WO1996039439A1 - Human g-protein receptor hcegh45 - Google Patents

Abstract

A human G-protein receptor HCEGH45 polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide for identifying antagonists and agonists to such polypeptide. Antagonists against such polypeptides may be used therapeutically to treat PACAP hypersecretory conditions and to create pharmacological amnesia models while the agonists may be employed to treat amnesia and Alzheimer's disease. Also disclosed are diagnostic methods for detecting a mutation in the receptor nucleic acid sequences and detecting a level of the soluble form of the receptors in a sample derived from a host.

Description

HUMAN G-PROTEIN RECEPTOR HCEGH45

This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human 7- transmembrane receptor. The transmembrane receptor is a G- protein coupled receptor. More particularly, the 7- transmembrane receptor has been putatively identified as a human G-protein pituitary adenylate cyclase activating polypeptide (PACAP) -like receptor for amnesiac like neuropeptides, sometimes hereinafter referred to as "HCEGH45". The invention also relates to inhibiting the action of such polypeptides.

It is well established that many medically significant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 352:353-354, 1991) . Herein these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins. Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al. , PNAS, 84:46-50 (1987); Kobilka^', B.K., et al., Science, 238:650-656 (1987); Bunzow, J.R. , et al., Nature, 336:783-787 (1988)), G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon et al . , Science, 252:802-8, 1991) .

For example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. G- protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G- protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.

A PACAP receptor protein purified from bovine cerebrum is disclosed in European Patent Application Publication Number 0 618 291 A2, the disclosure of which is incorporated by reference herein.

In accordance with one aspect of the present invention, there are provided novel polypeptides as well as fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.

In accordance with one aspect of the present invention, there are provided novel mature receptor polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The receptor polypeptides of the present invention are of human origin.

In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the receptor polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.

In accordance with a further aspect of the present invention, there are provided processes for producing such receptor polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequences encoding the receptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such receptor polypeptides.

In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptides of the present invention.

In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and activate the receptor polypeptide of the present invention which are useful in the prevention and/or treatment of amnesia and diseases related to nerve cell death, such as Alzheimer's disease, and other hyposecretory conditions.

In accordance with still another embodiment of the present invention there are provided processes of administering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful for preventing and/or treating PACAP hypersecretory conditions and for creating pharmacological amnesia.

In accordance with another aspect of the present invention there is provided a method of administering the receptor polypeptides of the present invention via gene therapy to treat conditions related to underexpression of the polypeptides or underexpression of a ligand to the receptor polypeptide.

In accordance with yet another aspect of the present invention, there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polynucleotide sequences of the present invention.

In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides.

In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such receptor polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors. These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor of the present invention. The standard one-letter abbreviation for amino acids is used. Sequencing was performed using a 373 Automated DNA Sequencer (Applied Biosystems, Inc.)

Figure 2 is an illustration of the secondary εtructural features of the G-protein coupled receptor. The first 7 illustrations set forth the regions of the amino acid sequence which are alpha helices, beta sheets, turn regions or coiled regions. The boxed areas are the areas which correspond to the region indicated. The second set of figures illustrate areas of the amino acid sequence which are exposed to intracellular, cytoplasmic or are membrane- spanning. The hydrophilicity plot illustrates areas of the protein sequence which are the lipid bilayer of the membrane and are, therefore, hydrophobic, and areas outside the lipid bilayer membrane which are hydrophilic. The antigenic index corresponds to the hydrophilicity plot, since antigenic areas are areas outside the lipid bilayer membrane and are capable of binding antibodies. The surface probability plot further corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plots show those regions of the protein sequences which are polar and non-polar. The flexible regions correspond to the second set of illustrations in the sense that flexible regions are those which are outside the membrane and inflexible regions are transmembrane regions.

Figure 3 illustrates an amino acid alignment of the G- protein coupled receptor of the present invention and rat PACAP-like receptor.

In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97132 on April 28, 1995.

The polynucleotide of this invention was discovered in a cDNA library derived from human cerebellum tissue. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 874 amino acid residues. The protein exhibits the highest degree of homology to rat PACAP-like receptor with 22.910 % identity and 48.607% similarity.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 or the deposited cDNA. The polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA >f the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants. As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The polynucleotides may also encode a soluble form of the receptor polypeptide which comprises the extracellular portion of the polypeptide minus the transmembrane portion and the intracellular portion.

The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.

Thus, for example, the polynucleotide of the present invention may encode a mature protein, or a protein having a prosequence or a protein having both a prosequence and a presequence (leader sequence) . The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be, for example, a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e. g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al . , Cell , 37 : 161 (1984)).

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons) .

Fragments of the full length HCEGH45 gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete HCEGH45 gene including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to. The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:l) or the deposited cDNA(s) .

Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides. The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.

