CA2220459A1 - Expression of functional vertebrate phospholipases in yeast - Google Patents

Abstract

Yeast cells comprising a heterologous phospholipase C protein and methods for their use in drug screening assays to identify a modulator (i.e. agonist or antagonist) of a phospholipase C are described.

Description

CA 022204~9 1997-11-27 W O ~C/10939 PCTnJS96/10002 Expression of Functional Verfebrate Phospholipases in Yeasf ~ Cross Refèrence to R~ t~Applications This invention is a Continnzttion-in Part of U.S.S.N 08/431,632, filed on June 7, 1995.

Field of the Invention This invention relates to functional expression of heterologous phospholipases in yeast, the recombinant yeast cells, and methods for using the engineered cells, including, inter alia, the identification of agonists and antagonists of signal transduction pathways which involve phospholipases.

~ackground of the Invention Eukaryotic phospholipases are known to be involved in cellular signal tr~n~cluction processes important in regulation of cellular growth, dirrel~;llliation and secretory events in numerous cell types. The binding of agonists to certain cell surface receptors leads to the generation of a variety of sign~lin~ molecules which include phospholipid derived second messengers. The phospholipid-derived second messengers mediate both transient and sust~in~cl responses and are implicated in a wide variety of physiological responses including growth regulation, immnn~ modulation and neulo~ mi~ion. Studies over the last two decades indicate that membrane lipids serve as substrates for the variety of different phospholipases that are responsible for the generation of phospholipid derived second messengers. These include phosphatidylinositols (the substrate for phospholipase C
enzymes, see below), phosphatidylcholine, phosphatidylethanolamine, sphingolipids (e.g.
sphingomyelin, sphingosine, sphingosine phosphate and sphingosine phosphocholine). See Dicheva and Irvine (1995) Cell 80:269-278 for a recent review.
There are at least five distinct types of phospholipase activities known to be responsible for the generation of phospholipid second messengers, namely phospholipase A
(including phospholipases Al and A2), phospholipase B, phospholipase C, phospholipase D
and sphingomyelinase. The distinguishing feature of each of these phospholipases is the substrate bond cleaved, and hence the second mec~l-ngers derived from a given phospholipid -~ substrate.
PLAl and PLA2 (E.C.3.1.1.4) catalyze the release of fatty acids, in particular 35 arachidonic acid (AA), from the snl and sn2 positions of 1,2-diacylglycerol, 3-phosphocholines, generating AA and lysophosphorylcholine (lyso-PC) respectively. AA, in CA 022204~9 1997-11-27 turn, has at least four known metabolic fates, namely, generation of proinfl~mm~tf-ry eicosanoids (leukotrienes and prost~ n~1in~), reincorporation into existing membrane phospholipids, reincorporation into soluble phospholipid metabolic pathways, and direct secretion from cells. In addition, lyso-PC serves as the precursor for the production of lipid 5 second messengers like platelet activating factor (PAF). cDNA and genomic clones encoding the pancreatic form of PLA2 have been isolated from a variety of eukaryotic sources including bovine (Tanaka et al. 1987), rat (Ohara, O. et al. 1986 and 1990, and Kusunoki, et al. 1990), dog (Kerfelec et al. 1986),and pig (Seilhamer et al. 1986). In addition to the pancreatic PLA2 isofor~n, a variety of cellular PLA2 (cPLA2) isoforms have been isolated 10 from a wide variety of m~mm~ n tissues and cell tvpes including brain (Gray and Strickland, 1982), liver (DeWinter et al. 1982), spleen (Terarnoto et al. 1983), macrophages (Trotter and Smith (1986) Neurochem. Res. 11:349-361), leukocytes (Traynor and Authi 1981), and others (for a review see Ban Den Bosch, 1980). Clones for human (Clark et al.
1991; Sharp et al 1991) and murine (Clark et al. 1991) cPLA2 gene products have been 15 isolated and characterized. The 85kDa gene product encoded by these cDNAs is expressed in cells types involved in the infl~mm~ ry response (neutrophils, platelets, monocytes and macrophages) and its expression is regulated by, for example, tumor necrosis factor, IL-l, TGF-,B, MCSF and glucocorticoids.
Phospholipase B (PLB) has been described in a variety of eukaryotic species from20 fungi to m~mm~ls. PLB isoforms have several catalytic properties including the release of fatty acids from the snl and sn2 positions of phospholipids (as with PLAl and PLA2), the release of fatty acids from lysopholipids, and in the yeast Saccharomyces cerevisiae, acyltransferase activity that catalyzes the synthesis of phospholipids from lysophospholipids (Kuwabara et al. 1989; G~ m~-Diagne 1989; and Lee et al. 1994). Genomic clones for 25 PLB-like enzymes have been isolated from several sources including S. cerevisiae (Lee et al.
1994) and Penicillium notatum (Masuda et al. 1991).
Phospholipase C enzymes (PLC; E.C. 3.1.4.3), of which there are at least four subfamilies known as PLC-a, -~ , and -~ (For reviews, see F~hee et al. 1989, and Cook and Wakelam 1992b) catalyze the hydrolysis of phosphatidylinositol (4,5) bisphosphate (PIP2) to 30 form two second messengers, inositol 1,4,5-trisphosphate (IP3) which is involved in the mobilization of intracellular stores of calcium, and diacylglycerol ~DAG), which binds to and activates selected isoforms of protein kinase C (PKC, E.C. 2.7.1.37). This class of enzymes, and second messengers generated by them have been demonslrated to be linked to receptor tyrosine kin~e~, G-protein coupled receptors and to MIRRs like the T-cell antigen receptor, 35 the B-cell antigen receptor and immunoglobulin Fc receptors -CA 022204~9 1997-11-27 W O 96/40939 PCT~US96/10002 Phospholipase D (PLD; E.C. 3.1.4.4) catalyzes the hydrolysis of phosphatidylcholines to yield phosphatidic acid (PA) and free choline (see Bishop, Pachter and Pai 1992; and Cook and W~kel~m, 1992a). While neither PA nor free choline has been shown to function as a second messenger directly, it has been reported recently that PA or its lyso derivative, lyso-5 PA, may function to stimulate hydrolysis of polyphosphoinositides, activation of PKC,inhibition of adenylyl cyclase and stimulation of DNA synthesis (Moolenaar et al, 1986;
Murayama and Ui, 1987, Van Corven et al, 1989; and Plevin et al, l991b. refs in Cook and Wakelam, 1992b), as well as activate kinases directly in a manner similar to DAG (Eppand and Stafford, 1990, and Bocckina and Exton, 1990, refs in Cook and Wakelarn, 1992b). In 10 addition, phosphatidic acid formed by the action of PLD can be converted to DAG by the action of phosphatidic acid phosphohydrolase (E.C. 3.1.3.4), and thus serve as a secondary reservoir for the production of DAG by PLC-independent mech~ni~ms (Bonser et al, 1989 cited in Divechia and Irvine 1995, review, and Cook and Wakelam, 1992b). cDNA clones for phospholipase D have been isolated from a number of different species including 15 Arcanobacterium haemolyticum (Cuevas, W.A., and J.G.L. Songer, 1993), Corynebacterium pseudotuberculosis (unpublished, GenBank Accession numbers L16586, L16587), Vibrio damsela (unpu~lished, GenBank Accession number L16584) and human (Tsang et al. 1993) Phospholipase C enzymes Phospholipase C enzymes (PLC; E.C. 3.1.4.3) are intracellular enzymatic mediators of a wide variety of cellular responses to extracellular stimuli. Binding of hormones, growth factors, neurotransmitters, and other agonists to specific cell surface receptors initiates the activation of PLC isozymes, which in turn result in the production of at least two well characterized active second messengers, inositol-1,4,5-trisphophate (1,4,5-IP3) and sn-1,2-diacylglycerol (DAG). 1,4,5-IP3 binds to a specific family of intracellular receptors localized on modified portions of the endoplasmic reticulum that bears homology to the ryanodine receptor family of intracellular calcium channels (the IP3 receptor family, reviewed in Berridge, 1993). In addition to functioning as the IP3 receptor, these receptors also function as IP3-sensitive calcium channels which cause release of intracellular stores of calciurn upon liganding with IP3.
Increases in intracellular calcium, in turn, result in the transient or sustained activation of a variety of cellular signaling pathways which include but are not limited to activation of protein kinase C (PKC) isoforms, transcriptional activation through the Mitogen Activated Protein Kinase (MAPK) and Jun Kinase (JNK) pathways, and mitogenesis. DAG, on the other hand, forms a complex with phosphatidylserine and calcium and activates protein kinase C (PKC) isozymes, which in turn activate signaling pathways by direct CA 022204~9 Iss7-ll-27 W 096/40939 PCT~US96/10002 phosphorylation of a variety of substrates which include adenylyl cyclases and RAF-l (P.J.
Parker et al, 1986, Coussens et al. 1986a, and Kolch et al. 1993).
The division of PLCs into four classes, a, ,B, ~, ~, originally corresponded to immunologically distinct proteins of 56 kDa, 150 kDa, 145 kDa, and 85 kDa purified from 5 bovine brain (PLC-~ , and -~) and other tissues including liver, seminal vesicles or uterus (PLC-a). (Described in Suh et al. 1986; and sllmm~ri7ed in A.J. Morris et al 1990). All of these enzymes have similar catalytic properties in that they hydrolyze phosphatidyl inositol (PI), phosphatidyl inositol 4-monophosphate (PIP) and phosphatidyl inositol-4,5,bisphosphate (PIP2) in a calcium dependent manner, but not phosphatidylcholine, 10 phosphatidylserine or phosphatidylethanolamine. However, these immunologically distinct isozymes are distinguishable in several regards, not the least of which is that they are all unique gene products encoded by different genes, as discussed in further detail below. At the enzymatic level, these enzymes differ with respect to both their catalytic properties and their modes of regulation. With respect to divalent cation requirements for activity, for 15 exarnple, polyphosphoinositides are the ~ler~ d substrates for the PLC-,B and -~ classes at low or physiological intracellular calcium concentrations, while PLC-~ isozymes prefer PI
and PIP2 at physiological intracellular calcium concentrations. The modes of regulation of PLC isozymes also differ considerably with respect to one another. The PLC-~ isozymes are activated in response to ligand binding to G-protein coupled receptors and are directly 20 stimulated by Ga and G13~ components of h~ tlillleric G-proteins. PLC-~ isozymes, on the other hand, are activated directly by phosphorylation via receptor and non-receptor tyrosine kinases. While little is known about the regulation of PLC-a activity in vivo or in viko, recent studies of PLC-~ regulation suggest that it may be regulated by a novel class of regulatory proteins (pl22-RhoGAP) that show similarity to the GTPase activating protein 25 homology region of bcr, display GAP activity towards RhoA, and bind to and directly stimulate PLC-~l (Homma, Y., and Y. Emori, 1995).

Cloning of PLC isozymes Molecular cloning studies have resulted in the identification of at least ten genes 30 encoding distinct PLC isozymes. Several PLC-a cDNA clones have been isolated from a variety of sources including rat basophilic leukemia cells (Bennett et al. 1988), mouse lymphocytes (Hempel and DeFranco, 1991), and bovine tissue (Hirano et al, GenBank Accession number D16235). Four PLC-,(3 encoding cDNAs encoding subtypes -,B1-4 (Suh et al 1988; Bahk et al. 1994; Park et al. 1992; Lee et al. 1993; and Kim et al. 1993) have been 35 reported. Two PLC-~ encoding cDNAs have been reported, which correspond to PLC-7rl and -~2 subtypes (Emori et al. 1989; Suh, et al~ 1988; and Burgess et al. 1990). Three PLC-~

CA 022204~9 1997-11-27 encoding cDNAs encoding subtypes PLC-~1-3 have been published (reviewed in Cook and Wakelam, 1 992b and Boyer et al, 1994).

Sequence Comparisons of PLCs S The overall primary structural identity between PLC-,B isoforms is quite low (~ 30%
identity), in part explaining the differences in size among the (lirrele~lL isozymes and the lack of immunological cross-reactivity observed with antisera and monoclonal antibodies developed against the various purified isozymes. PLC-,B, -y,and -~ isozymes share considerable sequence homology, however, in two regions, variously referred to as the X and Y regions (Rhee et al, 1989) or regions I and II (Meldrum, et al. 1991). The X region is approximately 150 amino acid residues in length, while the Y region is approximately 260 residues in length. Between classes, the X regions share approximately 50% identity, while the Y regions share approximately 40% identity in pairwise comparisons amongst PLC-~
and -~ isozymes. Based on the high degree of conservation of these two domains among the PLC-~, -y,and -â isozymes, it has been argued that these regions contribute to the catalytic activity of these enzymes. An additional feature of the spacer region between the X and Y
regions is that in PLC-~3, and -~ classes, these regions are separated by 50-100 residues rich in serine, threonine and acidic residues with no particular homology to known regulatory motifs, while in the PLC-y class the X and Y regions are separated by more than 400 residues. This region of the PLC-y isoforms encodes two src homology 2 (SH2) domains and one src homology 3 (SH3) domain, which are not present in either PLC-,B or -~ enzymes. As discussed below, the SH2 domains are involved in regulation of PLC-y activation by receptor and non-receptor tyrosine kinases.
Sequence analysis of the PLC-a cDNA clones from a rat basophilic leukemia cell line reveals considerable sequence divergence of this class of phospholipase C isozymes from the PLC-,~, -y,and -~ isozymes. PLC-a encodes neither the highly conserved X or Y regions found in all other PLC isoforrns nor SH2 or SH3 domains found in PLC-y isoforms.
Yeast PLC
In addition to the m~mm~ n PLC-,B isoforms discussed in the preceding sections, various PLCs have been isolated from several other or~ni~m~ Of considerable importance in this regard is the molecular cloning of the gene (PLCl ) encoding a protein with homology to the PLC class of phospholipases from the yeast Saccharomyces cerevisiae (Yoko-O et al.
1993; Payne and Fitzgerald-Hayes, 1993; and Flick and Thorner, 1993). Sequence analysis of the independently identified clones reveals first that all three clones are from the same CA 022204~9 1997-11-27 WO 9~'10339 PCT~US96/10002 genetic locus and that the protein coded for by this gene most resembles m~mm~ n PLC-~
isozymes both with respect to size of the enzyme encoded by it and with respect to structural features such as the relative distance between the X and Y domains, the size of the carboxyl t~rmin~l extension beyond the Y domain, and the absence of SH2 and SH3 domains between the X and Y motifs (t-his last point is to be expected as yeast show no evidence of phosphotyrosine modifcation by biochemical analyses). Flick and Thorner (1993) o~ ssed and purified this enzyme from yeast and demonstrated an associated phospholipase C activity with divalent cation requirement and substrate ~lef~ ces that resemble those of m~mm~ n PLC-~ isozymes. Finally, genetic analysis of S. cerevisiae 10 strains with deletions at the PLCl locus (plcl~) reveal a variety of conditionally lethal phenotypes associated with the plcl ~ genotype, such as, sensitivity to high osmolarity, poor growth on carbon sources other than glucose (i.e. galactose, raffinose, glycerol/ethanol), temperature sensitive growth at elevated t~ p~ldllres (>35~C) and finally, chromosome missegregation (~lick and Thorner, 1993, and Payne and Fitzgerald-Hayes, 1993).

Expression of Foreign Proteins in Yeast Cells A wide variety of foreign proteins have been produced in S. cerevisiae, that remain in the yeast cytoplasm or are directed through the yeast secretorv pathway (~ing.cm~n et al.
TIBTECH 5, 53 (1987). These proteins include, as examples, insulin-like growth factor 20 receptor (Steube et al. Eur. J. Biochem. 198, 651 (1991), influenza virus hem~gglutinin (Jabbar et al. Proc. Natl. Acad. Sci. 82, 2019 (1985), rat liver cytochrome P-450 (Oeda et al.
DNA 4, 203 (1985) and functional m~mm~ n antibodies (Wood et al. Nature 314, 446(1985). Use of the yeast secretory pathway is ~l~r~ d since it increases the likelihood of achieving faithful folding, glycosylation and stability of the foreign protein. Thus, expression 25 of heterologous proteins in yeast often involves fusion of the signal sequences encoded in the genes of yeast secretory proteins (e.g., a-factor pheromone or the SUC2 [invertase] gene) to the coding region of foreign protein genes.
A number of yeast ~ples~ion vectors have been designed to permit the constitutive or regulated expression of foreign proteins. Constitutive promoters are derived from highly 30 expressed genes such as those encoding glycolytic enzymes like phosphoglycerate kinase (PGKl) or alcohol dehydrogenase I (ADHl) and regulatable promoters have been derived from a number of genes including the galactokinase (GAL 1) gene. In addition, supersecreting yeast mutants can be derived; these strains secrete m~mm~ n proteins more efficiently and are used as "production" strains to generate large quantities of biologically 35 active m~mm~ n proteins in yeast (Moir and Davidow, Meth. in Enzymol. 194, 491 (1991).
The following two reviews of the field are incorporated herein by reference in their entireties:

_ CA 022204~9 1997-ll-27 W 096/40939 PCT~US96/10002 "The Molecular and Cellular Biology of the Yeast. Saccharomyces, Genome dynamics, Protein Synthesis, and Energetics." 1991. Edited by J.R.Broach, John Pringle and Elizabeth Jones. Cold Spring Harbor Laboratory Press; "Guide to Yeast Genetics and Molecular Biology" 1991. Methods in Enzymology vol. 194. Edited by Christine Guthrie and Gerald R. Fink, Academic Press.
Several groups have ~Le~ ed to express phospholipases in yeasts. Yoko-o et al., ((1993) Proc. Natl. Acad. Sci. USA 90:1804) claim to achieve complementation of a yeast PLC defect with an uncoupled rat PLC~l. Yoko-o et al. report the cloning of PLC from S.
cerevisiae by PCR methodology using primers designed to incorporate sequences from two 10 conserved amino acid sequences found in the X-region of m~mm~ n PLC enzymes After cloning the gene, they proceeded to make gene disruptions at the PLCl locus. Heterozygous diploid transformant (PLCl/plcl ::HIS3) were sporulated and tetrad analyses were performed.
In the TYl background, all four spores were found to be viable at a range of temperatures including 1 8~C, 30~C, and 37~C. In the TY4 background, Yoko-o et al. observed lethality at 15 30~Cin tetrad analyses. These phenotypes are in contradiction to those described herein, and those reported by Flick and Thorner in the art, where conditional lethality at 37~C is observed. This is important because it is not possible to measure complementation of a growth defect under the nonselective conditions of the Yoko-o et al experiments. Thus, Yoko-o et al. do not observe functional integration of the rat PLC~ into the yeast cell.
Arkin~t~ll et al ((1995) Mol. Cell. Biol. 15:1431) expressed a mz~mmz~ n platelet-derived growth factor,B receptor and PLC~2 in Schizosaccharomyces pombe. Arkin~t~ll et al.
found that in cells coexpressing the mouse PDGF,B receptor and PLC~2, levels of [3H]inositol phosphates in radioactively labeled yeast cells were increased. Coexpression of c-src was also found to result in phospholipid hydrolysis. Because these experiments only 25 measure the immediate biochemical consequence of phospholipase C~ stimulation, this work also fails to teach the functional integration of a m~mm~ n PLC~ into a yeast cell.

Brief Description of the Figures Figure 1 is a graphic representation showing human phospholipases and Ga 16 30 complementation of the plcl growth defect on high salt medium: S cerevisiae strain CY1630 ~MATa plcl~l::His3 ade2-101 his3~200 leu2~1 lys2-801 trpl~l ura3-52) transformed with plasmids carrying each of the following as described in the text was streaked out in sectors 1-6: (1) Gallp-rat PLC-,~l and GPAlp-Gal6; (2) CUPl-human PLC-,32 and no G protein; (3) CUPl-human PLC-,B2 and GPAlp-Gai2-Q205L; (4) CUPl-human 35 PLC-~2 and GPAlp-GaS-Q227L; (5) CUPl-human PLC-,~2 and GPAlp-Gal6; (6) No PLC

CA 022204~9 1997-11-27 W O~6/10339 PCT~US96/10002 and GPA1-Gal6. In the figure the symbol (+) represents growth and (-) represents no growth.

Summary of the Il2vention The present invention relates to the functional expression of m~mm~ n phospholipases in yeast cells. The use of the engineered yeast cells in identifying potential inhibitors or activators of ~e m~mm~ n phospholipase, or of other proteins which belong to a phospholipase signal tr~nc~ tion pathway, i.e., proteins which are naturally or artificially "coupled" to the mslmm~ n phospholipase in the engineered yeast cell is also within the scope of the invention. The te~n "coupled" here means that inhibition or inactivation of the coupled protein results in inhibition or activation (not necessarily respectively) of the phospholipase. The term coupled is meant to include both "natural" coupling of heterologous .~ign~lin~ molecules into a yea~t signal transduction ~lhw~y and "artificial" coupling of heterologous cisrn~ling molecules into a yeast p~lllw~y in a manner not normally operative in yeast cells. Functional expression of human phospholipases is especially desirable.
In general, the yeast cells of the subject invention are characterized as in~ ing a heterologous gene encoding a heterologous phospholipase C (PLC), e.g., a polypeptide having a phospholipase C activity. In preferred embo-limentc, the PT C is a mannm~ n PLC such as a human PLC. For example, the PLC can be a phospholipase selected from the group consisting of PLCa's, PLC,B's, PLC~'s and PLCy's. Prefe~ed PLC's are of the ,13 subtype, such as PLC~ 1, PLC~2, PLC133 and PLC,134. In certain embo-limentc, theheterologous phospholipase C can be con~LuLiLiv~ly activated. This may occur by way of mutations to the PLC itself which result in a higher level of activity, relative to the wild-type protein, in the absence of cign~ling to the PLC. In other embodiments, the constitutive activation of the PLC can occur due to overexpression and/or consitutively activating mutations to upstream regulators of the PLC, such as receptors, G proteins and the like.
In certain embodiments, the recombinant cell is characterized by the ability of the heterologous PLC to hydrolyze phosphatidylinositol 4,5-bisphosphate. In other embo-lim~ntc, the yeast cell has a loss-of-function mutation to an endogenous phospholipase gene, giving it a first flet~-ct~hle phenotype, and the heterologous PLC
complements the loss-of-function mutation and confers a second cletect~hle phenotype on the cell.
In preferred embo~lim~ntc, the heterologous PLC is functionally integrated in a phospholipase-dependent signal ~dLhw~y of the cell For example, the heterlogous PLC

CA 022204~9 1997-11-27 may complement a loss-of-function mutation of an endogenous phospholipase gene of the yeast cell, e.g., the heterologous PLC may complement the plcl~ mutation. Expression of the heterologous PLC may confer a phenotype to the host cell which is ~lete~t~hly different than the phenotype of the host cell in the absence of the heterologous PLC
5 protein. For instance, compl~m~nt~tion of a loss-of-function mutation, such as the plcl~
mutation, by the heterologous PLC can rescue/overcome such phenotypes as temperature-sensitivity and/or salt sensitivity. In certain embo~im~ms, the heterolgous PLC, via a phospholipase-dependent signal pathway, can modulate such downstream effectors as calcium mobilization and/or PKC activity.
Moreover, in those embo~im~ntc wherein the phospholipase-dependent signal pathway modulates gene expression, the recombinant cell may also be ~ngineered to include a reporter gene construct cont~ining a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the phospholipase-dependent signal pathway, expression of the reporter gene providing the detectable signal. Exemplary reporter 15 genes encode a gene product that gives rise to a ~tect~hle signal, such as color, fluoresc~nce, llln~in~scence, cell viability relief of a cell nutritional requirement, cell growth, or drug resistance. In preferred embo~im~nts, the reporter gene encodes a gene product selected from the group concicting of chloramphenicol acetyl transferase, beta-galactosidase, luciferase, fluorescent protein, and alkaline phosphatase. In other 20 embodiments, the reporter gene encodes a gene product which confers the ability to grow in the presence of a selective agent, e.g., canavanine.
In another embodiment the yeast cell further comprises a heterologous regulatoryprotein which is coupled to the phospholipase ~ign~ling pathway. e.g., the regulatory protein modulates the activity of the heterologous PLC or is modulated by the PLC activity.
25 Exemplary regulatory proteins include, for example, G-protein heterotrimers; G a subunits;
G,B~ subunits; proteins known to interact functionally with PLC substrates (e.g., profilin, gelsolin, cofilin, and alpha-actinin); and other effectors whose activity is dependent on PLC
activity (i.e., IP3 receptors/calcium channels, and IP3 or calcium sensitive enzyme activities such as PKC or calcium/calmodulin kinase (CaM kinase)).
In another embodiment the yeast cell comprises a heterologous receptor or ion - channel or other surface protein capable of transducing signals via the phospholipase-dependent signal pathway, e.g., which is known to couple to PLC activity either directly or via a regulatory protein. This aspect of the invention provides for more general readout systems to assay modulation of the activity of a variety of different cellular cign~ling components which effect phospholipase C activation. In a preferred embodiment, the host cell further comprises a heterologous gene encoding a heterologous G-protein coupled -CA 022204~9 1997-11-27 WO ~6/1~939 PCTrUS96/10002 receptor. Preferred G-protein coupled receptors include chemoattractant peptide receptors, neuropeptide receptords, cytokine, light receptors, neurotransmitter receptors, cydic AMP receptors, and polypeptide hormone receptors. For example, the receptor may be any one of: an alA-adrenergic receptor, an oclB-adrenergic receptor, an alC-adrenergic 5 receptor, an Ml AChR receptor, an M3 AChR receptor, an Ms AChR receptor, a D2 dopamine receptor, a D3 dopamine receptor, an Al adenosine receptor, a 5HTl-like receptor, a SHTld-like receptor, a 5HTld beta receptor, a substance K (neurokinin A) receptor, a f-Met-Leu-Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a 10 growth hormone-releasing hormone (GHRH) receptor, a vasoactive intestinal peptide receptor, an oxytocin receptor, a SSTR3 receptor, an Luetinizing hormone/chorionic gonadotropin (LH/CG) receptor, a thromboxane A2 receptor, a platelet-activating factor (PAF) receptor, a CSa anaphylatoxin receptor, an Interleukin 8 (IL-B) IL-8RA receptor, an IL-8RB receptor, a mip-l/RANTES receptor, a metabotropic ghltz~m~te mGluRl-5 receptor, 15 an ATP receptor, an amyloid protein precursor receptor, a bradykinin receptor, a gonadotropin-releasing hormone receptor, a cholecystokinin receptor, an antidiuretic hormone receptor, an adrenocorticotropic hormone II receptor, LTB4, LTD4 tachykinin receptor, thyrotropin releasing hormone receptor, and oxytocin receptor. In other embo~1iment~, the the receptor protein is a receptor tyrosine kinase.
In yet another embodiment, the recombinant cells are further engineered to include an expressible recombinant gene encoding a heterologous test polypeptide. In preferred embo~liment~7 such cells are provided as mixed culture collectively expressing a variegated population of test polypeptides.
The present invention also relates to a rapid, reliable and effective assay for screening and identifying pharmaceutically effective cornpounds that specifically interact with and modulate the activity of a phospholipase. The subject assay enables rapid screening of large numbers of test compounds to identifying those compounds which modulate, e.g., agonize or antagonize, phospholipase bioactivity. In general, the assay is characterized by the use of the recombinant cells described herein as engineered to express heterologous phospholipase activities which produce, in the engineered cell, a detection signal. The ability of particular test compounds contacted with the instant cells to modulate the phospholipase activity can be scored for by detecting up or down-regulation of the detection signal. For example, second messenger generation via the heterologous phospholipase activity can be measured directly.
Alternatively, the use of a reporter gene can provide a convenient readout. In any event, a statistically significant change in the detection signal can be used to facilitate identification of those compounds which are effectors of the phospholipase transducing activity.

