzgerald-Hayes, M. (1993). A Mutation in PLCl, a Candidate Phosphoinositide-Specific Phospholipase C Gene from Saccharomyces cerevisiae, Causes Aberrant Mitotic Chromosome Segregation. MCB, 13(7), 4351-4364.
Plevin, R., MacNulty, E. E., Palmer, S., & Wakelam, M. J. O. (1991). Differences in the regulation of endothelin- 1 and lysophosphatidic acid-stimulated Ins(l,4,5)P formation in Rat-1 fibroblasts. Biocehm J, 280, 609-615.
Rarick, H. M., Artemyer, N. O., & Hamm, H. E. (1992). A site on Rod G-protein alpha subunit that mediates effector activation. Science, 256, 1031-1033.
Rhee, S. G., Suh, P.-G., Ryu, S.-H., & Lee, S. Y. (1989). Studies of Inositol Phospholipid-Specific Phospholipase C. Science, 244(May 5), 546-550.
Riedel, H., Parissenti, A. M., Hansen, H., Su, L., & H.L.Shieh (1993a). Stimulation of Calcium Uptake in Saacharomyces cerevisiae by Bovine Protein Kinase C α. JBC, 268(5), 3456-3462.
Riedel, H., Su, L., & Hansen, H. (1993b). Yeast Phenotype Classifies Mammalian Protein Kinase C cDNA Mutants. MCB, 13(8), 4728-4735.
Rose, M. D., Winston, F., & Heiter, P. (1990). Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press.
Seilhamer, J. J., Randall, T. L., Yamanaka, M., & Johnson, L. K. (1986). Pancreatic phospholipase A2: Isolation of the human gene and cDNAs from porcine pancreas and human lung. DNA, 5(6), 519-527.
Sharp, J. D., White, D. L., Chiou, X. G., Goodson, T., Gamboa, G. C, McClure, D., Burgett, S., Hoskins, J. A., Skatrud, P. L., Sportsman, J. R., Becker, G. W., Kang, L. H., Roberts, E. F., & Kramer, R. M. (1991). Molecular cloning and expression of human Ca (2+)-sensitive cytosolic phospholipase A2. JBC, 266(23), 14850-14853. Sikorski, R. S., & Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, 122, 19- 27.
Stemweis, P. C, & Smrcka, A. B. (1992). Regulation of Phospholipase C by G Proteins. TIBS, 17(December), 502-506. Suh, P.-G., Ryu, S. H., Moon, K. H., Suh, H. W., & Rhee, S. G. (1988). Cloning and
Sequence of Multiple Forms of Phospholipase C. Cell, 54(July 15), 161-169.
Tanka, T., Kimura, S., & Ota, Y. (1987). Sequence of a cDNA coding for bovine pancreatic phospholipase A2. Nucleic Acids Res., 15(7), 3178.
Teramoto (1083). J. Biochim, 93, 1353-1360. Traynor, & Authi (1981). Biochim. Biophys. Acta., 665, 571-577.
Trotter, J., & Smith, M. E. (1986). The role of phospholipases from inflammatory macrophages in demyelination. Neurochem. Res., 11, 349-361. Tsang, T. C, Fung, W., Levine, J., Metz, C. N., Davitz, M. A., Burns, D. K., Huang, K.-S., & Kochan, J. P. (1992). Isolation and expression of two human glycosylphosphatidylinositol phospholipase D (GPI-PLD) cDNAs. FASEB, 6, 1922 - 1992.
Wu, D., Jiang, H., Katz, A., & Simon, M. I. (1993). Identification of critical regions on phospholipase C-beta 1 required for activation by G-proteins. JBC, 268, 3704-3709.
Wu, D., Lee, C. H., Rhee, S. G., & Simon, M. I. (1992). Activation of Phospholipase C by a Subunits of the G and Gj ^ Proteins in Transfected Cos-7 cells. JBC, 267(January 25), 1811-1817.
Yoko-o, T., Matsui, Y., Yagisawa, H., Nojima, H., Uno, I., & Toh-E, A. (1993). The putative phosphoinositide-specific phospholipase C gene, PLCl, of the yeast Saccharomyces cerevisiae is important to cell growth. Proc. Natl. Acad. Sci. USA, 90, 1804-1808.
Zupan, L. A., Steffens, D. L., Berry, C. A., Landt, M. L., & Gross, R. W. (1992). Cloning and expression of a human 14-3-3 protein mediating phospholipolysis. Identification of an arachidonoyl -enzyme intermediate during catalysis. JBC, 267, 8707-8710.
REFERENCES FOR TABLE 1
Bonner, T.I., Buckley, N.J., Young, A. C, and Brann, M. R. (1987). Identification of a family of muscarinic acetylcholine receptor genes. Science 237, 527-632. Bonner, T. I., Young, A. C, Brann, M. R., and Buckley, N. J. 20 (1988). Cloning and expression of the human and rat m5 muscarinic acecylcholine receptor genes. Neuron 1, 403-410.
Boulay, F., Mery, L., Tardif, M, Brouchon L., and Vignais, P. (1991) Expression cloning of a receptor for C5a anaphylatoxin on differentiated HL-60 cells. Biochemistry 30, 2993-2999.
Boulay, F., Tardif, M., Brouchon, L., Viguais, P. (1990) The human N-formylpeptide receptor. Characterization of two cDNA isolates and evidence for a new subfamily of G protein-coupled receptors. Biochemistryy 29, 11123-11133.
Bruno, J.F., Whittaker, J. Song, J.F., Berelowitz, M. (1991) Molecular cloning and sequencing of a cDNA encoding a human IA adrenergic receptor. Biochem. Biophys. Res.. Commun. 179, 1485-1490.
De-Nardin-E, Radel-S-.J. Lewis-N. Genco-R-J. Hammarskjold-M. (1992) Identification of a gene encoding for the human formyl peptide receptor. Biochem-Int. 26, 381-387. Dearry, A., Gingrich, J. A., Falardeau, P., Fremeau, R.T., Bates. M.D., Caron, M.G.
(1990) Molecular cloning and expression of the gene for a human D] dopamine receptor. Nature 347, 72-76. Demchyshyn, L., Sunahara, R.K.-Miller, K. Teitler-M.-Hoffman-B-J., Kennedy, J.L. Seeman-P. Van-Tol- H-H. Niznik-H-B. A human serotonin ID receptor variant (5HT1D beta) encoded by an intronless gene on chromosome 6. (1992) Proc-Natl-Acad-Sci-U-S-A. 89, 5522-5526. Evans, C.J., Keith, D.E. Jr., Morrison, H., Magendzo, K., and Edwards, R.H. (1992)
Cloning of a delta opioid receptor by functional expression. Science 258, 1952-1955.
Fargin, A., Raymond, J.R., Lohse, M.J., Kobilka, B.K., Caron, M.G. and Lefkowitz, R.J. (1988). The genomic clone G-21 which resembles a β-adrenergic receptor sequence encodes the 5-HTl α receptor. Nature 335, 358-360. Frielle, T., Collins, S., Daniel, K.W., Caron, M.G., Lefkowitz, R.J., and Kobilka, B.K.
