CA2221637A1 - Human g-protein receptor hcegh45 - Google Patents

Abstract

A human G-protein receptor HCEGH45 polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide for identifying antagonists and agonists to such polypeptide. Antagonists against such polypeptides may be used therapeutically to treat PACAP hypersecretory conditions and to create pharmacological amnesia models while the agonists may be employed to treat amnesia and Alzheimer's disease. Also disclosed are diagnostic methods for detecting a mutation in the receptor nucleic acid sequences and detecting a level of the soluble form of the receptors in a sample derived from a host.

Description

W~ 96~9439 PCTrUS9~071 HX~N G-PROTEIN RECEPTOR HCEGH45 This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the u~e of such polynucleotides and polyE~eptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a human 7-tran~membrane receptor. The tran~membrane receptor is a G-protein coupled receptor. More particularly, the 7-transmembrane receptor has been putatively identified as a hl~m~n G-protein pituitary adenylate cycla~e activating polypeptide (PACAP)-like receptor for amnesiac like neuropeptides, sometimes hereinafter referred to as l'HCEGH45". The invention also relates to inhibiting the action of such polypeptides.

It i~ well established that many medically significant biological processes are mediated by proteins participating in si~nal transduction pathways that involve G-proteins and/or second messenger6, e.g., cAMP (Lefkowitz, Nature, 351: 353-354, 1991). Herein these proteins are referred to as proteins participating in pathways with G-protein6 or PPG
proteins. Some examples of these proteins include the GPC
receptors, such as those for adrenergic agents and dopamine W O 96/39439 PCT~US95/07188 (Kobil~a, B.K., et al., PNAS, 84:46-50 (1987); Kobilka; B.K., et al., Science, 238:650-656 (1987); Bunzow, J.R., et al., Nature, 336:783-787 (1988)), G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon et al., Science, 252:802-8, 1991).

For example, in one form of signal transduction, the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP, and GTP also influences hormone binding. A G-protein connects the hormone receptors to adenylate cyclase. G-protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP-carrying form then binds to an activated adenylate cyclase. Hydrolysis of GTP
to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.

A PACAP receptor protein purified from bovine cerebrum is disclosed in European Patent Application Publication Number 0 618 291 A2, the disclosure of which is incorporated by reference herein.

In accordance with one aspect of the present invention, there are provided novel polypeptides as well as fragments, analogs and derivatives thereof. The polypeptide6 o~ the present invention are of human origin.

In accordance with one aspect of the present invention, there are provided novel mature receptor polypeptides as well CA 0222l637 l997-ll-l9 W O 96139439 PCT~US95/07188 as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The receptor polypeptides of the present invention are of hllm~n origin.

In accordance with another aspect of the present invention, there are provided i801ated nucleic acid molecules encoding the receptor polypeptides of the present invention, including mRNAs, DNAs, cDNAs, genomic DN~ as well as anti8en~e analog8 thereof and biologically active and diagnostically or therapeutically u~e~ul fragments thereof.

In accordance with a further aspect of the present in~ention, there are provided processes for producing such rec:eptor polypeptides by recombinant techniques compri8ing cu]turing recombinant prokaryotic and/or eukaryotic host ce]lR, contA;n;ng nucleic acid sequences encoding the rec:eptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and s~)sequent recovery of said polypeptides.

In accordance with yet a further aspect of the present invention, there are provided antibodies against such receptor polypeptides.

In accordance with another aspect of the present invention there are provided methods of screening for compounds which bind to and activate or inhibit activation of the receptor polypeptide~ of the present invention.

In accordance with still another embodiment of the present invention there are provided processes of administering compound~ to a host which bind to and activate the receptor polypeptide of the present invention which are useful in the prevention and/or treatment of amnesia and .

W O 96~9439 PCT~US95/07188 diseases related to nerve cell death, such as Alzheimer's disease, and other hyposecretory conditions.

In accordance with still another embodiment of the present invention there are provided processes of ~mi n; gtering compounds to a host which bind to and inhibit activation of the receptor polypeptides of the present invention which are useful for preventing and/or treating PACAP hypersecretory conditions and for creating pharmacological amnesia.

In accordance with another aspect of the present invention there is provided a method of ~m; n; stering the receptor polypeptides of the present invention via gene therapy to treat conditions related to underexpression of the polypeptides or underexpression of a ligand to the receptor polypeptide.

In accordance with yet another aspect of the present invention, there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polynucleotide sequences of the present invention.

In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to mutations in the nucleic acid se~uences encoding ~uch polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides.

