WO1996038566A1 - Nucleic acid fragment coding for an enzyme involved in the abscisic acid (aba) biosynthesis pathway in plants - Google Patents

Abstract

A nucleic acid fragment coding for an enzyme involved in the abscisic acid (ABA) biosynthesis pathway in plants is described.

Description

 "FRAGMENT OF NUCLEIC ACID ENCODING AN ENZYME

INVOLVED IN THE BIOSYNTHESIS OF ACID

ABSCISSIQUE (ABA) CHEES PLANTS "

The present invention relates to the cloning of a gene involved in the abscissic acid (ABA) biosynthesis pathway in plants.

More particularly, the present invention relates to an isolated nucleic acid fragment coding for an enzyme involved in the ABA biosynthesis pathway.

Abscissic acid (ABA) is considered a plant "stress hormone" because it is accumulated when plants are subjected to various stresses such as saline soils, low temperatures, frost and drought. ABA induces responses in the host plant that increase stress tolerance. The water content of plant tissues and the functioning of stomata are regulated by the ABA (Tal and Nevo, 1973). ABA also controls the dormancy and germination aspects of seeds (Koornneef et al., 1982, 1989), and promotes normal embryogenesis and the formation of proteins stored in seeds (see Kermode, 1990).

Despite its crucial importance for plants, the physiology of ABA is still poorly understood. The majority of information concerning the physiology of ABA and its role has been provided by the analysis of mutants affected in the synthesis or in the response induced by ABA (Zeevaart and

Creelman, 1988). The molecular data obtained so far relates only to genes involved in the ABA transduction signal. Mutants at the viviparous-1 locus of maize (vpl) show reduced sensitivity to ABA (Robichaud et al., 1980). The vp_l gene, cloned by labeling with a transposon (McCarty et al., 1989), codes for a transcriptional activator VP1. ABA-insensitive Arabidopsis mutants (abi) were selected for their ability to germinate at high concentrations of ABA (Koornneef et al., 1984). The abil and abi3 genes were isolated by positional cloning also called the method of works on the chromosome (Leung et al., 1994; Meyer et al., 1994; Giraudat et al., 1992). The abil gene codes for a calcium-regulated phosphatase, while abi3 codes for a protein homologous to VP1.

Biochemical studies of mutants deficient in ABA have allowed the elucidation of the biosynthetic pathway of ABA. The biosynthesis of ABA in higher plants is carried out via a C40 synthetic pathway, called "indirect", a synthetic pathway which derives from carotenoids (Zeevaart and Creelman, 1988; Gage et al., 1989). Recent evidence indicates that the xanthophyll-like precursor of ABA is 9'-cis-neoxanthin, which is formed from trans-violaxanthin (Li and Walton, 1989; Parry et al., 1990). Mutants with reduced ABA levels were selected based on their reduced seed dormancy or wilting phenotype. Viviparous mutants of vp-2 corn. vp-5. vp-7 and vp-9 are deficient in ABA and are blocked simultaneously in the early stages of carotenoid biosynthesis. Consequently, they present a photo-bleaching, due to the lack of protection of the photosynthetic devices by the carotenoids (Moore and Smith, 1985; Neil et al., 1986). The aba mutant of Arabidopsis thaliana is deficient in the epoxidation of zeaxanthin (Duckham et al., 1991; Rock and Zeevaart, 1991) which is considered to be the first step in the biosynthesis of ABA (Taylor, 1991). Several mutants isolated from tomatoes (flacca and sitiens). the potato (droopy). barley (nar 2 §-) or in Nicotiana plumbaginifolia (abal) present a deficiency at the level of the last stage of the synthetic route (for review see Taylor, 1991): the oxidation of aldehyde-ABA in ABA (Linforth et al., 1987). Finally, the wiltv mutant in peas (Duckham et al., 1989) and the notabilis mutant in tomatoes (Taylor et al., 1988) are probably affected in one of the other stages of the biosynthetic pathway (Taylor, 1991). Despite considerable progress in the elucidation of the biochemical stages of the ABA biosynthetic pathway, no gene from this synthetic pathway has so far been able to be cloned.

The aim of the present invention is the isolation of a gene from the ABA biosynthetic pathway. Given the physiological role of ABA in development, tolerance of plants to stress, dormancy or seed maturation, a gene from the ABA biosynthetic pathway can be used to control or modify the synthesis of ABA in transgenic plants.

As plant productivity is strongly affected by environmental stress, the genetic improvement of stress tolerance is one of the most important tasks in agriculture. Overproduction of ABA, using an inducible promoter, can accelerate a plant's response to environmental stress. For example, the transformation of certain tropical plants with a gene for the biosynthesis of ABA under the control of a promoter that can be induced by cold can lead to better adaptation to cold climates. Another important application of the genetic modification of ABA biosynthesis is the creation of transgenic plants with reduced seed dormancy by decreasing ABA levels in mature seeds. This can be achieved by the introduction of an anti-sense gene for ABA biosynthesis, under the control of a seed-specific promoter. In this strategy, it is essential to ensure correct protein and lipid storage in the seeds, to guarantee good development of future plants.

The present invention provides for the first time the isolation and molecular characterization of a gene from the ABA biosynthetic pathway. A new mutant deficient in ABA (called aba2) was isolated by insertion mutagenesis induced by a transposable element Ac in

Nicotiana plumbaginifolia. The main advantage of this mutant is that the gene for the ABA biosynthetic pathway is labeled there because the mutation, which causes ABA deficiency, is due to the insertion of the Ac element. Analysis of the corresponding cDNA indicates that it codes for a zeaxanthin epoxidase. This epoxidase is original and the control of its expression is decisive because it probably catalyzes the first two stages of ABA biosynthesis. Gene labeling experiments, using mutation by insertion of transposable elements, whatever the species, are completely random and can take several years. Indeed, it is necessary to obtain primary transformants (2 to 6 months depending on the species), then obtain their descendants until the fourth generation to possibly obtain a mutant and characterize it genetically. The generation time varies according to the species from 6 weeks in Arabidopsis to 4 months in Nicotiana plumbaginifolia.

In addition, these experiments must be carried out on a large quantity of plants in order to hope to isolate a given mutant. The genome of Arabidopsis is estimated at 100 megabases, that of N. plumbaginifolia is estimated at 1000 megabases. The transcribed sequence of the isolated gene measures approximately 2 Kilobases. Insertions into introns generally do not give a detectable mutation. We can therefore estimate that it would be necessary to test the progeny of approximately 50,000 plants for Arabidopsis and 500,000 plants in N. plumbaginifolia. having undergone a transposition event. This represents work and a greenhouse area that cannot be carried out systematically.

An ABA-deficient Arabidopsis thaliana mutant was known, but the gene was not labeled so it could never be isolated.

The method known as positional cloning or even walking on the chromosome could not make it possible to clearly isolate such a gene from the biosynthesis mutant of ABA in this species. Walking on the chromosome indeed requires having markers (RAPD,

AFLP ...) near (around 200 Kilobases) of the gene to be cloned and a bank of YACS or cosmids. Once the gene is located on a cosmid or a YAC, it is a question of transforming the mutant with fragments of this clone until finding the corresponding gene. All of these experiences require several years of work. Only a few genes have been cloned by this technique to date, while several hundred mutants have been identified in Arabidopsis. This is why, although the abscissic acid deficient mutant was isolated in 1982 from Arabidopsis, the corresponding gene has still not been cloned by this technique. The present invention therefore relates to an isolated nucleic acid fragment encoding an enzyme involved in the biosynthesis pathway for abscissic acid (ABA) in plants.

More particularly, the enzyme is an epoxidase involved in the first two stages of the ABA biosynthesis pathway. More particularly still, the enzyme exhibits an activity of epoxidation of zeaxanthin.

In a preferred embodiment, the subject of the present invention is an isolated nucleic acid fragment, characterized in that it comprises all or part of a nucleotide sequence as shown in the sequence identifier No. 1, or all or part of a sequence homologous to that shown in sequence identifier No. 1, or all or part of a sequence complementary to said sequence of sequence identifier No. 1 or of a homologous sequence.

By "nucleic acid fragment" is meant here a nucleotide polymer which may be of DNA or RNA type. These terms are defined in all basic molecular biology works. Preferably, a nucleic acid fragment according to the invention is a double stranded DNA fragment.

The term "part" designates a fragment comprising a portion of at least 500, preferably at least 1000 nucleotides identical to a portion of equivalent length of the nucleotide sequence indicated in the sequence identifier (IDS No. 1) or of its complementary.

The term "homologous" refers to any nucleic acid exhibiting one or more sequence modification (s) with respect to all or part of the sequence shown in IDS No. 1, and coding for an enzyme having the activity mentioned above. -above. These modifications can be obtained by mutations, deletion and / or addition of one or more nucleotide (s) relative to the native sequence. They can be introduced in particular to improve the activity of the enzyme. In this context, a degree of homology of 70% with respect to the native sequence will be preferred, advantageously 80% and preferably 90%. A person skilled in the art knows where to carry out the modifications so as not to drastically alter the function of the enzyme and also knows the techniques making it possible to assess whether the generated homolog has enzymatic activity, for example by insertion upstream. a reporter gene whose expression is easily detectable (β-galactosidase, cathechol-oxygenase, luciferase or even a gene conferring resistance to an antibiotic). But any other conventional technique can also be used.