.
CA 022204~9 1997-11-27 WO ~I/4C~39 PCT~US96/10002 In one embodiment, ~ere is provided an assay for identifying a modulator of a phospholipase C activity, comprising the steps of: (i) com~cting the cell of claim 1 with a test compound under conditions appropriate for cletecting an intracellular signal tr~ncf~-lce~l via the phospholipase-dependent signal pathway; and (ii) measuring a level of S signal tr~nc-~llce~ by the phospholipase-dependent signal pathway in the presence of the test compound. A st~ticti~lly cignific~nt difference in the level of signal in the presence of the test compound, e.g., increase or decrease relative to the absence of test compound, indicates that the test compound is a modulator of the he~erologous phospholipase C
activity. The intr~ct~ r signal can be ~-otecte~l, for example, by expression of a reporter 10 gene operably linked to transcriptional regulatory el~m~ntc sensitive to the phospholipase-dependent signal pathway. In other embodiments, the intracellular signal is (lete~tecl by measuring products of the hydrolysis of phosphatidylinositol 4,5-bisphosphate; by measuring Ca2+ mobilization; and/or by measuring the activation of a protein kinase such as PKC. In yet other embo~lim~ms, the intr~cell~ r signal can be fletecte-3 by measuring a 15 change in phenotype conferred by the heterologous phospholipase, such as a change in temperature sensitivity or NaCl sensitivity.
In a preferred embo-lim~nt, the assay makes use the ability of a heterologous PLC
to complement a loss-of-function mutation to an endogenous phospholipase activity. This embodiment of the subject assay generally includes the steps of: (i) contacting the cell with 20 a test compound under conditions appropriate for ~ietecting one or both of the phenotypes of the loss-of-function mutation or the complem~nte-l pheno~ype; and (ii) measuring the level or degree of one or both of these phenotype in the presence of the test compound.
By comparing this measurement with a similar measurement made in the absence of the test compound or the absence of the heterologous phospholipase C, the ability of the test 25 compound to alter the phenotype, relative to the absence of test compound or phospholipase C, can be used to identify test compounds that are modulators of the heterologous phospholipase C activity.
In yet another embodiment, the assay utilizes a cell which is further engineeredwith a reporter gene construct which is sensitive to a phospholipase-dependent signal 30 pathway from a heterologous PLC activity. Such assay formats generally include the steps of: (i) contacting the cell with a test compound under conditions appropriate for expression of the reporter gene; (ii) rletecting expression of the reporter gene in the presence of the test compound; and (iii) comparing the level of reporter gene expression in the presence of the test compound to the level of reporter gene expression in the absence 35 of the test compound or the absence of the heterologous phospholipase C. A statistically ~ignifie~nt difference in the level of reporter gene expression in the presence of the test W O 96/40939 PCT~US96/10002 compound, relative to the absence of test compound or phospholipase C, indicates that the test compound is a modulator of the heterologous phospholipase C activity.
Still another embodiment of the assay provides a differential screening format for identifying an agent which selectively inhibits a non-mamm~ n phospholipase C relative 5 to a m~mm~ n phospholipase. Such assay formats can include the steps of: (i) providing a first ye~st cell cont~ining a non-m lmm~ n phospholipase gene; (ii) providing a second yeast cell expressing a m~mm~ n phospholipase gene; (iii) cont~cting each of the first and second yeast cells with a test compound; and (iv) cletecting or quantitating the activity of the phospholipases of the first and second cell in the presence of the test compound. A
10 statistically greater decrease in the phospholipase activity of the first cell, relative to the second cell, inr~ic~tes that the test compound selectively inhibits the non-m~mm~ n phospholipase C. Such dirrele-lLial screening format can be used to identify inhibitors which are selective for phospholipases of m~mm~ n pathogens relative to the hostmamm~ n phosphoIipase. For instance, the m~mm~ n PLC can be a human PLC, and 15 the non-m~mm~lian PLC can be derived from a human fungal pathogen, e.g. a pathogen which causes a mycosis selected from a group consisting of candidiasis, aspergillosis, mucormycosis, blastomycosis, geotrichosis, cryptococcosis, chromoblastomycosis, penicilliosis, conidiosporosis, nocaidiosis, coccidioidomycosis, histoplasmosis,maduromycosis, rhinosporidosis, monoliasis, para-actinomycosis, and sporotrichosis. In 20 preferred embo~imt~ntc, the phospholipase of the first cell can be cloned from a human pathogen selected from a group concicting of Candida albicans, Candida stellatoidea, Candida tropicalis, Candida parapsi~osic, C~ndida kr~sei, Candida pse?~dotropicalis, Candida quillermondii, Candida n~gosa, As~pergillusf~migat?~s, Aspergillusflavus, Aspergillusniger, Aspergzllus nidulans, Aspergillus te~reus, Rhizopus awhiz~s, Rhizopus oryzae, Absidia 25 corymbifera, Absidia ramosa, and Mucor pusillus.
In any of the subject drug screening assays described herein, the assay can be carried out, e.g., repeated, for a library of at least 100 different test compounds, though more preferably at least 103, 104, 105, 106, or 107 different (variegated) compounds. The test compound can be, to illuskate, peptides, nucleic acids, carbohydrates, small organic 30 molecules, natural product extracts, synthetic compounds, or a mixture of combinatorial compounds.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art.
35 Such techniques are explained fully in the lil ldLul~. See, for example, Molecular CloningA
LaboratoryManual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor CA 022204~9 1997-11-27 Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985);Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Patent No: 4,683,195;
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B D. Hames & S. J. Higgins eds. 1984); Immobili~ed Cells And Enzymes (IRL
Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (~czlclemic Press, Inc., N.Y.); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986).

Detailed Descriptio~ of the I~2vention Phospholipases C (PLC) are a family of enzymes which hydrolyze the sn-3 phosphodiester bond in membrane phospholipids producing diacylglycerol and a phosphorylated polar head group. ~3mm~ n PLC enzymes exhibit specificity for the polar head group which is hydrolyzed, i.e., phosphatidylcholine, phosphatidylinositol, etc.
Hydrolysis of phosphatidylinositol 4,5-bisphosphate [PtdIns(4,5)P2] by specific PLC
enzymes generates two second messenger molecules, diacylglycerol, a co-factor required for activation of protein kinase C, and inositol 1,4,5-trisphosphate (IP3), a soluble second messenger molecule which promotes the release of Ca2+ from intracellular stores (Berridge, (1987) Ann. Rev. Biochem 56:159-193).
The importance of PLC activation in cell proliferation is evident from the fact that the hydrolysis of PtdIns(4,5)P2 is one of the early events that follow the interaction of many growth factors and mitogens with their respective receptors. However, the importance of PLC activation is not restricted to proliferation; it is one of the most common transmembrane 25 ~ign~ling events elicited by receptors that regulate many other cellular processes, including diLre,c;lltiation, metabolism, secretion, contraction, and sensory perception. Such PLC-mediated transmembrane ~ign~ling events include, for example, sign~ling via receptor tyrosine kinases and G protein coupled receptors.
Moreover, the diacylglycerol released may be further metabolized to free arachidonic 30 acid by sequential actions of diglycerol lipase and monoglycerol lipase. Thus, phospholipases C are not only important enzymes in the generation of second messenger molecules, but may serve an important role in making arachidonic acid available for eicosanoid biosynthesis in select tissues.
The present invention is based on the development of yeast strains which express a 35 functional, heterologous phospholipase and makes available a rapid, effective assay for CA 022204~9 1997-11-27 W 096/40939 PCT~US96/10002 screening and identifying ph~rm~reutically effective compounds that specifically interact with and modulate the activity of the heterologous phospholipase. As described herein, the present invention provides a convenient format for discovering drugs which can be useful to modulate cellular function, as well as to understand the ph~rm~fology of compounds that 5 specifically interact with phospholipases.
Before further description of the invention, certain terms employed in the specification, examples and appended claims are, for convenience, collected here.
"Signal transduction" is the process by which chemical signals are relayed from the cellular environment to cellular targets via the cell membrane, and may occur through one or 10 more mech~ni~m~, such as phosphorylation, activation of ;on channels, effector enzyme activation via guanine nucleotide binding protein intermediates, activation of phospholipase, and/or direct activation (or inhibition) of a transcriptional factor.
A "m~mm~ n phospholipase" is a protein which is either identical to an phospholipase occurring naturally in a m~mmsll, or is a mutant which is substantially 15 homologous with such a m~mm~ n phospholipase and more similar in sequence to it than to the yeast phospholipase. Related terms, such as "primate phospholipase", or "human phospholipase", are analogously defined. A m~mm~ n phospholipase is "functionally homologous" to a yeast protein if, either alone, or in concert with other exogenous proteins, or after being modified by a drug, it is able to provide an phospholipase activity within the 20 engineered yeast cell. It is not necessary that it be as efficient as the yeast protein, however, it is desirable that it have at least 10% of the activity of the analogous yeast protein.
An "activator" or "agonist" of a phospholipase is a substance which causes the phospholipase to become more enzymatically active, e.g., elevates the rate at which phospholipid hydroylsis occurs under particular conditions. The mode of action of the 25 activator may be direct, e.g., through binding the phospholipase, or indirect, e.g., through binding another molecule which otherwise interacts with the phospholipase.
Conversely, an "inhibitor or antagonist" of an phospholipase is a substance which causes the enzyme to become less active, and thereby reduces the rate or production of the hydrolytic second messengers to a detectable degree. The reduction may be complete or 30 partial, and due to a direct or an indirect effect.
The term "phospholipase-dependent signal pathway" as used herein refers to a signal transduction pathway including a phospholipase activity as a step in the transduction of the intracellular signal. Such a signal transduction p~ w~y is meant to include components of a pathway whose activity is modulated by a phospholipase, whether their activity is directly 35 modulated by the phospholipase or-indirectly modulated by the phospholipase or its second ~ =
CA 022204~9 1997-11-27 W O ~C/103~9 PCTAUS96/10002 messengers. This term also includes components of the pathway which are "upstream" of the phospholipase which regulate an activity of the phospholipase.
The term "functional integration" as used herein refers to the ability of an exogenous phospholipase to function in a phospholipase-dependent signal transduction pathway such S that a distal effect of a phospholipase activity can be cletermin~d, i.e., an activity regulated by the products produced from phospholipase dependent phospholipid hydrolysis. Such distal signaling effects can be observed in yeast expressing either a functional or mutant phospholipase. Another example of functional integration is complementation by aheterologous phospholipase C of one of the pleiotropy of effects seen in phospholipase loss-10 of-function yeast strains (e.g., reduced growth or NaCl sensitivity). Another assay of functional complementation is the ability of the heterologous phospholipase to modulate gene ~ transcription. Yet another assay of functional integration is the reconstitution of regulated phospholipase activity, i.e., phospholipase activity requiring stimulation, for example phospholipase activity upon receptor-ligand activation or upon activation by a G protein 15 subunit or subunits. This term can also include functional integration of a phospholipase into an endogenous yeast p~Lhw~y or a chimeric pathway including components not naturally found in yeast cells.
The term "modulation of a phospholipase activity" in its various grammatical forms, as used herein, cle~ipn~tec induction and/or potentiation, as well as inhibition of one or more 20 signal transduction pathways involving of a phospholipase. Such modulation may involve effects of a compound directly on a phospholipase, or on a component of a signaltransduction pathway involving a phospholipase, for example upstream regulatory elements, or downstream elements, including substrates.
The term "substantially homologous", when used in connection with amino acid 25 sequences, refers to sequences which are substantially identical to or similar in sequence, giving rise to a homology in conformation and thus to similar biological activity. The term is not intended to imply a common evolution of the sequences. Typically, "substantially homologous" sequences are at least 50%, more preferably at least 80%, identical in sequence, at least over any regions known to be involved in the desired activity. Most preferably, no 30 more than five residues, other than at the termini, are different. Preferably, the divergence in - sequence, at least in the aforementioned regions, is in the form of "conservative modifications".
The terms "protein", "polypeptide" and "peptide" are used interchangeably herein.
As used herein, "recombinant cells" include any cells that have been modified by the 35 introduction of heterologous DNA. Control cells include cells that are substantially identical to the recombinant cells, but do not express one or more of the proteins encoded by the CA 022204~9 1997-11-27 W O~G/~D3~9 PCT~US96/10002 heterologous DNA, e.g., do not include or express one or more of the exogenous phospholipase, regulatory protein, test polypeptide, or the reporter gene construct.
As used herein, the terms "heterologous DNA" or "heterologous nucleic acid" is meant to include DNA that does not occur naturally as part of the genome in which it is present or DNA which is found in a location or locations in the genome that differs from that in which it occurs in nature. ~Ieterologous DNA is not endogenous to the cell into which it is introduced, but has been obtained from another cell, i.e., is exogenous to the cell. Generally, although not nect ~c~rily, such DNA encodes RNA and proteins that are not normally produced by the cell in which it is expressed. Heterologous DNA may also be referred to as 10 foreign DNA. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which is expressed is herein encompassed by the term heterologous DNA. Examples of heterologous DNA include, but are not limited to, DNA
that encodes a phospholipase, test polypeptides, regulatory proteins, reporter genes, transcriptional and translational regulatory sequences, or selectable or traceable marker 15 proteins, such as a protein that confers drug resistance.
The terms "recombinant protein", "heterologous protein" and "exogenous protein" are used interchangeably throughout the specification and refer to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable ~p~ ion vector which is in turn used to transform a 20 host cell to produce the heterologous protein. That is, the polypeptide is expressed from a heterologous nucleic acid.
A "heterologous phospholipase" refers to a non-yeast phospholipase enzyme, having a phospholipase activity. For example, phospholipase C, in the presence of calcium, can convert phosphatidyl inositol (PI), phosphatidyl inositol 4-monophosphate (PIP) or 25 phosphatidyl inositol (4,5) biphosphate (PIP2) into at least inositol 1,4,5 triphosphate (IP3) and diacylglycerol (DAG).
An "endogenous, mutant phospholipase gene" as used herein refers to a yeast phospholipase gene that encodes an endogenous, mutant or impaired yeast phospholipase protein. For example, an endogenous, mutant phospholipase may have a deletion, insertion, 30 point mutation or other mutation that results in a conditional imp~irrnent or a constitutive impairment, making them ideal for selection or complementation studies. An example of an endogenous, mutant phospholipase gene is a deletion mutant in the S. cerevisiae PLC1 locus ~z71cl ). These mutants have several phenotypic differences from wildtype PLC l strains. plcl strains are sensitive to high osmolarity (0.5M NaCl or 1.2M sorbitol) at 30~C and do not 35 grow well in the presence of carbon sources other than glucose (i.e. glycerol/ethanol, raffinose, and galactose). Finally, plcl strains have a tt~ dLul~: sensitive phenotype; at , CA 022204~9 l997-ll-27 W O~C/~0339 PCTAJS96/10002 temperatures above 35~C, plcl strains do not grow, while at temperatures below 35~C, they grow, albeit slower than wildtype strains.
A "loss of function" mutation is one which leads to a change in the activity of a phospholipase gene. Such a mutation may alter one or more of the coding sequence, the S transcription, or the translation of an endogenous yeast phospholipase. Such a mutation will lead to the lack of ~ e~ion of a yeast phospholipase, or the expression of an inactive yeast phospholipase or a phospholipase of reduced activity.
As used herein, a "reporter gene construct" is a nucleic acid that includes a "reporter gene" operatively linked to a transcriptional regulatory sequences. Transcription of the 10 reporter gene is controlled by these sequences. The activity of at least one or more of these control sequences is directly or indirectly regulated by a signal transduction pathway involving a phospholipase, e.g., is directly or indirectly regulated by a second me~s.?nper produced by the phospholipase activity. The transcriptional regulatory sequences can include a promoter and other regulatory regions, such as enhancer sequences, that modulate the 15 activity of the promoter, or regulatory sequences that modulate the activity or efficiency of the RNA polymerase that recognizes the promoter, or regulatory sequences that are recognized by effector molecules, including those that are specifically induced upon activation of a phospholipase. For example, modulation of the activity of the promoter may be effected by altering the RNA polymerase binding to the promoter region, or, alternatively, 20 by interfering with initiation of transcription or elongation of the mRNA. Such sequences are herein collectively referred to as transcriptional regulatory elements or sequences. In addition, the construct may include sequences of nucleotides that alter the stability or rate of translation of the resulting mRNA in response to PLC second messages, thereby altering the amount of reporter gene product.
25As used herein, a "heterologous regulatory protein" refers to a protein that regulates or is coupled to a heterologous phospholipase. Such a regulatory protein may be upstream or downstream of a phospholipase and is capable of mocl~ ting the activity of a phospholipase or being modulated by the phospholipase. A preferred regulatory protein is a GTP binding protein (G protein), which as used herein refers to heterotrimeric G proteins, G protein 30subunits thereof, e.g. a, ,B and r subunits, or a functional heterodimer (e.g. ,B~). A regulatory protein as used herein may also be a receptor that modulates a signal transduction pathway involving a phospholipase. Examples of ~l~f~ d regulatory receptors are those that directly activate a phospholipase, such as the G protein coupled receptors, receptor tyrosine kinases (~TK's), receptors that activate phospholipases via the activation of a non-receptor kin~es, 35such as those that signal via src kinases and the like. Other regulatory proteins can bind PIP2, the ~lere,l~d substrate for many PLC isozymes (e.g. profilin, cofilin, gelsolin, and alpha-CA 022204~9 1997-11-27 W O~'1C339 PCTAJS96/10002 actinin) as discussed in Homma and Emori, 1995 and references therein. Regulatory proteins are discussed in further detail below.
As used herein, "cell surface receptor" refers to molecules that occur on the surface of cells, interact with the extracellular environment, and transmit or tr~n~d~lce the information 5 regarding the environment intracellularly in a manner that ultimately modulates transcription of specific promoters, resulting in transcription of specific genes.
As used herein, "extracellular signals" include a molecule or a change in the environment that is tran~ ced intracellularly via cell surface proteins that interact, directly or indirectly, with the signal. An extracellular signal or effector molecule includes any 10 compound or substance that in some manner specifically alters the activity of a cell surface protein. Examples of such signals include, but are not limited to, molecules such as ions, acetylcholine, growth factors, and hormones, that bind to cell surface and/or intracellular receptors and ion channels and modulate the activity of such receptors and channels.
Extracellular signals also include as yet unidentified substances that modulate a signal 15 transduction l~dLhWdy involving a phospholipase, and thereby influence intracellular functions. Such extracellular signals are potential phslrm~cological agents that may be used to treat specific ~ ce~ by mo-llll~tin~ phospholipase activity.

I. Ove~view of Assav In vit~o testing is a preferred methodology in that it permits the design of high-throughput screens: small quantities of large numbers of compounds can be tested in a short period of time and at low expense. Optimally, animals are reserved for the latter stages of compound evaluation and are not used in the discovery phase; the use of whole animals is labor-intensive and extremely expensive. Microorg~ni~m~, to a much greater extent than m~mm~ n cells and tissues, can be easily exploited for use in rapid drug screens. Yeast provide a particularly attractive test system, extensive analysis of this organism has revealed the conservation of structure and function of a variety of proteins active in basic cellular processes in both yeast and higher eukaryotes.
As set out above, the present invention relates to recombinant yeast cells expressing a heterologous phospholipase and the methods of using these cells to identify compounds capable of mot1~ ting the signal transduction activity of such phospholipases. In general, the subject assay is characterized by the use of recombinant cells which express a heterologous phospholipase protein whose signal transduction activity can be modulated in therecombinant cell so as to generate a detectable signal. As described below, these cells may 35 (optionally) also express one or more of: (i) an ~ es~,ible recombinant gene encoding an CA 022204~9 1997-11-27 WO 96t40939 PCT~US96/10002 exogenous test polypeptide from a polypeptide library, (iij a regulatory protein coupled to a phospholipase activity, and (iii) a reporter construct.
The functional expression of a m~mm~ n phospholipase in yeast provides for the design of inexpensive screens useful in the identification of modulators of the enzyme, the 5 activity which is required for the generation of a central sign~ling molecule in mzlmm~ n cells. Any chemical entity, or combination of chemical entities, whether natural or synthetic, may be screened for the ability to modulate the m~3mm~ n phospholipase. These modulators may act directly on the enzyme to alter the activity of the enzyme, e.g., they can competitively, noncompetitively, and/or allosterically potentiate or inhibit the enzyme's 10 activity, or may affect the ability of a regulatory protein to alter phospholipase activity.
In one embodiment, the engineered cell is used to screen for drugs which, like Ga or in some cases G,~~y, can directly activate the phospholipase, or increase the activity of a partially activated phospholipase. In certain embodiments a chimeric Ga or G~y may be expressed for this purpose.
l S In a second embodiment, the engineered cell is used to screen for drugs which inhibit m~mmz3li~n phospholipase. In this situation, the phospholipase must first be activated. This can be done by engineering the cell to express Ga or G,~y, as a~lopl;ate. Alternatively, the cell may be engineered to co-express both a G protein and a G protein coupled receptor, or any other protein which regulates the activity of the phospholipase, and the receptor 20 stimulated either by extern~lly added ligand or by a co-expressed ligand. In either case, the ligand is a known activator used merely to stimulate activation of the phospholipase, and the drugs are screened for inhibition of this phospholipase.
In a third embodiment, the engineered cell is used to screen for drugs which inhibit or activate phospholipase indirectly, e.g., by their action upon a regulatory protein, for example, 25 a G protein-coupled receptor. The receptor activates the G protein subunits which act on the phospholipase. In this case, a compatible G protein-coupled receptor and a compatible G
protein would be provided with the m~mm~ n phospholipase in the same yeast cell.
The ability of particular test compounds to modulate the signal transduction activity of the target phospholipase can be scored for by detecting up or down-regulation of the 30 detection signal. For example, second messenger generation (e.g. phospholipid hydrolysis, Ca2+ mobilization or PKC activation) via a phospholipase-dependent signal pathway can be measured directly. Alternatively, the use of a reporter gene can provide a convenient readout.
In any event, a statistically significant change in the detection signal can be used to facilitate identification of those compounds which are effectors of the target phospholipase.