The present invention further relates to a G-protein coupled receptor polypeptide which has the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e. functions as a G-protein coupled receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein coupled receptor, for example, a soluble form of the receptor. An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide. The fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such aε a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the εcope of thoεe εkilled in the art from the teachingε herein.

The polypeptideε and polynucleotides of the present invention are preferably provided in an iεolated form, and preferably are purified to homogeneity.

The term "iεolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexiεting materials in the natural syεtem, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptideε could be part of a composition, and εtill be isolated in that such vector or composition is not part of its natural environment. The polypeptides of the preεent invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at leaεt 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at leaεt 90% εimilarity (more preferably at leaεt 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (εtill more preferably at- leaεt 95% identity) to the polypeptide of SEQ ID NO:2 and alεo include portionε of such polypeptideε with εuch portion of the polypeptide generally containing at leaεt 30 amino acidε and more preferably at leaεt 50 amino acids.

Aε known in the art "εimilarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid εubεtituteε of one polypeptide to the εequence of a second polypeptide.

Fragmentε or portionε of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediateε for producing the full-length polypeptideε. Fragmentε or portionε of the polynucleotides of the preεent invention may be used to εyntheεize full-length polynucleotideε of the preεent invention.

The present invention also relates to vectors which include polynucleotideε of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniqueε.

Hoεt cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plaεmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformantε or amplifying the HCEGH45 geneε. The culture conditionε, such aε temperature, pH and the like, are thoεe previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artiεan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expresεion vectorε for expresεing a polypeptide. Such vectorε include chromoεomal, nonchromoεomal and εynthetic DNA εequenceε, e.g., derivativeε of SV40; bacterial plasmids; phage DNA; baculoviruε; yeast plasmidε; vectorε derived from combinationε of plaεmidε and phage DNA, viral DNA εuch as vaccinia, adenoviruε, fowl pox viruε, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures . In general, the DNA sequence is inεerted into an appropriate reεtriction endonucleaεe εite(ε) by procedureε known in the art. Such procedureε and otherε are deemed to be within the εcope of thoεe εkilled in the art .

The DNA εequence in the expreεεion vector iε operatively linked to an appropriate expreεεion control sequence (s) (promoter) to direct mRNA syntheεis . As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli . lac or trp, the phage lambda P_L promoter and other promoters known to control expresεion of geneε in prokaryotic or eukaryotic cellε or their viruεeε. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of tranεformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resiεtance in E. coli .

The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to expresε the protein.

As repreεentative exampleε of appropriate hoεtε, there may be mentioned: bacterial cellε, εuch as E. coli , Streptomyces , Salmonella typhimurium; fungal cells, such as yeast; insect cells such aε Drosophila and Spodoptera Sf9; animal cellε such aε CHO, COS or Boweε melanoma; adenovirus plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant conεtructε compriεing one or more of the sequences aε broadly deεcribed above. The conεtructε compriεe a vector, εuch as a plaεmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further compriεes regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectorε are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen) , pbε, pDIO, phageεcript, psiX174, pblueεcript SK, pbεks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia) . Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) . However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene uεing CAT (chloramphenicol tranεferaεe) vectorε or other vectorε with εelectable markerε . Two appropriate vectorε are PKK232-8 and PCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P_R, P and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I . Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art .

In a further embodiment, the present invention relateε to host cells containing the above-described conεtructε . The hoεt cell can be a higher eukaryotic cell, εuch aε a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such aε a bacterial cell. Introduction of the conεtruct into the hoεt cell can be effected by calcium phoεphate transfection, DEAE- Dextran mediated tranεfection, or electroporation. (Daviε et al., Baεic Methods in Molecular Biology, Elεevier, NY (1986) ) . The constructs in host cellε can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expresεed in mammalian cellε, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systemε can also be employed to produce such proteins using RNAs derived from the DNA constructε of the present invention. Appropriate cloning and expresεion vectorε for uεe with prokaryotic and eukaryotic hosts are described by Sambrook et al . , Molecular Cloning: A Laboratory Manual , Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increaεed by inserting an enhancer sequence into the vector. Enhancerε are ciε-acting elementε of DNA, uεually about from 10 to 300 bp that act on a promoter to increaεe itε tranεcription. Exampleε including the SV40 enhancer on the late εide of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expresεion vectors will include origins of replication and εelectable markerε permitting tranεformation of the hoεt cell, e. g. , the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoterε can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , or-factor, acid phoεphataεe, or heat εhock proteinε, among otherε. The heterologous εtructural εequence is aεsembled in appropriate phase with tranεlation initiation and termination εequenceε, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic εpace or extracellular medium. Optionally, the heterologouε εequence can encode a fuεion protein including an N-terminal identification peptide imparting deεired characteriεticε, e . g. , εtabilization or εimplified purification of expressed recombinant product.