The sequence of IDS No. 1 is a sequence isolated from the aba2 mutant described below. It is the cDNA sequence, that is to say devoid of introns.

Preferably, the fragment according to the invention comprises all or part of the coding sequence ranging from nuciéotide n ° 41 to 2029, IDS / 41 N ° l, or its complement, or of a sequence homologous or complementary to said homologous sequence.

Advantageously, the fragment according to the invention additionally comprises the leader sequence going from nuciéotide n ° 1 to 40 of IDS N ° 1.

Likewise, the fragment according to the invention advantageously comprises the termination sequence ranging from nuciéotide 2030 to 2400 from IDS No. 1.

Conventionally, it includes said termination sequence augmented by a poly A tail at its 3 ′ end.

According to a more preferred variant, the fragment according to the invention comprises the complete sequence of 2400 nucleotides as shown on IDS No. 1, a homologous sequence, a complementary sequence, or a sequence homologous to said complementary sequence. The invention also includes any sequence capable of hybridizing under stringent conditions with one of these sequences and coding for the same enzymatic activity involved in the ABA biosynthesis pathway, in particular in the first two steps.

The subject of the present invention is a cloning vector characterized in that it comprises a nucleic acid fragment according to the present invention.

In one embodiment, a cloning vector comprises a complete coding sequence of 2400 nucleotides as shown in IDS No. 1.

It should be understood that the invention also relates to any equivalent DNA sequence, that is to say that differs from the sequences mentioned above only by one or more neutral mutations, that is to say whose change or substitution of nucleotides involved does not affect the primary sequence of the resulting protein.

Mention may be made, as cloning vector comprising the fragment, of the vectors comprising a DNA sequence containing at least one origin of replication such as plasmids, cosmids, bacteriophages, viruses etc. Preferably, however, plasmids will be used.

Preferably, the DNA fragment according to the invention will be associated with a regulatory sequence suitable for its transcription and translation (hereinafter regulon) such as promoters, including start and stop codons, "enhancers", operators . The means and methods for identifying and selecting these promoters are well known to those skilled in the art. The DNA fragments according to the invention can be introduced into plant cells according to known mechanisms such as through the Ti plasmid of Agrobacterium tumefaciens. or by direct transfer of genes such as by the electroporation method. In this case, but not necessarily, the regulon constituting the corresponding gene can be advantageously used.

Alternatively, the DNA fragments according to the invention can be used to transform microorganisms or eukaryotic cells to clone and produce the corresponding Epoxidase enzyme.

The present invention finally makes it possible to improve the stress resistance of plants, by introducing into the cells of said plants a DNA fragment coding according to the invention, under conditions allowing its replication and its expression.

Genetic engineering methods which block the expression of a gene in a plant are known.

Thus, the expression of the gene can be blocked by hybridization of the mRNA transcribed by said gene with an RNA fragment complementary to at least part of the mRNA transcribed by one of said genes.

Said fragment of RNA complementary to at least part of the mRNA transcribed by one of said genes can be introduced as it is into the cells of plants to be transformed or in the form of a DNA fragment placed under the control of a transcriptional promoter, so that the transcription of said DNA fragment provides an RNA sequence complementary to at least part of the mRNA transcribed by the gene.

It is possible to introduce into the cells of a plant, a plasmid containing an exogenous DNA fragment placed under the control of a transcriptional promoter, so that the transcription of said DNA fragment provides an RNA sequence complementary to at least minus part of the endogenous mRNA transcribed by the gene. We can also be content to act on the regulation of the endogenous gene of the enzyme by modifying the regulatory genes which contribute to its expression so that they induce a blocking of the expression of the endogenous enzyme because of these changes.

Suitably, said exogenous DNA fragment codes for an RNA sequence complementary to part of the mRNA transcribed by the gene comprising the ribosome binding site and / or the translation initiation site.

The exogenous gene is generally a heterologous gene, that is to say which comes from a plant, from a species different from the host cell, the gene coding for the enzyme ordinarily not produced by the plant in the genome. from which it is introduced.

The exogenous gene introduced into the genome of the plant can also be a gene homologous to the endogenous gene, that is to say the expression of which produces the enzyme ordinarily produced by the plant.

Suitably, said exogenous DNA fragment codes for an RNA sequence complementary to more than 80% of the mRNA by one of the abovementioned genes.

Said exogenous DNA fragment may be a fragment of one of the functional genes coding for an abovementioned enzyme, this fragment being placed opposite to the endogenous gene with respect to the promoter, so that transcription of said reverse gene fragment occurs in a direction opposite to the direction of transcription of the gene to hybridize to the endogenous mRNA of said gene and block its expression.

The term "functional gene coding for the enzyme" means a DNA sequence which can therefore be shorter or longer than the total coding sequence, of the complete gene of the enzyme. In particular, the

"functional gene" could correspond to a coding sequence devoid of introns. It is also possible, to introduce a fragment of mRNA or of DNA into the plant, to implement first of all the methods of direct transfer of genes known to those skilled in the art, such as direct micro-injection into embryo cells or direct precipitation by means of EPG or bombardment by particle cannon or by infection with a bacterial strain into which the nucleic acid fragment has been introduced.

The plant can also be infected with a bacterial strain, in particular Agrobacterium tumefaciens according to a proven method (Schell and van Montagu, 1983) or Agrobacterium rhizogenes. especially for species recalcitrant during processing (Chilton et al., 1982). The bacterial strain will comprise said DNA fragment coding for the enzyme under the control of elements ensuring transcription into mRNA of said gene. The strain can be transformed by a vector into which is inserted the gene encoding the enzyme under the control of elements ensuring the transcription of said gene. This gene will be inserted, for example, into a binary vector such as pBINI19 (Bevan, 1984) or pMON 505 (Horsch and Klee, 1986) or any other binary vector derived from the plasmids Tl and Ri. It can also be usefully introduced by homologous recombination into a disarmed Tl or Ri plasmid, such as pGV 3850 (Zambryski et al., 1983) before the transformation of the plant.

Other advantages and characteristics of the present invention will become apparent in the light of the detailed description which follows, given with reference to the figures in which:

FIG. 1 represents the effect of the desiccation on the weight of loose leaves of the wild type and of the mutant AA67 (aba2) of Nicotiana Plumbaginifolia. The leaves were harvested, gently dried on absorbent paper and weighed every 5 min. in the drying atmosphere of a laminar flow hood. The mean and standard error of six independent experiments are shown. FIG. 2 represents the carotenoid profile of wild type leaves and of the AA67 mutant (aba2).

FIG. 3 represents the biosynthetic scheme of ABA from zeaxanthin. Adapted from the synthetic route proposed by Li and Walton (1 90) and Parry et al. (1990).

FIG. 4 represents the Southern analysis of the DNA of the mutant and wild progeny of the mutant plant AA67 (aba 2). carrying a trAc element. The DNA digested with EcoRI was hybridized to the probe A (on the 5 ′ edge of Ac). Ro indicates the primary transformant; R j, the parental AA67 plant; Ml to M3, mutant progeny R ₂ ; NI to N5, plants R ₂ having a wild phenotype; p indicates the proportion of mutants in the offspring of each plant.

FIG. 5 represents the partial restriction map of the locus mutated by the insertion of Ac. The positions of the probes corresponding to Ac and the adjacent DNA are indicated by bars A, B and C.

FIG. 6 represents the northern analysis of the RNA of wild type leaves and of the mutant aba2 hybridized with the C probe (FIG. 3B) and with the βATPase probe.

FIG. 7 represents the Southern analysis of the DNA of revertant plants in the progeny of a homozygous mutant plant. Digestion was carried out by EcoRV and hybridization with probe C

(figure 5). The tracks are as follows: WT, wild type; Ri, parental AA67 plant; R ₂ , a heterozygous R ₂ plant; lines 1 to 5 are the reverting plants of the R ₃ progeny of a homozygous mutant R ₂ plant; M4 and M5, two mutant R ₂ homozygous plants.

Figure 8 shows the complete cDNA sequence with the deduced amino acid sequence for the largest ORF starting with a methionine. The first initiation codon and the stop codon are indicated in bold. The 8 bp sequence duplicated in the genomic locus after the insertion of Ac is framed. FIG. 9 represents the three domains of significant homology of the protein are represented. The motif of binding to ADP (a), the central motif of unknown function (b) and the motif of binding to FAD (c). Amino acid positions are shown in parentheses. Abbreviations: (-) any residue; (w) Y, W, F (amino acids having an aromatic group); (x) K, R, H, S, T, Q, N (basic or hydrophilic amino acids); (y) A, I, L, V, M, C (small and hydrophobic amino acids); (z) D, E (acidic amino acids); (#) inequalities in the epoxidase sequence; (Epox.) Supposed epoxidase of Nicotiana plumbaginifolia zeaxanthin.

FIG. 10 represents the studies of import into the chloroplasts of the translation products of cDNA. Lane 1 is loaded with molecular weight markers, T is loaded with a microliter of translation mixture, C is loaded with the import reaction (corresponding to 1/4 of the total of the import reaction), P is loaded with the import reaction after protease treatment (corresponding to 1/4 of the import reaction).

The following abbreviations are used below

"ABA" for abscissic acid; "ABA-GE" for ester of ABA-glucose; "bp" for base pairs; "DW" for dry weight; "FW" for fresh weight; "HPLC" for high pressure liquid chromatography; "nt" for nuciéotide (s); "ORF" for open reading frame.