CA 022204~9 1997-11-27 By this method, test compounds which modulate phospholipase .~ign~ling can be screened. If the test compound does not appear to induce the activity of the phospholipase, the assay may be repeated and modified by the introduction of a step in which the recombinant cell is first contacted with a known activator of the phospholipase, and the test 5 compound can be assayed for its ability to inhibit the activity of the phospholipase, e.g., to identify phospholipase antagonists. Alternatively, the cell can be Pn~ineçred with an activated phospholipase. In yet other embo-liment~, test compounds can be screened for members which potentiate the response to a known activator of the phospholipase. In yet another embodiment a phsopholipase or a phospholipase regulatory protein may be 10 constituatively active to facilitate screening for inhibitors of an activated phospholipase. For example, constituatively active forms of the heterotrimeric Gq family members, such as Gl l and G16 have been described, such as Ga qQ209L and Goc 16Q212L.
Overexpression these GTPase deficient activated alleles of Ga was found to constitutively elevate basal phospholipase C activity, leading to persistent activation of cJun NH2-terminal kinases (Heasley et al. 1996 Mol. Cell. Biol. 16:648, Heasley et al. 1996. J:
Biol. Chem. 271:349; Qian et al. 1994 J. Biol. Chem. 1994. 269:17417). In still a further embodiment a con~ u~liv~ly actived form of a phospholipase activating receptor may be expressed, such as an a 1 B-adrenergic receptor which has been mut~tP~l to render it constituatively active (Perez et al. 1996. Mol. PharmacoZ. 49:112) or an altered form of the 20 formylmethionylleucylpheny~ nine receptor (Amatruda et al. 1995. J. Biol. Chem.
270:28010). In other embodiments the phospholipase itself may be expressed in aconstituatively activated form.
In a further embodiment, the subject reagent cells can be used to perform differential screening assays, e.g., which can be used to identify a compound that selectively effects a 25 non-m~mm~ n (e.g. non-human) phospholipase. Such compounds, by selective inhibition, can be used for treating or preventing a pathogen infection (e.g. viral, fungal, bacterial or protozoan) in a m~mm~l (e.g. human). Preferred heterologous phospholipase enzymes for performing differential screening assays against a mz~mm~ n phospholipase include phospholipases from viral, fungal or protozoan pathogens. Examples of fungal pathogens 30 include fungi that cause Candidiasis, Aspergillosis, Mucorrnycosis, Blastomycosis, Geotrichosis, Cryptococcosis, Chromoblastomycosis, Coccidioidomycosis, Conidiosporosis, Histoplasmosis, Maduromycosis, Rhinosporidosis, ~ocaidiosis, Para-actinomycosis,Penicilliosis, Monoliasis, and Sporotrichosis.
In a further embodiment of a dirr~ ial screen, the ability of a compound to 35 modulate the activity of one phospholipase and not another phospholipase may be measured.
For example, compounds which are agonists or antagonists of PLC~ and not PLCy or are CA 022204~9 1997-11-27 W 0~6/~39 PCT~US96/10002 capable of mo~ ting PLC~2 and not PLC,B3 may be selected. In yet another embodiment compounds which are capable of mo~llll~ting a heterologous phospholipase while not affecting another member of a signal transduction protein which may or may not be a member of a phospholipase pdLllwdy, such as PKC may be tested.
In developing the recombinant cells assays, it was recognized that a frequent result of the activation of a phospholipase ~i~n~ling pathway was the transcriptional activation or inactivation of specific genes, i.e., the activation of a phospholipase often ultimately leads to a rapid and detectable change in the transcription or translation of a gene. Thus, transcription of genes controlled by phospholipase-responsive transcriptional elements often reflects the activity of the surface protein by virtue of transduction of an intracellular signal.
To illustrate, the intracellular signal that is tr~n~ ecl can be initiated by the specific interaction of an extracellular signal, particularly a ligand, with a cell surface receptor which is coupled to the phospholipase. This interaction sets in motion a cascade of intracellular events, the ultimate consequence of which is a rapid and detectable change in the transcription or translation of a gene. By selecting transcriptional regulatory sequences that are responsive to the phospholipase-dependent intracellular signals and operatively linking the selected promoters to reporter genes, whose transcription, translation or ultimate activity is readily detectable and measurable, the transcription based assay provides a rapid indication of whether a specific test compound influences intracellular transduction. Expression of the reporter gene, thus, provides a valuable screening tool for the development of compounds that act as agonists or antagonists of phospholipase activities.
Reporter gene based assays of this invention measure the end stage of the above described cascade of events, e.g., transcriptional modulation and are thus ideal for assays in which a heterologous phospholipase is functionally integrated into a signal transduction pathway. Accordingly, in practicing one embodiment of the assay, a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on 2nd mes~t?ngers generated by the phospholipase activity. Typically, the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal transduction activity of the target phospholipase, with the level of expression of the reporter gene providing the phospholipase-dependent detection signal. The amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, specific mRN~
expression may be detected using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity. The amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a CA 022204~9 1997-11-27 WO ~6/~033g PCTrUS96/10002 substantially identical cell that lacks the target phospholipase. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the target phospholipase.
As described in fi~ther detail below, in ~l~rell~d embot1iment~ the gene product of 5 the reporter is detected by an intrinsic activity associated with that product. For instance, the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or lllminescence.
In other ~ler~ d embodiments, the reporter or marker gene provides a selective growth advantage, e.g., the reporter gene may enhance cell viability, relieve a cell nutritional 10 requirement, and/or provide resistance to a drug.
In other embo-liment~, second messenger generation can be measured directly in the detection step, such as mobilization of intracellular calcium or phospholipid metabolism are quantitated, for instance, the products of phospholipid hydrolysis IP3 or DAG could be measured For example, one of the downstream effects of PLC activation in m~mm~ n15 cells is Ca~ mobilization; because the te~- hings of the present invention demonstrate that a m~mm~ n phospholipase can be functionally integrated into a yeast cell, it is likely that this effect may be expected in yeast cells ~ S~illg functional, recombinant PLCs. Similarly, as m~mm~ n PLC is known to modulate PKC via its second messenger products (including DAG) functional expression of m~mm~ n PLCs in yeast may be expected to couple to other 20 signal pathway effectors including IP3-receptor, CaM kinase, calmodulin, PKA and PKC, or other proteins which interact with the phospholipases.

Il. Host Cells The host yeast cell of the present invention may be of any species which is cultivable 25 and in which an exogenous phospholipase can be moclnl~tt~l Suitable species include Kluyverei lactis, Schizosaccharomyces pombe, and Ustilaqo maydis; Saccharomyces cerevisiae is ~ d. Other yeast which can be used in practicing the present invention are Neurospora crassa, Aspergillus niger, Aspergillus nidulans2 Pichia pastoris, Candida tropicalis, and Hansenula polymorpha. The term "yeast", as used herein, includes not only 30 yeast in a strictly taxonomic sense, i.e., unicellular organisms, but also yeast-like multicellular fungi or fil~mentous fungi.
The choice of ~plopl;ate host cell will also be influenced by the choice of detection signal. For instance, reporter constructs, as described below, can provide a selectable or screenable trait upon transcriptional activation (or inactivation) in response to a signal 35 transduction pathway coupled to the target receptor. The reporter gene may be an -CA 022204~9 1997-11-27 W O 96/40939 PCT~US96/10002 unmodified gene already in the host cell pathway, such as the genes responsible for growth arrest in yeast. It may be a host cell gene that has been operably linked to a "phospholipase-responsive" promoter. Alternatively, it may be a heterologous gene that has been so linked Suitable genes and promoters are discussed below. Accordingly, it will be S understood that to achieve selection or screening, the host cell must have an ~p~ iate phenotype. For example, introducing a pheromone-responsive chimeric HIS3 gene into a yeast that has a wild-type HIS3 gene would frustrate genetic selection. Thus, to achieve nutritional selection, an auxotrophic strain will be desired.

"Inactivation", with respect to genes of the host cell, means that production of a functional gene product is prevented or inhibited. Inactivation may be achieved by deletion of the gene, mutation of the promoter so that expression does not occur, or mutation of the coding sequence so that the gene product is inactive. Inactivation may be partial or total.
Accordingly, in certain embodiments it may be desirable to disrupt an endogenousyeast phospholipase to facilitate screening for an activity of a heterologous phospholipase.
The field of yeast genetics is advanced and techniques for disrupting yeast genes are known in the art. For example, transplacement may be used to replace the endogenous yeast phospholipase gene with a modified form, as described by Flick and Thorner in art. In the case of yeast PLCl, aplc~l::HIS3 mutation can be created by replacing the internal PvuII
fragment of PLC1 (nucleotides +io69 to +1482) with HIS3, as follows. The 3.7-kb Eco RV
fragment cont~ining most of PLCl can be inserted into EcoRV-digested YCpS0 to (Rose et al. 1987. Gene. 60:237) to yield pJF10, which can be cleaved with PvuII and ligated with the 2.1-kb PvuII fragment of pJJ215 that contains HIS3 (Jones and Prakash. 1990 Yeast 6:363).
In the rç~llltin~ plasmid (pJF18), HIS3 has replaced residues 357 to 494 of Plclp. The plcl~ HIS3 allele can be introduced into yeast cells by DNA mediated transformation (Rothstein. 1983. Methods Enzymol. 101:202) of two different his3/his3 diploid strains, YPH501 (Sikorski and Heiter. 1989 Genetics 122:19) and W303 (Thomas and Rothstein 1989. Cell 56:619), using EcoRV-digested pJF18 and selecting for histidine prototrophy.
A plc1~2::LEU2 mutation can be created by replacing the HpaI-ClaI segment of PLC1 (nucleotides +277 to ~2333) with LEU2, as follows. pJF58~ which consists of a 4.3-kb Hind~lII fragment cont:~ining PLC1 inserted in pUCI9 can be digested with HpaI and ClaI
and incubated with the Klenow fragment of E coli DNA polymerase I. The resulting 5.4-kb linearized vector can be gel purified and ligated with a 2.2 kb SalI-XhoI fragment cont~ining LEU2 that can be excised from pJJ283 (Jones and Prakash, supra) and converted to flush ends by treatment with Klenow enzyme, yielding pJF96. The plcl~2::LEU2 allele, which is almost a complete deletion of the PLC1 gene, can be introduced into S. cerevisiae by DNA-CA 022204~9 1997-11-27 WO 96/~39 PCT~US96/10002 mediated transformation of the leu2/leu2 diploid strain, YPH501, using HindIII-digested pJF96 and selecting for leucine prototrophy.
Transplacement of the resident PLCI locus by the mutant allele on only one homolog in each of the diploid transformants can be confirmed by restriction enzyme digestion and 5 Southern blot hybridization analysis (Sambrook et al. 1989. Molecular cloning: a laboratory m~n~l, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). The phenotype of asci from sporulated cultures of heterozygous plcl~/PLCl diploids may be tPrmined as in the art.
Ideally, any . " ~ generated will have a selectable phenotype, such as, for example, 10 cessation of growth at 37~C, or failure to grow on a particular carbon source, will exhibit sensitivity to hypertonic stress (e.g., to salt or sorbitol), or will fail to grow on medium lacking a nitrogen source. In preferred embodiments a yeast cell expressing an endogenous mutant PLC will be capable of growth under one set of experimental conditions and will fail to grow or exhibit growth hllp~ ..ent under a second set of experimental conditions, i.e., 15 would be conditionally lethal.
"Complement~tion", with respect to genes of the host ceil, means that at least partial function of inactivated gene of the host cell is supplied by an exogenous nucleic acid. For instance, yeast cells can be "m:~mmaliani7.?d", and even "hllmani7~d", by complementation of receptor and signal tran~clllcfion proteins with mamm~ n homologs. To illustrate, 20 inactivation of a yeast phospholipase gene can be complemented, as described in the appended examples, by expression of a human phospholipase gene.
The complementation of the plcl ~ ts phenotype observed with human PLC-132 and Gaq family members can be used in a screening format to identify a variety of agonists and antagonists directed to these functionally interacting proteins. PLC-,(3 agonists can be 25 identified in a screen for compounds that stimulate growth of plcl~ yeast strains expressing PLC-~2 but not ~2~ple~ g any Gaq family Ga-subunit under non-permissive growth conditions.plcl~ strains expressing wildtype yeast PLC1 could serve as an ~ liate counterscreening strain. PLC-~ antagonists could be screened for in two formats. In the first format, plcl~ yeast strains whose growth under non-permissive conditions is not dependent 30 upon co-expression of Gaq subunits (i.e. strains expressing m~mm~ n PLC-,Bl, -~2, or -,B3 on high copy plasmids) could be screened for compounds that block growth at 37~C or on 0.5M NaCl at 30~C but not at 30~C. An additional counterscreen for this format would be to screen for compounds that block growth of the plcl ~ strains but not of PLC 1 strains under non-permissive conditions. This counterscreen would serve to distinguish between35 compounds that act on fungal and mamm~lian PLC isoforms as opposed to those that act on one or the other or both. In the second format, plcl ~ yeast strains whose growth under non-CA 022204~9 l997-ll-27 W 096/40939 PCTrUS96/10002 - 25 - _ peImissive conditions is dependent upon co-expression of Go~q subunits (i.e. strains expressing PLC-,~2 on a low copy plasmid) could be screened for loss of complementation when contacted with compounds. This screen could in theory detect compounds that act either by inhibiting PLC-isoforrns directly or by blocking the interaction between PLC-~
5 isofo~ns and Gaq subunits or by blocking ~e activation of Gaq subunits. As a final exampleof the use of functional complement~tion in screening, it may be possible to construct yeast strains in which the activation or inhibition of ~i~n~lin~ components downstream of PLC-,B
ca~ be scored ~lo~liately configured strains. For example, strains expressing both m~mm~ n PLC-~ isoforms and PKC may be used to screen for compounds that modulate10 the activity of either PLC-13 isoforrns, PKC isofonns, or both.
Otkter complement~tions for use in the subject assay can be constructed wi~out any undue experimentation. Indeed, numerous examples of yeast genetic complemen~:~tion with m~mm~ n signal transduction proteins have been described in the art. For example, the following table includes a list of some of the human genes which have been found to complement of yeast genes (see also Tuendreich et al. 1994. Hum. Mol. Gen. 3:1509) Table 2. Sequence similarity between Human cDNAs that complement S.
cerevisiae mutants and their correlate yeast proteins GenBank BLASTX Yeast SwissProt Human Gene Accession# P-value Mutant Accession # Reference ARF5 M57567 I .OE-91 arf2 P 19146 Lee FJ. et al. (1992) ARF5 M57567 1.4e-91 arfl P11076 Lee FJ. et al. (1992) ARF6 M57763 3.1e-85 arf2 P19146 Lee FJ. et al. (1992) ARF6 M57763 4.0e-84 arfl P11076 Lee FJ. et al. (1992) mo~llllin D45887 7.7e-63 cmdl P06787 Davis TN. et al. (1989) CBS L14577 9.4e-116 cys4 P32582 Kru~erWD.etal.(1994) CCNDI M64349 NotDetected clnl P20437 Xion,aetal.(1991) CCNDI M64349 NotDetected cln2 P20438 Xion~etal.(1991) CCNDI M64349 Not Detected cln3 P13365 Xion~ et al. (1991) CDC2 X05360 2.0e-130 cdc28 P00546 Ninomiva-Teuiietal.(1991) CDC34 L22005 5.1e-38 cdc34 P14682 Plon et al. (1993) CDK2 X61622 1.3e-137 cdc28 P00546 Elled~e et al. (1991) CA 022204~9 1997-11-27 WO 96/40939 PCT~US96/10002 CDK3 X66357 1.3e-137 cdc28 P00546 Meverson et al. (1992) CHK D10704 2.8e-20 ckil P20485 Hosaka et al. (1992) CKSI X54941 8.7e-23 cksl P20486 Richardson HE~ et al. (1990) CKS2 X54942 6 9e-14 cksl P20586 Richardson et al. (1990) CSBPI L32563 7.2e-117 hogl P32485 K~lmaretal.(1995~
CYCI X06994 1.2e-98 cycl P00044 Tanaka Y. et al. (1988) Cyclin E M73812 Not clnl P20437 Lew DJ. et al. (1991) Detected Cyclin E M73812 Not cln2 P20438 Lew DJ. et al. (1993) Detected Cyclin E M73812 Not cln3 P13365 Lew DJ. et al. (1991) Detected DHODH M94065 1.4e-5 ural P28272 Minet M. et al. (1992) elF-2alpha M85294 8.3e-24 gcn2 P15442 Dever7Eetal.(1993) elF-SA (elF-4D) M23419 1.6e-69 tifSlB P19211 S.,L~.~,lbc.~ .,. HG. et al. (1993) elF-5A (elF-4D) M23419 1.7e-70 tifSlA P23301 S~ lln,~ ~.. HG. et al. (1993) FLRN M59849 1.3e-120 nopl P15646 Jansen RP. et al. (1992) G25K M35543 2.3e-108 cdc42 P19073 1~ ... S. et al. (1990) G25K M35543 Not cdc24 P11433 M(~ S. et al. (1990) Detected GALK2 M84443 1.5e-64 gall P04385 Lee PT. et al. (1993) GALT M96264 2.5e-85 gal7 P08431 Fridovich-Keil JL. et al. (1993) GART X54199 2.0e-248 ade5, 7 P07244 Schild D. et al. (1990) GART X54199 4.8e-12 ade8 P04161 Schild D. et al. (1990) GBEI L07956 7.0e-290 glc3 P32775 ThonVJaal (1993) GOS8 L13463 1.4e-1 get2 P11972 Siderovski DPetal. (1996) GSPTI X17644 6.3e-165 get2 P05453 Hoshino S. et al. (1989) HAP2 M59079 2.2e-23 hap2 P06774 Becker DM et al. (1991) hFKB12 M80199 9.0e-43 rbpl P20081 Koltin Y. et al. (1991) H-GRF55 S62035 6.2e-29 cdc25 P04821 Schwei~hofferF.etal.(l991) HHR6A M74524 1.2e-73 rad6 P06104 KokenMHetal.(l991) HHR6B M74525 6.7e-74 rad6 P06104 Koken MH. et al. (1991) HMGCR M11058 1.0e-145 hrng2 P12684 Basson ME. et al. (1988) SUBSTITUTE SHEET ~RULE 26) CA 022204~9 1997-11-27 HMGCR M11058 4.6e-160 hmgl P13683 Basson ME. et al. (1988) hRPB7.0 Z47727 3.9e-13 rpclO P40422 Sh~al~ i GV et al. (1995) hRPB7.6 Z47728 3.9e-13 rpblO P22139 Shpakovski GV et al. (1995) hRPB17 Z49199 I.Oe-23 rpb8 P20436 Shpakovski GV et al. (1995) hRPB14.4 Z27113 2.8e-40 rpo26 P20435 Shpakovski GV et al. (1995) LIGI M36067 2.3e-168 cdc9 P04819 Barnes DE. et al. (1990) MGMT M29971 I.9e-8 mgt-l P26188 Xiac W. et al. (1995) MSSI D11094 8.4e-211 cimS P33299 Ghislain M. et al. (1993) MTTFI X64269 Not abf2 002486 Parisi MA. et al. (1993) Detected NFI M89914 I.5e-38 ira2 P19158 BallesterR.etal.(l990) NMT M86707 9 7e-122 nmtl P14783 Duronio RJ. et al. (1992) OAT M12267 9 7e-133 car2 P07991 Dou~herty KM. et al. (1993) Oxidu.. du.,l~c S90469 6.7e-83 ncprl P16603 Eu)zster HP. et al. (1002 PDE4A M37744 Not pdel P22434 McHale et al. (1991) Detected PDE4A M37744 6.4e-15 pde2 P06776 McHale et al. (1991) PDE7 L12052 Not pdel P22434 Michaeli T. et al. (1993) Detected PFKM M26066 1.9e-192 pfk P16861 Heinisch JJ. et al. (1993) PYCRI M77836 4.9e-21 pro3 P32263 Dou~hertv KH. et al. (1993) RCCI D00591 1.4e-13 srml P34760 Clark KL. et al. (1991) (prp20) SEC13r L09260 2.1e-116 secl3 004491 ShaywitzDA. etal. (1995) snRMP Dl J03798 I.le-20 smdl 003260 Rvmond BC. et al. (1993) SPT4 T50643 6.0e-19 spt4 P32914 Hartzo~ G. et al. (1996. submitted) TOPI J03250 6.1e-195 topl P04786 Biornsti MA. et al. (1989) TYMK L16991 4. Ie-47 cdc8 P06776 Su JY. et al. (1991) UBCEPI M24507 4.5e-46 ubi3 P04839 Monia BP et al. (1990) VDACI L06132 9 8e-15 porl P04840 Blachlv-Dvson E. et al. (1993) VDAC2 L06328 2.8e-21 porl P04840 Blachlv-Dvson E. et al. (1993) XPD X52221 2.9e-293 rad3 P06839 Guzder SN. et al. (1995) SUBSTITUTE SHEET ~RULE 26) ~ ~ .
CA 022204~9 l997-ll-27 WO ~6/~0339 PCTAUS96/10002 Methods for introducing heterologous DNA into eukaryotic cells are well known inthe art and any such method may be used. In addition, cDNA encoding various phospholipases and other of the recombinant proteins described herein are known to those of skill in the art, or may be cloned by any method known to those of skill in the art. Generally, ligating a polynucleotide coding sequence into a gene construct, such as an expression vector, and tra~sforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or m~mm~ n) or prokaryotic (bacterial cells), are standard procedures used in producing other well-known proteins, including sequences encoding exogenous receptor and peptidelibraries. Similar procedures, or modifications thereof, can be employed to prepare recombinant reagent cells of the present invention by tissue-culture technology in accord with the subject invention.
In general, it will be desirable that the vector be capable of replication in the host cell.
It may be a DNA which is integrated into the host genome, and thereafter is replicated as a part of the chromosomal DNA, or it may be DNA which replicates autonomously, as in the case of a plasmid. In the latter case, the vector will include an origin of replication which is functional in the host. In the case of an integrating vector, the vector may include sequences which facilitate integration, e.g., sequences homologous to host sequences, or encoding integrases.
A number of vectors exist for the expression of recombinant proteins in yeast. For instance, YEP24, YIP5, YEP51, YEP52, pYES2, and YRP17 are cloning and expressionvehicles useful in the introduction of genetic constructs into S cerevisiae (see, for example, Broach et al. (1983) in Experimental Manipulation of Gene Expression, ed. M. Inouye Ac~-lPmic Press, p. 83, incorporated by reference herein). These vectors can replicate in E.
coli due the presence of the pBR322 ori, and in S cerevisiae due to the replication deterrnin~nt of the yeast 2 micron plasmid. In addition, drug resistance markers such as ampicillin can be used.
Moreover, it will be understood that the expression of a gene in a yeast cell requires a promoter which is functional in yeast. Suitable promoters include the promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255, 2073 (1980) or other glycolytic euzymes (Hess et al., J. Adv En~yme Req. 7, 149 (1968); and Holland et al. Biochemistry 17, 4900 (1978)), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokin~ce, pyruvate decarboxylase, phospho-fructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phospho-glucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO
Publn. No. 73,657. Other promoters, which have the additional advantage of transcription CA 022204~9 1997-11-27 W O 96/40939 PCT~US96/10002 controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphzlt~e, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3-phosphate dehydrogenase, as well as enzymes responsible for maltose and galactose utilization. Finally, S promoters that are active in only one of the two haploid mating types may be ~ pl;ate in certain circumstances. Among these haploid-specific promoters, the pheromone promoters MFal and MFa 1 are of particular interest.

III. Phospholipases As set out above, one aspect of the present invention encompasses the functionalexpression of a heterologous phospholipase in a yeast cell. A preferred phospholipase is phospholipase C. Preferred PLCs for carrying out the subject screening assays include any isotype of any of the four classes of phospholipases C (e g- a, ~1-4,1' 1&2 ,or ~1-3) The phospholipases may be recombinant forms of vertebrate (e.g. m~mm~ n, such as bovine, 15 porcine, caprine, laprine, feline, canine, rodent, human or non-human primate), invertebrate (e.g. insect), bacterial, non-bacterial or viral phospholipases. Preferred phospholipases of the present invention are m~mm~ n, with particularly I~ler~ d phospholipases being of human origin. Several human PLCs have also been cloned. For example, PLC (Genbank Accession number ~14034), PLC1 (Genbank Accession number M37238), PLC~2 (Genbank Accessionnumber M95678; see also Park et al. J. Biol. Chem. 199Z. 267:16048) and PLC,B3 (Genbank Accession number Z37566), see also Ohta, Matsui, Nazawa, La~,~l.;l~lL~ et al. (Genomics (1995) 20:467:472); PLC,B4 (Genbank Accession number L41349) see also Alvarez et al.
(1995) Genomics 29:53), PLC~1 (Genbank Accession number U09117) see also Cheng et al (1995) J. Biol. Chem 270:5495); PLC~ (Genbank Accession number M34667) see also Burgess et al. (1990) Mol Cell Biol. 10:4770) and PLCo~ (Genbank accession number D16234) see also Hirano et al. (1994) Biochem Biophys Res. Commun 204:375.
Moreover, the heterologous phospholipase need not be a naturally occurring protein, rather, it may be a mutant form of a phospholipase. Preferably, the mutant is substantially homologous to a naturally occurring phospholipase, or a mutant known to be functional.
Moreover, the structural gene encoding the phospholipase may be the wild-type m:~mm~ n gene, or a modified gene. "Silent" modifications may be made to improveexpression, by, e.g., (1) elimin~ting secondary structures in the corresponding mRNA, or (2) substituting codons ~l~r~llcd by yeast for codons that are not so preferred, or to facilitate cloning, e.g., by introducing, deleting or modifying restriction sites. The gene may also be modified so that a mutant phospholipase is encoded.

CA 022204~9 l997-ll-27 W O 96/~339 PCT~US96/10002 Analysis of yeast codon usage indicates that there exists a preferred codon set con~i~ting of the most abundant isoaccepting tRNAs present in yeast and that this pl~felled set (25 out of the 61 possible coding triplets) is the sarne for all yeast proteins (Bennetzen and Hall (1981) J. Biol. Chem. 257,3026-3031). The rapid translation rate required for abundant proteins is believed to provide the selective pressure for the existence of the preferred set of codons. As the extent of biased codon usage in specific genes correlates directly with the level of gene expression (Hoekma et al. (1987) Mol. Cell. Biol. 7,2914-2924), experimental strategies aimed at the expression of heterologous genes in yeast exploit the codon bias that has been described for that organism (Sharp et al. (1986) Nuc. Acids Res. 14,5125-5143).
For in~t~nce, as described in details in the Exemplification, the amino termin~l seven residues of PLC-,Bl and the amino terminal 21 residues of human PLC-132 can be mutated using synthetic oligonucleotides to effect these changes. The nucleotide sequence of each construct may be subsequently verified by dideoxynucleotide seq~lencing methods on both DNA strands. Other desirable, conservative amino acid substitutions not specifically cited here may be made to the phsopholipase sequence without any ~limini~hment of wild type protein activity.

CA 022204~9 1997-11-27 WO ~6/1~39 PCTAJS96/10002 IV. Other Re~ulatorv Proteins In certain embo~liment~, the yeast cells of the present invention can be further~ engineered to express one or more regulatory proteins which regulate an exogenous 5 phospholipase. Preferred regulatory proteins are G-protein coupled receptors, G proteins, receptor tyrosine kinases, and/or non-receptor kinases. Examples of other regulatory proteins are proteins which bind to phospholipase substrates and influence the activity of a phospholipase, such as profillin. Phospholipase regulatory proteins are described in detail below.

A. G Protein-Coupled Receptors One family of signal transduction c~cc~rles found in eukaryotic cells utilizes h~le~ leric "G proteins." Transduction of growth signals by G protein-coupled receptors has been demonstrated to include phospholipase-dependent pathways. For example, ~-type 15 PLC isoforms are activated by the heterotrimeric G protein subfamily Gq. The a-subunits of Gq/~ 6, to further illustrate, specifically regulate PLC-,~1 and PLC-,~3, and the ,B/r-subunits of the Gi subfamily interact with PLC-,B2. Agonist interaction with specific G protein-coupled receptors causes the dissociation of Gq proteins into Ga and G ,s/r subunits and the exchange of GDP bound to Ga for GTP. The resulting GTP-bound Ga subunit then activates 20 certain PLC isoforms, such as PLC,B's, by binding to the enzyme. G protein .~i~n~ling systems include three components: a receptor, a GTP-binding protein (G protein), and an intracellular target protein.
In their resting state, the G proteins, which consist of alpha (a), beta (O and gamma (r) subunits, are complexed with the nucleotide guanosine diphosphate (GDP) and are in 25 contact with receptors. When a ligand engages the receptor, the receptor changes conformation and this alters its interaction with the G protein. This spurs the a subunit to release GDP, and the more abundant nucleotide guanosine triphosphate (GTP), replaces it, thus activating the G protein. The G protein then dissociates to separate the a subunit from the still complexed ~ and r subunits. The activated state lasts until the GTP is hydrolyzed to ~ 30 GDP by the intrinsic GTPase activity of the a subunit. Either the Ga subunit, or the G~r complex, depending on the pathway, interacts with an effector such as a phospholipase. In the instance of phospholipases, the enzyme in turn converts an inactive precursor molecule into an active "second messenger," which may diffuse through the cytoplasm, triggering a metabolic c~ le. Over time, the Ga converts the GTP to GDP, thereby inactivating itself.
35 The inactivated Ga may then reassociate with the G~y complex.