(1987) Cloning of the cDNA for the human 1 -adrenergic receptor. Proc. Natl. Acad. Sci. U.S.A. 84, 7920-7924.
Furuta, H. Guo-D-F. Inagam-T. (1992) Molecular cloning and sequencing of the gene encoding human angiotensin II type 1 receptor. Biochem- Biophys Res Commun. 183, 8-13. Gantz, I., Munzert, G., Tashiro, T., Schaffer, M., Wang, L., DelValle, J., Yamada, T.
(1991b) Molecular cloning of the human histamine H2 receptor. Biochem. Biophys. Res. Commun. 178, 1386-1392.
Gerard, N.P., Eddy, R.L., Jr., Shows, T.B., and Gerard, C. (1990) The human neurokinin A (Substance K) receptor. Molecular cloning of the gene, chromosomal localization, and isolation of cDNA from tracheal and gastric tissues. J. Biol. Chem. 265, 20455-20462.
Gerard, N.P. and Gerard, C. (1991) The chemotactic receptor for C5a anaphylatoxin. Nature 349, 614-617.
Gerard, N.P., Garraway, L.A., Eddy, R.L. Jr., Shows, T.B., Iijima, H., Paquet, J.-L and Gerard, C. (1990) Human substance P receptor (NK-1): Organization of the gene, chromosome localization, functional expression of cDNA clones. Biochem. 30, 10640- 10646.
Gerard, CM., Mollereau, C, Vassart, G., and Parmentier, M. (1991) Molecular cloning of a human cannabinoid receptor which is also expressed in testis. Biochem. J. 279, 129-134.
Grandy, D.K., Marchionni, M.A., Makam, H., Stofko, R.E-Alfanzo, M., Frothingham, L., Fischer, J.B., Burke-Howie, K.J., Bunzow, J.R., Server, A.C. and Civelli, O. (1989) Cloning of the cDNA and gene for a human D2 dopamine receptor. Proc. Natl. Acad. Sci. USA 86, 9762-9766. Hamblin, M.W. and Metcalf, M.A. (1991) Primary structure and functional characterization of a human 5-HTlD-type serotonin receptor. Mol. Pharmacol. 40, 143-148. Hamblin-M-W. Metcalf-M-A., McGuffin-R-W., Karpelis-S. (1992) Molecular cloning and functional characterization of a human 5-HT1B serotonin receptor: a homologue of the rat 5-HT1B receptor with 5-HTlD-like pharmacological specificity. Biochem- Biophys-Res-Commun. 184, 752-759. Hayzer-D-J., Rose-P-M., Lynch-J-S., Webb- M-L., Kienzel-B-K., Liu-E-C,
Bogosian-E-A., Brinson,-E., Runge-M-S. (1992) Cloning and expression of a human endothelin receptor: subtype A. Am-J-Med-Sci. Oct. 304, 231-238.
Herzog, H., Hort, Y.J., Ball, H.J., Hayes, G., Shine, J., and Selbie, L.A. (1992) Cloned human neuropeptide Y receptor couples to two different second messenger systems. Proc. Natl. Acad. Sci. U.S.A. 89, 5794-5798.
Hirata, M., Hayashi, Y., Ushikubi, F., Yokota, Y., Kageyama, R., Nakanishi, S and Narumiya, S. (1991) Cloning and expression of cDNA for a human thromboxane A2 receptor. Nature 349, 617-620.
Holmes, W.E., Lee, J., Kuang, W.-J., Rice, G.C., and Wood, W.I. (1991) Structure and functional expression of a human interleukin-8 receptor. Science 253, 1278-1280.
Hosoda-K Nakao-K. Hiroshi-Arai. Suga-S., Ogawa-Y. Mukoyama-M. Shirakami-G. Saito-Y. Nakanishi-S. Imura-H. (1991) Cloning and expression of human endothelin-1 receptor cDNA. FEBS-Lett. 287, 23-26.
Kang, J., Lemaire, H.-G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzeschik, K.-H., Multhaaup, G., Beyreuther, K., Mϋller-Hill, B. (1987) The precursor of Alzheimer's disease amyloid protein resembles a cell-surface receptor. Nature 235, 733,736.
Kiess, W., Blickenstaff, G.D., Sklar, M.M., Thomas, C.L., Nissley, S.P. and Sahagian, G.G. (1988) Biochemical evidence that the type II insulin-like growth factor receptor is identical to the cation-independent mannose 6-phosphate receptor. J. Biol. Chem. 263, 9339-9344.
Kimura, T., Tanizawa, O., Mori, K., Brownstein, M.J., and Okayama, H. (1992) Structure and expression of a human oxytocin receptor. Nature 356, 526-529.
Kobilka, B.K., Dixon, R.A.F., Frielle, T., Dohlman, H.G., Bolanowski, M.A., Sigal,
I.S., Yang-Feng, T.L., Francke, U., Caron, M.G., and Lefkowitz, R.J. (1987) cDNA for the human β2~adrenergic receptor: A protein with multiple membrane spanning domains and a chromosomal location shared with the PDGF receptor gene. Proc. Natl. Acad. Sci. USA 84,
46-50.
Kobilka, B.K., Frielle, T., Collins, S., Yang-Feng, T., Kobilka, T.S., Francke, U., Lefkowitz, R.J., and Caron, M.G. (1987) An intronless gene encoding a potential member of the family of receptors coupled to guanine nucleotide regulatory proteins. Nature 329, 75-79. Kunz, D., Gerard, N.P., and Gerard, C. (1992) The human leukocyte platelet- activating factor receptor. cDNA cloning, cell surface expression and construction of a novel epitope-bearing analog. J. Biol. Chem. 267, 9101-9106.
Larhammar, D., Blomqvist, A.G., Yee, F., Jazin, E., Yoo, H., Wahlested, C. (1992) Cloning and functional characterization of a human neuropeptide Y/peptide YY receptor of the Yl type. J. Biol. Chem. 267, 10935-10938.
Lemaire, H.G., Salbaum, J.M., Multhaup, Kang, J., Bayney, R.M., Unterbeck, A., Beyreuther, K., Mϋller-Hill, B. (1989) The PreA4,595 precursor protein of Alzheimer's disease A4 amyloid is divided by 16 exons. Nuc. Acids. Res. 17, 517-522. Levy, F.O., Gudermann, T., Perez-Reyes, E., Birnbaumer, M., Kaumann, A.J., and
Birnbaumer, L. (1992b) Molecular cloning of a human serotonin receptor (SI 2) with a pharmacological profile resembling that of the 5-HTld subtype. J. Biol. Chem. 267, 7553- 7562.
Levy, F.O., Gudermann, T., Birnbaumer, M. Kaumann, A.J., and Birnbaumer, L. (1992a) Molecular cloning of a human gene (S31) encoding a novel serotonin receptor mediating inhibition of adenylyl cyclase. FEBS. Lett. 296, 201-206.