1. Isolation of an ABA-deficient mutant in a Nicotiana plumbaginifolia line carrying a transposable element Aç _.

The transposable element of Aç maize, inserted into the sequence of a kanamycin resistance marker (Baker et al., 1987) was introduced via a transformation by Agrobacterium in N. plumbaginifolia. giving rise to primary transformants Ro (Marion-Poll et al.,

1993). 1.1. Material and method

Transgenic plants of Nicotiana plumbaginifolia cv. viviani were obtained by transformation with the construction pGV 3850 Hygro: pKU 3Ti (Baker et al., 1987) and characterized as previously described (Marion-Poll et al., 1993).

The screening of the mutant phenotypes was carried out using seeds sterilized on the surface, spread on a BNO ₃ medium (Gabard et al., 1987). To promote uniform germination, the seeds were placed for 10 to 20 days in a germination chamber having a significant difference in terms of day / night temperatures (25V17 ° C) and short days (8 hrs / 16 hrs). The boxes containing young seedlings were transferred to a growth chamber (16 h day / 8 h night and 25 ° C) to allow faster growth. 6 week old seedlings were transferred to the soil. The seedlings of the mutant aba2 were unable to grow under standard greenhouse conditions and were grown under a plastic film in the greenhouse (with an atmosphere saturated with water) or in a growth chamber (90% humidity relative, 16 h of day / 8 h of night and 25V17 ° C). All molecular and biochemical analyzes were carried out on non-stressed leaves harvested before the flowering period. The water stress protocol used was described by Parry et al., (1991).

1.2. Results

The transposition of Aç was monitored in the progeny (Ri) of the primary transformants using the excision marker for kanamycin resistance. This allowed the selection of 1000 Ri plants resistant to kanamycin which were cultivated until maturity, and whose offspring were put to germinate in vitro. One of them (AA67) showed segregation for an early germination phenotype. Freshly harvested AA67 mutant seeds germinated in 4 to 7 days, while wild type seeds took 10 to 15 days. This phenotype presented a Mendelian type segregation characteristic of a recessive and monogenic mutation. The young mutant seedlings were extremely sensitive to water stress, probably because they did not close their stomata. The mutant leaves lost 48% of their fresh weight (FW) in 60 min in a draft while, during the same period, the wild type leaves lost only 11% of FW (Figure 1). This required putting the plants to grow in 90 to 100% relative humidity. The young mutant plants treated with a daily spray of ABA at 40 μM for two weeks recovered the rate of transpiration of the wild type when loose leaves were tested (data not shown). The grafting of mutant plants onto wild type tobacco stems also allowed the restoration of the wild phenotype.

The AA67 mutant was crossed with the aba 1 mutant. previously isolated from N. plumbaginifolia (Bitoun et al, 1989, Rousselin et al., 1992). The complementation between these two mutants has shown that they are mutated on different genes. As a result, the AA67 mutant was called aba2.

2. Relationship between the aba2 mutation and the insertion of the element A_ç

2.1. Material and method

2.1.1. Southern analysis

Genomic DNA was extracted from 2 g of leaf material as described by Dellaporta et al. (1983), and purified on a cesium chloride gradient. Ten μg of DNA were digested with the appropriate restriction enzymes, separated on 0.8% agarose gels and transferred to a nylon membrane (Hybond-N, Amersham). Hybridization of the membranes was carried out under stringent conditions using probes A (a 0.7 kb AccI-HindIII fragment from the 5 'end of Aç), B (a 0.8 Hind HindIII-AccI fragment kb from edge 3 'of Aç) and C (an IPCR probe described below), as shown in Figure 5.

2.1.2. Northern analysis

Total leaf RNA was extracted according to Verwoerd et al. (1989) and 8 μg were loaded onto a 1.2% agarose gel containing formaldehyde (Maniatis et al., 1982). The hybridizations were carried out under stringent conditions using the C probe (FIG. 5) and the 1.6 kb EcoRI-SalI cDNA fragment of the β subunit, encoded by the nucleus, from the mitochondrial ATPase originating from from N. plumbaginifolia (Boutry and Chua, 1985).

2.1.3. Reverse polymerization chain reaction (IPCR)

The IPCR amplification of the sequences adjacent to Aç _. was performed as described by Earp et al. ( 1990). For the amplification of the adjacent 5 ′ and 3 ′ sequences, the genomic DNA was digested with Kpn1 and ligated using the DNA ligase from phage T4. The PCR reaction was carried out with oligonucleotides # 2 (5 'CGATAACGGTCGGTACGGGA-3') and # 6 (5 '-

CCCGTTCGTTTTCGTTACCG3 '). Oligonucleotide # 2 hybridizes to 44 bp located downstream of the 5 'edge of Ace. The oligonucleotide # 6 hybridizes at 1 15 bp located upstream of the 3 'edge of Ace. The PCR reactions used the following conditions: 30 cycles of denaturation of 45 sec at 94 ° C, 30 sec of hybridization at 60 ° C, 2 min extension at 72 ° C with a single final extension of 10 min at 72 ° C. The amplified 2 kb fragment was cloned and partially sequenced by standard procedures. This fragment was used as probe C (Figure 5) to hybridize to northern and Southern blots and to screen a cDNA library.

2.2. Results 2.2.1. The aba 2 mutation is due to the insertion of Aç_.

The mutation responsible for the ABA deficiency co-segregated with a new band hybridizing to Aç in the Southern analysis of the offspring by self-fertilization of an AA67 R plant. The DNAs coming from the mutant and wild descendants were analyzed by digestion with different enzymes and hybridized with the probe A (5 ′ edge of Ac). After EcoRI digestion, the primary transformant (R _υ ) presented a unique band of 3 kb hybridizing to Aç, corresponding to the localization of Aç within the T-DNA (FIG. 4). In the plant R i AA67, two new insertions of Ac (hybridization signals at 4.5 and 2.6 kb) were revealed by the same probe. As visualized in FIG. 4, the 4.5 kb band was present in each R ₂ mutant plant (Ml to M3) but only in some of the R ₂ sister plants having a wild phenotype (NI to N5). The smaller 2.6 kb band represented a second insertion of Ac. not linked to the mutation responsible for the ABA deficiency.

A total of 26 plants with a wild phenotype and 13 mutant plants were analyzed. All the mutant plants presented the 4.5 kb band hybridizing to Aç. Out of 26 normal plants, 17 had the 4.5 kb band and displayed segregation at the level of their descendants, in which one plant in four had the mutant phenotype. 8 other plants did not show the 4.5 kb band and gave a wild type progeny. These results are in agreement with the ratio of heterozygotes for the mutation (two-thirds) (66.6%) expected in plants having a wild type phenotype. These data suggested that the mutation was linked to the trAc band.

One of the plants with a wild phenotype did not exhibit the 4.5 kb band but segregated the mutant progeny in progeny. The possibility of Aç excision in this plant has been studied. 2.2.2. The aba2 mutation is unstable.

The heterozygous mutant without the 4.5 kb band could be due to an imprecise excision event that does not restore the functionality of the gene. A Kpn I fragment (FIG. 5) was cloned and sequenced after IPCR amplification. Oligonucleotides were synthesized on each side of the Ace insertion. The corresponding DNA was amplified and sequenced in the wild and the heterozygous mutant. A 7bp excision imprint left by the excision of A c is probably responsible for the phenotype. Indeed, the partial sequence of the Knp I fragment indicates that the insertion of A c has occurred in a coding sequence. The excision of A c caused the introduction of a TGA stop codon in phase in the additional 7 bp and the stable mutant was called aba 2-sl.

The offspring from a mutant plant, homozygous for the 4.5 kb band hybridizing to Aç, were grown and screened for the appearance of somatic and germinal reversal events, resulting in a rate of transpiration normal and survival under greenhouse conditions. Reversion of the mutation to the wild type should be correlated with the restoration of a DNA fragment the size of that of the wild type. Five revertant plants (found among approximately 5000 seeds) were analyzed at the molecular level (Figure 7). When hybridized with probe C, Southern blots of the mutant plants presented a 10 kb EcoRV fragment, also hybridizing to the Ace probes. A 2.8 kb EcoRV band was also revealed and corresponds to a genomic fragment located downstream of the insertion point of A. (figure 5). The wild type plants showed a band of 5.5 kb and the band of 2.8 kb. The ghosts carried the 10 kb EcoRV fragment with varying amounts of the 5.5 kb fragment found in the wild type. Varying levels of signals suggest that the revertants are chimeras, in which only part of the cells have recovered the potential to synthesize ABA, thus complementing the mutated sectors and conferring a wild type phenotype. The two-band profile found in plants revertants was similar to that observed with DNA from heterozygous plants R ₂ (line R ₂ in FIG. 7), whereas in homozygous mutant plants, only the band hybridizing to Aç was visible, as well as the band of 2.8 kb, located downstream of the Aç insertion (tracks M4 and M5 in Figure 7). The offspring of certain revertant plants were sown and evaluated for an early germination phenotype. Revertants 1, 2 and 3 showed offspring segregation with a rate of a quarter of early germination, so they were considered as A_ç_ excision events affecting L2 cells causing reverting offspring. Revertant 4 gave a homogeneous progeny with early germination and it could be considered as a somatic revenant. For two of these revertants, the excision of Ace _. exactly restored the wild type profile (see Figure 8).