Useful expresεion vectorε for bacterial uεe are conεtructed by inserting a εtructural DNA εequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic εelectable markerε and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hostε for tranεformation include E. coli , Bacillus subtilis , Salmonella typhimurium and various species within the genera Pseudomonaε, Streptomyces, and Staphylococcuε, although others may also be employed as a matter of choice.

As a representative but nonlimiting example, useful expresεion vectorε for bacterial uεe can compriεe a εelectable marker and bacterial origin of replication derived from commercially available plaεmidε compriεing genetic elements of the well known cloning vector pBR322 (ATCC 37017) . Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, WI, USA) . Theεe pBR322 "backbone" εectionε are combined with an appropriate promoter and the εtructural εequence to be ex-ressed.

Following tranεformation of a εuitable host εtrain and growth of the hoεt εtrain to an appropriate cell denεity, the εelected promoter iε induced by appropriate meanε (e.g., temperature εhift or chemical induction) and cellε are cultured for an additional period.

Cellε are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in expresεion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agentε, εuch methodε are well know to thoεe εkilled in the art.

Variouε mammalian cell culture εyεtemε can alεo be employed to expreεε recombinant protein. Examples of mammalian expression syεtemε include the COS-7 lineε of monkey kidney fibroblasts, described by Gluzman, Cell , 23 : 115 (1981) , and other cell lines capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lineε. Mammalian expreεεion vectorε will compriεe an origin of replication, a εuitable promoter and enhancer, and alεo any neceεεary riboεome binding sites, polyadenylation εite, εplice donor and acceptor εiteε, tranεcriptional termination εequences, and 5' flanking nontranscribed εequenceε. DNA εequenceε derived from the SV40 εplice, and polyadenylation εiteε may be uεed to provide the required nontranscribed genetic elements . The G-protein coupled receptor polypeptides can be recovered and purified from recombinant cell cultureε by methods including ammonium εulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The polypeptides of the preεent invention may be a naturally purified product, or a product of chemical εynthetic procedureε, or produced by recombinant techniques from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeaεt, higher plant, inεect and mammalian cellε in culture) . Depending upon the hoεt employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycoεylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

The polynucleotides and polypeptideε of the preεent invention may be employed as research reagents and materials for diεcovery of treatmentε and diagnoεticε to human disease.

The G-protein coupled receptor of the present invention may be employed in a procesε for εcreening for antagoniεtε and/or agoniεtε for the receptor.

In general, εuch εcreening procedures involve providing appropriate cells which expresε the receptor on the εurface thereof. In particular, a polynucleotide encoding the receptor of the present invention is employed to transfect cellε to thereby expreεε the G-protein coupled receptor. Such transfection may be accomplished by procedures as hereinabove described.

One such εcreening procedure involveε the uεe of the melanophoreε which are tranεfected to expreεε the G-protein coupled receptor of the preεent invention. Such a εcreening technique iε deεcribed in PCT WO 92/01810 publiεhed February 6, 1992.

Thuε, for example, εuch assay may be employed for screening for a receptor antagonist by contacting the melanophore cellε which encode the G-protein coupled receptor with both the receptor ligand and a compound to be εcreened. Inhibition of the εignal generated by the ligand indicates that a compound iε a potential antagoniεt for the receptor, i.e., inhibitε activation of the receptor.

The screen may be employed for determining an agoniεt by contacting such cells with compoundε to be εcreened and determining whether εuch compound generateε a εignal, i.e., activateε the receptor.

Other εcreening techniqueε include the uεe of cells which express the G-protein coupled receptor (for example, transfected CHO cells) in a system which measureε extracellular pH changeε cauεed by receptor activation, for example, aε deεcribed in Science, 246:181-296 (October 1989) . For example, potential agoniεts or antagonists may be contacted with a cell which expresses the G-protein coupled receptor and a second messenger reεponεe, e. g. εignal tranεduction or pH changes, may be measured to determine whether the potential agonist or antagonist is effective. Another such screening technique involves introducing RNA encoding the G-protein coupled receptor into xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted in the case of antagonist screening with the receptor ligand and a compound to be screened, followed by detection of inhibition of a calcium signal.

Another screening technique involves expreεsing the G- protein coupled receptor in which the receptor is linked to a phospholipase C or D. As representative examples of such cells, there may be mentioned endothelial cellε, smooth muεcle cells, embryonic kidney cells, etc. The screening for an antagoniεt or agoniεt may be accompliεhed aε hereinabove deεcribed by detecting activation of the receptor or inhibition of activation of the receptor from the phoεpholipaεe εecond εignal.