Libert, F., Lefort, A., Gerard, C, Parmentier, M., Perret, J., Ludgate, M., Dumont, J., Vassart, G. (1989) Cloning, sequence and expression of the human thyrotropin (TSH) receptor: Evidence for the binding of autoantibodies. Biochem. Biophys. Res. Commun. 165, 150-155.
Libert, F., Van Sande, J., Lefort, A., Czernilofsky, A., Dumont, J.E., Vassart, G., Ensinger, H.A., and Mendla, K.D. (1992) Cloning and functional characterization of a human Al adenosine receptor. Biochem. Biophys. Res. Commun. 187, 919-926.
Lomasney, J.W., Lorenz, W., Allen, L.F., King, K., Regan, J. W., Yang-Feng, T.L., Caron, M.G., and Lefkowitz, R.J. (1990). Expansion of the α2-adrenergic receptor family: cloning and characterization of a human α2-adrenergic receptor subtype, the gene for which is located on chromosome 2. Proc. Natl. Acad. Sci. U.S. A. 87, 5094-5098.
Mayo, K.E. (1992) Molecular cloning and expression of a pituitary-specific receptor for growth hormone-releasing hormone. Mol. Endorcrin. 6, 1734-1744. Minegish, T., Nakamura, K., Takakura, Y., Ibuki,, Y., and Igarashi, M. (1991)
Cloning and sequencing of human FSH receptor cDNA. Biochem. Biophys. Res. Commun. 175, 1125-1130.
Minegish, T., Nakamura, K., Takakura, Y., Miyamoto, K., Hasegawa, Y., Ibuki, Y., and Igarashi, M. (1990) Cloning and sequencing of human LH/hCG receptor cDNA. Biochem. Biophys. Res. Commun. 172, 1049-1054.
Misrahi, M., Lossfelt, H., Atger, M., Sar, S., Guiochen-Mantel, A., Milgrom, E. (1990) Cloning sequencing and expression of human TSH receptor. Biochem. Biophys. Res. Commun. 166, 394-403. Herbert J. Schon. E.A. (1988) A cDNA specifying the human amyloid precursor protein (ABPP) encodes a 95-kDA polypeptide. Nuc. Acids Res. 16, 9351.
Mochizuki-D. Yuyama-Y. Tsujita-R. Komaki-H. Sagai-H. (1992) Cloning and expression of the human 5-HTlB-type receptor gene. Biochem-Biophys-Res-Commun. 185, 517-523.
Murphy, P.M. and McDermott, D. (1991) Functional expression of the human formyl peptide receptor in Xenopus oocytes requires a complementary human factor. J. Biol. Chem. 266, 12560-12567. Murphy, P.M. and Tiffany, H.L. (1991) Cloning of complementary DNA encoding a functional human interleukin-8 receptor. Science 253, 1280-1283.
Nagayama, Y., Kaufman, K.D., Seto, P., and Rapoport, B. (1989) Molecular cloning, sequence and functional expression of the cDNA for the human thyrotropin receptor. Biochem. Biophys. Res. Commun. 165, 1184-1190. Nakamuta-M. Takayanagi-R. Sakai-Y. Sakamoto-S. Hagiwara-H. Mizuno. Saito-Y.
Hirose-S. Yamamoto-M. Nawata-H. (1991) Cloning and sequence analysis of a cDNA encoding human non-selective type of endothelin receptor. Biochem-Biophys-Res-Commun. 177, 34-39.
Nathans, J., and Hogness, D.S. (1984) Isolation and nucleotide sequence of the gene encoding human rhodopsin. Proc. Natl. Acad. Sci. U.S.A. 81, 4851-4855.
Nathans J., Thomas, D., and Hogness, D.S. (1986) Molecular genetics of human color vision: The genes encoding blue, green, and red pigments. Science 232, 193-202.
Neote, K. DiGregorio, D., Mak, J.Y., Horuk, R., and Schall, T. J. (1993) Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor. Cell 72, 415-425. Ogawa-Y. Nakao-K. Arai-H. Nakagawa-O. Hosoda-K. Suga-S.
Nakanishi-S. Imura-H. (1991) Molecular cloning of a non-isopeptide-selective human endothelin receptor. Biochem-Biophys-Res-Commun. 178. 248-255.
Peralta, E.G., Ashkenazi, A., Winslow, J.W., Smith, D.H., Ramachandran, J., and Capon, D.J. (1987b). Distinct primary structures, ligand-binding properties, and tissue- specific expression of four human muscarinic acetylcholine receptors. EMBO J. 6, 3923- 3929.
Pierce, K.D., Furlong, T.J., Selbie, L.A., and Shine, J.(1992) Molecular cloning and expression of an adenosine A2b receptor from human brain. Biochem. Biophys., Res. Commun. 187, 86-93. Ramarao-C.S. Denker-J-M. Perez-D-M. Gaivin-R.-J. Riek-R.P. Graham-R-M.
(1992) Genomic organization and expression of the human α lB-adrenergic receptor. J- Biol-Chem. 267, 21936-21945. Regan, J.W., Kobilka, T.S., Yang-Feng, T.L., Caron, M.G., and Lefkowitz, R.J. (1988) Cloning and expression of a human kidney cDNA for a novel β2 -adrenergic receptor. Proc. Natl. Acad. Sci. U.S.A. 85, 6301-6305.
Sokoloff, P., Giros, B., Martres, M.-P., Bouthenet, M.L., Schwartz, J.C. (1990) Molecular cloning and characterization of a novel dopamine receptor (D3) as a target for neuroleptics. Nature 347, 146- 151.
Sreedharan, S.P., Robichon, A., Peterson, K.E., and Goetzl, E. J. (1991) Cloning and expression of the human vasoactive intestinal peptide receptor. Proc. Natl. Acad. Sci. U.S.A. 88, 4986-4990. Sunahara, R.K., Niznik, H.B., Weiner, D.M., Stormann, T.M., Brann, M.R., Kennedy,
J.L. Gelernter, J.E., Rozmahel, R., Yang, Y., Israel, Y., Seeman, P., O'Dowd, B.F. (1990) Human dopamine D, receptor encoded by an intronless gene on chromosome 5. Nature 347, 80-83.
Takeda, Y., Chou, K.B., Takeda, J., Sachais, B.S., and Krause, J.E. (1991) Molecular cloning, structural characterization and functional expression of the human substance P. receptor. Biochem. Biophys,. Res. Commun. 179, 1232-1240.
Tanabe, Y., Hasu, H., Shigemoto, R., Nakanishi, S. (1992) A family of metabotropic glutamate receptors. Neuron 8, 169-179.
Van Tol, H.H., Bunzow, J.R., Guan, H.C., Sunahara, R.K., Seeman, P., Niznik, H.B., Civelli, O. (1991) Cloning of the gene for a human dopamine D4 receptor with high affinity for the anti psychotic clozapine. Nature 350, 610-614.