In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such receptor polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

CA 0222l637 l997-ll-l9 W O 96,139439 PCTAUS95J07188 The6e and other aspects of the pre~ent invention should be apparent to tho~e skilled in the art from the teachings herein.

~ he following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the inve,ntion as enco~r~sed by the claims.

Figure 1 shows the cDNA sequence and the corresponding decluced amino acid se~uence of the G-protein coupled receptor of the present invention. The st~n~d one-letter abbre~riation for amino acids i8 used. Sequencing was performed using a 373 Automated DNA Sequencer (Applied Biosystems, Inc.) Figure 2 is an illustration of the secon~y structural feature~ of the G-protein coupled receptor. The first 7 illu~trations set forth the regions of the amino acid sequence which are alpha helices, beta sheets, turn regions or coiled regions. The boxed areas are the areas which correspond to the region indicated. The second set of fi~ures illustrate areas o~ the amino acid sequence which are expo~ed to intracellular, cytoplasmic or are membrane-8p~nn; ng . The hydrophilicity plot illustrates areas of the protein sequence which are the lipid bilayer of the membrane and are, therefore, hydrophobic, and areas outside the lipid bilayer membrane which are hydrophilic. The antigenic index corresponds to the hydrophilicity plot, since antigenic areas are areas outside the lipid bilayer membrane and are capable of binding antibodies. The surface probability plot further corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plots show those regions of the protein sequences which are polar and non-polar. The flexible regions correspond to the second set of illu~trations in the sense that flexible regions are those W O 96~9439 PCTrUS95/07188 which are outside the membrane and inflexible regions are trAnRm~mbrane regions.

Figure 3 illustrates an amino acid alignment of the G-protein coupled receptor of the present invention and rat PACAP-like receptor.

In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97132 on April 28, 1995.

The polynucleotide of this invention was discovered in a cDNA library derived from human cerebellum tissue. It is structurally related to the G protein-coupled receptor family. It cont~ns an open r~Aing frame encoding a protein of 874 amino acid residues. The protein exhibits the highest degree of homology to rat PACAP-like receptor with 22.910 identity and 48.607~ similarity.

The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coA; ng sequence which ~nCo~es the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the reAl-n~Ancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 or the deposited cDNA.

CA 0222l637 l997-ll-l9 W O 96/39439 PCT~US95/07188 The polynucleotide which encode~ for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory se~ence or a proprotein sequence; the co~ing sequence for the ma~ure polypeptide (and optionally additional coding sequen~e) and non-coding sequence, such as int:rons or non-coding sequence 5' and/or 3' of the coding se~uence for the mature polypeptide.

Thus, the term 'Ipolynucleotide encoding a polypeptide"
enco~passes a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

The present invention further relates to variants of the hereinabove described polynucleotides which encode fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode a fragment, derivative or analog of the poly~eptide of Figure 1 or the polypeptide encoded by the cDMA _f the depo~ited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

W O 96~39439 PCT~US95/07188 As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The polynucleotides may also encode a soluble form of the receptor polypeptide which comprises the extracellular portion of the polypeptide minus the transmembrane portion and the intracellular portion.

The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same re~; ng frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader ~equence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode a proprotein which is the mature protein plu~ additional 5~
amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein r~; n~, Thus, for example, the polynucleotide of the present invention may encode a mature protein, or a protein having a prosequence or a protein having both a prosequence and a presequence (leader ~equence).

W O 96139439 P ~ ~US95/07~88 The polynucleotides of the present invention may al80 have the coding 6equence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be, ~or example, a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a m~mm~lian host, e . g. COS-7 cells, is used. The HA tag cor:~esponds to an epitope derived from the in~luenza hemagglutinin protein (Wilson et al., Cell, 37:767 (1984)).

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

Fragments of the full. length HCEGH45 gene may be used as a h~rbridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high se~lence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that: contain the complete HCEGH45 gene including regulatory and promotor regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene or the present invention are used to screen a l-brary of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

W O 96~9439 PCT~US95/07188 The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70~, preferably at least 90~, and more preferably at least 95~ identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95~ and preferably at least 97~ identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID NO:l) or the deposited cDNA(s).

Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR
primer.

Thus, the present invention is directed to polynucleotides having at least a 70~ identity, preferably at least 90~ and more preferably at least a 95~ identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.

W O 96J39439 PCT~US~07~88 The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purpose~ of Palent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an ad~ission that a deposit is required under 35 U.S.C. 112.
The sec~uence of the polynucleotide~ contained in the depoRited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no ~uch license is hereb~ granted.

The present inventi.on ~urther relates to a G-protein coupled receptor polypeptide which has the deduced amino acid sequence o~ Figure l or which has the amino acid sec~uence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.