Another method involves screening for antagoniεtε by determining inhibition of binding of labeled ligand to cellε which have the receptor on the εurface thereof. Such a method involveε transfecting a eukaryotic cell with DNA encoding the G-protein coupled receptor such that the cell expreεεes the receptor on its surface and contacting the cell with a potential antagoniεt in the preεence of a labeled form of a known ligand. The ligand can be labeled, e . g. , by radioactivity. The amount of labeled ligand bound to the receptors iε meaεured, e. g. , by meaεuring radioactivity of the receptorε. If the potential antagoniεt bindε to the receptor aε determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.

The present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein coupled receptor can bind to εuch receptor which compriεes contacting a mammalian cell which expresses a G-protein coupled receptor with the ligand under conditions permitting binding of ligandε to the G-protein coupled receptor, detecting the preεence of a ligand which bindε to the receptor and thereby determining whether the ligand bindε to the G-protein coupled receptor. The εyεtemε hereinabove deεcribed for determining agoniεtε and/or antagoniεts may also be employed for determining ligands which bind to the receptor.

In general, antagonists for G-protein coupled receptors which are determined by screening procedures may be employed for a variety of therapeutic purposeε. For example, such antagonists have been employed for treatment of hypertension, angina pectoris, myocardial infarction, ulcerε, aεthma, allergies, psychoseε, depreεεion, migraine, vomiting, and benign proεtatic hypertrophy.

Agoniεtε for G-protein coupled receptorε are alεo uεeful for therapeutic purpoεes, such as the treatment of asthma, Parkinson'ε diεeaεe, acute heart failure, hypotenεion, urinary retention, and oεteoporosis.

A potential antagoniεt iε an antibody, or in some cases an oligonucleotide, which binds to the G-protein coupled receptor but does not elicit a second messenger response such that the activity of the G-protein coupled receptor is prevented.

Potential antagonistε also include proteins which are closely related to the ligand of the G-protein coupled receptor, i.e. a fragment of the ligand, which have lost biological function and when binding to the G-protein coupled receptor, elicit no reεponεe. A potential antagoniεt alεo includes an antisenεe construct prepared through the use of antisenεe technology. Antiεenεe technology can be used to control gene expresεion through triple-helix formation or antiεense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisenεe RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide iε deεigned to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al . , Nucl . Acids Res . , 6: 3013 (1979); Cooney et al , Science, 241:456 (1988); and Dervan et al . , Science, 251:1360 (1991)), thereby preventing transcription and the production of G-protein coupled receptor. The antisenεe RNA oligonucleotide hybridizeε to the mRNA in vivo and blocks translation of the mRNA molecule into the G-protein coupled receptor (antisenεe - Okano, J^". Neurochem. , 56: 560 (1991); Oligodeoxynucleotideε aε Antiεense Inhibitorε of Gene Expression, CRC Presε, Boca Raton, FL (1988)). The oligonucleotideε deεcribed above can alεo be delivered to cellε εuch that the antisense RNA or DNA may be expressed in vivo to inhibit production of G-protein coupled receptor.

Another potential antagonist iε a εmall molecule which bindε to the G-protein coupled receptor, making it inacceεεible to ligandε such that normal biological activity is prevented. Examples of small molecules include but are not limited to small peptides or peptide-like moleculeε.

Potential antagoniεtε alεo include a εoluble form of a G-protein coupled receptor, e. g. a fragment of the receptor, which bindε to the ligand and preventε the ligand from interacting with membrane bound G-protein coupled receptorε. The G-protein coupled receptor of the preεent invention has been putatively identi: ed as a PACAP-like or secretin receptor. This identification haε been made aε a reεult of amino acid sequence homology.

The antagoniεtε may be used to treat hypersecretory conditionsand to create pharmacological amneεia or effect long-term memory. The antagoniεtε may be employed in a composition with a pharmaceutically acceptable carrier, e. g. , as hereinafter deεcribed.

The agonists identified by the screening method aε deεcribed above, may be employed to treat hyposecretory conditions, to improve memory, to treat amneεia and prevent nerve cell death in neuropathy to prevent and/or treat diseases such as Alzheimer's disease.

The antagonists or agoniεts may be employed in combination with a suitable pharmaceutical carrier. Such compositions compriεe a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includeε but iε not limited to saline, buffered saline, dextroεe, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provideε a pharmaceutical pack or kit compriεing one or more containerε filled with one or more of the ingredientε of the pharmaceutical compoεitions of the invention. Associated with such container(ε) can be a notice in the form preεcribed by a governmental agency regulating the manufacture, uεe or sale of pharmaceuticals or biological products, which notice reflectε approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides or agonistε or antagoniεtε of the preεent invention may be employed in conjunction with other therapeutic compoundε.

The pharmaceutical compoεitions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneouε, intranaεal or intradermal routeε. The pharmaceutical compoεitionε are adminiεtered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at leaεt about 10 μg/kg body weight and in moεt cases they will be administered in an amount not in exceεε of about 8 mg/Kg body weight per day. In most caseε, the doεage iε from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routeε of administration, symptoms, etc.