Vu, T.-K. H., Hung, D.T., Wheaton, V.I., and Coughlin, S.R. (1991) Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64, 1057-1068. Weinshank, R. L. Zgombick, J.M., Macchi, M., Adham, N., Lichtblau, H., Branchek,
T.A., and Hartig, P.R. (1990) Cloning, expression and pharmacological characterization of a human α-B - adrenergic receptor. Mol. Pharmacol. 38, 681-688.
Hartig-P-R. (1991) Molecular cloning and characterization of a high affinity dopamine receptor (DI beta) And its pseudogene. J-Biol-Chem. 266, 22427-22435. Xie, G.-X., Miyajima, A., and Goldstein, A. (1992) Expression cloning of cDNA encoding a seven-helix receptor from human placenta with affinity for opioid ligands. Proc. Natl. Acad. Sci. U.S.A. 89, 4124, 4128.
Yamada, Y., Post, S.R., Wang, K., Tager, H.S., Bell, G.I., Seino, S., (1992a) Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract and kidney. Proc. Natl. Acad. Sci. U.S.A. 89, 251- 255. Yamada, Y., Reisine, T., Law, S.F., Ihara, Y., Kubota, A., Kagimoto, S., Seino, M., Seino, Y. Bell, G.I., Seino, S., (1992b) Samatostatin receptors, and expanding gene family: Cloning and functional characterization of human SSTR3, a protein coupled to a adenylyl cyclase. Mol. Endocrin. 6, 2136-2142. Young, D., Waitches, G., Birchmeier, C, Fasano, O., and Wigler, M. (1986) Isolation and characterization of a new cellular oncogene encoding a protein with multiple transmembrane domains. Cell 45, 711-719.
Zhou, Q.-Y., Grandy, D.K., Thambi, L., Kushner, J.A., Van Tol, H.H.M., Cone, R., Pribnow, D., Salon, J., Bunzow, J.R., Civelli, O. (1990) Cloning and expression of human and rat D, dopamine receptors. Nature 347, 76-80.
Birnbaumer, M., Seibold, A., Gilbert, S., Ishido, M., Barberis, C, Antaramian, A., Brabet, P., Rosenthal, W., (1992) Molecular cloning of the receptor for human antidiuretic hormone. Nature 357, 333-5.
Chhajlan, V., Wikberg, J.-E., (1992) Molecular cloning and expression of melanocycte stimulating hormone receptor cDNA. FEBS Lett. 309, 417-420.
Chi, L., Zhou, W., Prikhosan, A., Flanagan, C, Davidson, J.S., Golembo, M. Illing, N., Millar, R.P., Sealfon, S.C. (1993) Cloning and characterization of human gonadotropin- releasing hormone receptor. Mol. Cell Endrocrinol, 91, R1-R6.
Hess, J.-F., Borkowski, J.-A., Young, G.-S., Strader, C.-D., Ransom, R.-W., (1992) Cloning and pharmacological characterization of a human bradykinin (BK-2) receptor. Biochem-Biophys-Res-Commun. 184, 260-8.
Mountjoy, K.G., Robbins, L.S., Mortrud, M.T., Cone R.D., (1992) The cloning of a family of genes that encode the melanocortin receptors. Science 257, 1248-1251.
Pisegna, J.R., de-Weerth, A., Huppi, K., Wank, S.A., (1992) Molecular cloning of the human brain and gastric cholecystokinin receptor: structure, functional expression and chromosomal localization. Biochem-Biophys-Res-Commun. 189, 296-303.
Zhou, Q.Y., Grandy, D.K., Thambi, L., Kushner, J.A., Van Ton, H.H.M., Cone, R., Pribnow, D., Salon, J., Bunzow, J.R., Civelli, O., (1990) Cloning and expression of human and rat D[ dopamine receptors. Nature 347, 76-80. All of the references and publications cited herein are hereby incorporated by reference.
Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
SEQUENCE LISTING
(1) GENERAL INFORMATION: (i) APPLICANT:
(A) NAME: Cadus Pharmaceutical Corporation.
(B) STREET: Old Saw Mill River Road
(C) CITY: Tarrytown
(D) STATE: NY (E) COUNTRY: USA
(F) POSTAL CODE (ZIP) : 10591
(G) TELEPHONE: (914) 345-3344 (H) TELEFAX: (914) 345-3565 (ii) TITLE OF INVENTION: Functional Vertebrate Phospholipase C in Yeast
(iii) NUMBER OF SEQUENCES: 10 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text)
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/481,632
(B) FILING DATE: 07-JUN-1995 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 bases
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GGGCGTCTCA CATGGCCCGC TCGCTGACC 29
(2) INFORMATION FOR SEQ ID NO:2 :
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 bases (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GGGCTCGAGC TGGGTCACAG CAGGTGGATC 30 (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 bases
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GGGCGTCTCA CATGACTCTG GAGTCCATCA TG 32 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 bases
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GGGCGTCTCC TCGAGGCACG GTTAGACCAG 30 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 bases
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GGGGGTCTCC CATGACTCTG GAGTCCATGA TG 32 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 bases
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6 :
GGGCTCGAGG AAGCCTGGCC CT 22
(2) INFORMATION FOR SEQ ID NO:7 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 bases
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
CATGGCTGGT GCTCAACCAG GTG 23 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 bases
(B) TYPE: nucleic acid (C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: TGCACACCTG GTTGAGCACC AGC 23
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 65 bases (B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CATGTCTTTG TTGAACCCAG TTTTGTTGCC ACCAAAGGTT AAGGCTTACT TGTCTCAAGG 60 TGAGC 65
(2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 61 bases
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
GCTCACCTTG AGACAAGTAA GCCTTAACCT TTGGTGGCAA CAAAACTGGG TTCAACAAAG 60 A 61