2.2.3. The insertion of Aç is in a coding sequence.

Northern transfer analysis performed on the total RNA of wild type and mutant leaves makes it possible to observe a single 2.5 kb transcript in the wild type leaves after hybridization with probe C (FIG. 5), while in mutant leaves the mRNA was 7.1 kb long. This difference of 4.6 kb suggested the presence of an Aç element _. integer in a coding sequence (Figure 6). This was confirmed by partial sequencing of the IPCR fragment (see below). A hybridization control was carried out with the β subunit, encoded by the nucleus, of the mitochondrial ATPase of N. plumbaginifolia (Boutry and Chua, 1985).

3. Deficiency of the aba2 mutant for the epoxidation of zeaxanthin.

As the instability of the aba2 mutation could give rise to reversion sectors, ABA and carotenoid measurements were carried out on the leaves of the aba2-sl mutant. 3.1. Material and method

3.1.1. ABA analysis

Analysis of ABA and its metabolites was carried out as described by Julliard et al., (1993). Leaf samples were immediately frozen in liquid nitrogen and lyophilized before being reduced to powder. Extraction in non-oxidative methanol / water (80:20, v / v), pre-purification and fractionation by high pressure liquid chromatography (HPLC) using a 0.2% formic acid / methanol gradient ( v / v) were carried out as described above. Quantification of the immunoreactive molecules was carried out using an enzyme linked immunosorbent test (ELISA). This ELISA test was slightly modified, using an anti-ABA monoclonal antibody available from Phytoscience (Angers, France), labeled with peroxidase conjugated to a goat antibody directed against mouse immunoglobulins (Sigma).

3.1.2. Carotenoid analysis

For measurements of chlorophylls and carotenoids, leaves were frozen in liquid nitrogen and stored at -80 ° C. Leaf samples (100 mg fresh weight), were ground in a mortar with liquid nitrogen and about 5 mg NaHCO ₃ and then were extracted with a solvent containing a mixture of acetone-methanol-ether petroleum (50-30-20%). The extracts were centrifuged for 5 min at 12,000 g and the supernatant stored in ice. The pellet was resuspended in the above solvent and centrifuged again. This process was repeated until the supernatant was colorless. The final supernatants were passed through 0.5 μm filters and then evaporated. The dry extracts were stored at -20 ° C in the dark under argon. Carotenoid pigments were separated by non-aqueous reverse phase HPLC as described by Gilmore and Yamamoto (1991). 3.2. Results

3.2.1. The ABA content is reduced in the mutant aba2-sl.

Three independent measurements (each repeated five times) of the ABA content were carried out on unstressed leaves of 3 to 5 plants. The wild leaves had 393 ± 57 to 1263 ± 36 pmol ABA per gram dry weight, and 158 ± 11 to 236 + 21 pmol (ABA equivalent) ABA-GE per gram dry weight. The ABA content of the aba 2-sl mutant was between 23 and 48% from the wild, while that of AGA-GE was undetectable in two of the experiments and of 139 pmol in the third.

3.2.2. The carotenoid composition is modified in the mutant aba2-sl.

The possibility that the lesion in the mutant aba2 affects the C ₄₀ part of the ABA biosynthetic pathway was studied by analyzing the carotenoid content of the two types of wild and mutant leaves. One of the three independent measurements carried out is represented in FIG. 2. There is no significant difference in the total amount of carotenoids accumulated in the two genotypes (respectively 3065 ± 160 and 3704 + 900 μg of total carotenoids per g of FW) . There were significant differences regarding zeaxanthin and its derivatives. Apocarotenoid zeaxanthin could not be detected in wild type leaves, but it accumulated up to 7% of the total pigment content in the leaves of the mutant. On the contrary, violaxanthin, antherxanthin and neoxanthin could not be detected in the leaves of the mutant, compared to wild type leaves, where the total amount of the three molecules represented 4.1% of the total carotenoid content. It can be noted that the levels of β-carotene, lutein and chlorophylls were comparable in the wild type and in the mutant, suggesting that the photo-protection of the photosynthetic devices is not affected by the mutation. According to the measurements of carotenoids, it can be concluded that the mutant aba2-s l has a deficiency in the epoxidation of zeaxanthin which is consequently accumulated and results in the absence of the following products in the biosynthesis of ABA (FIG. 3) .

4. Cloning of ΑDNc and nucleotide sequence

4.1. Material and method

Construction and screening of a cDNA library.

Young plants, at the first leaf stage (3 to 4 weeks old) were harvested (including the roots) and the total RNA was purified. The poly (A) ⁺ fraction was selected on oligo dT columns (Pharmacia). Double-stranded cDNA was synthesized using a cDNA synthesis kit (Promega) and an adapter-primer-NotI-oligo (dT). After ligation of EcoRI adapters (Pharmacia), the cDNA was digested with NotI and cloned directionally into the vector λgtll Sfi-Not (Promega). About 1.5 x 10 ⁶ independent recombinants were obtained after phage packaging (Stratagene) and infection in the strain LE 392 (Promega). The λgtll cDNA library was amplified in the RY 1090 strain of Escherichia coli. Hybridization of phage plaques, using probe C, was carried out according to standard procedures (Maniatis et al., 1982). Washes were carried out under conditions of low stringency in 2 × SCC, 0.5% sarkosyl at 65 ° C. The DNA inserts of the positive recombinant phages were subsequently cloned into - the EcoRI-Notl sites of a pBS-SK + vector (Stratagene) and into the Eco-Rl-Sacl sites of a pGEM-7Z vector (Promega ). Using these subclones, the sequencing of the two strands was carried out after partial digestion using an Exonuclease III deletion kit (Pharmacia). The nucleotide sequence of the deleted clones was determined with an ABI 373A automatic DNA sequencing device (Applied Biosystems) using staining primers and a Sequenase enzyme. 4.2. Results

The radioactive C probe was used to screen 3 x 10 ⁵ plates from the λgtll library. A positive clone showed a 2.4 kb insert. This was the expected size for the transcript (Figure 6). After cloning into a pBluescript vector, and subcloning into a pGEM vector, the insert was completely sequenced on both strands. The full cDNA sequence (2400 nucleotides long) and the largest open reading frame (ORF) starting with a methionine are shown in Figure 8. This ORF consists of 1989 bp, corresponding to a polypeptide of 663 residues amino acids (aa), with a predicted molecular weight of 72.54 kDa. A stop codon in phase located upstream of this ORF at the nucleotide position -20 confirms that the ORF presented in FIG. 6A is the entire coding region of the corresponding gene. If the ATG at the level of nuciéotide 1 is the initiation codon, the cDNA has a 5 'untranslated sequence of 40 bp, a coding region of 1989 bp, and a 3' untranslated sequence of 310 bp, followed by a poly (A) tail (58 bp long). The 3 'untranslated sequence contains three supposed poly (A) addition signals (ATAAA) at nucleotides 2015, 2109 and 2276 (Joshi, 1987).

As indicated by a partial sequencing of the KpnI fragment of cloned IPCR, the insertion of Ac takes place in the ORF at the level of nucieotide 434 (aa 145). The 8 bp duplicated after the insertion of Ac into genomic DNA are boxed in FIG. 8.

4.3. Sequence homology search.

The nucleotide and amino acid sequences were used to check the possible homologies with sequences in databases. Research in databases (National Center for Biotechnology Information using the BLAST network service) has revealed three segments of the amino acid sequence having significant homology with proteins known to Pseudomonas sp. or E. coli (Figure 9). The best adjustments were obtained with nahG (salicylate 1-hydroxylase, You et al., 1991); ubiH (2-octaprenyl-6-methoxyphenol monooxygenase, Nakahigashi et al., 1992), visA (ferrochelatase, Nakahigashi et al., 1992), pheA (phenol m on oo xy g e n as e, Nu rketal., 1 99 1); pcp B (pentachlorophenol-4-monooxygenase, Orser et al., 1993) and PHBH (p-hydroxybenzoate hydroxylase, Weijer et al., 1982). All of these protein sequences share a common function, which is hydroxylation or oxidation of an aromatic ring. This is consistent with the supposed activity of the protein encoded by the cloned cDNA, i.e. the epoxidation of zeaxanthin, a substrate containing an aromatic ring. Second, these enzymes use a common cofactor, either FAD or NAD (P). Thus, an ADP binding site is located at amino acids 81 to 109, which correspond to the consensus sequence (fingerprint) involved in binding to ADP (Wierrenga et al., 1986). This glycine-rich motif, common to enzymes that bind to the cofactor, makes it possible to predict whether a particular amino acid sequence can fold into βαβ with properties of binding to the ADP part of NAD (P) or FAD. Thus, a suspected FAD binding site was found. The amino acid sequence MQHGRLFLAGD is involved in the binding to FAD of PHBH (Wijnands et al., 1986). Amino acid residues 359 to 372 show 9 identical residues with this sequence, enough to guarantee the conformation that is necessary for binding to FAD. A few residues beyond this segment, amino acids 379 and 382 of our supposed epoxidase are present in the sequences of PHBH and salicylate-1-hydroxylase and have been described as having structural and functional importance in these enzymes (You et al., 1991). A third fragment of homology is included between the amino acid residues 230 and 249 of the ORF. This segment of homology has not yet been described until now, but is present in all the protein sequences having a certain homology with the sequence in question. 5. The ABA2 protein is imported into the chloroplasts

Database searches indicated the existence of an extension at the amino terminus of the cDNA relative to the proteins of Pseudomonas and E. coli. The extension at the amino terminus was between amino acid residues 1 and 50. The amino acid content in this region of the sequence revealed enrichment in serine and threonine. These amino acids constitute respectively 18 and 8% of the total amino acid content of this peptide, while they are much less abundant in the complete sequence of 663 amino acids (6.8 and 5% respectively). This characteristic has been described in known peptides for addressing the chloroplast, responsible for the import of nuclear proteins (Von Heijne et al., 1989).