This invention also provides a method of detecting expression of a HCEGH45 receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which compriεeε obtaining total mRNA from the cell and contacting the mRNA εo obtained with a nucleic acid probe compriεing a nucleic acid molecule of at leaεt 10 nucleotideε capable of εpecifically hybridizing with a εequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditionε, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the receptor by the cell.

The present invention also provides a method for identifying receptors related to the receptor polypeptides of the preεent invention. These related receptors may be identified by homology to a HCEGH45 receptor polypeptide of the present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the neuropeptide receptor polypeptides of the present invention.

The HCEGH45 receptor polypeptides and antagonistε or agoniεtε which are polypeptideε, may be employed in accordance with the preεent invention by expreεεion of εuch polypeptideε in vivo, which iε often referred to aε "gene therapy. "

Thuε, for example, cellε from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cellε then being provided to a patient to be treated with the polypeptide. Such methodε are well-known in the art. For example, cellε may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expresεion of the polypeptide in vivo. Theεe and other methodε for adminiεtering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expresεion vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cellε in vivo after combination with a εuitable delivery vehicle. Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosiε virus, retroviruseε such as Rous Sarcoma Viruε, Harvey Sarcoma Viruε, avian leukoεiε viruε, gibbon ape leukemia viruε, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor viruε. In one embodiment, the retroviral plaεmid vector iε derived from Moloney Murine Leukemia Viruε.

The vector includeε one or more promoterε. Suitable promoterε which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechnicrues. Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and /3-actin promoters) . Other viral promoters which may be employed include, but are not limited to, adenovirus promoterε, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the preεent invention iε under the control of a εuitable promoter. Suitable promoterε which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory εyncytial viruε (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove deεcribed) ; the β-actin promoter; and human growth hormone promoterε. The promoter alεo may be the native promoter which controlε the geneε encoding the polypeptideε.

The retroviral plaεmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cellε which may be tranεfected include, but are not limited to, the PE501, PA317, ψ-2 , φ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE , ψCRIl? , GP+E-86, GP+envAml2, and DAN cell lines aε deεcribed in Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such meanε include, but are not limited to, electroporation, the use of liposomes, and CaP0₄ precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a hoεt.

The producer cell line generateε infectiouε retroviral vector particleε which include the nucleic acid εequence(ε) encoding the polypeptideε. Such retroviral vector particleε then may be employed, to tranεduce eukaryotic cellε, either in vi tro or in vivo. The tranεduced eukaryotic cells will expresε the nucleic acid εequence(ε) encoding the polypeptide. Eukaryotic cellε which may be tranεduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic εtem cellε, hepatocytes, fibroblastε, myoblaεts, keratinocytes, endothelial cellε, and bronchial epithelial cellε.

The preεent invention alεo contemplates the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes. These genes can be detected by comparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is aεsociated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e.g., colorimetric assay, expresεion on MacConkey plateε, complementation experimentε, in a receptor deficient εtrain of HEK293 cellε) aε yet another meanε to verify or identify mutationε. Once "mutant" geneε have been identified, one can then screen population for carriers of the "mutant" receptor gene.

Individuals carrying mutations in the gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosiε may be obtained from a patient'ε cellε, including but not limited to such aε from blood, urine, saliva, tissue biopsy and autopεy material. The genomic DNA may be uεed directly for detection or may be amplified enzymatically by uεing PCR (Saiki, et al., Nature, 324:163-166 1986) prior to analyεiε. RNA or cDNA may alεo be uεed for the εame purpoεe. Aε an example, PCR primerε complimentary to the nucleic acid of the inεtant invention can be used to identify and analyze mutationε in the gene of the present invention. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antisense DNA sequenceε of the invention. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.

Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method. In addition, cloned DNA εegments may be used aε probes to detect specific DNA segmentε. The sensitivity of this method iε greatly enhanced when combined with PCR. For example, a εequence primer iε used with double stranded PCR product or a single εtranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radio labeled nucleotide or by an automatic sequencing procedure with fluoreεcent-tagε .

Genetic teεting baεed on DNA εequence differenceε may be achieved by detection of alterationε in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents . Sequences changes at specific locationε may alεo be revealed by nucleuε protection aεεayε, εuch RNase and SI protection or the chemical cleavage method (e.g. Cotton, et al., PNAS, USA. 85:4397-4401 1985) .

In addition, some diseaseε are a reεult of, or are characterized by changeε in gene expreεεion which can be detected by changeε in the mRNA. Alternatively, the genes of the present invention can be uεed aε a reference to identify individuals expreεsing a decrease of functionε aεεociated with receptors of thiε type.

The present invention alεo relateε to a diagnoεtic aεεay for detecting altered levels of soluble forms of the HCEGH45 receptor polypeptides of the present invention in various tissues. Asεayε uεed to detect levelε of the εoluble receptor polypeptideε in a εample derived from a host are well known to those of εkill in the art and include radioimmunoaεεays, competitive-binding assays, Western blot analysis and preferably as ELISA assay.