Claims

We Claim:
1. A yeast cell comprising a heterologous gene encoding a heterolgous phospholipase C, which heterologous phospholipase C is expressed by the cell and functionally integrated into a signal pathway of the cell.
2. The cell of claim 1, wherein the heterologous phospholipase C complements a loss- of-function mutation of an endogenous phospholipase gene of the cell.
3. The cell of any of claims 2 or 30, wherein the loss-of-function mutation is plcl A.
4. The cell of any of claims 1 or 29, wherein the heterologous phospholipase C is a phospholipase selected from the group consisting of PLCα's, PLCβ's, PLCδ's and PLCγ's.
5. The cell of claim 1, wherein the heterologous phospholipase C is a phospholipase whose activity can be modulated by a heterotrimeric G protein or one or more subunits thereof.
6. The cell of claim 1, wherein the heterologous phospholipase C is a phospholipase selected from the group consisting of PLCβl, PLCβ2, PLCβ3 and PLCβ4.
7. The cell of any of claims 2 or 29, wherein the heterologous phospholipase C is a mammalian phospholipase.
8. The cell of claim 7, wherein the heterologous phospholipase C is a human phospholipase.
9. The cell of any of claims 1, 27 or 29, which cell further comprises a heterologous gene encoding a regulatory protein, which regulatory protein modulates the activity of the heterologous phospholipase C.
10. A cell of claim 9, wherein the regulatory protein is selected from the group consisting of: profilin, cofilin, gelsolin, α actinin, a G-protein and a G protein subunit or complexes thereof.
11. The cell of claim 10, wherein the regulatory protein is a Gα or Gβγ.
12. The cell of any of claims 1 or 31, which cell further comprises a heterologous gene encoding a heterologous receptor which is capable transducing signals via the signal pathway.
13. The cell of claim 12, wherein the receptor is a G-protein coupled receptor capable of transducing a signal to the heterologous phospholipase.
14. The cell of claim 13, wherein the G-protein coupled receptor is selected from the group consisting of: a chemoattractant peptide receptor, a cytokine receptor, a neuropeptide receptor, a light receptor, a neurotransmitter receptor, a cyclic AMP receptor, and a polypeptide hormone receptor.
15. The cell of claim 14, wherein the receptor is selected from the group consisting of: an α lA-adrenergic receptor, an αlB-adrenergic receptor, an αlC-adrenergic receptor, an
M] ACh receptor, an M3 ACh receptor, an M5 ACh receptor, a D2 dopamine receptor, a D3 dopamine receptor, an Al adenosine receptor, a 5HTl-like receptor, a 5HT Id-like receptor, a 5HTld beta receptor, a substance K (neurokinin A) receptor, a f-Met-Leu- Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a growth hormone-releasing hormone (GHRH) receptor, a vasoactive intestinal peptide receptor, an oxytocin receptor, a SST3 receptor, an Lutinizing hormone/chorionic gonadotropin (LH/CG) receptor, a thromboxane A2 receptor, a platelet-activating factor (PAF) receptor, a C5a anaphylatoxin receptor, an Interleukin 8 (IL-8), IL-8A receptor, an IL-8B receptor, a mip-1 /RANTES receptor, a metabotropic glutamate mGlul-5 receptor, an ATP receptor, an amyloid protein precursor receptor, a bradykinin receptor, a gonadotropin-releasing hormone receptor, a cholecystokinin receptor, an antidiuretic hormone receptor, an adrenocorticotropic hormone II receptor, LTB4 receptor, LTD4 receptor, tachykinin receptor, thyrotropin releasing hormone receptor, vasopressin receptor and oxytocin receptor.
16. The cell of claim 12, wherein the receptor protein is a receptor tyrosine kinase.
17. The cell of any of claims 1 or 31, wherein the signal pathway modulates gene expression.
18. The cell of any of claims 1 or 31, which cell further comprises a reporter gene construct containing a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal pathway, expression of the reporter gene providing the detectable signal.
19. The cell of claim 18, wherein the reporter gene encodes a gene product that gives rise to a detectable signal selected from the group consisting of: color, fluorescence, luminescence, cell viability relief of a cell nutritional requirement, cell growth, and drug resistance.
20. The cell of claim 19, wherein the reporter gene encodes a gene product selected from the group consisting of chloramphenicol acetyl transferase, β-galactosidase, alkaline phosphatase, β-lactamase, luciferase and green fluorescent protein.
21. The cellof claim 19, wherein the reporter gene encodes a gene product which confers a growth advantage.
22. The cell of claim 19, wherein the reporter gene encodes a gene product which confers on the cell the ability to grow in media containing canavanine or a similar selective agent.
23. The cell of any of claims 1 or 31, wherein the signal pathway modulates calcium mobilization.
24. The cell of any of claims 1 or 31, wherein the signal pathway modulates PKC activity.
25. The cell of any of claims 1 or 31, wherein the signal pathway modulates temperature sensitivity of growth of the cell.
26. The cell of any of claims 1 or 29, wherein the heterologous phospholipase C is constutitively activated.
27. A yeast cell comprising a first heterologous gene encoding a mammalian β-type phospholipase C, which phospholipase C is expressed by the cell and is capable of hydrolyzing phosphatidylinositol 4,5-bisphosphate.
28. The cell of claim 27, wherein the phospholipase C is selected from the group consisting of PLCβl, PLCβ2, PLCβ3 and PLCβ4.
29. A yeast cell comprising: i) a phospholipase gene having a mutation thereto which confers a first detectable phenotype on the cell; and ii) a first heterologous gene encoding a polypeptide having a phospholipase C activity, which heterologous phospholipase C activity modulates the mutation and confers a second detectable phenotype on the cell.
