FR2903703A1 - GENES ENCODING CIS-LABDA-12,14-DIEN-8 ALPHA-OL (CIS-ABIENOL) SYNTHASE AND SYN-COPALYL-8-OL DIPHOSPHATE SYNTHASE AND USES THEREOF - Google Patents

Abstract

The present invention relates to the genes involved in the cis-abienol biosynthesis pathway, a syn-copalyl-8-ol diphosphate (syn-CODP) synthase and a cis-labda-12,14-dien-8 alpha-ol synthase, and their uses for the production of cis-abienol.

Description

1 GENES ENCODING CIS-LABDA-12,14-DIEN-8 ALPHA-OL (CIS-ABIENOL)

  Field of the Invention The present invention relates to genes involved in the synthesis of cis-abienol and their use for the preparation thereof in living organisms. SUMMARY OF SYNTHASE AND SYN-COPALYL-8-OL DIPHOSPHATE SYNTHASE AND USES THEREOF such as bacteria, yeasts, animal cells and plants.

  Introduction Terpenes form a large class of natural molecules found in all living organisms (bacteria, fungi, animals, plants).  In plants, they play various roles, particularly in the attraction of beneficial insects for the plant, and in defense against pathogens (bacteria, fungi, insects).  Terpenes consist of multiple isoprenyl units with 5 carbons.  The number of isoprenyl units makes it possible to classify them in particular as monoterpenes (compounds containing ten carbon atoms or C10), sesquiterpenes (C15), diterpenes (C20), triterpenes (C30), tetraterpenes (C40) and polyterpenes (> C45).  The biosynthetic pathways of terpene precursors have been widely described in the literature (see, for example, Eisenreich et al. , 2004).  The universal precursors of all terpenes are isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).  Two distinct pathways lead to the formation of IPP and DMAPP.  One, the mevalonate pathway (MEV) is localized in the cytoplasm while the other, the methyl-erythritol pathway (MEP), exists only in certain bacteria and plants where it is localized in plastids.  All the steps and genes encoding the enzymes of these two pathways are known.  From the precursors, the first step of the terpenes biosynthesis is carried out by trans-prenyltransferases which go through the condensation of the two precursors, IPP and DMAPP, to generate carbon chains consisting of isoprenyl units (C5) of length variable.  Thus, the sequential addition of one unit of IPP to a DMAPP produces trans-geranyl diphosphate (GPP, C10), then from the GPP of trans, trans-farnesyl diphosphate (FPP, C15) and finally from the FPP trans, trans, trans-geranyl geranyl diphosphate (GGPP, C20).  These prenyl diphosphate chains of variable length are the substrates of an enzyme class, the terpene synthases which allow the formation of the basic skeleton of cyclic or acyclic terpenes in C 10 (monoterpene), C15 (sesquiterpene), C20 (diterpene) ), C30 (triterpene) 2903703 2 (Cane 1999, McMillan and Beale 1999, Wise and Croteau 1999).  The reaction diversity of these enzymes is responsible for the diversity of cyclic terpene skeletons found in nature.  Cultivated tobacco (Nicotiana tabacum) produces a secretion in its trichomes, or secretory hairs, of which more than half are composed of diterpenes belonging to two classes, the cembranes and the labdans.  Of the labdans, cis-abienol is the compound predominantly produced by a large number of tobacco varieties (N.  tabacum).  In some varieties, the amount of cis-abienol may represent more than 1% of the fresh material of the leaves.  Cis-Abienol positively participates in the aromatic characteristics of tobacco leaves.  It can also be used as a precursor in the synthesis of ambroxides, molecules used in the perfume industry.  In the family of labdans, other molecules have been characterized as for example: (i) sclareol which is present in the floral tissues of clary sage (Salvia sclarea) but also produced in tobacco in response to pathogens; (ii) oryzalexins and phytocassanes produced in rice in response to pathogen attacks; and (iii) gibberellins and their precursor, ent-kaurene.  It has been shown that the biosynthesis of the labdanoid skeleton from GGPP requires two steps.  In a first step, GGPP is transformed into ent- or syncopalyldiphosphate (ent- or syn-CDP) by the ent- or syncopalyldiphosphate synthase (entou syn-CPS), respectively.  In a second step, the CDP is converted to a labdanoid olefin by a labdane synthase.  The genes encoding these two types of enzymes have been cloned in many plants.  For example, in Arabidopsis, AtGAJ genes (Sun et al. , 1994) and AtGA2 (Yamaguchi et al. 1998) are involved in gibberellin biosynthesis and encode ent-copalyldiphosphate synthase (ent-CPS) and ent-kaurene synthase, respectively.  