An ELISA assay initially comprises preparing an antibody specific to antigens of the HCEGH45 receptor polypeptides, preferably a monoclonal antibody. In addition a reporter antibody is prepared againεt the monoclonal antibody. To the reporter antibody iε attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradiεh peroxidaεe enzyme. A εample iε now removed from a host and incubated on a solid εupport, e.g. a polyεtyrene dish, that binds the proteins in the sample. Any free protein binding siteε on the diεh are then covered by incubating with a non¬ specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the diεh during which time the monoclonal antibodies attach to any HCEGH45 receptor proteins attached to the polystyrene diεh. All unbound monoclonal antibody iε washed out with buffer. The reporter antibody linked to horseradiεh peroxidaεe iε now placed in the diεh reεulting in binding of the reporter antibody to any monoclonal antibody bound to HCEGH45 receptor proteins. Unattached reporter antibody is then washed out. Peroxidase subεtrateε are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of HCEGH45 receptor proteins present in a given volume of patient sample when compared against a standard curve.

The sequenceε of the present invention are also valuable for chromosome identification. The sequence is εpecifically targeted to and can hybridize with a particular location on an individual human chromoεome. Moreover, there iε a current need for identifying particular εites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating thoεe εequences with geneε aεsociated with diseaεe. Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysiε of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification proceεε. Theεe primerε are then uεed for PCR εcreening of εomatic cell hybridε containing individual human chromoεomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

PCR mapping of εomatic cell hybridε iε a rapid procedure for aεεigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomeε or poolε of large genomic cloneε in an analogouε manner. Other mapping εtrategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes nd preselection by hybridization to construct chromoεome εpecific-cDNA librarieε.

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromoεomal εpread can be uεed to provide a precise chromosomal location in one step. Thiε technique can be uεed with cDNA aε εhort as 50 or 60. For a review of this technique, see Verma et al . , Human Chromosomes : a Manual of Basic Techniques, Pergamon Press, New York (1988) .

Once a sequence has been mapped to a precise chromoεomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in McKusick, Mendelian Inheri tance in Man (available on line through Johns Hopkins University Welch Medical Library) . The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes) .

Next, it iε neceεsary to determine the differences in the cDNA or genomic εequence between affected and unaffected individualε. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation iε likely to be the cauεative agent of the disease.

With current reεolution of phyεical mapping and genetic mapping techniques, a cDNA precisely localized to a chromoεomal region aεεociated with the diεeaεe could be one of between 50 and 500 potential cauεative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .

The polypeptides, their fragmentε or other derivativeε, or analogs thereof, or cells expresεing them can be uεed aε an immunogen to produce antibodieε thereto. Theεe antibodieε can be, for example, polyclonal or monoclonal antibodieε. The present invention also includeε chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the preεent invention can be obtained by direct injection of the polypeptides into an animal or by adminiεtering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate t ;e polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Exampleε include the hybridoma technique (Kohler and Milstein, JVature, 256^':495-497, 1975), the trioma technique, the human B-cell hybridoma technique

(Kozbor et al . , Immunology Today 4 : 12 , 1983), and the EBV- hybridoma technique to produce human monoclonal antibodies

(Cole et al . , in Monoclonal Antibodies and Cancer Therapy, Alan R. Lisε, Inc., pp. 77-96, 1985).

Techniqueε described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce εingle chain antibodieε to immunogenic polypeptide products of this invention. Alεo, tranεgenic mice may be uεed to expreεε humanized antibodies to immunogenic polypeptide productε of thiε invention.

The preεent invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amountε, unleεs otherwise εpecified, are by weight.

In order to facilitate underεtanding of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artiεan.

"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes uεed herein are commercially available and their reaction conditionε, cofactorε and other requirementε were uεed as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpoεe of isolating DNA fragments for plasmid conεtruction, typically 5 to 50 μg of DNA are digeεted with 20 to 250 unitε of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymeε are εpecified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragmentε is performed using 8 percent polyacrylamide gel described by Goeddel et al . , Nucleic Acids Res . , 8 : 4051 (1980) .

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that haε not been dephoεphorylated.

"Ligation" referε to the process of forming phosphodieεter bondε between two double εtranded nucleic acid fragmentε (Maniatiε et al . , Id., p. 146) . Unleεε otherwiεe provided, ligation may be accorolished uεing known bufferε and conditions with 10 units to T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amountε of the DNA fragmentε to be ligated.

Unleεε otherwiεe εtated, tranεformation waε performed aε deεcribed in the method of Graham and Van der Eb, Virology, 52:456-457 (1973) .