The terms "fragment, n "derivative" and "analog" when referring to the polypeptide of Figure l or that encoded by the deposited cDNA, mean~ a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e. functions aR a G-protein coupled receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein coupled receptor, for example, a soluble form of the receptor. An analog includes a proprotein which can be act:ivated by cleavage of the proprotein portion to produce an act:ive mature polypeptide.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

W O 96~9439 PCT~US95/07188 The fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting ~aterials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a compo~ition, and still be isolated in that such vector or composition is not part of its natural environment.

W O 96139~39 PCT~US95/07188 The polypeptides of the present invention include the polypeptide of SEQ ID NO: 2 ( in particular the mature polypeptide) as well as polypeptides which have at least 70 similarity (preferably at least 70~ identity) to the polypeptide o~ SEQ ID NO: 2 and more preferably at lea~t 90 similarity (more preferably at least 90~ identity) to ~he polypeptide of SEQ ID NO: 2 and still more pre~erably at least 95~ ~imilarity (still more preferably at least 95~ identity) to the polypeptide of SEQ ID N0:2 and al~o include portions of such polypeptides with such portion of the polypeptide gen.erally cont~;n;ng at least 30 amino acids and more preferably at least 50 amino acids.

As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid su~stitutes of one polypeptide to the sequence of a second polypeptide.

Fragments or portions of the polypeptides of the present invention may be employed for producing the corre~ponding full-length polypeptide ~y peptide synthesis; therefore, the fra~ments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the pre~ent invention may be used to synthesize full-length polynucleotides o~ the present invention.

The present invention also relates to vectors which inc:Lude polynucleotides of the present invention, host cells which. are genetically engineered with vectors of the inven.tion and the production of polypeptides of the invention by ~ecombinant techniques.

Host cells are genetically engineered (transduced or transformed or transfec~ed) with the vector~ of this CA 02221637 1997-ll-l9 W O 96~9~39 PCTAUS95/07188 invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the HCEGH45 genes. The culture conditions, such as temperature, pH and the like, are those previously u~ed with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

The polynucleotides of the present invention may be employed for producing polypeptides by recombinant technique~. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA;
baculovirus; yeast plasmid~; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
However, any other vector may be used as long as it is replicable and viable in the host.

The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA
sequence i5 inserted into an appropriate restriction ~n~onllclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of thoee skilled in the art.

The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthe6is. As representative examples of such promoters, there may be mentioned: LTR or W O 96139439 PCTnJS95/07188 SV~0 promoter, the E. coli. lac or trp, the phage lambda PL
promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait ~or selection of transformed host cells such as dihy~rofolate reductase or neo~ycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin re~i~tance in E. coli.

The vector contA; n; n~ the appropriate DNA 8equence as hereinabove described, a~ well as an appropriate promoter or control sequence, may be employed to transform an appropriate ho~t to permit the host to express the protein.

As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella ty~him7~ium; fungal cells, such as yeast; insect cells such as Drosophila and Spodoptera Sf9;
~n; mA 1 cellg guch as CH0, COS or Bowes melanoma; adenovirus plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such a~ a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this W O 96~9439 PCTAUS95107188 embsA~m~nt, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR~ PL and trp.
Eukaryotic promoters include CMV immediate early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a m~m~l ian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation. (Davis et al., Basic Methods in Molecular Biology, Elsevier, NY
(1986)).

W O 96~39439 PCT~US95/071X~

The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence~ Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizer6.

Mature proteins can be expressed in m~mm~l ian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can al~o be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
Appropriate cloning and expression vector~ for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Col~ Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by in~erting an ~nh~ncer sequence into the vector. ~nh~ncers are cis-acting element~ of DNA, usually about from 10 to 300 bp that act on a pro~oter to increase its transcription.
Examples including the S~40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevi~iae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic O 96~9439 PCTrUS95/07188 enzyme~ such as 3-phosphoglycerate kinase (PGK), ~-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable re~; ng pha8e with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus E~ubtilis, Sc~7m~nella t~him~7~ Lm and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

A~ a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone"

W O 96~9439 PCT~US95/07188 sections are combined with an appropriate promoter and the ~tructural sequence to be ex-ressed.

Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter i8 induced by appropriate means (e.g., temE~erature shift or chemical induction) and cells are cultured for an additional period.

Cells are typically harvested by centrifugation, di~rupted by physical or chemical means, and the resulting crude extract retained for further purification.

Microbial cells employed in expression o~ proteins can be ~isrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell ly~i.ng agents, such methods are well know to those skilled in the art.