5.1. Material and method.

The cDNA cloned into a pBS-SK + vector was translated from the T3 RNA polymerase promoter. The construction PsaD, coding for a photosystem protein I located in the chloroplasts (Kjaruff and Okkels, 1993), was used as a positive control for the import reactions. In vitro transcription / translation was carried out with 1 μg of each plasmid and with methionine labeled with S ³⁵ using the Reticulocyte Lysate System coupled to TNT (Promega Corporation, Madison, WI). Chloroplasts were isolated from leaves from two-week-old pea plants according to Cline et al. (1985). The import tests were carried out as described by Hoff et al. (1995). The samples were analyzed on polyacrylamide-SDS gels (12% for the PsaD import reaction and 5% for our construction) according to Laemmli (1970), followed by fluorography (Skinner and Griswold, 1983).

5.2. Results

In order to study the chloroplastic localization of zeaxanthin epoxidase, we carried out the in vitro transcription and translation of the clone of corresponding cDNA. The labeled translation products were incubated with pea-purified chloroplasts. An aliquot of the reaction was treated with thermolysin to degrade the proteins located on the surface of the chloroplast, thus only the proteins located inside the organelles were protected. Figure 10 shows the fluorography of the polyacrylamide-SDS gel loaded with the import reactions. PsaD, a 28 kDa protein from photosystem I, used as a positive control, was imported and matured (20kDa) as expected (data not shown). The protein epoxidase (72.5 kDa) was also imported and matured into a mature protein of 69 kDa, in agreement with the analysis of the sequence data.

6. The cloned cDNA complements the aba2-s l mutation.

6.1. Material and method.

The plant transformation vector pKYLX71-35S ² was used to clone the cDNA between a 35S promoter having a duplicated activator domain B and a 3 'rbcS region (Maiti et al. 1993). The resulting plasmid, as well as a control plasmid without the cDNA insert, were introduced by triparental conjugation into a disarmed LBA4404 strain of Agrobacterium tumefaciens, as described by Koncz and Schell (1986). The transformation of leaf discs was carried out as described previously (Marion-Poll et al., 1993). Sheets of homozygous aba2-sl mutants from plants cultivated in vitro were used.

6.2. Results

Discs of leaves of aba2-s l plants were transformed via

Agrobacterium by a construct comprising the epoxidase cDNA under the control of the 35S promoter or by a control plasmid without insert. The regenerated transformants growing on a selective medium have been tested for their carotenoid composition. Regenerants transformed by a control plasmid showed an absence of antheroxanthin, neoxanthin and violaxanthin, and an accumulation of zeaxanthin like the unprocessed witness. The regenerants obtained after transformation by the construction containing the cDNA exhibited a composition of wild type carotenoids. Thus the cloned cDNA was able to restore the wild-type phenotype when it is reintroduced into the mutant genetic environment, providing an additional argument for labeling the epoxidase gene.

7. Mapping of the ABA2 locus in Arabidopsis.

7.1. Material and method.

EST of Arabidopsis.

The PCR screening of the YAC CIC bank was carried out on batches of three-dimensional YACS. The oligonucleotides used allowed the amplification of a 230 bp fragment of the EST sequence (T45502).

7.2. Results.

Comparison of the cDNA sequence with EST sequences

(Expressed Sequence Tags) of a database (dbEST) led to the identification of a homologous EST in Arabidopsis thaliana (reference number T45502). This EST sequence is 480 bp long and the deduced amino acid sequence between base pair 4 and base pair 210 shows 71% identity (81% similarity) with the amino acid sequence of CDNA of N. plumbaginifolia. Oligonucleotides, making it possible to amplify a 230 bp fragment in the A. thaliana cDNA and a 416 bp genomic fragment, were used to screen the YAC CIC library of Arabidopsis (Creusot et al., In preparation). A unique YAC clone has been identified which is located at the bottom of chromosome five and is part of a contig containing the RFLP marker ve028, located at position 134.1 on the map (Lister, 1995). This location is in perfect correlation with the position of the aba locus on the Arabidopsis map (Koornneef et al., 1982). This result, without being definitive proof, provides an additional argument to say that the locus ABA2 of N. plumbaginifolia is the counterpart of the locus ABA of Arabidopsis. BIBLIOGRAPHY

1. Baker, B., Coupland, G., Fedoroff, N., Starlinger, P. and Schell, J. (1987) Phenotypic assay for excision of the maize controlling element Ac i n Tobacco. EMBOJ. 6, 1547-1554.

2. Bevan, M. (1984) Binary Agrobacterium vectors. Naked. Acid Res., 12, 8711-8721.

3. Bitoun, R., Rousselin, P. and Caboche, M. (1989) A pleiotropic mutation results in cross-resistance to auxin, abscisic acid and placobutrazol. Mol. Gen. Genet., 220, 234-239.

4. Boutry, M. and Chua, N.H. (1985) A nuclear gene encoding the beta subunit of the mitochondrial ATP synthase in Nicotiana plumbaginifolia.

EMBOJ. 4, 2159-2165.

5. Chilton, M.D., Tepfer, D.A., Petit A., David, C, Casse-Delbart, F., and Tempe, J. (1982) Agrobacterium rhizogenes inserts T-DNA into the genome of the host plant root cells. Nature, 295, 432-434.

6. Dellaporta, S.L, Woods, J. and Hicks, J.B. (1983) A plant DNA minipreparation version II. Plant Mol. Biol. Rep. 1, 19-21.

7. Duckham, S.C., Taylor, I.B., Lindforth, R.S.T., Al-Naieb, R.J., Marples, B.A. and Bovvman, W.R. (1989) The metabolism of is ABA-aldehyde by the wilty mutants of potato, pea and Arabidopsis thaliana. J. Exp. Bot. 40, 901-905.

8. Duckham, S.C., Lindforth, R.S.T., Taylor, I.B. (1991) Abscisic acid- deficient mutants at the aba gene locus of Arabidopsis thaliana are impaired in the epoxidation of zeaxanthin. Plant Cell Environ. 14, 601-606.

9. Earp, DJ, Lowe, B. and Baker, B (1990) Amplification of genomic sequences flanking transposable elements in host and heterologous plants: a tool for transposon tagging and genome characterization. Nucl. Acids Res. 18, 3271-3279. 10. Gabard, J., Marion-Poll, A., Chérel, L, Meyer, C, Mϋller, A. and Caboche, M. (1987) Isolation and characterization of Nicotiana plubaginifolia nitrate reductase-defîcient mutants: genetic and biochemical analysis of the NIA complementation group. Mol. Gen. Broom. 209, 596-606.

11. Gage, D.A., Fong, F. and Zeevaart, J.A.D. (1989) Abscisic acid biosynthesis in isolated embryos of Zea mavs L Plant Physiol. 89, 1039-1041.

12. Gilmore, A.M. and Yamamoto, H. Y. (1991) Resolution of lutein and zeaxanthin using a non-endcapped, lightly carbon-loaded Cl 8 high performance liquid chromatography column. Journal of chromatography 543, 137-145.

13. Giraudat, J., Hauge, B.M., Valon, C, Smalle, J., Parcy, F. and Goodman, H.M. (1992) Isolation of the Arabidopsis ABI3 gene by positional cloning. Plant Cell, 4, 1251-1261.

14. Hoff, T., Schnorr, K., Meyer, C. and Caboche, M. (1995) Isolation of two Arabidopsis cDNAs involved in early steps of molybdenum cofactor biosynthesis by functional complementation of Esche chia coli mutants. J. Biol. Chem., 270, 6100-6107.

15. Horsch, R.B. and Klee, H.J. (1986) Rapid assay of foreign gene expression in leaf dises transformed by Agrobacterium tumefaciens: role of T-DNA borders in the transfer process. Proc. Natl. Acad. Sci. USA, 83, 4428-4432.

16. Joshi, C.P. (1987) Putative polyadenylation signais in nuclear genes of higher plants: a compilation and analysis. Nucleic Acids Res. 15, 9627-

9640.

17. Julliard, J., Pelese, F., Sotta, B., Maldiney, R., Primard-Brisset, C, Jouanin, L, Pelletier, G. and Miginiac, E. (1993) TI-DNA transformation decreases ABA levels. Physiol. Plant. 88, 654-660. 18. Kermode, AR (1990) Regulatory mechanisms involved in the transition from seed development to germination. Crit. Rev. Plant Sci. 9, 155-195.

19. Koncz, C. and Schell, J. (1986) The promoter of the TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector Mol. Gen. Broom. 204, 383-396.