Example 1 Expression of Recombinant HCEGH45 in COS-7 cells The expreεεion of plaεmid, HCEGH45-HA iε derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin reεiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation εite. A DNA fragment encoding the entire HCEGH45 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein aε previouεly deεcribed (Wilεon et al . , Cell 37 : 161 , 1984) . The infuεion of HA tag to our target protein allowε eaεy detection of the recombinant protein with an antibody that recognizeε the HA epitope.

The plaεmid construction strategy iε deεcribed as follows: The DNA sequence encoding HCEGH45, ATCC # 97132, was constructed by PCR was cloned using two primers: the 5' primer GGCTTCCTCGAATCCCGTCATGAACTCC (SEQ ID NO:4) contains an EcoRI site followed by 9 nucleotides of HCEGH45 coding sequence starting from the initiation codon; the 3' sequence GMTTCTCGAGCGGGCACTGCTCACAGAGGAGACG (SEQ ID NO:5) contains complementary sequences to an Xhol site, translation stop codon, HA tag and the last 11 nucleotides of the HCEGH45 coding sequence (not including the stop codon) . Therefore, the PCR product contains an EcoRi site, HCEGH45 coding sequence, a translation termination stop codon and an Xhol site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with EcoRI and Xhol restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant HCEGH45, COS-7 cells were transfected with the expression vector by DEAE-DEXTRAN method. (Sambrook et al . , Molecular Cloning: A Laboratory Manual , Second Edition, Cold Spring Laboratory Press, (1989)). The expression of the HCEGH45-HA protein was detected by radiolabelling and immunoprecipitation method. (Harlow and Lane, AπtiJbodies: A Laboratory Manual , Cold Spring Harbor Laboratory Press, (1988)) . Cells were labelled for 8 hours with ³⁵S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson et al . , Id. 37:767 (1984)). Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody. Proteins precipitated were analyzed on 15% SDS-PAGE gels. Example 2 Cloning and Expression of HCEGH45 Using the Baculovirus Expression System

The DNA sequence encoding the full length HCEGH45 protein, ATCC # 97132, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

The 5' primer has the sequence GTGCGTCCCGGGTTCCTCAGACC GCCATCATGAACTCC (SEQ ID NO:4) and contains a Smal restriction enzyme site (in bold) followed by 17 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, J. Mol . Biol . 196:947-950 (1987) , and just behind the first 9 nucleotides of the HCEGH45 gene (the initiation codon for translation "ATG" is underlined) .

The 3' primer has the sequence CGGGTACCAGAGCGGGCA CTGCTCACAGAGGAGACG (SEQ ID NO:5) and contains the cleavage site for the restriction endonuclease Asp718 and 13 nucleotides complementary to the 3' non-translated sequence of the HCEGH45 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonucleases Smal and Asp718 and then purified as described above. This fragment is designated F2.

The vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the HCEGH45 protein using the baculovirus expression system (for review see: Summers and Smith, A Manual of Methods for Baculovirus Vectorε and Insect Cell Cul ture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555, 1987) . This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleaεes Smal and Asp718. The polyadenylation εite of the simian virus (SV)40 is used for efficient polyadenylation. For an easy εelection of recombinant viruεes the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequenceε for the cell-mediated homologous recombination of co-tranεfected wild-type viral DNA. Many other baculoviruε vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow and Summers, Virology, 170:31-39 1989) .

The plasmid was digested with the restriction enzymes Smal and Asp718 and then dephoεphorylated uεing calf inteεtinal phosphatase by procedureε known in the art. The DNA waε then iεolated from a 1% agaroεe gel aε deεcribed above. Thiε vector DNA is designated V2.

Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBac-HCEGH45) with the HCEGH45 gene using the enzymes Smal and Asp718. The sequence of the cloned fragment was confirmed by DNA sequencing.

5 μg of the plasmid pBac-HCEGH45 were co-transfected with 1.0 μg of a commercially available linearized baculovirus ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA. ) using the lipofection method (Feigner et al . , Proc . Natl . Acad. Sci . USA, 84:7413-7417 (1987)) .

lμg of BaculoGold™ virus DNA and 5 μg of the plasmid pBac-HCEGH45 were mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD) . Afterwards 10 μl Lipofectin pluε 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added drop wise to the Sf9 insect cellε (ATCC CRL 1711) εeeded in a 35 mm tiεεue culture plate with 1 ml Grace' medium without εerum. The plate waε rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium εupplemented with 10% fetal calf εerum waε added. The plate was put back into an incubator and cultivation continued at 27°C for four days.

After four days the supernatant was collected and a plaque asεay performed εimilar aε deεcribed by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allowε an eaεy iεolation of blue εtained plaqueε . (A detailed deεcription of a "plaque assay" can also be found in the user' ε guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9- 10) .