Various m~m~l ian cell culture systems can also be emlployed to express recombinant protein. Examples of m~lnm~lian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a co~patible vector, for example, the C127, 3T3, CH0, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination se~uences, and 5' flanking nontranscribed sequence~. DNA sequences derived from the SV40 splice, and polyadenylation sites may be u~ed to provide the required nontranscribed genetic elements.

CA 0222l637 l997-ll-l9 W O 96~9439 PCT~US95/07188 The G-protein coupled receptor polypeptides can be recovered and purified from recombinant cell cultures by methods including ~mmo~; um sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding step6 can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant technique6 from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
Polypeptides of the invention may also include an initial methionine amino acid residue.

The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.

The G-protein coupled receptor of the present invention may be employed in a process for screening for antagonist6 and/or agonists for the receptor.

In general, such screening procedures involve providing appropriate cells which express the receptor on the surface thereof. In particular, a polynucleotide encoding the receptor of the present invention is employed to transfect W O 96/39439 PCTAUS95/07~8 cells to thereby express the G-protein coupled receptor.
Such trans~ection may be accompli~hed by procedures as hereinabove described.

One such screening procedure involves the use of the melanophores which are transfected to express the G-protein co~pled receptor of the pre6ent invention. Such a screening technique is described in PCT WO 92/01810 published February 6, 1992.

Thus, for example, such assay may be employed for sc~eening for a receptor antagonist by contacting the melanophore cells which encode the G-protein coupled receptor wit:h both the receptor ligand and a compound to be screened.
Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.

The screen may be employed for determ;n;n~ an agonist by contacting such cells with compounds to be screened and determ; n; ng whether such compound generates a signal, i.e., activates the receptor.

Other screening techniques include the use of cells which express the G-protein coupled receptor (for example, transfected CHO cells) in a system which measures ext:racellular pH changes caused by receptor activation, for example, as described in Science, 246:181-296 (October 1989).
For example, potential agonists or antagonists may be contacted with a cell which expresses the G-protein coupled receptor and a second messenger response, e. g. signal tran~duction or pH changes, may be measured to determine whether the potential agonist or antagonist i~ effective.

Another such screening technique involves introducing RNA encoding the G-protein coupled receptor into xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted in the case of antagonist screening with the receptor ligand and a compound to be screened, followed by detection of inhibition of a calcium signal.

Another screening technique involves expressing the G-protein coupled receptor in which the receptor is linked to a phospholipase C or D. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening for an antagonist or agonist may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase second signal.

Another method involves screening for antagonists by determining inhibition of b; n~; ng of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA
encoding the G-protein coupled receptor such that the cell expresses the receptor on its surface and contacting the cell with a potential antagonist in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the potential antagonist binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.

The present invention also provides a method for determining whether a ligand not known to be capable of W O 96/39439 PCT~US95~7188 b;~; ng to a G-protein coupled receptor can ~ind to such receptor which compriRe~: contacting a m:~ -1 ian cell which e~?resses a G-protein coupled receptor with the ligand under collditions permitting binding of ligands to the G-protein coupled receptor, detecting the presence o~ a ligand which bind~ to the receptor and thereby deter~; n; ng whether the licgand binds to the G-protein coupled receptor. The system~
hereinabove described for determining agonists and/or antagonists may also be employed for determining ligands which bind to the receptor.

In general, antagonist~ for G-protein coupled receptors which are determ;neA by ~creening procedures may be employed for a variety of therapeutic purposes. For example, such antagonists have been employed for treatment of hypertension, anyi~a pectoris, myocardial infarction, ulcers, asthma, allergies, psychoses, depression, migraine, vomiting, and be~i~n prostatic hypertr~phy.

Agonists for G-protein coupled receptors are also useful for therapeutic purposes, such as the treatment of asthma, Parkinson's disease, acute heart ~ailure, hypotension, urinary retention, and osteoporosis.

A potential antagonist is an antibody, or in some cases an cligonucleotide, which binds to the G-protein coupled receptor but does not elicit a second messenger response such that the activity of the G-protein coupled receptor is prevented.

Potential antagonists also include proteins which are closely related to the ligand of the G-protein coupled receptor, i.e. a ~ragment o~ the ligand, which have lost biological ~unction and when binding to the G-protein coupled receptor, elicit no response.

W O 96/39439 PCT~US95/07188 A potential antagonist also includes an antisense construct prepared through the use of antisense technology.
Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on b; n~; ng of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 ba~e pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl. Acid~
Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988);
and Dervan et al ., Science, 251:1360 (1991)), thereby preventing transcription and the production of G-protein coupled receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in ~ivo and blocks translation of the mRNA molecule into the G-protein coupled receptor (antisense - Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA
may be expressed in vivo to inhibit production of G-protein coupled receptor.