30. The cell of claim 29, wherein the mutation is a loss-of-function mutation, and the heterologous phospholipase C complements the loss-of-function.
31. The cell of claim 29, wherein the heterologous phospholipase C activity is functionally integrated in a signal pathway of the cell.
32. The cell of claim 29, wherein the first detectable phenotype is selected from the group consisting of temperature sensitive growth and NaCl-sensitivity.
33. The cell of any of claims 1, 27 or 29, which cell is a Saccharomyces cell.
34. A variegated culture comprising the cells of any of claims 1, 27 or 29, wherein the cells further comprise an expressible recombinant gene encoding a heterologous test polypeptide, and a mixture of the cells in the culture collectively express a variegated population of test polypeptides.
35. An assay for identifying a modulator of a phospholipase C activity, comprising the steps of: i) contacting the cell of claim 1 with a test compound under conditions appropriate for detecting an intracellular signal transduced via the signal pathway; and ii) measuring a level of signal transduced by the signal pathway in the presence of the test compound, wherein a statistically significant difference in the level of signal in the presence of the test compound, relative to the absence of test compound, indicates that the test compound is a modulator of the heterologous phospholipase C activity.
36. The assay of claim 35, wherein the intracellular signal is detected by expression of a reporter gene operably linked to transcriptional regulatory elements sensitive to the signal pathway.
37. The assay of claim 35, wherein the intracellular signal is detected by measuring products of the hydrolysis of phosphatidylinositol 4,5-bisphosphate.
38. The assay of claim 35, wherein the intracellular signal is detected by measuring one or more of the degree of Ca2+ mobilization and the activation of a protein kinase.
39. The assay of claim 35, wherein the intracellular signal is detected by measuring a change in growth.
40. An assay for identifying a modulator of a phospholipase C activity, comprising the steps of: i) contacting the cell of claim 29 with a test compound under conditions appropriate for detecting one or both of the first and second phenotypes; ii) measuring the level or degree of the first and/or second phenotype in the presence of the test compound; and iii) comparing the measurement of step ii) with a similar measurement in the absence of the test compound or the absence of the heterologous phospholipase C, wherein a statistically significant change in the measured phenotype in the presence of the test compound, relative to the absence of test compound or phospholipase C, indicates that the test compound is a modulator of the heterologous phospholipase C activity.
41. An assay for identifying a modulator of a phospholipase C activity, comprising the steps of: i) contacting the cell of claim 18 with a test compound under conditions appropriate for expresion of the reporter gene; ii) detecting expression of the reporter gene in the presence of the test compound; and iii) comparing the level of reporter gene expression in the presence of the test compound to the level of reporter gene expression in the absence of the test compound or the absence of the heterologous phospholipase C, wherein a statistically significant difference in the level of reporter gene expression in the presence of the test compound, relative to the absence of test compound or phospholipase C, indicates that the test compound is a modulator of the heterologous phospholipase C activity.
42. A differential screening assay for identifying an agent which selectively inhibits a non-mammalian phospholipase C, comprising the steps of: i) providing a first yeast cell containing a non-mammalian phospholipase C gene; ii) providing a second yeast cell expressing a mammalian phospholipase C gene; iii) contacting each of the first and second yeast cells with a test compound; iv) detecting or quantitating the activity of the phospholipases of the first and second cell in the presence of the test compound, wherein, a statistically greater decrease in the phospholipase activity of the first cell, relative to the second cell, indicates that the test compound selectively inhibits the non-mammalian phospholipase C.
43. The assay of claim 42, wherein the phospholipase C of the first yeast cell is a vertebrate phospholipase C, and the phospholipase C of the second yeast cell is a phospholipase C from a pathogen of the vertebrate.
44. The assay of claim 43, wherein the vertebrate is a human.
45. The assay of claim 43, wherein the human pathogen is selected from the group consisting of a fungus, virus, bacteria and protozoan.
46. The assay of claim 43, wherein the human pathogen is human fungal pathogen.
47. The assay of any of claims 35, 40, 41 or 42, wherein the assay is repeated for a library of at least 100 different test compounds.
48. The assay of any of claims 35, 40, 41 or 42, wherein the test compound is selected from the group consisting of small organic molecules, and natural product extracts.
49. A collection of at least two different yeast cells, each cell comprising a gene encoding a different phospholipase
50. The collection of claim 49, wherein each different yeast cell encodes a different isotypes of phospholipase obtained from the same organism or the same or different isotype obtained from different organisms.
PCT/US1996/010002 1995-06-07 1996-06-07 Expression of functional vertebrate phospholipases in yeast WO1996040939A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP50214497A JP2001507201A (en) 1995-06-07 1996-06-07 Expression of functional vertebrate phospholipase in yeast
EP96918448A EP0832248A2 (en) 1995-06-07 1996-06-07 Expression of functional vertebrate phospholipases in yeast
AU61108/96A AU6110896A (en) 1995-06-07 1996-06-07 Expression of functional vertebrate phospholipases in yeast