20. Koornneef, M., Jorna, M.L., Brinkhorst-van der Swan, D.L.C. and Karssen, CM. (1982) The isolation of abscisic acid (ABA) deficient mutants by selection of induced revenons in non-germinating gibberellin- sensitive Unes of Arabidopsis thaliana (L) Heinh. Theor. Appl. Broom. 61, 385-393.

21. Koornneef, M., Reuiling, G. and Karssen, CM. (1984) The isolation and characterization of abscisic acid-insensitive mutants of Arabidopsis thaliana. Physiol. Plant. 61, 377-383.

22. Koornneef, M., Hanhart, C.J., Hilhorst, H.W.M. and Karssen, CM. (1989) In vitro inhibition of seed development and reserve protein accumulation in recombinants of abscisic acid biosynthesis and responsiveness mutants in Arabidopsis thaliana. Plant Physiol. 90, 463-469.

23. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685.

24. Leung, J., Bouvier-Durand, M., Morris, P-C, Guerrier, D., Chefdor, F. and Giraudat, J. (1994) Arabidopsis ABA response gene ABA1: Features of a calcium-modulated protein phosphatase. Science, 264, 1448-1452.

25. Li, Y. and Walton, D.C. (1990) Violaxanthin is an abscisic acid precursor in water-stressed dark-grown bean leaves. Plant Physiol. 92, 551-559.

26. Linforth, RST, Bowman, WR, Griffin, DA, Marples, BA and Taylor, IB (1987) 2-trans-ABA alcohol accumulation in the wilty tomato mutants flacca and sitiens. Plant Cell Environ. 10, 599-606. 27. Lister C. (1995), Latest Lister and Dean Ri map. Weeds World Vol. 2.

28. Maiti, I.B., Murphy, J.F., Shaw, J.G. and Hunt, A.G. (1993) Plants that express a potyvirus VPg-proteinase gene are resistant to virus infection. Proc. Natl. Acad. Sci. USA, 90, 6110-6114.

29. Maniatis, T., Fritsch, EF. and Sambrook, J. (1982) Molecular Cloning: A Laboratorv Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

30. Marion-Poll, A., Marin, E., Bonnefoy, N., and Pautot, V. (1993) Transposition of the maize autonomous element Aç _. in transgenic Nicotiana plumbaginifolia plants. Mol. Gen. Broom. 238, 209-217.

31. McCarty, D.R., Cardon, C.B., Stinard, P.S. and Robertson, D.S. (1989) Molecular analysis of viviparous- 1: an abscisic acid-insensitive mutant of maize. Plant Cell, 1, 523-532.

32. Meyer, K., Leube, M.P. and Grill E (1994) A protein phosphatase 2C involved in ABA signal transduction in Arabidonsis thaliana. Science, 264,

1452-1455.

33. Moore, R. and Smith, J.D. (1985) Graviresponsiveness and abscisic-acid content of roots of carotenoid-deficient mutants of Zea-mavs L Planta, 164, 126-128.

34. Nakahigashi, K., Miyamoto, K., Nishimura, K. and Inokuchi, H. (1992) Isolation and characterization of a light-sensitive mutant of Escherichia coli K-12 with a mutation in a gene that is required for the biosynthesis of ubiquinone. J. Bacteriol. 174, 7352-7359.

35. Neil, SJ, Horgan, R. and Parry, AD (1986) The carotenoid and abscisic acid content of viviparous kernels and seedlings of Zea mavs L Planta, 169, 87-96. 36. Nurk, A., Kasak, L and Kivisaar, M. (1991) Sequence of the gene (pheA) encoding phenol monooxigenase from Pseudomonas sp. EST1001: expression in Escherichia coli and Pseudomonas putida Gene, 102, 13-18.

37. Orser, C.S., Lange, CC, Xun, L, Zahrt, T.C. and Schneider, B.J. (1993) Cloning, sequence analysis, and expression of the Flavobacterium pentaclorophenol-4-monooxigenase gene in Escherichia coli. J. Bacteriol. 175, 411-416.

38. Parry, A.D., Babiano, M.J. and Horgan, R. (1990) The role of ciscarotenoids in abscisic acid biosynthesis. Planta, 182, 1 18-128.

39. Parry, A.D., Blonstein, A.D., Babiano, M.J., King, P.J. and Horgan, R.

(1991) Abscisic-acid metabolism in a wilty mutant of Nicotiana plumbaginifolia Planta, 183, 237-243.

40. Robichaud, C.S., Wong, J. and Sussex, I.M. (1980) Control of in vitro growth of viviparous embryo mutants of maize by abscisic acid. Dev. Broom. 1, 325-330.

41. Rock, CD. and Zeevaart, J.A.D. (1991) The aba mutant of Arabidopsis __ thaliana is impaired in epoxy-carotenoid biosynthesis. Proc. Natl. Acad. Sci. USA, 88, 7496-7499.

42. Rousselin, P., Kraepiel, Y., Maldiney, R., Miginiac, E. and Caboche, M.

(1992) Characterization of three hormone mutants of Nicotiana plumbaginifolia: evidence for a common ABA deficiency. Theor. Appl. Genet., 85, 213-221.

43. Schell and Van Montagu (1983).

44. Skinner, MK and Griswold, MD (1983) Fluorographic detection of radioactivity in polyacrylamide gels with 2,5-diphenyloxazole in acetic acid and its comparison with existing procedures. Biochem. J. 209, 281-284. 45. Tal, M. and Nevo, Y. (1973) Abnormal stomatal behavious and root resistance, and hormonal imbalance in three wilty mutants of tomato. Biochem. Broom. 8, 291-300.

46. Taylor, I.B. (1991) Genetics of ABA synthesis. In Abscisic Acid / Physiology and Biochemistry, W.J. Davies and H.G. Jones eds. (Oxford: Bios Scientific), pp. 23-25.

47. Taylor, I.B., Lindforth, R.S.T., Al-Naieb, R.J., Bowman, W.R. and Marples, B.A. (1988) The wilty tomato mutants flacca and sitiens are impaired in the oxidation of ABA-aldehyde to ABA. Plant Cell Environ., 11, 739-745.

48. Verhoerd, T.C, Dekker, B.M.M. and Hoekema, A. (1989) A small-scale procedure for the rapid isolation of plant RNAs. Nucl. Acids Res. 17, 2362.

49. Von Heijne, G., Steppuhn, J., and Herrmann, R.G. (1989) Domain structure of mitochondrial and chloroplast targeting peptides. Eur. J.

^" Biochem. 180, 535-545.

50. Wierenga, R.K., Terpstra, P. and Hol, W.G.J. (1986) Prediction of the occurrence of the ADP-binding βαβ-fold in proteins, using amino acid sequence fingerprint. J. Mol. Biol. 187, 101-107.

51. Weijer, W.J., Hofsteenge, J., Verreijken, J.M., Jekel, P.A. and Beintema, J.J. (1982) Primary structure of p_-Hydroxybenzoate hydroxylase from Pseudomonas fluorescens. Biochim. Biophys. Acta, 704, 385-388.

52. Wijnands, RA, Weijer, WJ, Muller, F., Jekel, PA, van Berkel, WJH and Beintema, JJ (1986) Chemical modification of tyrosine residues in p_- hydroxybenzoate hydroxylase from Pseudomonas fluorescens. assignment in sequence and catalytic involvement. Biochemistry 25, 4211-4215. 53. You, IS., Ghosal, D. and Gunsalus, IC (1991) Nucieotide sequence analysis of the Pseudomonas putida PpG7 Salicylate hydroxylase gene (nahG) and its 3'-flanking region. Biochemistry 30, 1635-1641.

54. Zeevaart, J.A.D. and Creelman, R.A. (1988) Metabolism and physiology of abscisic acid. Ann. Rev. Plant Physiol. Plant Mol. Biol. 39, 439-473.

55. Zambryski, P., Joos, H., Genetello, C, Leemans, J., Van Montagu, M. and Schell, J. (1 83) Ti plasmid vector for the introduction of DNA into plant cells without alteration of their normal regeneration capacity. EMBO J., 2, 2193-2250.