Another potential antagonist is a small molecule which binds to the G-protein coupled receptor, making it inaccessible to ligands such that normal biological activity is prevented. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.

Potential antagonists also include a ~oluble form of a G-protein coupled receptor, e.g. a fragment of the receptor, which binds to the ligand and prevents the ligand from interacting with membrane bound G-protein coupled receptors.

W O 96139439 PCTAUS95/~7188 The G-protein coupled receptor of the present invention ha~ been putatively identi~ -d as a PACAP-like or secretin receptor. This identification has been made as a result of amino acid sequence homology.

The antagonists may be used to treat hypersecretory conditionsand to create pharmacological amnesia or effect long-term memory. The antagonists may be employed in a composition with a phar~aceutically acceptable carrier, e.g., as hereinafter described~

The agonists identified by the screening method as described above, may be employed to treat hyposecretory cond:itions, to improve memory, to treat amnesia and prevent nerve cell death in neuropathy to prevent and/or treat diseases such as Alzheimer's disease.

The antagonists or agonists may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice re~lects approval by the agency of manuf.acture, use or sale for human administration. In addition, the polypeptides or agonists or antagonists of the W O 96~9439 PCT~US95/07188 present invention may be employed in conjunction with other therapeutic compounds.

The pharmaceutical co~positions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are ~m; n; gtered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the pharmaceutical compositions will be ~m; n; stered in an amount of at least about 10 ~g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ~g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

This invention also provides a method of detecting expression of a HCEGH45 receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which comprises obtaining total mRNA from the cell and contacting the mRNA 80 obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA
hybridized to the probe, and thereby detecting the expression of the receptor by the cell.

The present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. These related receptors may be identified by homology to a HCEGH45 receptor polypeptide of the present invention, by low stringency cross hybridization, W 09~9439 PCTAUS9SJO718~
or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharm~cological blockade of the neuropeptide receptor polypeptides of the present invention.

The HCEGH45 receptor polypeptides and antagonists or agonists which are polypeptides, may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."

Thus, for example, cells from a patient may be engi.neered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle cont~;n;ng RNA encoding a polypeptide of the present invention.

Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cel] for producing a retroviral particle cont~;n;ng RNA
encoding the polypeptide of the present invention may be ~m; n; stered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the pre~ent invention. For exa~ple, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.

W O 96~9439 PCT~US95/07188 Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and m~mm~ry tumor virus.
In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the hl~m~n cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ~-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs , W O 96~9439 PCT~US9SJO7188 (including the modified retroviral LTRs hereinabove de~cribed); the ~-actin promoter; and h~ n growth hormone promoters. The promoter also may be the native promoter whi.ch controls the genes encoding the polypeptides.

The retroviral plasmid vector is employed to transduce ~ packaging cell lines to ~orm producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ~-2, ~-AM, PA12, T19-14X, VT-lg-17-H2, ~CRE, ~CRIP, GP+E-86, GP+envAm12, and DAN cell line~ as described in Miller, Human Gene Thera~Y, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cell~ through any means known in the art. Such means include, but are not limited to, electroporation, the use of lipo~omes, and CaP04 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a lipo~ome, or coupled to a lipid, and then ~m;n; stered to a host.

The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid 6equence(6) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblast6, keratinocytes, endothelial cells, and bronchial epithelial cells.

The present invention also contemplates the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes. These W O 96~9439 PCTAJS95/07188 genes can be detected by comparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene i6 associated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells) as yet another means to verify or identify mutations. Once "mutant" genes have been identified, one can then screen population for carriers of the "mutant" receptor gene.

Individuals carrying mutations in the gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosis may be obtained from a patient's cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR
(Saiki, et al., Nature, 324:163-166 1986) prior to analysis.
RNA or cDNA may also be used for the same purpose. As an example, PCR primers complimentary to the nucleic acid of the instant invention can be used to identify and analyze mutations in the gene of the present invention. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antisense DNA sequences of the invention. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing W O 96~9439 PCT~US95~a7~88 method. In addition, cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequence primer is used with double stranded PCR
product or a single stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radio labeled nucleotide or by an automatic sequencing procedure with fluorescent-tags.

Genetic testing based on DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragmen~s in gels with or without denaturing agents. Sequences changes at specific locations may also be revealed by nucleus protection assays, such RNase and Sl protection or the chemical cleavage method (e.g. Cotton, et al., PNAS, USA, 85:4397-4401 1985).

In addition, some diseases are a result of, or are characterized by changes in gene expression which can be detected by change8 in ~he mRNA. Alternatively, the genes of the present invention can be used as a reference to identify individuals expressing a decrease of functions associated with receptors of this type.