CA 022204~9 1997-11-27 WO 96/40939 PCT~US96/10002 Hundreds, if not thousands, of receptors tr~n~(1nce signals through heterotrimeric G
proteins, of which at least 17 distinct forms have been isolated. Although the greatest variability has been seen in the a subunit, several different ~ and y structures have been reported. There are, additionally, several different G protein-dependent effectors.
Most G protein coupled receptors are comprised oi~ a single protein chain that is threaded through the plasma membrane seven times. Such receptors are often referred to as seven transmembrane receptors (STRs). The following is a partial list of seven transmembrane domain receptors that have been reported in the literature to be coupled to phosphoinositide metabolism in cells and accordingly suitable for generating the subject reagent cell: an alA-adrenergic receptor, an alB-adrenergic receptor, an alC-adrenergic receptor, an Ml ACh receptor, an M3 ACh receptor, an M5 ACh receptor, a D2 dopamine receptor, a D3 dopamine receptor, an Al adenosine receptor, a 5HT1-like receptor, a SHTld-like receptor, a SHTld beta receptor, a substance K (neurokinin A) receptor, a f-Met-I,eu-Phe (FMLP) receptor, an angiotensin II type 1 receptor, a mas proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a growth hormone-releasing hormone (GHRH) receptor, a vasoactive in~estinzll peptide receptor, an oxytocin receptor, a SST3 receptor, an Ll1tini7ing hormone/chorionic gonadotropin (LH/CG) receptor, a thromboxane A2 receptor, a platelet-activating factor (PAF) receptor, a C5a anaphylatoxin receptor, an Interleukin 8 (IL-8), IL-8A receptor, an IL-8B receptor, a mip-1/RANTES receptor, a metabotropic glutarnate mGlul-5 receptor, an ATP receptor, an amyloid protein precursor -receptor, a bradykinin receptor, a gonadotropin-releasing hormone receptor, a cholecystokinin receptor, an antidiuretic hormone receptor, an adrenocorticotropic hormone II receptor, LTB4 receptor, LTD4 receptor, tachykinin receptor, thyrotropin releasing hormone receptor, vasopressin receptor and oxytocin receptor Cloning references for exemplary G protein coupled recepotors are provided in Table 1.

RECEPTORS: REFERENCES FOR CLONING

RECEPTOR REFERENCE
a1A-adrenergic receptor Bruno et al. (1991) a1 g-adrenergic receptor Ramarao et al. (1992) m1l~c~nnic receptors: Ml AChR, M2 AChR, Bonner et al (1987) M3 AChR, Peralta et al. (1987) M5 AChR Bonner et al. (1988) D~ dopamine Grandy et al. (1989)1 CA 022204~9 1997-11-27 W O9Ç'4~3g PCTAUS96/10002 D3 dopamine Sokoloff et al. (1990) Al adenosine Libert et al. (1992) 5-HTla Kobilka et al. (1987) Fargin et al. (1988) 5-HTlb Hamblin et al. (1992) Mochizuki et al. (1992) 5HT1-like Levy et al. (1992a) 5-HTld Levy et al. (1992b) 5HTld-like Hambln and Metcalf (1991) 5HTld beta Demchyshyn et al. (1992) substance K (neurokinin A) Gerard, et al. (1991);
Takeda et al. (1991) f-Met-Leu-Phe Boulay et al. (1991) Murphy & McDermott (1991) DeNardin et al. (1992) angiotensin II type 1 Furuta et al. (1992) mas proto-oncogene Young et al. (1986) endothelin ETA Hayzer et al. (1992) Hosoda et al. (1991) endothelin ETB Nakamuta et al. (1991) Ogawa et al. (1991) thrombin Vu et al. (1991) growth horrnone-releasing hormone (GHRH) Mayo (1992) vasoactive intestinal peptide (VIP) Sreedharan et al. (1991) oxytocin Kimura et al. (1992) somatostatin Yamada et al. (1992a) SSTR3 Yamada et al. (1992b) Leutenizing hormone/chorionic gonadotrophin Minegish et al. (1990) thromboxane A2 Hirata et al. (1991) platelet-activating factor (PAF) Kunz et al. (1992) - C5a anaphylatoxin Boulay et al. (1991) Gerard and Gerard (1991) ~ IL-8RA Holmes et al. (1991) IL-8RB - Murphy and Tiffany (1991) MIP-1/RANTES Neote et al. (1993) Murphy et al., in press CA 022204~9 1997-11-27 WO ~C/1~939 PCT~US96/10002 metabotropic glnt~m~te mGluRl-6 Tanabe et al. (1992) ATP Julius, David (unpub.) amyloid protein precursor Kang et al. (1987) Mita et al. (1988) Lemaire et al. (1989) bradykinin Hess et al. (1992) gonadotropin-releasing hormone Chi et al. (1993) cholecystokinin Pisegna et al. (1992) antidiuretic hormone receptor Birnbaumer et al. (1992) adrenocorticotropic hormone II Mountjoy et al. (1992) Specific human G protein-coupled receptors for which genes have been isolated and for which expression vectors could be constructed include those listed herein and others known in the art. Thus, the gene would be operably linked to a promoter functional in the cell to be en~in~ered and to a signal sequence that also functions in the cell. For example in the case of yeast, suitable promoters include those derived from Ste2, Ste3 and ~all genes.
Suitable signal sequences include those of Ste2, Ste3 and of other genes which encode proteins secreted by yeast cells. As appropriate, the yeast genome is preferably modified so that it is unable to produce the yeast analog of the recombinant receptor in functional form.

B. G protein subunits PLC-,(~ enzymes are activated in response to ligand binding to G-protein coupledreceptors by hormones, n~ul~ niLlel~, small molecules and other agonists. This occurs via a pertussis toxin insensitive mech~ni~m mediated by members of the Gq family of Ga subunits as well as via a pertussis toxin sensitive mechanism mediated by G-protein complexes cont~inin~ Ga subunits of the Gi or Go family. With respect to activation of PLC-,B enzymes by Gq family members, all members of the Gq family (q, 11, 14, 15, and 16) have been demonstrated both in vitro and in cell culture systems to directly stim~ te the catalytic activity of PLC-~ 32, and -,~3 and -134 enzymes (A.J. Morris et al 1990, and references therein; Sternweis and Smrka, 1992, Wu et al. 1992, and Lee et al. 1992).
Members of other Ga subunit families (Gi, Go, Gt, Gz), on the other hand, do not directly stimlll~te PLC-~ activity. The observation that in some cell types stimulation of PLC-~
enzymes is sensitive to pertussis toxin tre~tm~nt is now understood to be due to the direct effect of G~3~ subunits on PLC-~ isozymes (sllmm~ri~d in Boyer et al. 1994, and Clapham and Neer, 1993). Recent work from a number of laboratories has demonstrated that P~C-,B
isoforms (in particular PLC-,B2 and -~3) are sensitive to stimlll~tion directly by G,B~ subunits.

CA 022204~9 1997-11-27 W O~'4~339 PCT~US96/10002 Thus, G,By subunits derived from Gai or GaO-cont~ining heterotrimers could contribute to the pertussis toxin sensitivity of PLC-,13 stimulation observed in whole cell systems in the past. Certain of the regions of PLC-,13 isozymes that are required for activation by Ga or G,B
r subunits have been characterized. For instance, deletion mutations have shown that S residues at the carboxyl terminll~ of PLC-~Bl (Wu et al, 1993) are crucial for interaction with Ga subunits, while residues at the amino terrninll~ appear to be t~cs~nti~l for interaction with G,'3r subunits, perhaps through binding of G,B~ subunits to a presumptive pleckstrin homology present in the amino terminal 150 residues of PLC-,B2 (Inglese et al. 1995, and references therein).
In certain embodiments of the invention it may be desirable to express both a phospholipase and one or more exogenous G protein subunits, for example, a G protein a subunit. If the exogenous G a subunit is not adequately coupled to the endogenous yeast G,l~r or G protein coupled receptor, the Ga subunit may be modified to improve coupling.
These modifications often will take the form of mutations which, relative to interaction with the receptor or G13~ complex, increase the resemblance of the Ga subunit to the yeast Ga while decreasing its resemblance to the receptor-associated Ga. For example, a residue may be changed so as to become identical to the corresponding yeast Ga residue, or to at least belong to the same exchange group of that residue. After modification, the modified Ga subunit might or might not be "substantially homologous" to the foreign and/or the yeast Ga 20 subunit.
The modifications are preferably concentrated in regions of the Ga which are likely to be involved in one or both of receptor binding and G,13r binding. In some embo~liment~, the modifications will take the form of replacing one or more segments of the receptor-associated Ga with the corresponding yeast Ga segment(s), thereby forming a chimeric Ga subunit.
25 (For the purpose of the appended claims, the term "segment" refers to three or more consecutive amino acids.) In other embo-liment~, point mutations may be sufficient.
This chimeric Ga subunit will interact with the endogenous receptor and the yeast G~y complex, thereby permitting signal transduction to occur via a pathway which includes the heterologous phospholipase. While use of the endogenous yeast G~r is preferred7 if a 30 foreign or chimeric G,Br capable of transducing the signal to the recombinant phospholipase - may be used instead.

C. Tyrosine Kinases Certain phospholipase, such as PLC-r enzymes, are activated directly in response to 35 phosphorylation of key tyrosine residues by both receptor and non-receptor tyrosine kinases CA 022204~9 1997-11-27 W 096/40939 PCT~US96/10002 (Surnmarized in Cook and Wakelam, 1992b). Examples of receptors which mediate PLCy activation include those for epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor, platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), nerve growth factor (NGF), and erbB2 which have intrinsic tyriosine kinase activity (Kumjian et al. (1991) J: Biol. Chem. 266:3973, Margolsis et al. 1989. Cell 57:1101;
~ei~Pnh~lder et al. 1989. Cell 57: 1109; Moh~mm~-li et al. l 9g 1. Mol. Cell. Biol. 11 :5068;
Stephens et al. 1994. ~euron 12:691). Other receptor systems which are devoid of intrinsic enzymatic activity are also linked to PLC. These include receptors for a range of cytokines (Boulton et al. 1994. ~ Biol. Chem. 269:11648), erythropoietin (Res et al. 1994. J Biol.
10 Chem. 269:19633), and thrombin (Guinebault et al. 1993. Biochem J. 292:851), as well as multisubunit immune recognition receptors (MIRRs) such as membrane immunoglobulin M
and CD40 in B Iymphocytes (Coggeshall, et al. 1992. Proc. Natl. ~cad Sci. USA 89:5660;
Ren et al. 1994. J ~xp. Med 179:673), the T-cell antigen receptor (Park et al. 1991. Proc.
Natl. Acad. Sci. USA 88:5453; Weiss and Littman. 1994. Cell 76:253), the high-affinity 15 immunoglobulin E receptor in basophilic lellkemi~ cells (Li et al. 1992. Mol. Cell. Biol.
12:3176; Park et al. 1991. J~ Biol. Chem. 266:24237), and the immllnnglobulin G receptor in monocytic cells (Liao et al. 1993. Biochem. Biophys. Res. Commun. 191: 1028). When the receptor has no intrinsic tyrosine kinase activity, non-receptor protein tyrosine kinases coupled to the receptor mediate the response, such as members of the Src and Syk/ZAP70 20 family, including lyn, syk and fyn (Liao et al. supra; Rhee et al. 1992. Adv. Second Messenger Phosphoprotein Res. 26:35-61; Weiss and Littman, supra).
PLC-~ isozymes bind to specific autophosphorylated tyrosine residues within the kinase domains of these PTKs via the SH2 domains present in the spacer region between the PLC X and Y regions and the PLCs themselves become substrates for tyrosine 25 phosphorylation. Phosphorylation of specific tyrosine residues (Tyr783 and Tyrl254 on PLC-~I and Tyr753 and Tyr759 on PLC-y2) by the receptor associated tyrosine kinase activities in turn increases the catalytic activity of PLC-~ isozymes which results in increased production of l ,4,5-IP3 and sn- l ,2-diacylglycerol (DAG).

30 D Other Regulatory Proleins Yet other regulatory proteins may be coexpressed with a heterologous phospholipase in yeast cells. Recent work has also focused on the interaction between cytoskeletal elements and polyphosphoinositides. For example PtdIns(4,5)P2 has been found to bind to profilin.
(Vojtek et al. (1991) Cell 66:497). PIP2-binding proteins are known to bind actin and to 35 regulate its assembly in vivo, suggesting a possible role for PIP2 hydrolysis by PLC enzymes in the regulation of cytoskeletal org~ni7~tion, volume regulation, and in other cellular CA 022204~9 1997-11-27 W O 96140939 PCT~US96/10002 functions related to the state of cytoskeletal assembly. Furthermore, Gol~lcçhmi~lt-Clermont et al. (1991) Science 251:1231 demonstrated a role for profilin in regulating PI turnover in vivo by showning that profilin-bound PIP2 was found to be resistant to cleavage by PLC-yl except when the PLC-yl had been activated by tyrosine phosphorylation. Other exemplary 5 molecules which may regulate a phospholipase include profilin, gelsonin, cofilin, alpha-actin, and villin. The binding sites for PtdIns(4,5)P 2 on gelsolin and villin have recently been identified (Janmey et al.,(1992) J. Biol Chem 267:11818).
Recent studies of PLC-~ regulation suggest that it may be regulated by a novel class of regulatory proteins (pl22-RhoGAP) that show similarity to the GTPase activating protein 10 homology region of bcr, display GAP activity towards RhoA, and bind to and directly stimulate PLC-ol (Homma, Y., and Y. Emori, 1995) Other reports suggest that rho can regulate PtdIns(4,5)P2 levels (Chong et al. (1994) Cell 79:507).
Also some PLCs such as PLC,~1 (Bernstein and Ross) have a GAP-like activity for certain Gq family members. This activity serves to down regulate the activity of both the Gq 15 and the PLC itself.
Other exemplary regulatory proteins include: IP3 receptors, calcium ch~nnelc, DAG
protein kinase C (PKC), PKA3 (cAMP dependent protein kinase catalytic subunit), SOK1 (suppressor of PKA o~e~ ession), CMD1 (calmodulin, CMK1 (Calcium/calmodulin dependent protein kinase), and CMK2 (calmodulin dependent protein kinase).

V. Drug Screening In certain embo~liment.c, the assay is characterized by the use of recombinant cells to sample a variegated compound library for phospholipase agonists and/or antagonists. In l,lertlled embo~limentc, the reagent cells express a m~mm~ n phospholipase capable of 25 producing a detectable signal in the reagent cell.
In certain embo(1imentc, the reagent cell also produces the test compound which is ~being screened. For instance, the reagent cell can produce a test polypeptide, a test nucleic acid and/or a test carbohydrate which is screened for its ability to modulate the mzlmm~ n phospholipase activity. In such embodiments, a culture of such reagent cells will collectively 30 provide a variegated library of potential phospholipase effectors and those members of the library which either agonize or antagonize the phospholipase function can be selected and ~ identified. Moreover, it will be apparent that the reagent cell can be used to detect agents which directly alter the activity of the m~mm~ n phospholipase, or which act on some target upstream or downstream of the mzlmm~ n phospholipase.

CA 022204~9 l997-ll-27 W O ~f'103~9 PCT~US96/10002 In other embodiments, the test compound is exo~çenously added. In such embodiments the test compound is contacted with the reagent cell. Exemplary compounds which can be screened for activity include peptides, nucleic acids, carbohydrates, small organic molecules, and natural product extract libraries. In such embodiments, both S compounds which agonize or antagonize the phospholipase function can be selected and identified. Moreover, it will be a~,~dlelll that the reagent cell can be used to detect agents which directly alter the activity of the m~mm~ n phospholipase, or which act on some target upstream or downstream of the m~rnm~ n phospholipase.
In still other embo~liment~7 the test compound is produced by cells which are 10 cocultured with the reagent cells expressing a m~mm~ n phospholipase.

,4. Screening and Selection: ,4ssays of Second Messenger Generation When screening for bioactivity of peptides, intracellular second messenger generation can be measured directly. Fxempl~ry assays for the direct measurement of phospholipase 15 generated second mes~ngers are provided below; other assays for the measurement of second messengers generated in a signal transduction pathway involving a phospholipase will be a~pa~ to those of skill in the art and may be substituted for the assays described below.
In one embodiment, the phospholipase enzymatic activity can be measured in yeastcell extracts. In other embodiments measurements of a detecting a phospholipase activity 20 are made using intact yeast cells.
Certain receptors stimul~t~ the activity of phospholipase C which stimlll~tes the breakdown of phosphatidylinositol 4,5, bisphosphate to 1 ,4,5-IP3 (which mobilizes intracellular Ca++) and diacylglycerol (DAG) (which activates protein kinase C). Inositol lipids can be extracted and analyzed using standard lipid extraction techniques. DAG can 25 also be measured using thin-layer chromatography. Water soluble derivatives of all three inositol lipids (IPI, IP2, IP3) can also be ~lu~lLi~t~d using radiolabelling techniques or HPLC.
The mobilization of intracellular calcium or the inilux of calcium from outside the cell can be measured using standard techniques. The choice of the appropriate calcium 30 indicator, fluorescent, bioluminescent, metallochromic, or Ca++-sensitive microelectrodes depends on the cell type and the magnitude and time constant of the event under study (Borle (1990) Environ Health Perspect 84:45-56). As an exemplary method of Ca++ detection, cells could be loaded with the Ca++sensitive fluorescent dye fura-2 or indo-l, using standard methods, and any change in Ca+~ measured using a fluorometer.

CA 022204~9 1997-11-27 The other product of PIP2 breakdown, DAG can also be produced from phosphatidyl choline. The breakdown of this phospholipid in response to receptor-mediated .~ign~lin~ can also be measured using a variety of radiolabelling techniques.
The activation of phospholipase A2 can easily be qll~ntit~tçd using known 5 techniques, including, for example, the generation of arachadonate in the cell.
In certain embodiments of the assay, it may be desirable to screen for changes in cellular phosphorylation. The ability of compounds to modulate phospholipase activation could be screened using colony immunoblotting (Lyons and Nelson (1984) Proc. Natl. Acad.
Sci. US,4 81 :7426-7430) using anti-phosphotyrosine. Reagents for p~lrO~llli~lg such assays 10 are commercially available, for example, phosphotyrosine specific antibodies which measure increases in tyrosine phosphorylation and phospho-specific antibodies can be purchased (New England Biolabs, Beverly, MA). Tests for phosphorylation could be useful to measure the phosphorylation of proteins in response to the modulation of a phospholipase activity; it is noted that protein phosphorylation need not be directly affected by the modulation in 15 phospholipase activity, but rather may amplify signals generated by the phospholipase.
Multi-kinase ç~c.~clçs allow not only signal amplification but also signal divergence to multiple effectors that are often cell-type specific, allowing a growth factor to stimulate mitosis of one cell and differentiation of another.
One such cascade is the MAP kinase pathway that appears to mediate both mitogenic, 20 differentiation and stress responses in different cell types. Stimulation of growth factor receptors results in Ras activation followed by the sequential activation of c-Raf, MEK, and p44 and p42 MAP kinases (ERKl and ERK2). Activated MAP kinase then phosphorylates many key regulatory proteins, including p90RSK and Elk-l that are phosphorylated when MAP kinase translocates to the nucleus. Homologous pathways exist in m~mm~ n and25 yeast cells. For instance, an ç~f nti~l part of the S. cerevisiae pheromone sign~lin~ pathway is comprised of a protein kinase cascade composed of the products of the STEl l, STE7, and FUS3/KSSl genes (the latter pair are distinct and functionally re~ n~l~nt). Accordingly, phosphorylation and/or activation of members of this kinase cascade can be detected and used to assay phospholipase modulation.

B. Complementation Techniques to assay for complementation of a mutant endogenous yeast gene are well known in the art; numerous assays exist for the selection of auxotrophs. For example, as described in detail herein, conditional PLC1 mutations lead to a pleitropy of phenotypes 35 expressed in yeast under nonper-missive conditions and have been complemented by CA 022204~9 l997-ll-27 WO ~C/4D339 PCTAUS96/10002 functional ~x~lc~sion of m~mm~ n PLCs. In one embodiment of the present assay it will be possible to test for agonists and/or antagonists of a functionally integrated, exogenous phospholipase by observing reversion to the original mutant phenotype. For example, yeast may cease to display a telllpeldlure or NaCl sensitive phenotype upon expression of a 5 m~mm~ n PLC, and may revert to a temperature or NaCl sensitive phenotype upon tre~tm~nt with an antagonist of the exogenous PLC.

C Screening and Selection Using Reporter Gene Constructs Reporter gene based assays of this invention measure the end stage of the above 10 described cascade of events, e.g., transcriptional modulation. Accordingly, in practicing one embodiment of the assay, a reporter gene construct is inserted into the reagent cell in order to generate a detection signal dependent on phospholipase .ci~n~ling. Typically, the reporter gene construct will include a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to phospholipase signal modulation, with the 15 level of expression of the reporter gene providing the receptor-dependent detection signal. If only one transcriptional regulatory element is included it must be a regulatable promoter. At least one the selected transcriptional regulatory elements must be indirectly or directly regulated by the activity of the heterologous phospholipase whereby activity of the phospholipase can be monitored via transcription of the reporter genes.
Many reporter genes and transcriptional regulatory elements are known to those of skill in the art and others may be identified or synthe~i7~tl by methods known to those of skill in the art.
A reporter gene includes any gene that expresses a detectable gene product, which may be RNA or protein. Preferred reporter genes are those that are readily detectable. The reporter gene may also be included in the construct in the form of a fusion gene with a gene that includes desired transcriptional regulatory sequences or exhibits other desirable properties.
Examples of reporter genes include, but are not limited to CAT (chloramphenicol acetyl transferase) (Alton and Vapnek (1979), Nature 282: 864-869) luciferase, and other en_yme detection systems, such as beta-galactosidase; firefly luciferase (deWet et al. (1987), Mol. Cell. Biol. 7:725-737); bacterial luciferase (Engebrecht and Silverman (1984), PNAS 1:
4154-4158; Baldwin et al. (1984), Biochemistry 23: 3663-3667), ~Ik~line phosphatase (Toh et al. (1989) Eur. J. Biochem. 182: 231-238, Hall et al. (1983) J. Mol. Appl. Gen. 2: 101), human placental secreted ~lk~line phosphatase (Cullen and Malim (1992~ Methods in Enzymol. 216:362-368).

-CA 022204~9 l997-ll-27 W096/40939 PCT~US96/10002 Transcriptional control elements which may be included in a reporter gene construct include, but are not limited to, promoters, enhancers, and repressor and activator binding sites. Suitable transcriptional regulatory elements may be derived from the transcriptional regulatory regions of genes whose expression is rapidly induced, generally within minlltes, after modulation of a phospholipase. Examples of such genes include those which are responsive to the second messengers generated upon phospholipase activation, such as Ca++, cAMP, and others. One such gene is c-fos, an immediate early gene (see, Sheng et al. (1990) Neuron 4: 477-485). Immediate early genes are genes that are rapidly induced upon binding of a ligand to a cell surface protein. The characteristics of preferred genes from which the 10 transcriptional control elements are derived include, but are not limited to, low or undetectable expression in quiescent cells, rapid induction at the transcriptional level within minlltes of exkacellular simlll~tion, induction that is transient and independent of new protein synthesis, subsequent shut-off of transcription requires new protein synthesis, and mRNAs transcribed from these genes have a short half-life. It is not necessary for all of these 15 properties to be present.
The amount of transcription from the reporter gene may be measured using any method known to those of skill in the art to be suitable. For example, specific mRNA
expression may be cl~tectc~l using Northern blots or specific protein product may be identified by a characteristic stain or an intrinsic activity.
In preferred embo~liment~, the gene product of the reporter is detected by an intrinsic activity associated with that product. For instance, the reporter gene may encode a gene product that, by enzymatic activity, gives rise to a detection signal based on color, fluorescence, or Illminescence.
The amount of expression from the reporter gene is then compared to the amount of expression in either the same cell in the absence of the test compound or it may be compared with the amount of transcription in a substantially identical cell that lacks heterologuos DNA, such as the phospholipase. Any statistically or otherwise significant difference in the amount of transcription indicates that the test compound has in some manner altered the activity of the phospholipase.
In other pl~f~lled embodiments, the reporter or marker gene provides a selectionmethod such that cells in which the peptide is a ligand for the receptor have a growth advantage. For example the reporter could enhance cell viability, e.g., by relieving a cell nutritional requirement, and/or provide resistance to a drug. For example the reporter gene could encode a gene product which confers the ability to grow in the presence of a selective agent, e.g., canavanine.