Four days after the serial dilution of the viruses was added to the cells, blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruseε was then reεuεpended in an Eppendorf tube containing 200 μl of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses was used to infect Sf9 cells εeeded in 35 mm diεhes . Four days later the εupernatants of these culture dishes were harvested and then stored at 4°C.

Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS . The cells were infected with the recombinant baculovirus V-HCEGH45 at a multiplicity of infection (MOD of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg) . 42 hourε later 5 μCi of ³⁵S-methionine and 5 μCi ³⁵S cyεteine (Amerεham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Example 3 Expression Pattern of HCEGH45 in Human Tissue Northern blot analysis is carried out to examine the levelε of expreεεion of HCEGH45 in human tiεεues. Total cellular RNA εamples are isolated with RNAzol™ B system (Biotecx Laboratories, Inc. 6023 South Loop East, Houεton, TX 77033) . About lOμg of total RNA iεolated from each human tiεεue εpecified is separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatiε, Molecular Cloning, Cold Spring Harbor Preεs, (1989)) . The labeling reaction is done according to the Stratagene Prime- It kit with 50ng DNA fragment. The labeled DNA is purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303) . The filter is then hybridized with radioactive labeled full length HCEGH45 gene at 1,000,000 cpm/ml in 0.5 M NaP0₄, pH 7.4 and 7% SDS overnight at 65'C. After being washed twice at room temperature and twice at 60^*C with 0.5 x SSC, 0.1% SDS, the filter is then exposed at -70^*C overnight with an intensifying screen. The mesεage RNA for HCEGH45 iε abundant in human cerebellum tissue.

Example 4 Expression via Gene Therapy

Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tisεue-culture medium and εeparated into εmall pieceε. Small chunkε of the tiεsue are placed on a wet surface of a tisεue culture flaεk, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and εubsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flaskε. pMV-7 (Kirεchmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeatε of the Moloney murine sarcoma virus, iε digested with EcoRI and Hindlll and subsequently treated with calf intesimal phosphataεe. The linear vector is fractionated on agarose gel and purified, using glass beads.

The cDNA encoding a polypeptide of the preεent invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer contains an EcoRI εite and the 3' primer further includeε a Hindlll site. Equal quantitieε of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .

Fresh media is added to the transduced producer cells, and subεequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particleε, iε filtered through a millipore filter to remove detached producer cellε and thiε media iε then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a εelectable marker, such as neo or his.

The engineered fibroblastε are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblastε now produce the protein product.

Numerous modifications and variations of the present invention are posεible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

Claims

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:

(a) a polynucleotide encoding the polypeptide as set forth in Figure 1;

(b) a polynucleotide encoding a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 97132;

(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b) ; and

(d) a polynucleotide fragment of the polynucleotide of (a) or (b) .

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 comprising from nucleotide 1 to nucleotide 4568 as set forth in Figure 1.

4. The polynucleotide of Claim 1 encoding a soluble form of the polypeptide of Figure 1.

5. A vector containing the DNA of Claim 2.

6. A host cell transformed or transfected with the vector of Claim 5.

7. A process for producing a polypeptide comprising: expressing from the host cell of Claim 8 the polypeptide encoded by said DNA.

8. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cells with the vector of Claim 5.

9. A receptor polypeptide comprising a member selected from the group consisting of: (i) a polypeptide having the deduced amino acid sequence of Figure l and fragments, analogs and derivatives thereof; and

(ii) a polypeptide encoded by the cDNA of ATCC Deposit No. 97132 and fragments, analogs and derivatives of said polypeptide.

10. An antibody against the polypeptide of claim 9.

11. A compound which activates the polypeptide of claim 9.

12. A compound which inhibits activation of the polypeptide of claim 9.

13. A method for the treatment of a patient having need to activate a G-protein receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 11.

14. A method for the treatment of a patient having need to inhibit a G-protein receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 12.

15. The method of claim 13 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA encoding said agonist and expressing said agonist in vivo.

16. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 9 comprising: determining a mutation in the nucleic acid sequence encoding said polypeptide.

17. The polypeptide of Claim 9 wherein the polypeptide is a soluble fragment of the polypeptide and is capable of binding a ligand for the receptor.

18. A diagnoεtic process comprising: analyzing for the presence of the polypeptide of claim 17 in a sample derived from a host.

19. A method for identifying compounds which bind to and activate and which bind to and inhibit a G-protein coupled receptor polypeptide comprising: contacting a cell expresεing on the surface thereof the receptor polypeptide, said receptor being asεociated with a εecond component capable of providing a detectable εignal in response to the binding of a compound to said receptor polypeptide, with a compound under conditions sufficient to permit binding of the compound to the receptor polypeptide; and identifying if the compound iε an effective agoniεtε or antagonist by detecting the presence or absence of the εignal produced by said second component.

20. A process for diagnosing a diεease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 9 comprising: determining a mutation in the nucleic acid sequence encoding said polypeptide.