The present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the HCEGH45 receptor polypeptides of the present invention in various tissues. Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive-binding as~ays, Western blot analysis and preferably as ELISA assay.

An ELISA assay initially comprises preparing an antibody specific to antigens of the HCEG~45 receptor polypeptides, W O 96/39439 PCT~US95/07188 preferably a monoclonal antibody. In addition a reporter antibody i8 prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any HCEGH45 receptor proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to HCEGH45 receptor proteins.
Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of HCEGH45 receptor proteins present in a given volume of patient sample when compared against a standard curve.

The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.

W O 96139439 PCT~US95/07188 Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA.
Computer analysis of the cDNA is used to rapidly select pr:imers that do not span more than one exon in the genomic DNA, thus complicating the ampli~ication process. The8e primers are then used ~or PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids cont~; n; n~ the hllm~n gene corresponding to the primer will yield an amplified fragment.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
Usi.ng the present invention with the same oligonucleotide pri.mers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that ca~ similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled ~low-sorted chromosomes -nd preselection by hybridization to construct chromosome specific-cDNA libraries.

Fluorescence in situ hybridization (FISH) of a cDNA
clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60. For a review of this technique, see Verma et al., Human Chromosomes: a Manual o~ Basic Techni~ues, Pergamon Press, New ~ork ~1988).

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are ~ound, ~or example, in McKusick, Mendelian Inh.eritance in Man (avai]able on line through Johns Hopkins University Welch Medical Library). The relationship between W O 96/39439 PCT~US9S/07188 genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analyeis (coinheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).

The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The present invention also includes chimeric, single chain, and hllm~n;zed antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an ~n;m~l or by ~m;n; ~tering the polypeptides to an ~n;m~l, preferably a nonhllm~n. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be CA 0222l637 l997-ll-l9 W O 96,139439 PCT~US95/07188 used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate t:e polypeptide from tissue expressing that polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Nature, 256:495-497, 1975), the trioma technique, the human B-cell hybridoma technique (Kozbor et al ., Immunology Today 4:72, 1983), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Lis6, Inc., pp. 77-96, 1985).

Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodiec to ;m~llnogenic polypeptide products of this invention. Also, transgenic mice may be used to express hllm~n;zed antibodies to ; lnogenic polypeptide products of this invention.

The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

In order to facilitate underst~nA;ng of the following examples certain frequently occurring methods and/or terms will be described.

"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be CA 02221637 1997-ll-l9 W O 96t39439 PCT~US95/07188 constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

~ Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 ~g of plasmid or DNA
fragment is used with about 2 units of enzyme in about 20 ~1 of buffer solution. For the purpose of isolating DNA
fragments for plasmid construction, typically 5 to 50 ~g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel et al., Nucleic Acids Res., 8:4057 (1980).

"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic CA 0222l637 l997-ll-l9 W O 96/39439 PCTAUS9~07188 oligonucleotide will ligate to a fragment that has not been dephosphorylated.

"Ligation" refers to the proce~3 5 of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis et al., Id., p. 146). Unless otherwise provided, ligation may be accor~li8hed u8ing known buffer8 an~ conditions with 10 units to T4 DNA ligase t"ligase") per 0.~ ~g of approximately equimolar amounts of the DNA
fragments to be ligated.

Unless otherwise stated, transformation was performed as de~cribed in the method of Graham and Van der Eb, Virology, 52:456-457 (1973).

~xamPle 1 Expre~sion of Recombinant HCEGH45 in COS-7 cells The expression of plasmid, HCEGH45-HA is derived from a vector pcDNAIjAmp (Invitrogen) cont~n~ng: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA
fragment encoding the entire HCEGH45 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hernagglutinin protein as previously described (Wilson et al., Cell 37:767, 1984). The infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is described as fo]lows:

The DNA sequence encoding HCEGH45, ATCC # 97132, was constructed by PCR was cloned using two primers: the 5' primer GGCTTCCTCGAATCCCGTCATGAACTCC (SEQ IN NO:4) contains an EcoRI site followed by 9 nucleotides of HCEGH45 coding sequence starting from the initiation codon; the 3' sequence GGGTTCTCGAGCGGGCACTGCTCACAGAGGAGACG (SEQ ID NO:5) contains complementary sequences to an XhoI site, translation stop codon, HA tag and the last 11 nucleotides of the HCEGH45 coding sequence (not including the stop condon). Therefore, the PCR product contains an EcoRi site, HCEGH45 coding sequence, a translation termination stop codon and an XhoI
site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with EcoRI and XhoI restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on amplicillin media plates and resistant colonies were selected. Plasmid DNA was isolated form transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant HCEGH45, COS-7 cells were transfected with the expression vector by DEAE-DESTRAN
method. (Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Laboratory Press, (1998)). The expression of the HCEGH45-HA protein was detected by radiolabelling and immunoprecipitation method.
(Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1998)). Cells were labelled for 8 hours with 35S-cysteine two days post transfection.
Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1%
NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson et al., Id.
37:767 (1984)). Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody.
Proteins precipitated were analyzed on 15% SDS-PAGE gels.