CA 022204~9 1997-11-27 For example,use of the S cerevisiae plcl ~ allele as an endogenous mutant phospholipase C gene provides a readout system, whereby functional complementation (i.e.
detection of the second detectable phenotype rather than the first detectable phenotype) can be detected or quantitated by cell growth. However, growth systems suffer from their 5 "quantal" nature. Other readout systems, which provide a dirr~lellL detectable phenotype when the endogenous, mutant phospholipase C is complemented by the expression ofheterologous phospholipase C may be more sensitive in a given range or may be more convenient for automation. For example, a transcriptionally based readout may be ~rer~lled because it is rapid (i.e. hours instead of days) and affords greater flexiblity both in terms of 10 types of readout and dynamic range of the readout. For example, by placing the bacterial gene encoding lacZ under the control of the promoter sensitive to signals generated upon activation of a phospholipase pathway can be detected in less than an hour by monitoring the ability of permeabilized yeast to produce color from a chromogenic substrate. The rapidity of such a readout would, in itself, be advantageous. And such a readout would be necessary to 15 monitor phospholipase activity under conditions where the yeast do not grow.
A transcriptional readout can be developed by identifying genes/promoters that are positively or negatively regulated by the PLC1 locus (i.e. promoters that are up or down-regulated in PLCl vs. plclA strains or in plcl~ strains expressing human PLC-,B2 plus Ga 16). These promoters can then be linked to a reporter gene. Alternatively, the reporter gene 20 can be expressed in response to a downstream phospholipase C signal molecule, such as IP3, DAG, increased intracellular calcium levels or increased PKC activity.
For example, a transcriptional based readout can be constructed using yeast expressing m~mm~ n PLC enzymes in the following mamler. CREB is a transcription factor whose activity is regulated by phosphorylation at a particular serine (S133). When this 25 serine residue is phosphorylated, "phospho-CREB", binds to a recognition se~uence known as a CRE (cAMP Responsive Element) found to the 5' of promotors known to be responsive to elevated cAMP levels. Upon binding of phosphorylated CR~B to a CRE, transcription from this promoter is increased. Phosphorylation of CREB is seen in response to both increased cAMP levels and increased intracellular calciurn levels. Increased cAMP levels 30 result in activation of protein kinase A, which in turn phosphorylates CREB and leads to binding to CRE and transcriptional activation. Increased intracellular calcium levels results in activation of calcium/calmodulin responsive kinases (CaM kinases). Phosphorylation of CREB by CaM kinase IV is effectively the sarne as phosphorylation of CREB by PKA, and results in transcriptional activation of CRE cont~inin~ promotors.
Therefore, a transcriptional-based readout can be constructed in plcl~ yeast strains expressing a m~mm~ n PLC enzyme, regulatory proteins (G a and/or G~y), if n~cees~ry, _ -CA 022204~9 1997-11-27 W O 96140939 PCT~US96/10002 and/or a reporter gene (i.e. lacZ) whose expression is driven by a basal promoter containing one or more CREs in the following manner. Changes in the intracellular concentration of Ca~ (a result of alterations in the activity of the recombinant PLC) will result in changes in the level of expression of the reporter gene if: a) CREB is also co-expressed in the cell, and 5 b) either the endogenous yeast CaM kinase will phosphorylate CREB in response to increases in calcium or if an exogenously expressed CaM kinase IV is present in the same cell. In other words, stimulation of PLC activity will result in phosphorylation of CREB and increased transcription from the CRE-lacZ construct, while inhibition of PLC activity will result in decreased transcription from the CRE-lacZ construct.
In one embodiment, the promoter is activated upon activation of the phospholipase, in which case, for selection, the expression of the marker gene should result in a benefit to the cell. A preferred marker gene is the imidazoleglycerol phosphate dehydratase gene (HIS3).
If a phospholipase responsive promoter is operably linked to a beneficial gene, the cells will be useful in screening or selecting for phospholipase activators. If it is linked to a deleterious 15 gene, the cells will be useful in screening or selecting for inhibitors.
Alternatively, the promoter may be one which is repressed by phospholipase, thereby preventing e2~le~ion of a product that is deleterious to the cell. With a phospholipase-repressed promoter, one screens for agonists by linking the promoter to a deleterious gene, and for antagonists, by linking it to a beneficial gene.
Repression may be achieved by operably linking a phospholipase-intlll~ ed promoter to a gene encoding mRNA that is arltisense to at least a portion of the mRNA encoded by the marker gene (whether in the coding or fl~nking regions), so as to inhibit translation of that mRNA. Repression may also be obtained by linking a phospholipase induced promoter to a gene encoding a DNA-binding repressor protein, and incorporating a suitable operator site into the promoter or other suitable region of the marker gene.
In yeast, suitable positively selectable (beneficial) genes include the following:
URA3, LYS2, HIS3, LEU2, TRPl; ADEl,2,3,4,5, 7,8; ARGI, 3, 4, 5, 6, 8; HISl, 4, 5; ILVl, 2, 5; THRl, ~; TRP2, 3, 4, 5; LEUl, 4; MET2,3,4,8,9,14,16,19; UR~1,2,4,5,10; HOM3,6, ASP3; CHOl; ARO 2, 7; CYS3; OLEl; IN01,2,4; PR01,3 Countless other genes are potential selective markers. The above are involved in well-characterized biosynthetic pathways. The imidazoleglycerol phosphate dehydratase (IGP dehydratase) gene (;~) is preferred because it is both quite sensitive and can be selected over a broad range of expression levels. In the simplest case, the cell is auxotrophic for histidine (requires histidine for growth) in the absence of activation. Activation leads to synthesis of the enzyme and the cell becomes prototrophic for histidine (does not require histidine). Thus the selection is for growth in the CA 022204~9 1997-11-27 absence of hi~ti~line. Since only a few molecules per cell of IGP dehydratase are required for histidine prototrophy, the assay is very sensitive.
In ~ro~liate assays, so-called counterselectable or negatively selectable genes may be used. Suitable genes include: URA3 (orotidine-5'-phosphate decarboxylase, inhibits S growth on 5-fluoroorotic acid), LYS2 (2-aminoadipate reductase; inhibits growth on a-aminoadipate as sole nitrogen source), CYH2 (encodes ribosomal protein L29;
cycloheximide-sensitive allele is ~ minz-nt to resistant allele), CAN 1 (encodes arginine permease; null allele confers resistance to the arginine analog canavanin), and other recessive drug-resistant markers.
The marker gene may also be a screenable gene. The screened characteristic may be a change in cell morphology, metabolism or other screenable features. Suitable markers include beta-galactosidase (Xgal, C 1 2FDG, 3almon-gai, Magenta-Gal (latter two from Biosynth Ag)), ~1kzl1ine phosphatase, horseradish peroxidase, exo-gluc~n~e (product of yeast exbl gene, nonessential, secreted); luciferase; bacterial green fluorescent protein; (human 15 placental) secreted ~lk~line phosphatase (SEAP); and chlorarnphenicol transferase (CAT).
Some of the above can be engineered so that they are secreted (although not 13-galactosidase).
A p~r~llcd screenable marker gene is beta-galactosidase; yeast cells expressing the enzyme convert the colorless substrate Xgal into a blue pigment. Again, the promoter may be receptor-in(l~ e~l or receptor-inhibited.

D. Detection of Inhibi~ion or ~ctivation of Proteins Other Than Phospholipase The present invention also facilitates the detection of inhibitors or activators of proteins other than phospholipase provided that the yeast cell expresses or is engineered to 25 express the protein of interest in such a manner that it is functionally "coupled", directly or indirectly, to the phospholipase.
For example, the yeast cells can also be used in more general readout systems for modulation of the activity of a variety of different cellular sign~llin~ components which regulate phospholipase activation, such as receptors, which are known to couple to 30 phospholipases, either directly, (e.g. the PDGF receptor) or via a regulatory protein (e.g. a G-protein coupled receptor or tyrosine kinase coupled receptor); a G-protein hete~)Llilller; a G a subunit; a G,13~ subunit; another protein known to interact functionally with a known phospholipase substrate (e.g., profilin, gelsolin, cofilin, and alpha-actin); and other effectors whose activity is dependent on phospholipase C activity (i.e., IP3 receptors/calcium chzlnnel~, CA 022204~9 1997-11-27 W O ~6/~03~9 PCT~US96/10002 other potential IP3 sensitive calcium channels, and other calcium sensitive enzyme activities such as PKC or CaM kinase).
In a pl~f~ d embodiment the yeast cells of the present invention may be used to identify drugs which modulate the activity of a m~mm~lian G protein-coupled receptor. In 5 this embodiment, the yeast cell is engineered to express a mamm~lian G protein-coupled receptor.

E. Test Compounds Exemplary compounds which can be screened for activity include peptides, nucleic10 acids, carbohydrates, small organic molecules, and natural product extract libraries.
One class of potential modulators of particular interest is the peptide class. The term "peptide" is used herein to refer to a chain of two or more amino acids, with adjacent amino acids joined by peptide (-NHCO-) bonds. Thus, the peptides of the present invention include oligopeptides, polypeptides, and proteins. Preferably, the peptides of the present invention are 2 to 200, more preferably 5 to 50, amino acids in length. The minimum peptide length is chiefly dictated by the need to obtain sufficient potency as an activator or inhibitor. The m~imllm peptide length is only a function of synthetic convenience once an active peptide is identified.
Synthetic peptides are also of interest. By way of example, peptides based on the calmodulin-binding domain of calmodulin-dependent phospholipases could serve as modulators of phospholipase activity. In addition, peptides or molecules of any structure which inhibit the interaction between the phospholipase and known endogenous modulators of phospholipase activity are of interest. Known endogenous phospholipase modulators include Ca2+, Ca2+/calmodulin, protein kinase C, protein kinase A, Gas, Gai, G~, and adenosine.
When peptide drugs are being assayed, the yeast cells may be engineered to express the peptides, rather than being exposed to the peptides simply by adding the peptides to the culture medium. Peptide libraries are systems which simultaneously display, in a form which permits interaction with a target, a highly diverse and numerous collection of peptides. These peptides may be presented in solution (Houghten 1991), or Oll beads (Lam 1991), chips (Fodor 1991), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Cull 1992) or on phage (Scott, Devlin, Cwirla, Felici, Ladner '409). Many of these systems are limited in terms of the m~ x i ~ l l " length of the peptide or the composition of the peptide (e.g., Cys excluded). Steric factors, such as the proximity of a support, may hlLt:l~ele with binding.
Usually, the screening is for binding in vitro to an artificially presented target, not for _ CA 022204~9 1997-11-27 activation or inhibition of a cellular signal tr~n~ tion pathway in a living cell. While a cell surface receptor may be used as a target, the screening will not reveal whether the binding of the peptide caused an allosteric change in the conformation of the receptor.
Ladner, USP 5,096,815 describes a method of identifying novel proteins or polypeptides with a desired DNA binding activity. Semi-random ("variegated") DNAencoding a large number of dirre~ellL potential binding proteins is introduced, in expressible form, into suitable host cells. The target DNA sequence is incorporated into a genetically engineered operon such that the binding of the protein or polypeptide will prevent expression of a gene product that is deleterious to the cell under selective conditions. Cells which 10 survive the selective conditions are thus cells which express a protein which binds the target DNA. While it is taught that yeast cells may be used for testing, bacterial cells are preferred.
The interactions between the protein and the target DNA occur only in the cell, not in the periplasm, and the target is a nucleic acid, not a protein.
Substitution of random peptide sequences for functional domains in cellular proteins 15 permits some (letermin~tion of the specific sequence requirements for the accomplishment of function. Though the details of the recognition phenomena which operate in the localization of proteins within cells remain largely unknown, the constraints on sequence variation of mitochondrial targeting sequences and protein secretion signal sequences have been elucidated using random peptides (Lemire et al., J. Biol. Chem. 264, 20206 (1989) and Kaiser 20 et al. Science 235, 312 (1987), respectively).
Yeast have been enginet?red to express foreign polypeptide variants to be tested as potential antagonists of m~mm~ n receptors. Libraries encoding mutant glucagon molecules were generated through random misincorporation of nucleotides during synthesis of oligonucleotides co~ illg the coding sequence of m~mm~ n glucagon. These libraries 25 were expressed in yeast and culture broths from transformed cells were used in testing for antagonist activity on glucagon receptors present in rat hepa~ocyte membranes (Smith et al.
1 993).
In one embodiment, the yeast cells are engineered to express a peptide library. A
"peptide library" is a collection of peptides of many different sequences (typically more than 30 1000 different sequences), which are prepared es~enti~lly simgrowthultaneously, in such a way that, if tested ~im~lltz~neously for some activity, it is possible to characterize the "positive" peptides. The peptide library of the present invention takes the form of a yeast cell culture, in which e~nt~ y each cell expresses one, and usually only one, peptide of the library. While the diversity of the library is m~imi~f -1 if each cell produces a peptide of a 35 different sequence, it is usually prudent to construct the library so there is some redl]n~l~ncy.
Moreover, each sequence should be produced at assayable levels.

CA 022204~9 1997-11-27 W O 95.'~39 PCT~US96/10002 e::

The peptides of the library are encoded by a mixture of DNA molecules of dirrel~lt sequence. Each peptide-encoding DNA molecule is ligated with a vector DNA molecule and the resulting recombinant DNA molecule is introduced into a yeast cell. Since it is a matter of chance which peptide-encoding DNA molecule is introduced into a particular cell, it is not S predictable which peptide that cell will produce. However, based on a knowledge of the manner in which the mixture was prepared, one may make certain statistical predictions about the mixture of peptides in the peptide library.
It is convenient to speak of the peptides of the library as being composed of constant and variable residues. If the nth residue is the same for all peptides of the library, it is said to 10 be constant. If the nth residues varies, depending on the peptide in question, the residue is a variable one. The peptides of the library will have at least one, and usually more than one, variable residue. A variable residue may vary among any of two to any of all twenty of the genetically encoded amino acids, the range of possibilities may be different, if desired, for each of the variable residues of the peptide. Moreover, the frequency of occurrence of the 15 allowed amino acids at particular residue positions may be the same or different. The peptide may also have one or more constant residues.
There are two principal ways in which to prepare the required DNA mixture. In one method, the DNAs are synth( ~i7~ ~1 a base at a time. When variation is desired, at a base position dictated by the Genetic Code, a suitable mixture of nucleotides is reacted with the 20 nascent DNA, rather than the pure nucleotide reagent of conventional polynucleotide synthesis.
The second method provides more exact control over the amino acid variation. First, trinucleotide reagents are ~ red, each trinucleotide being a codon of one (and only one) of the amino acids to be featured in the peptide library. When a particular variable residue is to 25 be synthesized, a mixture is made of the ~plup~;ate trinucleotides and reacted with the nascent DNA.
Once the necessary "degenerate" DNA is complete, it must be joined with the DNA
sequences necessary to assure the expression of the peptide, as discussed in more detail elsewhere, and the complete DNA construct must be introduced into the yeast cell.

VI. Periplasmic Secretion The cytoplasm of the yeast cell is bounded by a lipid bilayer called the plasma membrane. Between this plasma membrane and the cell wall is the periplasmic space.
Peptides secreted by yeast cells cross the plasma membrane through a variety of mech~ni~m~
35 and thereby enter the periplasmic space. The secreted peptides are then free to interact with CA 022204~9 1997-11-27 other molecules that are present in the periplasm or displayed on the outer surface of the plasma membrane. The peptides then either undergo re-uptake into the cell, diffuse through the cell wall into the medium, or become degraded within the periplasmic space.
The peptide library may be secreted into the periplasm by one of two distinct 5 mech~ni~mc, depending on the nature of the expression system to which they are linked. In one system, the peptide may be structurally linked to a yeast signal sequence, such as that present in the a-factor precursor, which directs secretion through the endoplasmic reticulum and Golgi apparatus. Since this is the same route that the receptor protein follows in its journey to the plasma membrane, opportunity exists in cells expressing both the receptor and 10 the peptide library for a specific peptide to interact with the receptor during transit through the secretory pathway. This has been postulated to occur in m~mm~ n cells exhibiting autocrine activation. Such interaction would likely yield activation of the linked pheromone response pathway during transit, which would still allow identification of those cells expressing a peptide agonist.
An ~lt~rn~tive mech~ni~m for delivering peptides to the periplasmic space is to use the ATP-dependent transporters of the STE6/MDR1 class. This transport pathway and the signals that direct a protein or peptide to this pathway are not as well characterized as is the endoplasmic reticulum-based secretory pathway. Nonetheless, these transporters ~p~llLly can efficiently export certain peptides directly across the plasma membrane, without the 20 peptides having to transit the ER/Golgi pathway. We anticipate that at least a subset of peptides can be secreted through this pathway by ~ hlg the library in context of the a-factor prosequence and terminal tetrapeptide. The possible advantage of this system is that the receptor and peptide do not come into contact until both are delivered to the ~?xt~rn~l surface of the cell. Thus, this system strictly mimics the situation of an agonist or antagonist 25 that is normally delivered from outside the cell. Use of either of the described pathways is within the scope of the invention.
The present invention does not require periplasmic secretion, or, if such secretion is provided, any particular secretion signal or transport pathway.

30 VII. Pharmaceutical Preparations of Identified ~s~enfs After identifying certain test compounds as potential modulators of the target phospholipase activity, the practioner of the subject assay will continue to test the efficacy and specificity of the selected compounds both in vitro and in vivo. Whether for subsequent in vivo testing, or for ~(1mini.ctration to an animal as an approved drug, agents identified in the CA 022204~9 1997-11-27 W 096/40939 PCT~US96/10002 = -49-=

subject assay can be formulated in rh~rrnzl~eutical p~ dlions for in vivo ~1mini~tration to an animal, preferably a human.
The subject compounds selected in the subject, or a ph~rrr-~çeutically acceptable salt thereof, may accordingly be forrn~ ted for ~-lmini~tration with a biologically acceptable 5 medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof. The optimum concentration of the active ingredient(s) in the chosen medium can be ~let~rrnined empirically, according to procedures well known to medicinal chemists. As used herein, "biologically acceptable medium" includes any and all solvents, dispersion media, and the 10 like which may be ~lopl;ate for the desired route of ~rlmini~tration of the ph~rm:~relltical p-e~,~dlion. The use of such media for phz~rm~reutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the activity of the compound, its use in the phslrmslceutical preparation of the invention is contemplated.
Suitable vehicles and their form~ tion inclusive of other proteins are described, for example, 15 in the book Remington's ph~rm~reutical Sciences (Remington's Ph~rrr-~elltical Sciences.
Mack Publishing Company, Easton, Pa., ~JSA 1985). These vehicles include injectable "~eposit fon~ ions". Based on t~ a~ove, such ph~rm~eutical formulations include,although not exclusively, solutions or freeze-dried powders of the compound in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered 20 media at a suitable pH and isosmotic with physiological fluids. In preferred embodiment, the compound can be disposed in a sterile pl~ udlion for topical and/or systemic ~imini~tration In the case of freeze-dried preparations, supporting excipients such as, but not exclusively, mannitol or glycine may be used and ~lo~l;ate buffered solutions of the desired volume will be provided so as to obtain adequate isotonic buffered solutions of the desired pH.
25 Similar solutions may also be used for the ph~rms~ceutical compositions of compounds in isotonic solutions of the desired volume and include, but not exclusively, the use of buffered saline solutions with phosphate or citrate at suitable concentrations so as to obtain at all times isotonic ph~rm~eutical ~ dlions of the desired pH, (for example, neutral pH).

The present invention is further illustrated by the following examples, which should not be construed as limiting in any way. The contents of all cited references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference.

CA 022204~9 1997-11-27 WO ~C/4~39 PCTAUS96/10002 Exemplif cafion Example 1. Development of Yeast Strains and Complementation Assays Methods A. Yeast Plasmids Which Express G Proteins Expression Plasmids All expression pl~mi<l~ are based upon the shuttle vectors originally described by Sikorski and Hieter (R.S. Sikorski and P.Hieter (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics 122: 19-27). The expression plasmids with the GPAl promoter (Cadus 1127), the PGK promoter (Cadus 1447) and the CUPl promoter (Cadus 1725 and 1728) have been described elsewhere (Cadus published Patent Application WO 94/23025 entitled "Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor).

Ga-subunits - Construction of Low Copy Expression Plasmids The following full length G-protein encoding inserts: GaS, Gai2, Gai3, Gaq, Gal 1, Go~16, GaOA, GaOB, Gal2, GNAZ, and activated alleles (GTPase-deficient) of GaS, Ga i2, Gaq, and Gal6 (Wu et al. (1992); Wu et al (1993); Park et al (1992) and references therein) were amplified by polymerase chain reaction using VENT polymerase, with cloning sites added to the 5' and 3' ends of the coding regions. In all cases, the restriction site added to the 5' end of the gene encoded a novel NcoI compatible overhang, while the restriction site added to the 3' end of the gene encoded a novel XhoI compatible overhang. PCR products were gel purified, restricted with the ~plopliate endonucleases, and cloned into NcoI/XhoI
cut Cadus 1127 (construction of this plasmid is described in Cadus patent application W094/23025). Cadus 1127 is a low copy plasmid (CEN6 ARS4) in which heterologous gene expression is driven by the GPAl promoter (-1400 to +1 of the native GPAl locus). A
novel NcoI site has been engineered into this vector such that the initiator methionine (at position +l) is embedded in this site (CCATGG).

CA 022204~9 1997-11-27 W O ~ 39 PCTAUS96/10002 All G-protein expression cassettes were constructed as described below for Gal6.Full length human Gal6 was arnplified from Cadus plasmid 1127 with Vent polymerase (New England Biolabs) using 5' oligonucleotide KS9829 = 5' GGGCGTCTCACATGGCCCGCTCGCTGACC 3 ' (in which a BsmB 1 site encoding a NcoI
5 overhang (CATG) has been introduced and is underlined) and 3' oligonucleotide KS9830 =
5' GGGCTCGAGCTGGGTCACAGCAGGTGGATC 3' (in which an XhoI site has been introduced following the t(?rmin~tion codon (underlined). Template (100 ng) and primers (1 uM final concentrations) were added in the presence of lOx reaction buffer cont~inin~ 2 mM
MgSO4. Template was denatured at 94~C for 30 seconds in the presence of primers followed 10 byaddition of lul per l OOul reaction volurne of VENT polymerase. DNA was amplified in a two stage amplification protocol: Stage 1 = 2 cycles of 94~C/ 30 seconds followed by 55~C130 seconds followed by 72~C/60 seconds; Stage 2 = 25 cycles of 94~C/ 30 seconds followed by 60~C/30 seconds followed by 72~C/ 60 seconds. The amplified product was purified by gel electrophoresis, cut with BsmBI and XhoI, and ligated to NcoI / XhoI cut and 15 phosphatase treated Cadus 1127 vector DNA. Recombinant clones were identified by colony PCR using primers fl~nking the inserted Gal6 sequences, confirmed by restriction digestion, and validated by dideoxynucleotide sequencing of the PCR product. Gaq and Gall expressing plasmids were prepared in a similar fashion using the following oligonucleotide primer pairs for amplification: Gaq - S' oligonucleotide = KS A14282 = 5' 20 GGGCGTCTCACATGACTCTGGAGTCCATCATG 3' (encoding an Esp3I site at the S' end which leaves an NcoI overhang following cleavage with Esp3I or BsmBI) and 3'oligonucleotide = KS A 14283 = S'GGGCGTCTCCTCGAGGCACGGTTAGACCAG 3' (encoding an Esp3I site at the 3' end that leaves an XhoI compatible overhang following cleavage with Esp3I or BsmI). Gal 1 - 5' oligonucleotide = KS A14645 25 S'GGGGGTCTCCCATGACTCTGGAGT- CCATGATG3' (encoding a BsaI sites that creates an NcoI compatible overhang following cleavage with BsaI) and 3' oligonucleotide =
KS A14285 = 5' GGGCTCGAGG-AAGCCTGGCCCT 3' (encoding a XhoI site).

Ga-subunits - High Copy ~xpression Plasmids Full length G-protein encoding inserts were amplified by polymerase chain reaction using VENT polymerase as described above, with cloning sites added to the S' and 3' ends of the coding regions. In all cases, the restriction site added to the S' end of the gene encoded a novel NcoI compatible overhang, while the restriction site added to the 3' end of the gene encoded a novel XhoI ct-mp~tihle overhang. PCR products were gel purified, restricted with the a~lopl;ate endonucleases, and cloned into NcoI/XhoI cut Cadus 1447. Cadus 1447 is a high copy plasmid (2 micron origin of replication) in which heterologous gene expression is , CA 022204~9 1997-11-27 W O~f/10339 PCTrUS96/10002 driven by the phosphoglycerol kinase (PGK) promoter. A novel NcoI site is present at the initiator methionine, and a unique XhoI site is downstream from it. G-proteins cloned in this manner include Go~S, Gaq, Gall, Gal6, GaOA, GaOB, Gal2, GNAZ, and activated alleles (GTPase-deficient) of GaS, Gai2, Gaq, and Gal6.

Yeast Plasmids Which Express Phospholipase C Genes PLC-~l Rat PLC-~1 (Suh et al., (1988)) was cloned into Cadus 1725 (CUPp LEU2 CEN ARS
AmpR) and Cadus 1728 (CUPp LEU2 2 micron origin AmpR). In these expression vectors, a minim~l CUPl promoter has been engineered to contain an initiator methionine codon (ATG) imbedded in an NcoI site, so that cloning into the NcoI cut vector introduces the gene of interest in frame into the NcoI site. The resulting plasmid, Cadus 1642 (Rat PLC-~ 1), was cleaved with ApaLI and ligated to a duplex adapter encoding the amino terminal seven 15 residues of rat PLC-,Bl with yeast codon bias. The sequences of these oligonucleotides are:
Oligo A = 5' CATGGCTGGTGCTCAACCAGGTG 3' and Oligo B--5' TGCACACCTGG-TTGAGCACCAGC 3'. Oligo B was kin~eecl with polynucleotide kinase prior to ~nne~ling and ligation. Following ligation to ApaLI cut Cadus plasmid 1642, the ligation mixture was treated with polynucleotide kinase, cleaved with BamHI and a 3.8 kb fragment with the entire 20 coding region of rat PLC-~1 was isolated by gel electrophoresis. This 3.8 kb PLC-,B1 fragment was then ligated to NcoI - BamHI cut Cadus 1725 and Cadus 1728. Plasmids cont~ining inserts in the correct orientation were identified by colony PCR and verified by restriction analysis and double-str~n~le~l DNA sequencing using Sequenase V2.0 (U.S.
Biochemicals).