LIST OF SEQUENCES

(1) GENERAL INFORMATION:

(i) DEPOSITOR:

(A) NAME: INRA

(B) STREET: 147 STREET OF THE UNIVERSITY

(C) CITY: PARIS

(E) COUNTRY: FRANCE

(F) POSTAL CODE: 75338

(ii) TITLE OF THE INVENTION: CLONING OF THE GENE OF ABSCISTIC ACID (iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER-DETACHABLE FORM:

(A) TYPE OF SUPPORT: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: Patentln Release # 1.0, Version # 1.30 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 2400 base pairs

(B) TYPE: nuciéotide

(C) NUMBER OF STRANDS: double

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA for mRNA (iv) ANTI-SENSE: NO

(vi) ORIGIN:

(A) ORGANIZATION: NICOTIANA PLUMBAGINIFOLIA

(B) STRAIN: CV. viviani

(D) DEVELOPMENT STAGE: seedling (F) FABRIC TYPE: whole plant

(ix) CHARACTERISTIC:

(A) NAME / KEY: CDS

(B) LOCATION: 41..2032

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1:

TGAAGACTAC ACTCTTTCTT GAACTTGGGT TCAAGTAAAG ATG TAT TCA ACT GTG 55

Met Tyr Ser Thr Val 1 5

TTT TAC ACT TCA GTT CAT CCA TCC ACT TCA GCT TTT TCA AGA AAG CAG 103 Phe Tyr Thr Ser Val His Pro Ser Thr Ser Ala Phe Ser Arg Lys Gin 10 15. . 20

CTG CCT TTA TTG ATC TCT AAG GAT TTT CCA ACA GAG TTG TAT CAT TCT 151 Leu Pro Leu Leu Ile Ser Lys Asp Phe Pro Thr Glu Leu Tyr His Ser 25 30 35

TTA CCA TGC AGT AGA AGC TTG GAA AAT GGT CAA ATC AAG AAA GTC AAA 199 Leu Pro Cys Ser Arg Ser Leu Glu Asn Gly Gin Ile Lys Lys Val Lys 40 45 50

GGT GTA GTA AAA GCC ACA ATA GCT GAA GCT CCA GCA ACT ATT CCT CCA 247 Gly Val Val Lys Ala Thr Ile Ala Glu Ala Pro Ala Thr Ile Pro Pro 55 60 65 ACT GAT TTA AAA AAG GTA CCA CAG AAG AAG CTG AAA GTA TTA GTA GCA 295 Thr Asp Leu Lys Lys Val Pro Gin Lys Lys Leu Lys Val Leu Val Ala 70 75 80 85

GGT GGT GGG ATT GGA GGA TTA GTT TTT GCA TTG GCG GCA AAG AAA AGG 343 Gly Gly Gly Ile Gly Gly Leu Val Phe Ala Leu Ala Ala Lys Lys Arg 90 95 100

GGA TTT GAT GTG TTG GTA TTT GAG AGA GAT TTA AGT GCT ATT AGA GGA 391 Gly Phe Asp Val Leu Val Phe Glu Arg Asp Leu Ser Ala Ile Arg Gly 105 110 115

GAA GGA CAA TAT AGA GGA CCA ATT CAG ATA CAA AGC AAT GCA TTG GCT 439 Glu Gly Gin Tyr Arg Gly Pro Ile Gin Ile Gin Ser Asn Ala Leu Ala 120 125 130

GCT TTA GAA GCA ATT GAT ATG GAT GTT GCT GAA GAC ATA ATG AAT GCT 487 Ala Leu Glu Ala Ile Asp Met Asp Val Ala Glu Asp Ile Met Asn Ala 135 140 145

GGT TGT ATC ACT GGT CAA AGG ATT AAT GGT TTG GTT GAT GGT GTT TCT 535 Gly Cys Ile Thr Gly Gin Arg Ile Asn Gly Leu Val Asp Gly Val Ser 150 155 160 165

GGT AAC TGG TAT TGC AAG TTT GAT ACG TTT ACT CCA GCC GTG GAA CGC 583 Gly Asn Trp Tyr Cys Lys Phe Asp Thr Phe Thr Pro Ala Val Glu Arg 170 175 180

GGA CTT CCT GTG ACA AGA GTC ATC AGC CGC ATG ACT TTG CAA CAG AAC 631 Gly Leu Pro Val Thr Arg Val Ile Ser Arg Met Thr Leu Gin Gin Asn 185 190 195

CTT GCA CGT GCC GTC GGG GAA GAT ATC ATT ATG AAT GAA AGT AAT GTA 679 Leu Ala Arg Ala Val Gly Glu Asp Ile Ile Met Asn Glu Ser Asn Val 200 205 210

GTG AAC TTT GAG GAT GAT GGT GAA AAG GTT ACT GTG ACT CTT GAG GAT 727 Val Asn Phe Glhe Asp Asp Gly Glu Lys Val Thr Val Thr Leu Glu Asp 215 220 225

GGA CAG CAA TAT ACA GGT GAT CTT CTG GTT GGT GCT GAT GGC ATA AGG 775 Gly Gin Gin Tyr Thr Gly Asp Leu Leu Val Gly Ala Asp Gly Ile Arg 230 235 240 245

TCT AAG GTA CGG ACT AAT TTG TTC GGA CCC AGT GAT GTA ACT TAC TCT 823 Ser Lys Val Arg Thr Asn Leu Phe Gly Pro Ser Asp Val Thr Tyr Ser 250 255 260

GGC TAC ACT TGT TAC ACT GGA ATT GCA GAT TTT GTT CCT GCT GAT ATT 871 Gly Tyr Thr Cys Tyr Thr Gly Ile Ala Asp Phe Val Pro Ala Asp Ile 265 270 275

GAG ACA GTT GGG TAC CGA GTC TTT TTG GGC CAC AAA CAG TAC TTT GTT 919 Glu Thr Val Gly Tyr Arg Val Phe Leu Gly His Lys Gin Tyr Phe Val 280 285 290

TCT TCA GAT GTG GGT GGA GGC AAG ATG CAG TGG TAT GCA TTT CAC AAT 967 Ser Ser Asp Val Gly Gly Gly Lys Met Gin Trp Tyr Ala Phe His Asn 295 300 305

GAA CCA GCT GGC GGT GTG GAT GAT CCA AAC GGT AAA AAG GCA AGA TTG 1015 Glu Pro Ala Gly Gly Val Asp Asp Pro Asn Gly Lys Lys Ala Arg Leu 310 315 320 325 CTT AAA ATA TTT GAG GGG TGG TGT GAC AAT GTT ATA GAC CTA TTA GTA 1063 Leu Lys Ile Phe Glu Gly Trp Cys Asp Asn Val Ile Asp Leu Leu Val 330 335 340

GCC ACA GAT GAA GAT GCA ATT CTT CGA CGT GAC ATC TAT GAT AGA CCG 1111 Ala Thr Asp Glu Asp Ala Ile Leu Arg Arg Asp Ile Tyr Asp Arg Pro 345 350 355

CCA ACA TTT AGT TGG GGA AAA GGT CGT GTT ACA TTG CTT GGG GAC TCT 1159 Pro Thr Phe Ser Trp Gly Lys Gly Arg Val Thr Leu Leu Gly Asp Ser 360 365 370

GTC CAT GCT ATG CAG CCT AAT TTG GGT CAA GGG GGA TGC ATG GCC ATA 1207 Val His Ala Met Gin Pro Asn Leu Gly Gin Gly Gly Cys Met Ala Ile 375 380 385

GAG GAT AGC TAT CAA CTA GCA CTG GAA CTT GAT AAA GCA TTG AGC CGA 1255 Glu Asp Ser Tyr Gin Leu Ala Leu Glu Leu Asp Lys Ala Leu Ser Arg 390 395 400 405

AGC GCC GAG TCA GGA ACC CCT GTG GAT ATC ATC TCA TCT TTA AGG AGC _ 1303 Ser Ala Glu Ser Gly Thr Pro Val Asp Ile Ile Ser Ser Leu Arg Ser 410 415 420

TAT GAA AGT TCT AGA AAA CTT CGA GTT GGA GTT ATC CAT GGA CTG GCT 1351 Tyr Glu Ser Ser Arg Lys Leu Arg Val Gly Val Ile His Gly Leu Ala 425 430 435

AGA ATG GCT GCA ATC ATG GCA TCA ACT TAC AAG GCT TAT CTT GGT GTC 1399 Arg Met Ala Ala Ile Met Ala Ser Thr Tyr Lys Ala Tyr Leu Gly Val 440 445 450

GGA CTT GGT CCA TTA TCA TTT TTG ACC AAG TTT AGG ATA CCA CAT CCT 1447 Gly Leu Gly Pro Leu Ser Phe Leu Thr Lys Phe Arg Ile Pro His Pro 455 460 465

GGA AGA GTT GGT GGA AGA TTT TTT ATT GAC TTG GGA ATG CCG CTT ATG 1495 Gly Arg Val Gly Gly Arg Phe Phe Ile Asp Leu Gly Met Pro Leu Met 470 475 480 485

TTA AGC TGG GTT CTA GGA GGC AAC GGG GAA AAG CTT GAA GGC AGA ATA 1543 Leu Ser Trp Val Leu Gly Gly Asn Gly Glu Lys Leu Glu Gly Arg Ile 490 495 500

CAA CAT TGC AGG CTA TCT GAG AAA GCA AAT GAC CAA TTG AGA AAT TGG 1591 Gin His Cys Arg Leu Ser Glu Lys Ala Asn Asp Gin Leu Arg Asn Trp 505 510 515

TTT GAA GAT GAT GAT GCT TTA GAG CGT GCT ACT GAT GCA GAG TGG CTA 1639 Phe Glu Asp Asp Asp Ala Leu Glu Arg Ala Thr Asp Ala Glu Trp Leu 520 525 530

TTG CTT CCT GCC GGG AAT AGC AAT GCT GCT TTA GAA ACT CTC GTT TTA 1687 Leu Leu Pro Ala Gly Asn Ser Asn Ala Ala Leu Glu Thr Leu Val Leu 535 540 545

AGC AGA GAT GAG AAC ATG CCT TGC AAT ATT GGG TCT GTC TCA CAT GCA 1735 Ser Arg Asp Glu Asn Met Pro Cys Asn Ile Gly Ser Val Ser His Ala 550 555 560 565

AAC ATT CCT GGA AAA TCA GTT GTT ATA CCT TTG CCT CAG GTG TCC GAA 1783 Asn Ile Pro Gly Lys Ser Val Val Ile Pro Leu Pro Gin Val Ser Glu 570 575 580 ATG CAC GCC CGG ATA TCC TAC AAA GGT GGA GCA TTT TTT GTA ACT GAT 1831 Met His Ala Arg Ile Ser Tyr Lys Gly Gly Ala Phe Phe Val Thr Asp 585 590 595