EX~1e 2 C10~ina arld EX~reg8iOn Of ElCEGH45 ~ginq the BaCU10~irUg EXP:reS~ iOn SY8 tem The DNA sequence encoding the full length HCEGH45 pro~ein, ATCC # 97132, was amplified using PCR
oligonucleotide primers correspon~n; to the 5' and 3 se~lences of the gene:

The 5~ primer has the sequence GTG~l-~'~l-lCCTCAGACC
GCCATCATGAACTCC (SEQ ID NO:4) and contain~ a SmaI restriction enzyme site (in bold) followed by 17 nucleotides resembling an ef~icient signal for the initiation of translation in eukaryotic cells (Kozak, J. Mol. Biol. 196:947-950 (1987), and just behind the first 9 nucleotides of the HCBGH45 gene (the initiation codon for translation "ATG" is underlined).

The 3' primer has the sequence CGGGTACCAGAGCGGGCA
CTGCTCACAGAGGAGACG (SEQ ID NO:5) and contains the cleavage site for the reDtric;:ion ~n~onllclea~e ksp71~ and 13 nucleotides complementary to the 3' non-translated sequence of ~he HCEGH45 gene. The amplified sequences were isolated fron~ a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the ~n~onllcleases SmaI and Asp718 and then pu:ri.fied as described above. This fragment is designated F2.

The vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the HCEGH45 protein using the baculovirus expression ~ystem (for review see:
Summers and Smith, A M~nr~ 7 of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimen~al Station Bulletin No. 1555, 1987).
Th:is expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis vi.rus ~AcMNPV) followed by the recognition sites for the W O 96~9439 PCT~US95/07188 restriction endonucleases SmaI and Asp718. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences ~or the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow and Summers, Virology, 170:31-39 1989).

The plasmid was digested with the restriction enzymes SmaI and Asp718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1~ agarose gel as described above. This vector DNA is designated V2.

Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli B 101 cells were then transformed and bacteria identified that contained the plasmid (pBac-HCEGH45) with the HCEGH45 gene using the enzymes SmaI and Asp718. The sequence of the cloned fragment was confirmed by DNA sequencing.

5 ~g of the plasmid pBac-HCEGH45 were co-transfected with 1.0 ~g of a commercially available linearized baculovirus ("BaculoGold~ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al., Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).

l~g of BaculoGold~ virus DNA and 5 ~g of the plasmid pBac-HCEGH45 were mixed in a sterile well of a microtiter plate containing 50 ~l of serum free Grace's medium (Life W O 9~9439 PCT~US9~/07~88 Te~hnologies Inc., Gaithersburg, MD). Afterwards 10 ~l Lipofectin plus 90 ~l Grace'~ medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added drop wise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tis6ue culture plate with l ml Grace' medium without serum. The plate wa8 rocked back and forth to mix the newly added solution. The plate wa6 then incubated for 5 hours at 27~C. After 5 hours the tran,sfection solution was removed from the plate and 1 ml o~
Grace's insect medium supplemented with 10~ fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27~C for four days.

After four days the supernatant was collected and a plaq~e assay performed similar as described by Summers and Smith (supra). As a modi.fication an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A
detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10) .

Four day6 after the serial dilution of the viruses wasadded to the cells, blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube cont~;n;ng 200 ~l of Grace's medium. The agar was removed by a brief centri~ugation and the supernatant containing the recombinant baculoviru~es was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4~C.

Sf9 cells were grown in Grace's medium supplemented with lO~ heat-inactivated FBS. The cells were infected with the -W O 96~9439 PCTrUS95/07188 recombinant baculovirus V-HCEGH45 at a multiplicity of infection (MOI) of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 ~Ci of 35S-methionine and 5 ~Ci 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.