PLC-~2 Human PLC-~2 (Park et al., (1992) was cloned into Cadus plasmid 1725 (CUPp LEU2 CEN ARS AmpR) and Cadus 1728 (CUPp LEU2 2 micron origin AmpR). The resulting plasmid, Cadus 1680 (Human PLC-~B2), was restricted with Eco47III and EcoRI to 30 completion and then treated with T4 polymerase to fill in the EcoRI overhang. The EcoRI-bluntlEco47III cut plasmid was then ligated to a duplex adapter encoding the amino terminal twenty-one residues of human PLC-~2 with yeast codon bias. The sequences of these are:
Oligo C = 5'CATGTCTTTGTTGAACCCAGTTTTGTTGCCACCAAAGGTTAAGGCTT-ACTTGTCTCAAGGTGAGC 3' CA 022204~9 1997-11-27 WO 96'1C339 PCTnJS96/10002 and Oligo D -5'GCTCACCTTGAGACAAGTAAGCCTTAACCTTTGGTGGCAACAAA-ACTGGGTTCAACAAAGA3'.
Oligo D was treated with polynucleotide kinase prior to ~nne~ling to oligo C and ligation to EcoRI-blunt/Eco47III cut Cadus 1680. Following ligation, the ligation mixture was treated S with polynucleotide kinase to phosphorylate the NcoI overhang 2t the 5 ' end of the gene cLr.d the 3.8kbfragment with the entire coding region of human PLC-~2 was purified by gel electrophoresis. This 3.8kb ~agment has NcoI compatible overhangs at both t~rmini, and was ligated to NcoI cut/ shrimp ~lk~line phosphatase treated Cadus 1725 and 1728.
Plasmids cont~ining insert in the correct orientation were identified by colony PCR and 10 verified by restriction analysis and double-stranded DNA sequencing using Sequenase V2Ø

Table 3 Yeast Strains No. ~A~ Genobpe :'IAME PlGENE ~2 Name P2GENE
1630 a plc1*1::HIS3 ade2-101 his3 *200 leu2* 1 Iys2-801 trp I * I ura3-52 1632 a PLCI ade2-101 his3*200 leu2*1 Iys2-801 trpl*l ura3-52' 1633 a plc1*2::LEU2 ade2-101 his3*200 leu2*1 Iys2-801 trp I * I ura3-52 1901 a plc1*2::LEU2 ade2-101 1443 URA3 2mu-ori his3 *200 leu2* 1 Iys2-801 REP3 AmpR PGKp trp I * I ura3 -52 1902 a plc1*2::LEU2 ade2-101 1460 URA3 CEN6 ARS4 his3 *200 leu2 * I Iys2-801 AmpR PGKp trp I * I ura3-52 1903 a plc1*2::LEU2 ade2-101 GALlp PLCI URA3 his3*200 leu2*1 Iys2-801 1637 2mu-ori AmpR
trp I * I ura3-52 1904 a plcl*2::LEU2ade2-101 1639 GALlpratPLC-his3*200 leu2*1 Iys2-801 betal URA3 CEN6 trp I * I ura3-52 ARS4 AmpR
2099 a plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1127 TRPI CEN6ARS4 his3*2001eu2*1 Iys2-801 betal URA3CEN6 AmpRGPAlp trp I * I ura3-51 ARS4 AmpR
2100 a plcl*2::LEU2ade2-101 J639 GALlpratPLC- 1179 TRPI CEN6ARS4 his3 *200 leu2* 1 Iys2-801 beta I URA3 CEN6 AmpR GPA I p trp I * I ura3-52 ARS4 AmpR GPA I
- 2101 a plc1*2::LEu2 ade2-101 1639 GALlp rat PLC- 1181 TRPI CEN6 ARS4 his3*200 leu2*a Iys2-801 betal URA3 CEN6 AmpR GPAlpGaS
trp I * I ura3-52 ARS4 AmpR
2102 a plc1*2::LEU2 ade2-101 1639 GALlp ratPLC- 1606 trpl CEN6 ARS4 his3*200 leu2* 1 Iys2-801 - betal URA3 CEN6 AmpR GPA I Pga2 frp I * I ura3-52 ARS4 AmpR

2103 a plcl *2::LEU2 ade2- 101 1639 GALI p rat PLC- 1617 TRPI CEN6 ARS4 his3 *200 leu2* 1 Iys2-801 beta I URA3 CEN6 AmpR GPA I p trpl*l ura3-52 ARS4 AmpR Human Gal6 2104 a PLCI*2::1eu2 ADE2-101 1639 GALlp ratPLC- 1685 TRPI CEN6 ARS4 HIS3*200 LEU2*1 LYSI- betal URA3 CEN6 AmpR GPAlp 801 . ARS4 AmpR Murine TRP I * I URA3-52 Gaq 2105 a plc1*2::LEU2 DE2-101 1639 GALlpratPLC- 1749 TRPI CEN6ARS4 his3 *200 leu2* 1 Iys2-801 betal URA3 CEN6 AmpR GPA Ip trpl*l ura3-52 ARS4AmpR Murine Gaq 2106 a plc1*2::LEU2 ade2-101 1639 GALlp rat PLC- 1753 TRPI CEN6 ARS4 his3*2001eu2*1 Iys2-801 betal URA3 CEN6 AmpRGPAlp trpl*l ura3-52 ARS4 AmpRq\ Human Ga 16-Q212L
2107 a plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1447 TRPI Imu-ori his3*200 leu2*1 Iys2-801 betal URA3 CEN6 AmpR
trp I * I ura3-52 ARS4 AmpR PGKp 2108 a plcl*2::LEu2ade2-101 1639 GALlpratPLC- 1630 TRPI 2mu-ori his3*200 leu2*1 Iys2-801 beta URA3 CEN6 AmpR
trpl * I ura3-52 ARS4 AmpR PGKp GaS
2110 a plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1783 TRPI 2mu-ori his3*200 leu2*1 Iys2-801 BETAI ura3 cen6 AmpR
trpl*l ura3-52 ars4 aMPr PGKp Murine Gaq 2111 a plc1*2::LEu2 ade2-101 1639 GALlp rat PLC- 1786 TRPI 2mu-ori his3*200 leu2*1 Iys2-801 betal URA3 CEN6 AmpR
trp I * I ura3-52 ARS4 AmpR PGKp Human Ga 2112 a plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1786 TRPI 2mu-ori his3 *200 leu2*a Iys2-801 betal URA3 CEN6 AmpR
trpl*l ura3-52 ARS4 AmpR PGKp Human Ga q-Q209L
2113 a plcl*2::LEU2ade2-101 1639 GALlpratPLC- 1786 TRPI 2mu-ori his3*200 leu2*1 Iys2-801 betal URA3 CEN6 AmpR
trpl*l ura3-52 ARS4AmpR PGKpHuman Ga 2945 a plc l * I ::HIS3 ade2-101 1725 LEU2 CEN6 ARSH4 1127 TRPI GPA I p his3*200 leu2*1 Iys2-801 CUPI AmpR CEN6 trp I * I ura3-52 ARS4 AmpR
2946 a plcl*l::HIS3ade2-101 1728 LEU22m-oriREP3 1855 GPAlpBamHI
his3 *200 leu2* 1 Iys2-801 CUPI AmpR GPA-trp I * I ura3-52 Ga 16 TRP I CEN6 ARS4 AmpR
2948 a plcl*l::HIS3 ade2-101 1728 LEU22mu-oriREP3 1855 GPAlpBamHI
his3*200 leu2*1 Iys2-801 CUPI AmpR GPA-trp I * I ura3-52 Ga 16 TRP I CEN6 ARS4 AmpR
2950 a plcl*l::HIS3ade2-101 1639 GALlpratPLC- 1127 TRPI GPAlp his3 *200 leu2* 1 Iys2-801 beta- I URA3 CEN CEN6 trpl * I ura3-52 ARS AmpR ARS4 AmpR
2952 a plcl*l::HlS3 ade2-101 1640 ADHlp rat PLC- 1855 GPAlp BamHI
his3*200 leu2*a Iys2-801 beta-l LEU2 2mu GPA-trp I * I ura3-52 origin AmpR Ga 16 TRP I CEN6 ARS4 AmpR

W 096/40939 , PCTAUS96/10002 2954 a plcl*l::HlS3ade2-101 1922 CUPratPLC- 1127 TRP1 PAlpCEN6 his3*200 leu2*1 Iys2-801 betal LEU2 2mu-ori ARS4 AmpR
trp I * 1 ura3-52 REP3 AmpR
2956 a plc I * 1: :HIS3 ade2- 101 1922 CUP rat PLC- 1855 GPA 1 p BamHI
his3 *200 leu2* 1 Iys2-801 beta I LEU2 2mu- GPA-trp I * I ura3-52 ori REP3 AmpR Ga 16 TRP I CEN6 ARS4 AmpR
2958 plcl*l::HIS3ade-2-101 1961 LEU2CEN6ARSH4 1127 TRPI GPAlp a his3*200 leu2*1 Iys2-801 AmpRCUP-PLC- CEN6 trpl * I ura3-52 beta2 ARS4 AmpR
2962 plcl*l::HlS3 ade2-101 1961 LEU2 CEN6 ARSH4 1537 TRPI 2mu-ori a his3*200 leu2*1 Iys2-801 AmpRCUP-PLC- REP3 trpl*l ura3-52 beta AmpRPGKp-ratGasQ227L
2964 plcl*l::HlS3 ade2-101 1961 LEU2 CEN6 ARSH4 1617 GPAlp Human a a his3*2001eu2*1 Iys2-801 AmpRCUP-PLC- 16 trpl*l ura3-52 beta2 TRPI CEN6 ARS4 AmpR
2966 plcl*l::HlS3 ade2-101 1961 LEU2 CEN6 ARSH4 1685 GPAlpMurineGaq a his3*200 leu2*1 Iys2-801 AmpR CUP-PLC- TRPI CEN6 ARS4 trpl*l ura3-52 beta2 AmpR fl ori 2968 plcl*l::HlS3 ade2-101 1961 LEU2 CEN6 ARSH4 1752 GPAlp-Gaq-a his3*200 leu2*1 Iys2-801 AmpRCUP-PLC- Q209L
trp 1 * I ura3-52 beta2 TRP I CEN6 ARS4 AmpR
2970 plcl*l::HlS3 ade2-101 1961 LEU2 CEN6 ARSH4 1783 GPAlp-Gal6-a his3*200 leu2*1 Iys2-801 AmpRCUP-PLC- Q212L
trp I * I ura3-52 beta2 TRPI CEN6 ARS4 AmpR
2972 plcl*l::HlS3ade2-101 1961 LEU2CEN6ARSH4 1783 MurineGaq a his3*200 leu2*1 Iys2-801 AmpRCUP-PLC- PGKp trp I * I ura3-52 beta2 TRP I 2mu ori AmpR
2974 plc I * 1: :HIS3 ade2- 101 1961 LEU2 CEN6 ARSH4 1786 PGKp Human a 16 a his3*200 leu2*1 Iys2-801 AmpR CUP-PLC- TRP1 2mu ori trpl*l ura3-52 beta2 REP3 AmpR
2977 plc I * 1: :HIS3 ade2- 101 1961 LEU2 CEN6 ARSH4 1796 PGKp Human a 16-a his3*200 leu2*1 Iys2-801 AmpR CUP-PLC- !212L 2mu ori trpl*l ura3-52 beta2 REP3 AmpR
2979 plcl*l::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1794 PGKp Murine Ga a his3*2001eu2*1 Iys2-801 AmpRCUP-PLC0 1-trpl*l ura3-52 beta2 Q209L TRPI 2mu - REP3 AmpR
2981 plc I * 1: :HIS3 ade2- 101 1961 LEU2 CEN6 ARSH4 1850 PGKp Murine Ga a his3*200 leu2*1 Iys2-801 AmpRCUP-PLC0 11 trpl*l ura3-52 beta2 TRPI 2mu-ori AmpR fl ori CA 022204~9 1997-11-27 WO ~/40:~39 PCT/US96/10002 3222 plcl*l::HIS3 ad~2-101 1961 LEU2 CEN6 ARSH4 1524 TRPI GPAlp-ratGo~ his3*200 leu2*1 Iys2-801 AmpR CUP-PLC- as-trpl*l ura3-52 beta2 Q227L CEN6 AmpR
3226 plcl*l::HIS3ade2-101 1961 LEU2CEN6ARSH4 1606 GPAlpHuman a his3*200 leu2*1 Iys2-801 AmpR CUP-PLC- i~
trpl*l ura3-52 beta2 TRPI CEN6 ARS4 AmpR
3228 plcl*l::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1612 GPAlp Human a c~ his3*2001eu2*1 Iys2-801 AmpRCUP-PLC- i3 trpl * I ura3-52 beta~ TRPI CEN6 ARS4 AmpR
3230 plcl*l::HIS3 ae2-101 1961 LEU2 CEN6 ARSH4 1622 GPAlp Murine a his3*2001eu2*1 Iys2-801 AmpRCUP-PLC0 Oa bpl*l ura3-52 beta2 TRPI CEN6ARS4 AmpR
3232 plcl*l::HIS3 ade2-101 1961 LEU2 CEN6 ARSH4 1623 GPAlp Murine aa his3*200 leu2*a Iys2-801 AmpR CUP-PLC- Ob trpl*l ura3-52 beta2 TRPI CEN6 ARS4 AmpR

Biological Deposit S.cerevisiae strain CY 2964 (plcl*l::HIS3 ade2-101 his3*200 leu2*1 lys2-801 trpl * 1 ura3-52 [LEU2 CEN6 ARS4 AmpR CUP-PLC-beta2], [GPAlp Human alphal 6 TRPlCEN6 ARS4 AmpR] was deposited with the American Type Culture Collection (Rockville, Maryland) on June 5, 1995 and has been c~ ign~t.od with the ATCC Accession Number:
74345; and S.cerevisiae strain CY 2954 (plcl*l::HIS3 ade2-101 his3*200 leu2*1 lys2-801 trpl*l ura3-52 [CUP RAT PLCbetal LEU2 2mu-ori REP3 AmpR], GPAlp TRP1 CEN6 ARS4 AmpR] was deposited with the American Type Culture Collection (Rockville, Maryland) on June 5, 1995 and has been designated with the ATCC Accession Number:
74343.

PLCl ~ Yeast Strains and Complementation ~lssays Yeast Transformations All yeast transformation with the plcl~ strains (Flick and Thorner (1993) were done using lithium acetate-based protocols and the Yeastmaker transformation kit (Clontech) according to the manufacturer's specifications. In general, strains were grown up overnight CA 022204~9 1997-11-27 at 30~C to late log phase and diluted the next morning to an OD600 = 0.2-0.3. Following 5 hours of growth at 30~C, cells were washed once in water and resuspended in lithium acetate/TE such that the cells were concentrated 30-50 fold. To 100 ul of this suspension of cells, carrier DNA (100 ug), and plasmid DNA (0.1 - 0.5 ug) were added. Cells and DNA
were then vortexed, PEG/lithium acetate/TE added, the suspension vortexed again, and the suspension incubated at 30~C for 30 minutes. DMSO was then addedto a final concentration of 10% was then added and the cells were heat shocked at 42~C for 15 minutes. Following cooling on ice, the cells were centrifuged, the PEG con~ining supernatant was decanted, the cells were resuspended in sterile TE and plated on selective plates.
Growth assays and alternative readouts Standard media were used for the culture of yeast cells, and established procedures were used for genetic manipulations (Rose, M.D., Winston, F., and P. Heiter (1990) Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). All yeast skains were grown under selective conditions on synthetic medium supplemented with nutrients a~lo~l;ate for selection and m:~inten~nce of insertional mutations and plasmids (Guthrie, C, and G.R. Fink (1991) Methods in Enzymology Volumel94. Guide to Yeast Genetics and Molecular Biology, Academic Press, Inc.).Strains to be tested for suppression of plcl~ conditional lethal phenotypes were picked from single colonies from selective Synthetic Complete (SC) plates and were then streaked onto SC plates to single colonies and then grown for 48 to 72 hours under the following conditions.

Permissive growth conditions:
SC / 2% Glucose / 30~C
Non-permissive growth conditions:
SC / 2% Glucose / 1.2 M Sorbitol / 30~C
SC / 2% Glucose / 0.5 M NaCl / 30~C
SC / 2% Glucose / 37~C
SC / 2% Glucose / 12M Sorbitol / 37~C
SC / 2% Glucose / 0.5 M NaCl / 37~C
The non-permissive conditions are listed above from least stringent to most stringent.
Cell growth was monitored visually by light microscopy using a Nikon phase contrast - microscope and were photographed using the UVP digital image processing system.
Resul~s GALl promoter driven PLC-~l does not complement the plcl mutant -CA 022204~9 1997-11-27 phenotype Initial attempts to complement the plcl ts and osmotic sensitivity phenotypes with m~mm~ n PLC-~ isozymes were carried out using a rat PLC-~l construct driven by the GAL 1 promoter (the sequence of this construct was verified by dideoxynucleotidesequencing) in Cadus yeast strains CY1630 (plcl~l::HIS3 ade2-101(Oc) his3-dlO0 leu2-dl lys2-801 (Am) trpl-dl) and CY1633 (plc1~2::HIS3 ade2-101(Oc) his3-dlO0 leu2-dl lys2-801 (Am) trpl-dl). In these ~x~ ents, no complementation was observed under conditions in which the GALl promoter was either repressed (in the presence of glucose) or when it was derepressed in the presence of low glucose and activated in the presence of galactose. In control experiments using a GALl promoter driven PLCl cassette (Cadus plasmid 1639) transformed into the same strain backgrounds (CY1630 and CY1633), both the temperature sensitive and osmotic sensitivity phenotypes were complemented. These negative results with the rat PLC-,Bl indicated that functional complementation of plcl phenotypes requires more than ~ es~ion from the GALl promoter of the rat PLC-~l gene alone.

Complementation Analysis with Ga subunits Phospholipase-C ,13 dependent hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) to form inositol 1,4,5, trisphosphate (IP3) and diacylglycerol (DAG) is stim~ tl ~l by both Ga and G~ y subunits of heLe~ neric G-proteins. Stimulation of PLC-13 activity by G
a subunits is restricted to members ofthe Gq family that includes Gq, -11, -14, -15, and -16.
Ga subunits belonging to other families (-s, -i, and -12/13) do not sfim~ te PLC-,B dependent hydrolysis of PIP2 . In several cell types, agonist dependent stimulation of IP3 and calciurn mobilization have been shown to be partially sensitive to pertussis toxin. This observation initially lead to speculation that Gi or Go could stimulate PLC-,13 activity. More recently the pertussis toxin sensitive component of agonist dependent IP3 production has been shown to be due to the ability of G,B y subunits to stimulate PLC-~ isoforrns directly.

In an effort to recapitulate G-protein dependent regulation of PLC-~ isoforms inyeast, a series of CY1630 derivatives were transformed with expression vectors coding for m~mm~ n G-proteins and complementation of the plcl mutant phenotypes were scored.
Cadus yeast strains CY1901, CY1903 and CY1904 (all CY1630 derivatives cont~ining the plcl~l::HIS3 allele) contain, respectively, Cadus plasmids 1443 (no PLC), 1637 (GALlp-rat PLC-~l) or 1639 (GALlp-PLCl)(See Strain List, Table 2). While all three strains grow at 30~C on both synthetic complete and rich media, CY1904. harboring a GALlp-PLCl expression cassette on a 2 micron plasmid, grows better than e-i.ner CY1901 (empty vector) or CY1903 (harboring a GALlp-rat PLC-~l expression c~e~e ~n a 2 micron plasmid). At CA 022204~9 1997-ll-27 W 096/40939 PCT~US96/10002 _ 59 _ non-permissive temperatures (>35~C), CY1901 and CY1903 failed to form colonies after 3 days in culture, while CY1904 forms large colonies.

CY1901, CY1903, and CY1904 (all haploid strains) were transformed by lithium 5 acetate transformation procedures (Clontech, as per manufacturer's recomm~n~l~tions) with a panel of low-copy number (CEN ARS) Ga subunit expression plasmids coding for thefollowing genes under the transcriptional control of the GPAl upstream promoter: Cadus plasmid 1127 (empty vector), 1179 (GPAl), 1181 (GaS), 1606 (Gai2), 1617 (Gal6), 1753 (Gal6-Q209L GTPase~ activated allele), 1685 (Gaq), and 1749 (Gaq-Q209L GTPase~
10 activated allele)(See Strain List, Table 1). Following transformation into the strains listed above, isolated colonies were streaked to selective plates (-Ura, -Trp + glucose) and . incubated at 30~C or at 37~C for up to 96 hours. While all strains cont~inin~ all combinations of PLC expression vectors (1443, 1637, and 1639) and G-protein expression vectors grew under permissive conditions (30~C), only those strains expressing the yeast 15 PLCl gene under the control of the GALl promoter grew at 37~C. Induction of the GALl promoter by growth on low glucose/high galactose plates did not result in rescue of the ts phenotypes of CY1901 or CY1903 derivatives, either. Even at times up to 96 hours post-plating, there was no evidence of growth under non-permissive conditions for strains harboring vectors expressing rat PLC-,Bl from the GALl promoter. These results indicate 20 that plasmids encoding the rat PLC-131 driven by the GALl promoter are not capable of complementing the ts defect in plcl strains of yeast.

CUP-PLC-~ expression vectors One possible explanation for the negative results described in the previous section is a 25 lack of expression or an inappropriate level of expression of rat PLC-,Bl from the GALl promoter. A second potential difficulty presented with the GALl promoter relates to the inability of plcl strains to utilitize galactose as a carbon source. If galactose utilization is conlplolnised in these strains, then induction of galactose sensitive promoters like GALlp and GAL 10p would also be compromised. To circumvent both of these potential problems, 30 the m~mm~ n PLC-,B isozymes were expressed from an inducible promoter whose activation is not dependent on carbon sources other than glucose. Unlike other high level constitutive promoters (i.e. PGK or ADHl), has not been associated with cellular toxicity.
This sort of toxicity has, in fact been reported in the literature by Flick and Thorner (1993) with respect to overexpression of the yeast PLCl gene from the GALl promoter in the 35 presence of galactose. Flick and Thorner report that the growth of wildtype strains of yeast that contained the PLCl gene under the control of the GALl promoter was col~lplulllised CA 022204~9 1997-11-27 WO 96/40939 - PCTrUS96/10002 when the GALl promoter was in~ ce~l on galactose but not when it was repressed on glucose-cont~ining media.

Four novel PLC-,I~ constructs were made, two encoding the rat PLC-,~l gene and two encoding the human PLC-~2 gene each under the control of the CUPl promoter. In these constructs, the nucleotide sequences of amino terminal regions of rat PLC-,~l and human PLC-,B2 were altered to reflect a bias towards yeast codon usage instead of mz~mm~ n codon usage. The amino terminal seven residues of PLC-~l and the amino ttsrmin~l 21 residues of human PLC-132 were mutated using synthetic oligonucleotides to effect these changes. The 10 nucleotide sequence of each construct subsequently was verified by dideoxynucleotide sequencing methods on both DNA strands.
Yeast Strain CY1630 was transformed with each of these pl~mifl~, as well as other PLC constructs in which PLC isozymes are driven by the GALlp or ADHl promoters, in the presence or absence of plasmids expressing various Ga subunits. Initial experiment~ tested 15 for complement~tion of the temperature sensitive (ts) phenotype associated with the plcl genotype by human PLC-,B2 and rat PLC-~Bl in the presence of a hybrid Ga subunitcomposed of the amino t~:rmin~l 60% of the yeast GPAl subunit and the carboxyl terrnins~l 40% of the human Gal6 subunit (Gal6-Bam) This hybrid construct was chosen over avariety of other human Ga subunits for two reasons. First, in independent experiments it had 20 been demonstrated that this particular hybrid subunit is functionally expressed in yeast (i.e. it couples to yeast G~ subunits and supresses activation of the pheromone response pathway in gpal- strains). Second, the structural ~let~rmi~nt~ involved in effector activation by Ga subunits are thought to map to residues in the carboxyl t~rmin~l portions of Ga subunits (Berlot and Bourne (1992); Rarick et al. (1992); Artemeyer et al.(l993)).
Y1630 ( plcl) derivatives (See Strain List, Table 2) harboring combinations of m~mm~ n PLC-~ isozymes and Ga subunits were first colony purified and then duplicate sibs of each co-transformation assayed for growth at 30OC and 37OC in the presence or absence of lOOuM CuS04. At 48 hours post-plating, all plcl strains, including those 30 cont~inin~ plasmids encoding rat PLC-,~l, grew at 30OC, albeit less well than strains CY1633 (PLC 1) or CY 1904 (plc 1 ~ HIS3 [GAL 1 p-PLC 1]). At non-permissive temperatures, several differences could be observed between strains harboring m~mmz~ n PLC-~ isozymes and those harboring empty vector by 48 hours post-plating. First, strains cont~ining high copy versions (2 micron based) of rat-PLC-,Bl grew at 37OC regardless of the promoter 3~ driving expression of the PLC-,B isozyme, while strains cont~ining empty vector did not.
CY1630 derivatives cont~inin~ Cadus plasmid 1640 (ADHlp-rat PLC-131) or Cadus plasmid CA 022204~9 1997-11-27 WO 9GM033g PCTAUS96/10002 1922 (CUP-human PLC-~l) formed small colonies within 48 hours at 370C, while CY1630 derivatives cont~ining Cadus 1443 (empty vector) did not.

Second, CY1630 derivatives co-transformed with a low copy (CEN ARS) plasmid 5 encoding CUP-human PLC-~2 and a low copy (CEN ARS) plasmid encoding the Gal 6-Bam allele grew at both 300C and at 370C. Third, growth of CY1630 derivatives at 370C in this assay was not due to expression of the Gal6-Bam allele alone as strains cont:~ininp the Ga subunit variant alone in the absence of rat or human PLC-,B isozymes did not support growth at 370C.
Finally, growth of CY1630 derivatives expressing m~mm~lian PLC isozymes was unaffected by the addition of lOOuM CuS04 at 300C, while at 370C growth in the presence of copper was less than growth in the absence of copper. This ~~ nl inhibition of growth in the presence of copper at non-permissive temperatures may reflect toxicity due to 15 o~ x~l~ssion of phospholipase C enzymatic activity by analogy with the observations made by Flick and Thorner on overexpression of PLC 1. These data represent the first demonstration to our knowledge that expression of m~mm~ n PLC-~3 isozymes in yeast could functionally complement defects in the PLCl allele of S. cerevisiae. These data also demonstrate that members of the G-protein regulated PLC-,B family of phospholipase C
20 enzymes can functionally replace members of the PLC-delta family in yeast.