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US48163295A 1995-06-07 1995-06-07
US08/481,632 1995-06-07

Publications (2)

Publication Number Publication Date
WO1996040939A2 true WO1996040939A2 (en) 1996-12-19
WO1996040939A3 WO1996040939A3 (en) 1997-01-23

Family

ID=23912754

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/010002 WO1996040939A2 (en) 1995-06-07 1996-06-07 Expression of functional vertebrate phospholipases in yeast

Country Status (5)

Country Link
EP (1) EP0832248A2 (en)
JP (1) JP2001507201A (en)
AU (1) AU6110896A (en)
CA (1) CA2220459A1 (en)
WO (1) WO1996040939A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998055654A2 (en) * 1997-06-06 1998-12-10 University Of Iowa Research Foundation CANDIDA ALBICANS TWO-COMPONENT HYBRID KINASE GENE, CaNik1, AND USE THEREOF
JP2003180386A (en) * 2000-02-08 2003-07-02 Sanagamo Biosciences Inc Cell for drug discovery
CN111004787A (en) * 2020-01-06 2020-04-14 江南大学 Streptomyces phospholipase D mutant, transformation method and application thereof
WO2020076697A1 (en) * 2018-10-08 2020-04-16 Novozymes A/S Enzyme-expressing yeast for ethanol production
CN114525266A (en) * 2022-02-22 2022-05-24 华南理工大学 Phospholipase D mutant from Antarctic bacteria and application thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114891765B (en) * 2019-11-21 2023-12-19 天津科技大学 Phospholipase and application thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992005244A1 (en) * 1990-09-13 1992-04-02 Duke University Expression of g protein coupled receptors in yeast
DE4138621A1 (en) * 1991-11-25 1993-06-17 Boehringer Ingelheim Int METHOD FOR SCREENING SUBSTANCES WITH MODULATING EFFECT ON A RECEPTACLE-RELATED CELLULAR SIGNAL TRANSMISSION PATH
WO1994023025A1 (en) * 1993-03-31 1994-10-13 Cadus Pharmaceuticals, Inc. Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
WO1995008624A1 (en) * 1993-09-24 1995-03-30 Shionogi & Co., Ltd. HUMAN PHOSPHOLIPASE C-α AND DNA SEQUENCE CODING FOR THE SAME
WO1995021925A1 (en) * 1994-02-14 1995-08-17 American Cyanamid Company Heterologous g protein coupled receptors expressed in yeast, their fusion with g proteins and use thereof in bioassay
WO1995030012A1 (en) * 1994-04-26 1995-11-09 Cadus Pharmaceutical Corporation Functional expression of mammalian adenylyl cyclase in yeast

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992005244A1 (en) * 1990-09-13 1992-04-02 Duke University Expression of g protein coupled receptors in yeast
DE4138621A1 (en) * 1991-11-25 1993-06-17 Boehringer Ingelheim Int METHOD FOR SCREENING SUBSTANCES WITH MODULATING EFFECT ON A RECEPTACLE-RELATED CELLULAR SIGNAL TRANSMISSION PATH
WO1994023025A1 (en) * 1993-03-31 1994-10-13 Cadus Pharmaceuticals, Inc. Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
WO1995008624A1 (en) * 1993-09-24 1995-03-30 Shionogi & Co., Ltd. HUMAN PHOSPHOLIPASE C-α AND DNA SEQUENCE CODING FOR THE SAME
WO1995021925A1 (en) * 1994-02-14 1995-08-17 American Cyanamid Company Heterologous g protein coupled receptors expressed in yeast, their fusion with g proteins and use thereof in bioassay
WO1995030012A1 (en) * 1994-04-26 1995-11-09 Cadus Pharmaceutical Corporation Functional expression of mammalian adenylyl cyclase in yeast