Ex~mple 3 Expression Pattern of HCEGH45 in Human Tissue Northern blot analy6is i8 carried out to ~x~m; ne the levels of expression of HCEGH45 in human tissues. Total cellular RNA samples are isolated with RNAzolY B system (Biotecx Laboratories, Inc. 6023 South Loop East, Houston, TX
77033). About 10~g of total RNA isolated from each hllm~n tissue specified is separated on 1~ agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring Harbor Press, (1989)). The labeling reaction is done according to the Stratagene Prime-It kit with 50ng DNA fragment. The labeled DNA is purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303). The filter is then hybridized with radioactive labeled full length HCEGH45 gene at 1,000,000 cpm/ml in 0.5 M NaPO4, pH 7.4 and 7~ SDS
overnight at 65 C. After being washed twice at room temperature and twice at 60 C with 0.5 x SSC, 0.1~ SDS, the filter is then exposed at -70 C overnight with an intensifying screen. The message RNA for HCEGH45 is abundant in human cerebellum tissue.

ExamPle 4 Expression via Gene TheraPY
Fibroblasts are obtained from a subject by 6kin biopsy.
The resulting tissue is placed in tis6ue-culture medium and wa 96139439 PC~S9~i~07~8~

separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask i~ turned upside down, cloRed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10~ FBS, penicillin and streptomycin, is added.
This is then incubated at 37~C for approximately one week.
At this time, fresh media i6 added and ~ubsequently changed every several days. After an additional two weeks in cu].ture, a monolayer of fibroblasts emerge. The monolayer is tryp~inized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, i5 dige ted with EcoRI and HindIII and subsequently treated with calf intes~lnal phosphatase. The linear vector i8 fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention i8 amplified using PCR primers which correspond to the 5~ and 3~ end sequences respectively. The 5~ primer contains an EcoRX site and the 3' primer further includes a HindIII site.
Equa] quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly in~erted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco~s Modlfied Eagles Medium (DMEM) with 10~ calf serum (CS), penicillin and streptomycin. The MSV vector containing the , W O 96/39439 PCT~US95/07188 gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The ~ibroblasts now produce the protein product.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

Claims (20)

WHAT IS CLAIMED IS:

1. An isolated polynucleotide comprising a member selected from the group consisting of:
(a) a polynucleotide encoding the polypeptide as set forth in Figure 1;
(b) a polynucleotide encoding a mature polypeptide encoded by the DNA contained in ATCC Deposit No. 97132;
(c) a polynucleotide capable of hybridizing to and which is at least 70% identical to the polynucleotide of (a) or (b); and (d) a polynucleotide fragment of the polynucleotide of (a) or (b).

2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.

3. The polynucleotide of Claim 1 comprising from nucleotide 1 to nucleotide 4568 as set forth in Figure 1.

4. The polynucleotide of Claim 1 encoding a soluble form of the polypeptide of Figure 1.

5. A vector containing the DNA of Claim 2.

6. A host cell transformed or transfected with the vector of Claim 5.

7. A process for producing a polypeptide comprising: expressing from the host cell of Claim 8 the polypeptide encoded by said DNA.

8. A process for producing cells capable of expressing a polypeptide comprising transforming or transfecting the cells with the vector of Claim 5.

9. A receptor polypeptide comprising a member selected from the group consisting of:

(i) a polypeptide having the deduced amino acid sequence of Figure 1 and fragments, analogs and derivatives thereof; and (ii) a polypeptide encoded by the cDNA of ATCC Deposit No.
97132 and fragments, analogs and derivatives of said polypeptide.

10. An antibody against the polypeptide of claim 9.

11. A compound which activates the polypeptide of claim 9.

12. A compound which inhibits activation of the polypeptide of claim 9.

13. A method for the treatment of a patient having need to activate a G-protein receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 11.

14. A method for the treatment of a patient having need to inhibit a G-protein receptor comprising: administering to the patient a therapeutically effective amount of the compound of claim 12.

15. The method of claim 13 wherein said compound is a polypeptide and a therapeutically effective amount of the compound is administered by providing to the patient DNA encoding said agonist and expressing said agonist in vivo.

16. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 9 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.

17. The polypeptide of Claim 9 wherein the polypeptide is a soluble fragment of the polypeptide and is capable of binding a ligand for the receptor.

18. A diagnostic process comprising:
analyzing for the presence of the polypeptide of claim 17 in a sample derived from a host.

19. A method for identifying compounds which bind to and activate and which bind to and inhibit a G-protein coupled receptor polypeptide comprising:
contacting a cell expressing on the surface thereof the receptor polypeptide, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of a compound to said receptor polypeptide, with a compound under conditions sufficient to permit binding of the compound to the receptor polypeptide; and identifying if the compound is an effective agonists or antagonist by detecting the presence or absence of the signal produced by said second component.

20. A process for diagnosing a disease or a susceptibility to a disease related to an under-expression of the polypeptide of claim 9 comprising:
determining a mutation in the nucleic acid sequence encoding said polypeptide.