In an extension of these initial observations, a series of CY1630 derivatives were constructed in which different combinations of m~rnm~ n PLC-13 isozymes and m~mm~ n Ga subunits were co-expressed. The table of yeast strains (Table 2) lists the combinations 25 tested in growth complementation assays. Strains cont~inin~ any combination of Gq family members (wildtype alleles of q, 11, 16 as well as GTPase-deficient alleles of q and 16) and PLC-,B2 supported growth under non-permissive conditions. Go~ subunits from the GaS and Gai families, on the hand, did not support growth of plc l ~ strains under restrictive conditions. The Figure shows representative data. plcl~ strains expressing PLC-,~l under the 30 control of the CUP promoter grow under restrictive conditions regardless of the presence or absence of Ga subunits.
-Complementation of the temperature sensitive and NaCl-sensitive phenotype associated with the plcl genotype was observed in two sets of circllm~t~nces. In PLCI~
35 strains cont~ining high copy plasmids encoding either rat PLC-,Bl (Plasmid 1922) or human PLC-~2 (Plasmid 1964), growth at 370C did not require co-expression of a m~mm~ n Ga subunit. These strains, therefore, display G-protein independent compl~ment~tion of the ts CA 022204~9 1997-11-27 W O 96/40939 PCTnJS96/10002 defect. In strains cont~ining low copy plasmids encoding the human PLC-,132 allele (Plasmid 1961), growth at 370C required co-expression of a Ga subunit from the Gq farnily. plcl strains cont~ining human PLC-~2 and Gq,-ll, or -16, either on low or high copy number plasmids, all grew at 370C. Furthermore, strains expressing human PLC-,B2 and activated forms of Gaq(Q209L) or Gal6(Q~12L) grew robustly at both 300C and 370C while strains harboring human PLC-,B2 and an activated form of GaS (Q227L) failed to support growth at 370C. 3 Example 2. Complk".~,.lulion of fheyeast plcl mutation by human PLC-~3 Human PLC-~3 has been found to complement the temperature-sensitive and NaCI
sensitive phenotypes associated with the plcl genotype in yeast in a G-protein independent 15 fashion. These conclusions are based on the finding that expression of the human PLC-,~3 in yeast strains with the plcl background under the control of the CUP promoter on either high or low copy plasmids, results in growth on 0.5M NaCl or at elevated temperatures, independent of the co-expression of Ga subunits of the Gq family (i.e. q, 11, 14, 15, or 16).
In this respect the char~çt~ri.~tics of the human PLC-~33 isoform expressed in yeast resemble 20 those of rat PLC-,~l in exhibiting G-protein independent growth under non-permissive conditions, as distinct from the G-protein dependent growth phenotype of the human PLC-,132 isoform.

REFERENCES
Arkinstall, S., Payton, M., & Maundrell, K. (1995). Activation of Phospholipase C
gamrna in Schizosaccharomyces pombe by Coexpression of Receptor or Nonreceptor Tyrosine Kinases. MCB, 15(3), 1431-1438.
Artemyer, N. O., Mills,J.S., Thornburg, K. R., Knapp, D. R., Schey, K. L., & Hamm, H. E. (1993). A site on transducin alpha subunit of interaction with the polycationic region of 30 cGMP phosphodiesterase inhibitory subunit. .
Bahk, Y.-Y., Lee, Y.-H., Ryu, S.-H., Suh, P.-G., Lee, T. G., & Seo, J. (1994). J. Biol.
Chem., 269, 8240-8245.
Bennett, C. F., Balcarek, J. M., Varichio, A., & Crooke, S. T. (1988). Nature, 334(268).
Berlot, C. H., & Bourne, H. R. (1992). Tn~( ntification of effector-activating residues of Ga S. Cell, 68, 911-922.' Berridge, M. J. (1993). Inositol trisphosphate and calcium ~ign~lling Nature, 361 (January 28), 315-325.

CA 022204~9 l997-ll-27 W O ~6/~0~39 PCT~US96/10002 Berstein, G., Blank, J. L., Jhon, D.-Y., Exton, J. H., Rhee, S. G., & Ross, E. M.
(1992). Phospholipase C-bl Is a GTPase-Activating Protein for Gq/l l, Its Physiologic Regulator. Cell, 70(August 7), 411-418.
Bhak, M. J. K. Y. Y., Min, D. S., Lee, S. J., Ryu, S. H., & Suh, P. G. (1993).
Biochem. Biophys. Res. Commun., 194, 706-712.
Bishop, W. R., Pachter, J. A., & Pai, J.-K. (1992). Regulation of Phospholipid Hydrolysis and Second Messenger Formation By Protein Kinase C. Advan. Enzyme Regul., 32, 177-192.
Bonser, R. W., Thompson, N. T., Randall, R. W., & Garland, L. G. (1989).
Phospholipase D activation is functionally linked to superoxide generation in the human neutrophil. Biochem J, 264, 617-620.
Bosch, B. D. (1980). Biochim. Biophys. Acta, 604, 191-246.
Boyer, J. L., Paterson, A., & Harden, T. K. (1994). G-Protein-Mediated Regulation of Phospholipase C. TCM, 4(2), 88-95.
Burgess, W. H., Dionne, C. A., Kaplow, J. M., Mudd, R., Firesel, R., Zilberstein, A., Schlessinger, J., & Jaye, M. (1990). Characterization and cDNA cloning of phospholipase C-g~mm~, a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. MCB, 10, 4770-4777.
Cl~ph~m, D. E. (1995). Calcium Sign~1ing Cell, 80(January 27), 259-268.
Clapham, D. E., & Neer, E. J. (1993). New roles for G-protein beta gamrna-dimers in transmembrane ~i~n~lling Nature, 365(September 30), 403-406.
Clark, J. D. (1991). Cell, 65, 1043-1051.
Cook, J. T., & Wakelam, M. J. (1992a). Epidermal growth factor increases sn-1,2,-diacylglycerol levels and activates phospholipase D-catalysed phosphatidylcholine breakdown in Swiss 3T3 cells in the absence of inositol-lipid hydrolysis. Biochem. J., 285, 247-253.
Cook, S. J., & Wakelam, M. J. (1992b). Phospholipases C and D in Mitogenic Signal Transduction. Rev. Physiol. Biochem. Ph~rrn~col, 119, 13-45.
Corven, E. J. V., Groenik, A., Jalink, K., Eichoholtz, T., ~ Moolenaar, W. H. (1989).
Lysophosphatidate-induced cell proliferation: identification and dissection of sign~llin~
pathways mediated by G proteins. Cell, 59, 45-54.
- Coussens, L., parker, P. J., Rhee, L., Yang-Feng, T. L., Chen, E., Waterfield, M. D., Francke, U., & Ullrich, A. (1986a). The Complete Primary Structure of Protein Kinase C -the Major Phorbol Ester Reception. Science, 233, 853 - 8596.
Coussens, L., Parker, P. J., Rhee, L., Yang-Feng, T. L., Chen, E., Waterfield, M. D., Francke, U., & Ullrich, A. (1986b). Multiple, Distinct Forms of Bovine and Human Protein Kinase C Suggest Diversity in Cellular Si~?n~lin~ Pathways. Science, 233, 859-866.

_ CA 022204~9 1997-11-27 W O ~C/10~39 PCTAUS96/10002 Cuevas, W. A., & Songer, J. G. (1993). Arcanobacterium haemolyticum phospholipase D is genetically and functionally similar to Corynebacterium pseudotuberculosis phospholipase D. Infect. Immun, 61, 4310-4316.
DeWinter (1982). Biochim. Biophys. Acta, 712, 332-341.
Divecha, N., & Irvine, R. F. (1995) Phospholipid Si3~n~1ing Cell, 80(January 27), 269-278.
Emori, Y., Homma, Y., Sorimachi, H., Kawasaki, H., N~k~ni~hi, O., Suzuki, K., &
Takenawa, T. (1989). A second type of rat phosphoinositide-specific phospholipase C
cont~ining a src-related sequence not essential for phosphoinositide-hydrolyzing activity.
JBC, 264, 21885-21890.
Flick, J. S., & Thorner, J. (1993). Genetic and Biochemical Characterization of a Phosphatidylinositol-Specific Phospholipase C in Saccharomyces cerevisiae. MCB, 13(9), 5861 -5876.
('Ts-cs~m~-Diagne, A., Fauvel, J., & Chap, H. (1989). J. Biochem, 264, 9470-9475.
Gor lel~-17~, J. O., Bjoro, T., Torjesen, P. A., Ostberg, B. C., Haug, E., & Gautivik, K.
M. (1989). Protein kinase C stimulates adenylate cyclase activity in prolactin-secreting rat ~ ?nom~ (GH4Cl) pituicytes by inactivating the inhibitory GTP-binding protein Gi. Eur. J.
Biochem, 183, 397-406.
Gray, & Stickland (1982). Can. J. Biochim, 60, 108-117.
Guthrie, C., & Fink, G. R. (1991). Guide to Yeast Genetics and Molecular Biology. Methods inEnzymology, 194.
Hempel, W. M., & DeFranco, A. L. (1991). Expression of phospholipase C isozymes by murine B Iymphocytes. J. Immunol., 146, 3717-3720.
Homma, Y., & Emori, Y. (1995). A dual functional signal mediator showing RhoGAP and phospholipase C-delta stimulating activities. EMBO J, 14~2), 286-91.
Inglese, J., Koch, W. J., Touhara, K., & Lefkowitz, R. J. (1995). G,B gamma interactions with PH domains and Ras-MAPK signaling pathways. TIBS, 20, 151-156.Iniguez-Lluhi, J., Kleuss, C., & Gilman, A. G. Tchi7~ki, J., Ohara, O., Nakamura, E., Tamaki, M., Ono, T., Kanda, A., Yoshida, N., Teraoka, H., Tojo, H., & Okamoto, M. (1989).
cDNA cloning and sequence det~rrnin~tion of rat membrane-associated phospholipase A2.
Biochem. Biophys. Res. Commun., 162, 1030-1036.
Jiang, H., Wu, D., & Simon, M. I. (1994). Activation of phospholipase C-,134 by heterotrimeric GTP-binding proteins. JBC, 269(10), 7593-7596.
Kerfelec, B., LaForge, K. S., Puigserver, A., & Scheele, G. (1986). Primary structures of canine pancreatic lipase and phospholipase A-2 messenger RNAs. Pancreas, 1, 430-437.

CA 022204~9 1997-11-27 Kolch, W., Heidecker, G., Kochs, G., Hummel, R., Vahidi, H., Mischak, H., Finkenzeller, G., Marme, D., & Rapp, U. R. (1993). Protein Kinase Ca activates RAF-l direct phosphorylation. Nature, 364, 249-252.
Kusunoki, C., Satoh, S., Kobayashi, M., & Niwa, M. (1990). Structure of genomic DNA ~or rat platelet phospholipase A2. Biochim. Biophys. Acta., 1087(1), 95-97.
Kuwabara, Y., Maruyama, M., Watanabe, Y., & Tanaka, S. (1989). J. Biochem., 104,236-241.
Lee (1994). J. Biol. Chem., 269, 19725-19730.
Lee, C. H., Park, D., Wu, D., Rhee, S. G., & Simon, M. I. (1992). Members of the10 Gqa Subunit Gene Family Activated Phospholipase C ~3 Isozymes. JBC, 267(23), 16044-16047.
Lee, C. W., Lee, K. H., Lee, S. B., Park, D., & Rhee, S. G. (1994). Regulation of phospholipase C-beta 4 by ribonucleotides and the alpha subunit of Gq. JBC, 269(41), 25335-25338.
Lee, H.-H., Park, D.-J., Lee, S.-B., Yoo, O.-J., & Rhee, S. G. (1993). JBC, 268, 6654-6661.
Meldrum, E., Parker, P. J., & Carozzi, A. (1991). The PtdIns-Plc superfamily andsignal transduction. Biochem. Biophys. Acta, 1092, 49-71.
Moolenaar, W. H., Kruijer, W., Tilley, B. C., Verlaan, I., Bierman, A. J., & DeLatt, S.
20 W. (1986). Growth factor-like action of phosphatidic acid. Nature, 323, 171-173.
Morris, A. J., Waldo, G. L., Boyer, J. L., Helper, J. R., Do~,vnes, C. P., & Harden, T.
K. (1990). Regulation of Phospholipase C. Soc. Gen. Physiol Ser, 45, 61-75.
Ohara, O., Tchi7~ki, J., Nakano, T., Arita, H., & Teraoka, H. (1990). A simple and sensitive method for cl~L~I "~ining transcription initiation site: identification of two 25 transcription initiation sites in rat group II phospholipase A2 gene. Nucleic Acids Res., 18(23), 6997-7002.
Ohara, O., Tamaki, M., Naka~nura, E., Tsuruta, Y., Fujii, Y., Shin, M., Teraoka, H., &
Okamoto, M. (1986). Dog and rat pancreatic phospholipases A-2: Complete amino acid sequences deduced from complementary DNAs. J. Biochem., 99, 733-739.
Park, D., Jhon, D.-Y., Kriz, R., Knopf, J., & Rhee, S. G. (1992). Cloning. Sequencing, Expression, and Gq-independent Activation of Phospholipase C-,~2. JBC, 267(23), 16048-Parker, P. J., Coussens, L., Totty, N., Rhee, L, Young, S., Chen, E., Stabel, S., Waterfield, M. D., & Ullrich, A. (19g6). The Complete Primary Structure of Protein Kinase 35 C-the Major Phorbol Ester Receptor. Science, 233, 853-859.

CA 022204~9 1997-11-27 Payne, W. E., & Fitzgerald-Hayes, M. (1993). A Mutation in PLCl, a C~nfli~ te Phosphoinositide-Specific Phospholipase C Gene ~om Saccharomyces cerevisiae, Causes Aberrant Mitotic Chromosome Segregation. MCB, 13(7), 4351-4364.
Plevin, R., MacNulty, E. E., Palmer, S., & Wakelam, M. J. O. (1991). Differences in S the regulation of endothelin-l and lysophosphatidic acid-stimulated Ins(1,4,5)P3 forrnation in Rat-l fibroblasts. Biocehm J, 280, 609-615.
Rarick, H. M., Artemyer, N. O., & Harnm, H. E. (1992). A site on Rod G-protein alpha subunit that mediates effector activation. Science, 256, 1031 - 1033.
Rhee, S . G., Suh, P.-G., Ryu, S.-H., & Lee, S. Y. (1989). Studies of Inositol 10 Phospholipid-Specific Phospholipase C. Science, 244(May 5), 546-550.
Riedel, H., p~ri.~ nti, A. M., Hansen, H., Su, L., & H.L.Shieh (1993a). Stimulation of Calcium Uptake in Saacharomyces cerevisiae by Bovine Protein Kinase C a. JBC, 268(5), 3456-3462.
Riedel, H., Su, L., & Hansen, H. (1993b). Yeast Phenotype Classifies M~mmz~ n 15 Protein Kinase C cDNA Mutants. MCB, 13(8), 4728-4735.
Rose, M. D., Winston, F., & Heiter, P. (1990). Methods in Yeast Genetics: A
Laboratory Course Manuak Cold Spring Harbor Laboratory Press.
Seilh~mer, J. J., Randall, T. L., Y~m~n~k~, M., & Johnson, L. K. (1986). Pancreatic phospholipase A2: Isolation of the human gene and cDNAs from porcine pancreas and 20 human lung. DNA, 5(6), 519-527.
Sharp, J. D., White, D. L., Chiou, X. G., Goodson, T., Gamboa, G. C., McClure, D., Burgett, S., Hoskins, J. A., Skatrud, P. L., Sportsman, J. R., Becker, G. W., Kang, L. H., Roberts, E. F., & Kramer, R. M. (1991). Molecular cloning and expression of human Ca (2+)-sensitive cytosolic phospholipase A2. JBC, 266(23), 14850-14853.
Sikorski, R. S., & Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics, 122, 19-27.
Sternweis, P. C., & Smrcka, A. B. (1992). Regulation of Phospholipase C by G
Proteins. TIBS, 17(December), 502-506.
Suh, P.-G., Ryu, S. H., Moon, K. H., Suh, H. W., & Rhee, S. G. (1988). Cloning and Sequence of Multiple Forms of Phospholipase C. Cell, 54(July 15), 161-169.
Tanka, T., Kimura, S., & Ota, Y. (1987). Sequence of a cDNA coding for bovine pancreatic phospholipase A2. Nucleic Acids Res., 15(7), 3178.
Teramoto (1083). J. Biochim, 93, 1353-1360.
Traynor, & Authi (1981). Biochim. Biophys. Acta., 665, 571-577.
Trotter, J., & Smith, M. E. (1986). The role of phospholipases from inflzlmm~tory macrophages in demyelination. Neurochem. Res., 11, 349-361.

CA 022204~9 1997-11-27 Tsang, T. C., Fung, W., Levine, J., Metz, C. N., Davitz, M. A., Burns, D. K., Huang, K.-S., & Kochan, J. P. (1992). Isolation and expression of two human glycosylphosphatidylinositol phospholipase D (GPI-PLD) cDNAs. FASEB, 6, 1922 - 1992.
Wu, D., Jiang, H., Katz, A., & Simon, M. I. (1993). Identification of critical regions on phospholipase C-beta 1 required for activation by G-proteins. JBC, 268, 3704-3709.
Wu, D., Lee, C. H., Rhee, S. G., & Simon, M. I. (1992). Activation of Phospholipase C by a Subunits of the Gq and G11 Proteins in Transfected Cos-7 cells. JBC, 267(January 25), 1811-1817.
Yoko-o, T., Matsui, Y., Yagisawa, H., Nojima, H., Uno, I., & Toh-E, A. (1993). The 10 putative phosphoinositide-specific phospholipase C gene, PLCl, of the yeast Saccharomyces cerevisiae is important to cell growth. Proc. Natl. Acad. Sci. USA, 90, 1804-1808.
Zupan, L. A., Steffens, D. L., Berry, C. A., Landt, M. L., & Gross, R. W. (1992).
Cloning and ~ ession of a human 14-3-3 protein me~ tin~ phospholipolysis. Identification of an arachidonoyl-enzyme intermediate during catalysis. JBC, 267, 8707-8710.

Bonner, T.I., Buckley, N.J., Young, A. C., and Brann, M. R. (1987). Identification of a family of mll~ç~rinic acetylcholine receptor genes. Science 237, 527-632.
Bonner, T. I., Young, A. C., Brann, M. R., and Buckley, N. J. 20 (1988). Cloning and s~ion of the human and rat mS muscarinic acecylcholine receptor genes. Neuron 1,403-410.
Boulay, F., Mery, L., Tardif, M, Brouchon L., and Vignais, P. (1991) Expression cloning of a receptor for C5a anaphylatoxin on dirrelcllliated HL-60 cells. Biochemistry 30, 25 2993-2999.
Boulay, F., Tardif, M., Brouchon, L., Viguais, P. (1990) The human N-formylpeptide receptor. Characterization of two cDNA isolates and evidence for a new subfamily of G
protein-coupled receptors. Biochemistryy 29, 11123-11133.
Bruno, J.F., Whittaker, J. Song, J.F., Berelowitz, M. (1991) 30 Molecular cloning and sequencing of a cDNA encoding a human lA adrenergic receptor.
Biochem. Biophys. Res.. Commun. 179, 1485- 1490.
De-Nardin-E, Radel-S-.J. Lewis-N. Genco-R-J. Hammarskjold-M. (1992) Identification of a gene encoding for the human formyl peptide receptor. Biochem-Int. 26, 381 -387.
Dearry, A., Gingrich, J. A., Falardeau, P., Fremeau, R.T., Bates. M.D., Caron, M.G.
(1990) Molecular cloning and expression of the gene for a hurnan Dl dopamine receptor.
Nature 347, 72-76.

CA 022204~9 1997-11-27 W O 96/40939 PCT~US96/10002 Demchyshyn, L., Sunahara, R.K.-Miller, K. Teitler-M.-Hoffman-B-J., Kennedy, J.L.Seeman-P. Van-Tol- H-H. Niznik-H-B. A human serotonin lD receptor variant (SHTlDbeta) encoded by an intronless gene on chromosome 6. (1992) Proc-Natl-Acad-Sci-U-S-A.
89, 5522-5526.
Evans, C.J., Keith, D.E. Jr., Morrison, H., Magendzo, K., and Edwards, R.H. (1992) Cloning of a delta opioid receptor by functional expression. Science 258, l 952-1955.
Fargin, A., Raymond, J.R., Lohse, M.J., Kobilka, B.K., Caron, M.G. and Lefkowitz, R.J. (1988). The genomic clone G-21 which resembles a ,~-adrenergic receptor sequence encodes the S-HTIa receptor. Nature 335, 358-360.
Frielle, T., Collins, S., Daniel, K.W., Caron, M.G., Lefkowitz, R.J., and Kobilka, B.K.
(1987) Cloning of the cDNA for the human l-adrenergic receptor Proc. Natl. Acad. Sci.
U.S.A. 84, 7920-7924.
Furuta, H. Guo-D-F. Inagam-T. (1992) Molecular cloning and sequencing of the gene encoding hurnan angiotensin II type 1 receptor. Biochem- Biophys Res Cornmun. 183, 8-13.
Gantz, I., Munzert, G., Tashiro, T., Schaffer, M., Wang, L., DelValle, J., Yamada, T.
(199lb) Molecular cloning of the human hi~t~3mine H2 receptor. Biochem. Biophys. Res.
Commun. 178, 1386-1392.
Gerard, N.P., Eddy, R.L., Jr., Shows, T.B ., and Gerard, C. (1990) The human neurokinin A (Substance K) receptor. Molecular cloning of the gene, chromosomal 20 localization, and isolation of cDNA from tracheal and gastric tissues. J. Biol. Chem. 265, 20455-20462.
Gerard, N.P. and Gerard, C. (1991) The chemotactic receptor for C5a anaphylatoxin.
Nature 349, 614-617.
Gerard, N.P., Cd~l~w~y7 L.A., Eddy, R.L. Jr., Shows, T.B., Iijima, H., Paquet, J.-L
25 and Gerard, C. (1990) Human substance P receptor (NK-l): Or~ni7~3tion of the ~ene, chromosome localization, functional expression of cDNA clones. Biochem. 30, 10640-10646.
Gerard, C.M., Mollereau, C., Vassart, G., and Parmentier, M. (l991) Molecular cloning of a human cannabinoid receptor which is also expressed in testis. Biochem. J. 279, 129-134.
Grandy, D.K., Marchionni, M.A., Makam, H., Stofko, R.E-Alfanzo, M., Frothingh~m,L., Fischer, J.B., Burke-Howie, K.J., Bunzow, J.R., Server, A.C. and Civelli. O. (1989) Cloning of the cDNA and gene for a human D2 dopamine receptor. Proc. Natl Acad. Sci.
USA 86, 9762-9766.
Hamblin, M.W. and Metcalf, M.A. (l991) Primary structure and functional characterization of a human 5-HTlD-type serotonin receptor. Mol. Ph~rrn~/~ol. 40, 143-148.

CA 022204~9 1997-11-27 W O ~6!40939 PCT~US96/10002 Hamblin-M-W. Metcalf-M-A., McGuffin-R-W., Karpelis-S. (1992) Molecular cloning and functional characterization of a human 5-HT1 B serotonin receptor: a homologue of the rat S-HTlB receptor with 5-HTlD-like pharmacological specificity. Biochem-Biophys-Res-Commun. 184, 752-759.
SHayzer-D-J., Rose-P-M., Lynch-J-S., Webb- M-L., Kienzel-B-K., Liu-E-C., Bogosian-E-A., Brinson,-E., Runge-M-S. (1992) Cloning and expression of a human endothelin receptor: subtype A. Am-J-Med-Sci. Oct. 304, 231 -238.
Herzog, H., Hort, Y.J., Ball, H.J., Hayes, G., Shine, J., and Selbie, L.A. (1992) Cloned human neuropeptide Y receptor couples to two different second messenger systems.
10Proc. Natl. Acad. Sci. U.S.A. 89, 5794-5798.
Hirata, M., Hayashi, Y., Ushikubi, F., Yokota, Y., Kageyama, R., N~k~ni~hi, S and Narumiya, S. (1991) Cloning and expression of cDNA for a human thromboxane A2 receptor. Nature 349, 617-620.
Holmes, W.E., Lee, J., Kuang, W.-J., Rice, G.C., and Wood, W.I. (1991) Structure15and functional expression of ahuman interleukin-8 receptor. Science 253, 1278-1280.
Hosoda-K Nakao-K. Hiroshi-Arai. Suga-S., Ogawa-Y. Mukoyama-M. Shirakami-G.
Saito-Y. N~k~ni~hi-S. Imura-H. (1991) Cloning and expression of human endothelin-l receptor cDNA. FEBS-Lett. 287, 23-26.
Kang, J., Lemaire, H.-G., Unterbeck, A., Salbaum, J.M., Masters, C.L., Grzeschik, 20K.-H., Multhaaup, G., Beyreuther, K., Muller-Hill, B. (1987) The precursor of Alzheimer's disease amyloid protein resembles a cell-surface receptor. Nature 235, 733,736.
Kiess, W., Blic k~n~t~ff, G.D., Sklar, M.M., Thomas, C.L., Nissley, S.P. and ~h~gizln, G.G. (1988) Biochemical evidence that the type II insulin-like growth factor receptor is identical to the cation-independent mannose 6-phosphate receptor. J. Biol. Chem.
25263, 9339-9344.
Kimura, T., Tanizawa, O., Mori, K., Brownstein, M.J., and Okayama, H. (1992) Structure and expression of a human oxytocin receptor. Nature 356, 526-529.
Kobilka, B.K., Dixon, R.A.F., Frielle, T., Dohlman, H.G., Bolanowski, M.A., Sigal, I.S., Yang-Feng, T.L., Francke, U., Caron, M.G., and Lefkowitz, R.J. (1987) cDNA for the 30human ~2-adrenergic receptor: A protein with multiple membrane spanning domains and a chromosomal location shared with the PDGF receptor gene. Proc. Natl. Acad. Sci. USA 84, 46-50.
Kobilka, B.K., Frielle, T., Collins, S., Yang-Feng, T., Kobilka, T.S., Francke, U., Lefkowitz, R.J., and Caron, M.G. (1987) An intronless gene encoding a potential member of 35the family of receptors coupled to guanine nucleotide regulatory proteins. Nature 329, 75-79.