TTA CGA AGT GAA CAT GGT ACC TGG ATT ACG GAT AAC GAA GGC AGA AGA 1879 Leu Arg Ser Glu His Gly Thr Trp Ile Thr Asp Asn Glu Gly Arg Arg 600 605 610

TAC CGA GCA TCT CCA AAC TTC CCT ACT CGC TTT CAT CCA TCA GAT ATT 1927 Tyr Arg Ala Ser Pro Asn Phe Pro Thr Arg Phe His Pro Ser Asp Ile 615 620 625

ATT GAA TTT GGT TCT GAT AAA AAG GCA GCA TTT CGC GTA AAG GTA ATG 1975 Ile Glu Phe Gly Ser Asp Lys Lys Ala Ala Phe Arg Val Lys Val Met 630 635 640 645

AAA TTT CCT CCA AAA ACT GCT GCA AAA GAA GAG CGT CAA GCA GTG GGG 2023 Lys Phe Pro Pro Lys Thr Ala Ala Lys Glu Glu Arg Gin Ala Val Gly 650 655 660

GCA GCT TGA AAATTCGGAA GTTTGGCCTG ATATAAACGG GGAAATTGTA __ 2072

Ala Ala *

CAGCATTTTT ATAGCAACAG CACAAACTGA GCCATTTAAA TCAGCTAATT TTGTATACTG 2132

TAGGTTTAGA AGATTGATAA ACAGAACAAC AATGCAAGAA ACTACAAGGG TTATATAGCT 2192

TCCCCCTATA GAAACCTGGA GAAAGTTATG GTACATTGGT CCTTTCTACC ATTGCTAAAA 2252

TATAGTAGTA GTTTTGTATG TATACCCAAT TACAGGGGCC ATAATGTTAA GTTGTCTTCC 2312

TTCATAAATT ACGGCCATAT ATTTTCTTAT AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 2372

AAAAAAAAAA AAAAAAAAAA AAAAAAAA 2400

(2) INFORMATION FOR SEQ ID NO: 2:

(i) CHARACTERISTICS OF THE SEQUENCE:

(A) LENGTH: 1989 base pairs

(B) TYPE: nuciéotide

(C) NUMBER OF STRANDS: double

(D) CONFIGURATION: linear

(ii) TYPE OF MOLECULE: cDNA for mRNA (iv) ANTI-SENSE: NO

(vi) ORIGIN:

(A) ORGANIZATION: NICOTIANA PLUMBAGINIFOLIA

(B) STRAIN: CV. viviani

(D) DEVELOPMENT STAGE: seedling (F) FABRIC TYPE: whole plant

(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2:

ATGTATTCAA CTGTGTTTTA CACTTCAGTT CATCCATCCA CTTCAGCTTT TTCAAGAAAG 60

CAGCTGCCTT TATTGATCTC TAAGGATTTT CCAACAGAGT TGTATCATTC TTTACCATGC 120

AGTAGAAGCT TGGAAAATGG TCAAATCAAG AAAGTCAAAG GTGTAGTAAA AGCCACAATA 180

GCTGAAGCTC CAGCAACTAT TCCTCCAACT GATTTAAAAA AGGTACCACA GAAGAAGCTG 240 AAAGTATTAG TAGCAGGTGG TGGGATTGGA GGATTAGTTT TTGCATTGGC GGCAAAGAAA 300

AGGGGATTTG ATGTGTTGGT ATTTGAGAGA GATTTAAGTG CTATTAGAGG AGAAGGACAA 360

TATAGAGGAC CAATTCAGAT ACAAAGCAAT GCATTGGCTG CTTTAGAAGC AATTGATATG 420

GATGTTGCTG AAGACATAAT GAATGCTGGT TGTATCACTG GTCAAAGGAT TAATGGTTTG 480

GTTGATGGTG TTTCTGGTAA CTGGTATTGC AAGTTTGATA CGTTTACTCC AGCCGTGGAA 540

CGCGGACTTC CTGTGACAAG AGTCATCAGC CGCATGACTT TGCAACAGAA CCTTGCACGT 600

GCCGTCGGGG AAGATATCAT TATGAATGAA AGTAATGTAG TGAACTTTGA GGATGATGGT 660

GAAAAGGTTA CTGTGACTCT TGAGGATGGA CAGCAATATA CAGGTGATCT TCTGGTTGGT 720

GCTGATGGCA TAAGGTCTAA GGTACGGACT AATTTGTTCG GACCCAGTGA TGTAACTTAC 780

TCTGGCTACA CTTGTTACAC TGGAATTGCA GATTTTGTTC CTGCTGATAT TGAGACAGTT 840

GGGTACCGAG TCTTTTTGGG CCACAAACAG TACTTTGTTT CTTCAGATGT GGGTGGAGGC 900

AAGATGCAGT GGTATGCATT TCACAATGAA CCAGCTGGCG GTGTGGATGA TCCAAACGGT 960

AAAAAGGCAA GATTGCTTAA AATATTTGAG GGGTGGTGTG ACAATGTTAT AGACCTATTA 1020

GTAGCCACAG ATGAAGATGC AATTCTTCGA CGTGACATCT ATGATAGACC GCCAACATTT 1080

AGTTGGGGAA AAGGTCGTGT TACATTGCTT GGGGACTCTG TCCATGCTAT GCAGCCTAAT 1140

TTGGGTCAAG GGGGATGCAT GGCCATAGAG GATAGCTATC AACTAGCACT GGAACTTGAT 1200

AAAGCATTGA GCCGAAGCGC CGAGTCAGGA ACCCCTGTGG ATATCATCTC ATCTTTAAGG 1260

AGCTATGAAA GTTCTAGAAA ACTTCGAGTT GGAGTTATCC ATGGACTGGC TAGAATGGCT 1320

GCAATCATGG CATCAACTTA CAAGGCTTAT CTTGGTGTCG GACTTGGTCC ATTATCATTT 1380

TTGACCAAGT TTAGGATACC ACATCCTGGA AGAGTTGGTG GAAGATTTTT TATTGACTTG 1440

GGAATGCCGC TTATGTTAAG CTGGGTTCTA GGAGGCAACG GGGAAAAGCT TGAAGGCAGA 1500

ATACAACATT GCAGGCTATC TGAGAAAGCA AATGACCAAT TGAGAAATTG GTTTGAAGAT 1560

GATGATGCTT TAGAGCGTGC TACTGATGCA GAGTGGCTAT TGCTTCCTGC CGGGAATAGC 1620

AATGCTGCTT TAGAAACTCT CGTTTTAAGC AGAGATGAGA ACATGCCTTG CAATATTGGG 1680

TCTGTCTCAC ATGCAAACAT TCCTGGAAAA TCAGTTGTTA TACCTTTGCC TCAGGTGTCC 1740

GAAATGCACG CCCGGATATC CTACAAAGGT GGAGCATTTT TTGTAACTGA TTTACGAAGT 1800

GAACATGGTA CCTGGATTAC GGATAACGAA GGCAGAAGAT ACCGAGCATC TCCAAACTTC 1860

CCTACTCGCT TTCATCCATC AGATATTATT GAATTTGGTT CTGATAAAAA GGCAGCATTT 1920

CGCGTAAAGG TAATGAAATT TCCTCCAAAA ACTGCTGCAA AAGAAGAGCG TCAAGCAGTG 1980

GGGGCAGCT 1989

Claims

1. Nucleic acid fragment coding for an enzyme involved in the abscissic acid (ABA) biosynthesis pathway in plants.

2. Fragment according to claim 1, characterized in that the enzyme is an epoxidase involved in the first two stages of the ABA biosynthetic pathway.

3. Fragment according to claim 1 or 2 characterized in that the enzyme has an activity of epoxidation of zeoxanthin.

4. Fragment according to one of claims 1 to 3, characterized in that it is isolated from Nicotiana Plumbaginifolia.

5. Nucleic acid fragment according to one of claims 1 to 4 characterized in that it comprises all or part of the nucleotide sequence as shown in the sequence identifier (IDS) N "1.

6. Fragment according to one of claims 1 to 5, characterized in that it comprises all or part of the coding sequence ranging from nuciéotide n ° 41 to 2029 of IDS N ° 1.

7. Fragment according to one of claims 1 to 6, characterized in that it further comprises the leader sequence ranging from nuciéotide n ° 1 to 40 of IDS N ° 1.

8. Fragment according to one of claims 1 to 7 characterized in that it also comprises the termination sequence going from the nuciéotide 2030 to 2400 of the IDS N "1.

9. Fragment according to claim 8, characterized in that it comprises said termination sequence increased by a poly A tail at its 3 ′ end.

10. Fragment according to one of claims 1 to 9, characterized in that it comprises the complete sequence of 2400 nucleotides as shown on IDS No. 1.

11. Fragment according to one of claims 4 to 9 characterized in that it comprises all or part of a sequence complementary, homologous or complementary to the homologous to that of said sequence (s) of IDS N ° 1.

12. A nucleic acid fragment capable of hybridizing under weakly stringent conditions with a fragment according to one of claims 1 to 11 and coding for a said enzyme involved in the ABA biosynthesis pathway.