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BIOCHIMICA AND BIOPHYSICA ACTA, vol. 1092, 1991, pages 49-71, XP000611209 MELDRUM, E. ET AL.: "The PtdIns-PLC Superfamily and Signal Transduction" cited in the application *
FEBS LETTERS, vol. 364, May 1995, pages 45-50, XP002018653 ARKINSTALL, S. ET AL.: "Mapping Regions of Galphaq Interacting with PLCbeta1 Using Multiple Overlapping Synthetic Peptides" *
FEBS LETTERS, vol. 375, November 1995, pages 183-187, XP002018654 ARKINSTALL, S. ET AL.: "Co-Expression of the Neurokinin NK2 Receptor and G-Protein Components in the Fission Yeast Schizosaccharomyces pombe" *
MOLECULAR AND CELLULAR BIOLOGY, vol. 13, no. 9, September 1993, pages 5861-5876, XP000609195 FLICK, J. S. AND THORNER, J.: "Genetic and Biochemical Characterization of a Phosphatidylinositol-Specific Phospholipase C in Saccharomyces cerevisiae" cited in the application *
MOLECULAR AND CELLULAR BIOLOGY, vol. 15, no. 3, March 1995, pages 1431-1438, XP000609196 ARKINSTALL, S. ET AL.: "Activation of Phospholipase Cgamma in Schizosaccharomyces pombe by Coexpression of Receptor or Nonreceptor Tyrosine Kinase" cited in the application *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 90, March 1993, pages 1804-1808, XP002018652 YOKO-O, T. ET AL.: "The Putative Phosphoinositide-Specific Phospholipase C Gene, PLC1, of the Yeast Saccharomyces cerevisiae is important for Cell Growth" cited in the application *
TCM, vol. 4, no. 2, 1994, pages 88-95, XP000611204 BOYER, J. ET AL.: "G-Protein-Mediated Regulation of Phospholipase C - In volvement of beta / gamma Subunits" *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998055654A2 (en) * 1997-06-06 1998-12-10 University Of Iowa Research Foundation CANDIDA ALBICANS TWO-COMPONENT HYBRID KINASE GENE, CaNik1, AND USE THEREOF
WO1998055654A3 (en) * 1997-06-06 1999-03-04 Univ Iowa Res Found Candida albicans two-component hybrid kinase gene, canik1, and use thereof
US6803191B2 (en) 1997-06-06 2004-10-12 University Of Iowa Research Foundation Candida albicans two-component hybrid kinase gene, CaNik1, and use thereof
JP2003180386A (en) * 2000-02-08 2003-07-02 Sanagamo Biosciences Inc Cell for drug discovery
JP2011147448A (en) * 2000-02-08 2011-08-04 Sanagamo Biosciences Inc Cell for drug discovery
WO2020076697A1 (en) * 2018-10-08 2020-04-16 Novozymes A/S Enzyme-expressing yeast for ethanol production
CN113286889A (en) * 2018-10-08 2021-08-20 诺维信公司 Enzyme-expressing yeast for producing ethanol
US11807889B2 (en) 2018-10-08 2023-11-07 Novozymes A/S Yeast expressing a heterologous phospholipase for ethanol production
CN111004787A (en) * 2020-01-06 2020-04-14 江南大学 Streptomyces phospholipase D mutant, transformation method and application thereof
CN111004787B (en) * 2020-01-06 2022-05-10 江南大学 Streptomyces phospholipase D mutant, transformation method and application thereof
CN114525266A (en) * 2022-02-22 2022-05-24 华南理工大学 Phospholipase D mutant from Antarctic bacteria and application thereof
CN114525266B (en) * 2022-02-22 2023-06-20 华南理工大学 Phospholipase D mutant from Antarctic bacteria and application thereof

Also Published As

Publication number Publication date
CA2220459A1 (en) 1996-12-19
WO1996040939A3 (en) 1997-01-23
JP2001507201A (en) 2001-06-05
AU6110896A (en) 1996-12-30
EP0832248A2 (en) 1998-04-01

Similar Documents

Publication Publication Date Title
CA2266543C (en) Methods and compositions for identifying receptor effectors
CA2188950C (en) Functional expression of mammalian adenylyl cyclase in yeast
Ghislain et al. Cdc48p interacts with Ufd3p, a WD repeat protein required for ubiquitin‐mediated proteolysis in Saccharomyces cerevisiae.
Yan et al. Two novel transcriptional regulators are essential for infection-related morphogenesis and pathogenicity of the rice blast fungus Magnaporthe oryzae
AU685103B2 (en) Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor
US7319009B2 (en) Methods and compositions for identifying receptor effectors
JP2009143932A (en) Yeast cells expressing modified g protein and method of use thereof
Fischer et al. Regulation of cell-to-cell communication and cell wall integrity by a network of MAP kinase pathways and transcription factors in Neurospora crassa
US20080268475A1 (en) Yeast cells expressing modified g proteins and methods of use therefor
Noble et al. Development of a yeast bioassay to characterize G protein-coupled receptor kinases: Identification of an NH2-terminal region essential for receptor phosphorylation
Mayrhofer et al. Functional characterization of an α-factor-like Sordaria macrospora peptide pheromone and analysis of its interaction with its cognate receptor in Saccharomyces cerevisiae
EP0832248A2 (en) Expression of functional vertebrate phospholipases in yeast
US7273747B2 (en) Cell having amplified signal transduction pathway responses and uses therefor
US20030009022A1 (en) Methods and compositions for identifying receptor effectors
Fischer et al. A network of MAP-Kinase pathways and transcription factors regulates cell-to-cell communication and cell wall integrity in Neurospora crassa
Yerra Relationship Between Morphogenesis and Secretion in the Filamentous Fungus Aspergillus Nidulans
MXPA05000837A (en) Method for identifying substances.
Weng Characterization of the Saccharomyces cerevisiae gene KAP104: Its role in G (alpha)-mediated adaptation
Pateman RGS proteins and G protein signalling
Zhou Isolation and characterization of G (alpha) mutations that uncouple G (beta-gamma) binding from adaptive function in yeast
AU7169600A (en) Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA

AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2220459

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2220459

Country of ref document: CA

ENP Entry into the national phase in:

Ref country code: JP

Ref document number: 1997 502144

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1996918448

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1996918448

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1996918448

Country of ref document: EP