CA 022204~9 1997-11-27 WO ~6/~39 PCT~US96/10002 Kunz, D., Gerard, N.P., and Gerard, C. (1992) The human leukocyte platelet-activating factor receptor. cDNA cloning, cell surface ~ e~ision and construction of a novel epitope-bearing analog. J. Biol. Chem. 267, 9101-9106.
T.;1.1"1.""~r, D., Blomqvist, A.G., Yee, F., Jazin, E., Yoo, H., Wahlested, C. (1992) Cloning and functional characterization of a human neuropeptide Y/peptide YY receptor of the Y1 type. J. Biol. Chem. 267, 10935-10938.
Lemaire, H.G., Salbaurn, J.M., Multhaup, Kang, J., Bayney, R.M., Unterbeck, A., Beyreuther, K., Muller-Hill, B. ( 1989) The PreA4695 precursor protein of Alzheimer's disease A4 amyloid is divided by 16 exons. Nuc. Acids. Res. 17, 517-522.
Levy, F.O., G~ rrn~nn, T., Perez-Reyes, E., Birnbaumer, M., ~llm~nn, A.J., and Birnh~llnnPr7 L. (1992b) Molecular cloning of a human serotonin receptor (S12) with a pharmacological profile resembling that of the 5-HTld subtype. J. Biol. Chem. 267, 7553-7562.
Levy, F.O., G1l~1L.II~ , T., Birnh~-lm~r, M. ~llm~nn, A.J., and Birnbaumer, L.
15 (1992a) Molecular cloning of a human gene (S31) encoding a novel serotonin receptor me~i~fing inhibition of adenylyl cyclase. FEBS. Lett. 296, 201-206.
Libert, F., Lefort, A., Gerard, C., Parmentier, M., Perret, J., Ludgate, M., Dumont, J., Vassart, G. (1989) Cloning, sequence and expression of the human thyrotropin (TSH) receptor: Evidence for the binding of autoantibodies. Biochem. Biophys. Res. Commun. 165, 20 150-155.
Libert, F., Van Sande, J., Lefort, A., Czernilofsky, A., Dumont, J.E., Vassart, G., Ensinger, H.A., and Mendla, K.D. (1992) Cloning and functional characterization of a human A1 adenosine receptor. Biochem. Biophys. Res. Commun. 187, 919-926.
Lomasney, J.W., Lorenz, W., Allen, L.F., King, K., Regan, J. W., Yang-Feng, T.L., 25 Caron, M.G., and Lefkowitz, R.J. (1990). Fxp~n~ion of the a2-adrenergic receptor family:
cloning and characterization of a human az-adrenergic receptor subtype, the gene for which is located on chromosome 2. Proc. Natl. Acad. Sci. U.S. A. 87, 5094-5098.
Mayo, K.E. (1992) Molecular cloning and expression of a ~iLuiL~y-specific receptor for growth hormone-releasing hormone. Mol. Endorcrin. 6, 1734-1744.
Minegi~h, T., Nakamura, K., Takakura, Y., Ibuki" Y., and Igarashi, M. (1991) Cloning and sequencing of human FSH receptor cDNA Biochem. Biophys. Res. Commun.175, 1125-1130.
Min~gi~h, T., Nakamura, K., Takakura, Y, Miyamoto, K., Hasegawa, Y., Ibuki, Y., and Igarashi, M. (1990) Cloning and sequencing of human LHAlCG receptor cDNA.
35 Biochem. Biophys. Res. Cornmun. 172, 1049-1054.
Misrahi, M., Lossfelt, H., Atger, M., Sar, S., Guiochen-Mantel, A., Milgrom, E.
(1990) Cloning sequencing and ~ ion of human TSH receptor. Biochem. Biophys. Res.

CA 022204~9 1997-11-27 WO 96/~339 PCTAUS96/10002 Cornmun. 166, 394-403. Herbert J. Schon. E.A. (1988) A cDNA specifying the humanamyloid precursor protein (ABPP) encodes a 95-kDA polypeptide. Nuc. Acids Res. 16, 9351.
Mochizuki-D. Yuyama-Y. Tsujita-R. Komaki-H. Sagai-H. (1992) Cloning and expression ofthe human 5-HTlB-type receptor gene. Biochem-Biophys-Res-Commun. 185, 517-523.
Murphy, P.M. and McDermott, D. (1991) Functional expression ofthe human formyl peptide receptor in Xenopus oocytes requires a complement~ry human factor. J. Biol. Chem.
266, 12560-12567.
Murphy, P.M. and Tiffany, H.L. (1991) Clonirig of complementary DNA encoding a functional human interleukin-8 receptor. Science 253, 1280-1283.
Nagayama, Y., ~ fm~n, K.D., Seto, P., and Rapoport, B. (1989) Molecular cloning,sequence and functional expression of the cDNA for the human th~loL~opill receptor.
Biochem. Biophys. Res. Commun. 165, 1184-1190.
N~klmllf~-M. Takayanagi-R. Sakai-Y. S~kz~moto-S. Hagiwara-H. Mizuno. Saito-Y.
Hirose-S. Yamamoto-M. Nawata-H. (1991) Cloning and sequence analysis of a cDNA
encoding human non-selective type of endothelin receptor. Biochem-Biophys-Res-Commun.
177, 34-39.
Nathans, J., and Hogness, D.S. (1984) Isolation and nucleotide sequence ofthe gene 20 encoding human rhodopsin. Proc. Natl. Acad. Sci. U.S.A. 81, 4851 -4855.
Nathans J., Thomas, D., and Hogness, D.S. (1986) Molecular genetics of human color vision: The genes encoding blue, green, and red pigments. Science 232, 193-202.
Neote, K. DiGregorio, D., Mak, J.Y., Horuk, R., and Schall, T. J. (1993) Molecular cloning, functional expression, and signaling characteristics of a C-C chemokine receptor.
25 Cell 72, 415-425. Ogawa-Y. Nakao-K. Arai-H. Nakagawa-O. Hosoda-K. Suga-S.
N~k~ni~hi-S. Imura-H. (1991) Molecular cloning of a non-isopeptide-selective human endothelin receptor. Biochem-Biophys-Res-Commun. 178. 248-255.
Peralta, E.G., Ashkenazi, A., Winslow, J.W., Smith, D.H., l~m~h:~nllran, J., andCapon, D.J. (1987b). Distinct primary structures, ligand-binding properties, and tissue-30 specific expression of four human mll~c~rinic acetylcholine receptors. EMBO J. 6, 3923-3929.
Pierce, K.D., Furlong, T.J., Selbie, L.A., and Shine, J.(1992) Molecular cloning and expression of an adenosine A2b receptor from human brain. Biochem. Biophys., Res.
Commun. 187, 86-93.
Ramarao-C.S. Denker-J-M. Perez-D-M. Gaivin-R.-J. Riek-R.P. Graham-R-M.
(1992) Genomic org~ni7~tion and ~pl~s~ion of the human (x lB-adrenergic receptor. J-Biol-Chem. 267, 21936-21945.

CA 022204~9 1997-11-27 W O9~ 339 - PCT~US96/10002 Regan, J.W., Kobilka, T.S., Yang-Feng, T.L., Caron, M.G., and Lefkowitz, R.J.
(1988) Cloning and ~ es~ion of a human kidney cDNA for a novel 132 -adrenergic receptor.
Proc. Natl. Acad. Sci. U.S.A. 85, 6301-6305.
Sokoloff, P., Giros, B., Martres, M.-P., Bouthenet, M.L., Schwartz, J.C. (1990) 5 Molecular cloning and characterization of a novel dopamine receptor (D3) as a target for neuroleptics. Nature 347, 146-151.
Sreedharan, S.P., Robichon, A., Peterson, K.E., and Goetzl, E. J. (1991) Cloning and expression of the human vasoactive intestinal peptide receptor. Proc. Natl. Acad. Sci. U.S.A.
88, 4986-4990.
Sunahara, R.K., Niznik, H.B., Weiner, D.M., Stormann, T.M., Brann, M.R., Kennedy, J.L. Gelernter, J.E., Ro~m~hel, R., Yang, Y., Israel, Y., Seeman, P., O'Dowd, B.F. (1990) Human dopamine Dl receptor encoded by an intronless gene on chromosome 5. Nature 347, 80-83.
Takeda, Y., Chou, K.B., Takeda, J., Sachais, B.S., and Krause, J.E. (1991) Molecular cloning, structural characterization and functional expression of the human substance P.
receptor. Biochem. Biophys,. Res. Commun. 179, 1232-1240.
Tanabe, Y., Hasu, H., Shigemoto, R., N~k~ni~hi, S. (1992) A family of metabotropic glutamate receptors. Neuron 8, 169-179.
Van Tol, H.H., Bunzow, J.R., Guan, H.C., Sunahara, R.K., Seeman, P., Niznik, H.B., Civelli, O. (1991) Cloning of the gene for a human dopamine D4 receptor with high affinity for the anti psychotic clozapine. Nature 350, 610-614.
Vu, T.-K. H., Hung, D.T., Wheaton, V.I., and Coughlin, S.R. (1991) Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mech~ni~m of receptor activation. Cell 64, 1057-1068.
Wein~h~nk, R. L. Zgombick, J.M., Macchi, M., Ad_am, N., Lichtblau, H., Branchek,T.A., and Hartig, P.R. (1990) Cloning, ~ ion and ph~rrnzl~o1Ogical characterization of a hurnan a-B-adrenergic receptor. Mol. Ph~ col. 38, 681-688.
Hartig-P-R. (1991) Molecular cloning and characterization of a high affinity dopamine receptor (D1 beta) And its pseudogene. J-Biol-Chem. 266, 22427-22435.
Xie, G.-X, Miyajima, A., and Goldstein, A. (1992) Expression cloning of cDNA
encoding a seven-helix receptor from human placenta with affinity for opioid lig~n~1~ Proc.
Natl. Acad. Sci. U.S.A. 89, 4124, 4128.
Yamada, Y., Post, S.R., Wang, K., Tager, H.S., Bell, G.I., Seino, S., (1992a) Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract and kidney. Proc. Natl. Acad. Sci. U.S.A. 89, 251-255.

WO 96'1~39 PCT~US96/10002 Yamada, Y., Reisine, T., Law, S.F., Ihara, Y., Kubota, A., Kagimoto, S., Seino, M., Seino, Y. Bell, G.I., Seino, S., (1992b) S~mzltost~tin receptors, and expanding gene family:
Cloning and functional characterization of human SSTR3, a protein coupled to a adenylyl cyclase. Mol. Endocrin. 6, 2136-2142.
Young, D., Waitches, G., Birchrneier, C., Fasano, O., and Wigler, M. (1986) Isolation and characterization of a new cellular oncogene encoding a protein with multipletransmembrane domains. Cell 45, 711-719.
Zhou, Q.-Y., Grandy, D.K., Thambi, L., Kushner, J.A., Van Tol, H.H.M., Cone, R.,Pribnow, D., Salon, J., Bunzow, J.R., Civelli, O. (1990) Cloning and expression of human 10 and rat Dl dopamine receptors. Nature 347, 76-80.
Birnbaumer, M., Seibold, A., Gilbert, S., Ishido, M., Barberis, C., Antaramian, A., Brabet, P., Rosenthal, W., (1992) Molecular cloning of the receptor for human antidiuretic hormone. Nature 357, 333-5.
Chhajlan, V., Wikberg, J.-E., (1992) Molecular cloning and expression of 15 melanocycte stim~ tin~ hormone receptor cDNA. FEBS Lett. 309, 417-420.
Chi, L., Zhou, W., Prikhos~n, A., Fl~n~g~n, C., Davidson, J.S., Golembo, M. Illing, N., Millar, R.P., Sealfon, S.C. (1993) Cloning and characterization of human gonadotropin-releasing hormone receptor. Mol. Cell Endrocrinol, 91, R1-R6.
Hess, J.-F., Borkowski, J.-A., Young, G.-S., Strader, C.-D., Ransom, R.-W., (1992) 20 Cloning and ph~ cological characterization of a human bradykinin (BK-2) receptor.
Biochem-Biophys-Res-Commun. 184,260-8.
Mountjoy, K.G., Robbins, L.S., Mortrud, M.T., Cone R.D., (1992) The cloning of afamily of genes that encode the melanocortin receptors. Science 257, 1248-1251.
Pisegna, J.R., de-Weerth, A., Huppi, K., Wank, S.A., (1992) Molecular cloning ofthe 25 human brain and gastric cholecystokinin receptor: structure, functional expression and chromosomal localization. Biochem-Biophys-Res-Commun. 189, 296-303.
Zhou, Q.Y., Grandy, D.K., Thambi, L., Kushner, J.A., Van Ton, H.H.M., Cone, R., Pribnow, D., Salon, J., Bunzow, J.R., Civelli, O., (1990) Cloning and expression of human and rat Dl dopamine receptors. Nature 347, 76-80.

CA 02220459 l997-ll-27 WO 96/~-939 -- PCT~US96/10002 All of the references and publications cited herein are hereby incorporated by reference.

Equivalenfs Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embot1iment~ of the invention described herein. Such equivalents are intPn~le-l to be encompassed by the following claims.

CA 022204~9 l997-ll-27 WO 96/40939 PCT~U~96/10002 ~u~ LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: Cadus Pharmaceutical Corporation.
(B) STREET: Old Saw Mill River Road (C) CITY: Tarrytown (D) STATE: NY
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 10591 (G) TELEPXONE: (914) 345-3344 (H) TELEFAX: (914) 345-3565 (ii) TITLE OF lNv~N~l~lON: Functional Vertebrate Phospholipase C
in Ye2st (iii) NUMBER OF SEQUENCES: 10 ( iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: ASCII (text) (vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/481,632 (B) FILING DATE: 07-~UN-1995 (2) INFORMATION FOR SEQ ID NO:l:
(i) ~u~ CHARACTERISTICS:
(A) LENGTH: 29 bases (B) TYPE: nucleic acid (c) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

CA 022204~9 l997-ll-27 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 bases (B) TYPE: nucleic acid (C) STR~Nn~nM~.~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) ~yu~Nu~ DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:

(i) ~yU~N~' CHARACTERISTICS:

CA 022204~9 1997-11-27 W O 96/40939 PCT~US96/10002 (A) LENGTH: 22 bases (B) TYPE: nucleic acid (C) STR~Nn~nNR~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
GGGCTCGAGG AAGCCTGGCC CT ~ 22 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 bases (B) TYPE: nucleic acid (C) STR~Nn~nNR~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(Xi) ~ U~N~ DESCRIPTION: SEQ ID NO:8:

(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 65 bases (B) TYPE: nucleic acid (C) sTRA-NnRnNR~s single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

CA 02220459 l997-ll-27 W O9C/40~39 PCTAUS96/10002 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CATGTCTTTG TTGAACCCAG r~ GCC ACCAAAGGTT AAGGCTTACT TGTCTCAAGG 60 (2) INFORMATION FOR SEQ ID NO:lO:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 61 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO:lO:
GCTCACCTTG AGACAAGTAA GCCTTAACCT TTGGTGGCAA CAAAACTGGG TTCAACA~AG 60 A ~ 61

Claims

1. yeast cell comprising a heterologous gene encoding a heterologous phospholipase C .beta., which heterologous phospholipase C .beta. is expressed by the cell and functionally integraded into a signal pathway of the cell.

2. The cell of claim 1, wherein the heterologous phospholipase C .beta. complement a loss-of-function mutation of an endogenous phospholipase of the cell 3. The cell of any of claims 2 or 28, wherein the loss-of-function mutation is ~

4. The cell of claim 1, wherein the heterologous phospholipase C .beta. is a phospholipase whose activity can be modulated by a heterotrimeric G protein or one or more subunits thereof.

5. The cell of claim 1, wherein the heterologous phospholipase C .beta. is a phospholipase selected from the group consisting of PLC.beta.1, PL,C.beta.2, PL,C.beta.3 and PLC.beta.4.

6. The cell of any of claims 2 or 27, wherein the heterologous phospholipase C .beta. is a mammalian phospholipase.

7. The cell of claim 6, wherein the heterologous phospholipase C .beta. is a human phospholipase.

8. The cell of any of claims 1 or 27, which cell further comprises a heterologous gene encoding a regulatory protein, which regulatory protein modulates the activity of the heterologous phospholipase C.beta..

9. A cell of claim 8, wherein the regulatory protein is selected from the group consisting of: profilin, cofilin, gelsolin, .alpha. actinin, a G-protein and a G protein subunit or complexes thereof.

10. The cell of claim 9, wherein the regulatory protein is a or Ga or G.beta..gamma..

11. The cell of any of claims 1 or 29, which cell further comprises a heterologous gene encoding a heterologous receptor which is capable transducing signals via the signal pathway.

12. The cell of claim 11, wherein the receptor is a G-protein coupled receptor capable of transducing a signal to the heterologous phospholipase.

13. The cell of claim 12, wherein the G-protein coupled receptor is selected from the group consisting of: a chemoattractant peptide receptor, a cytokine receptor, a neuropeptide receptor, a light receptor, a neurotransmitter receptor, a cyclic AMP
rcceptar, and a polypeptide hormone receptor.

14. The cell of claim 13, wherein the receptor is selected from the group consisting of: an .alpha. 1A-adrenergie receptor, an .alpha. 1B-adrenergie receptor, an .alpha. 1C-adrenergie receptor, an M1 ACh receptor, an M3 ACh receptor, an M5 ACh receptor, a De dopamine receptor, a D3 dopamine receptor, an A1 adenosine, a 5HT1-like receptor, a 5HT1d-like receptor a 5IIT1d beta receptor, a substance K (neurokinin A) receptor, a Met-Leu-Phe (FMLP) receptor, an angiotensin II type receptor, a mus proto-oncogene receptor, an endothelin ETA receptor, an endothelin ETB receptor, a thrombin receptor, a growth hormone-releasing hormone (GHKII) receptor, a vasoactive intestinal peptide receptor, an oxytoein receptor, a SST3 receptor, an Lutinizing hormone/chorionie gonadotropin (LII/CG) receptor, a thromboxane AZ receptor, a platelet-activating factor (PAF) receptor, a C5a anaphylotoxin receptor, an Interleukin 8 (IL-8), IL-8A receptor an IL-8B RECEPTOR, A mip-1/RANTES receptor, a matabotropie glutamate mGlul-5 receptor, an ATP receptor, an amyloid protein precursor receptor, a hradykinin receptor, agonadotropin-releasing hormone receptor, a cholecystokinin receptor, an antidiuretic hormone receptor, an adrenocorticotropic hormone II receptor, LTB4 receptor, LTD4 receptor and oxytocin receptor.
15. The cell of any of claims 1 or 29, wherein the signal pathway modulates geneexpression.
16. The cell of any of claim 1 or 29, which cell further comprises a reporter gene construct containing a reporter gene in operative linkage with one or more transcriptional regulatory elements responsive to the signal pathway, expression of the reporter gene providing the detectable signal.
17. The cell of claim 16, wherein the reporter gene encodes a gene product that gives rise to a detectable signal selected from the group consisting of color fluorescence luminescence, cell viability relief of a cell nutritional requirement, cell growth and drug resistance.
18. The cell of claim 17, wherein the reporter gene encodes a gene product selected from the group consisting of chloramphenicol acetyl transferase, .beta.-galactosidase alkaline phosphatase, .beta.-lactamase, luciferase and green fluorescent protein.

19. The cell of claim 17, wherein the reporter gene encodes a gene product whichconfers a growth advantage.
20. The cell of claim 17, wherein the reporter gene encodes a gene product which confers on the cell the ability to grow in media containing canavanice or a similar selective agent.
21. The cell of any of claim 1 or 29, wherein the signal pathway modulates calcium mobilization.
22. The cell of any of claims 1 or 29, wherein the signal pathway modulates PKCactivity.
23. the cell of any of claims 1 or 29, wherein the signal pathway modulates temperature sensitivity of growth of the cell.
24. The cell of any of claim 1 or 27, wherein the heterologous phospholipase C .beta. is capable of constutively activated.
25. The yeast cell of claim 1 or 27, wherein said phospholipase C .beta. is capable of hydrolyzing phosphatidylinositol 4,5-bisphosphate.
26. The cell of claim 27, wherein the phospholipase C .beta. is selected from the group consisting of PLC.beta.1, PLC.beta.2, PLC.beta.3 and PLC.beta.4.

27. A yeast cell comprising:
i) a phospholipase gene having a mutation thereto which confers a first detectable phenotype on the cell; and ii) a first heterologous gene encoding a polypeptide having a phospholipase C .beta.
activity, which heterologous phospholipase C .beta. activity modulates the mutation and confers a second detectable phenotype on the cell.

28. The cell of claim 27, wherein the mutation is a loss of function mutation, and the heterologous phospholipase C.beta. complements the loss-of function.

29. The cell of claim 27, wherein the heterologous phospholipase C .beta. activity is functionally integrated in a signal pathway of the cell.

30. The cell of claim 27, wherein the first detectable phenotype is selected from the group consisting of temperature sensitive growth and NaCl-sensitivity.

31. The cell of any of claims 1 or 27, which cell is a Saccharomyces ceil.

32. A variegated culture comprising the cells of any of claims 1 or 27, wherein the cells further comprise an expressible recombinant gene encoding a heterologous test polypeptide, and a mixture of the cells in the culture collectively express a variegated population of test polypeptides.

33. An assay for identifying a modulator of a phospholipase C activity, comprising the steps of:
i) contacting the cell of claim 1 with a test compound under condition appropriate for detecting an intracellular signal transduced via the signal pathway; and ii) measuring a level of signal transduced by the signal pathway in the presence of the test compound, wherein a statistically significant difference in the level of signal in the presence of the test compound, relative to the absence of test compound indicates that the test compound is a modulator of the heterologous phospholipase C activity.

34. The assay of claim 33, wherein the intracellular signal is detected by expression of a reporter gene operably linked to transcriptional regulatory elements sensitive to the signal pathway.

35. The assay of claim 33, wherein the intracellular signal is detected by measuring products of the hydrolysis of phosphatidylinositol 4,5-bisphosphate.

36. The assay of claim 33, wherein the intracellular signal is detected by measuring one or more of the degree of Ca2+ mobilization and the activation of a protein kinase 37. The assay of claim 33. wherein the intracellular signal is detected by measuring a change in growth.

38. An assay for identifying a modulator of phospholipase C activity comprising the step of:
i) contacting the cell of claim 27 with a test compound under conditions appropriate for detecting one or both of the first and second phenotypes;
ii) measuring the level or degree of the first and/or second phenotype in the presence of the test compound, and iii) comparing the measurement of step ii) with a similar measurement in the absence of the test compound or the absence of the heterologous phospholipase C, wherein a statistically significant change in the measured phenotype in the presence of the test compound, relative to the absence of test compound or phospholipase C, indicates that the test compound is a modulator of the heterologous phospholipase C, activity.
39. An assay for identifying a modulator of a phospholipase C activity comprising the steps of:
i) contacting the cell of claim 19 with a test compound under conditions appropriate for expresion of the reporter gene:
ii) detecting expression of the reporter gene in the presence of the lest compound;
and iii) comparing the level of reporter gene expression in the presence of the test compound to the level of reporter gene expression in the absence of the test compound or the absence of the heterologous phospholipase C.
wherein a statistically significant difference in the level of reporter gene expression in the presence of the test compound relative to the absence of test compound or phospholipase C, indicates that the test compound is a modulator of the heterologous.
phospholipase C activity.

40. A differential screening assay for identifying an agent which selectively inhibits at non-mammalian phospholipase C, comprising the steps of:
i) providing a first yeast cell containing a non-mammalian phospholipase C gene;
ii) providing a second yeast cell expressing a mammalian phospholipase C gene;
iii) contacting each of the first and second yeast cells with a test compound;
iv) detecting or quantitating the activity of the phospholipases of the first and second cell in the presence of the test compound.
wherein, a statistically greater decrease in the phospholipase activity of the first cell, relative to the second cell, indicates that the test compound selectively inhibits the non-mammalian phospholipase C.
41. The assay of claim 40, wherein the phospholipase C of the first yeast cell is a vertebrate phospholipase C, and the phospholipase C of the second yeast cell is a phospholipase C from a pathogen of the vertebrate.
42. The assay of claim 40, wherein the vertebrate is a human.

43. The assay of claim 40, wherein the human pathogen is selected from the group consisting of a fungus, virus, bacteria and protozoan.
44. The assay of claim 40, wherein the human pathogen is human fungual pathegen 45. The assay of any of claim 33. 38, 39 or 40, wherein the test compound is selected library of a least 100 different test compounds.
46. The assay of any of claims 33, 38, 39 or 40, wherein the test compound is selected from the group consisting of small organic molecules, and natural product extracts.

47. A collection of at least two different yeast cells, each cell comprising a gene encoding a different phospholipase.

48. The collection of claim 47, wherein each different yeast cell encodes a different isotypes of phospholipase obtained from the same organism or the same or different isotype obtained from different organisms.
49. The assay of any of claims 33, 38, 39 or 40 wherein the mammalian phospholipase C gene is selected from the group consisting of PLC.beta.1, PLC.beta.2, PLC.beta.3 and PLC.beta.4.
50. A yeast cell comprising a heterologous gene encoding a heterologous phospholipase C; which heterologous phospholipase C is expressed by the cell andfunctionally integrated into a signal pathway of the cell, wherein the heterologous gene is operatively linked to the CUP1 promoter.
52. The cell of claim 50, wherein the heterologous phospholipase C is a phospholipase selected from the group consisting of PLC.alpha., PLC.beta., PLC8, and PLCz 53. The cell of claim 50, wherein the heterologous phospholipase C is a mammalian phospholipase.
54. The cell of claims 50 which cell further comprises a heterologous gene encoding a regulatory protein, which regulatory protein modulates the activity of the heterologous phospholipase C.

55. The cell of claim 50, which cell further comprises a heterologous gene encoding a heterologous receptor which is capable transducing signals via the signal pathway.
56. The cell of claim 50, which cell further comprises a heterologous gene encoding a regulatory protein, which regulatory protein modulates the activity of the heterologous phospholipase C.
57. The cell of claims 50, which cell further comprises a reporter gene construct containing a reporter gene in operative linkage with one or more transcriptionalregulatory elements responsive to the signal pathway, expression of the reporter gene providing the detectable signal.