In rice, two genes code for CPS-ent (OsCPS1 and OsCPS2) and a gene for syn-CPS (OsCPS3).  OsCPS1 is responsible for the biosynthesis of the gibberellin precursor, ent-kaurene (Sakamoto et al. , 2004).  OsCPS2 and OsCPS3 are involved in the biosynthesis of the precursors of several labdane type phytoallexins (ent-cassa-12; 15-diene; ent-sandaracopimaradiene; Stemar-13-ene; 9J3-pimara-7,15-diene).  There are nine genes in the rice genome homologous to the kaurene synthase of Arabidopsis, OsKS 1 to 9 (Sakamoto et al. , 2004).  The analysis of mutants deficient in gibberellic acid has demonstrated that OsKS 1 encodes ent-kaurene synthase (Sakamoto et al. , 2004).  Moreover, the function of several OsKS was determined in vitro after expression in E.  al.  For example, OsKS7 and OsKS 10 encode ent-cassa-12,15-diene and ent-sandaracopimaradiene, respectively.  In tobacco, cis-abienol synthase activity was detected in cells extracted from trichomes.  However, the genes coding for the biosynthesis of cisabienol from GGPP have not been identified.  As for all labdanoids, a CDP molecule is a likely intermediate in the biosynthesis of cis-abienol (Fig.  1).  More particularly, the cis-abienol structure suggests that the intermediate is syn-copalyl-8-ol diphosphate (syn-CODP) (Carman and Duffield, 1993, Guo et al. , 1994).  Other labdanoid diterpenes are derived from copalyl-8-ol diphosphate, such as sclareol or (13E) -labdene-8,15-diol.  Syn-CODP synthase, the sequence of which was unknown to date, would therefore be the first step in the biosynthesis of these molecules from GGPP.  There is a strong demand for processes which would make it possible to produce inexpensively terpenes of interest such as adenol or sclareol which are difficult to access for synthesis.  The characterization of the synthetic route of cis-abienol would make it possible to develop methods of producing this molecule, very useful in perfumery, as well as other labdanoid diterpenes that can be prepared by this synthetic route.  Summary of the Invention The invention relates to enzymatic activities, the peptide sequences responsible for these activities and the corresponding nucleic acid sequences responsible for the biosynthesis of cis-abienol from GGPP.  The invention also relates to methods for producing cis-abienol or derivatives thereof using these enzymatic activities.  The present invention thus relates to a method for producing cis-abienol or derivatives thereof from geranyl geranyl diphosphate (GGPP) in a cell having a source of GGPP, comprising: a) introducing into said cell of a construct carrying an expression cassette comprising a gene encoding a syn-copalyl-8-ol diphosphate synthase (syn-COPS), said synthase having at least 80% identity with SEQ ID No. 22 and a construct carrying an expression cassette comprising a gene coding for a cis-labda-12,14-dien-8 alpha-ol (= cis-abienol) synthase, said synthase having at least 80% identity with the SEQ ID No 24; B) culturing the transformed cell under conditions appropriate for gene expression; and, c) optionally, harvesting cisabienol or derivatives thereof contained in said cell and / or in the culture medium.  The present invention also relates to an isolated or recombinant protein having cis-abienol synthase activity and having a sequence having at least 95% identity with SEQ ID No. 24.  It also relates to a nucleic acid comprising a nucleotide sequence coding for such a protein, or a sequence capable of hybridizing thereto under stringent conditions and having cis-abienol synthase activity.  The present invention further relates to an isolated or recombinant protein having syn-COPS activity and having a sequence having at least 80% identity with SEQ ID No. 22.  It also relates to a nucleic acid comprising a nucleotide sequence coding for such a protein, or a sequence capable of hybridizing thereto under stringent conditions and having syn-COPS activity.  The present invention relates to an expression cassette comprising a nucleic acid according to the present invention, a vector comprising an expression cassette or a nucleic acid according to the present invention, a host cell comprising a vector, an expression cassette or a nucleic acid according to the present invention, and a non-human transgenic organism comprising a cell, a vector, an expression cassette or a nucleic acid according to the present invention.  The present invention relates to the use of a transgenic protein, nucleic acid, host cell or organism according to the present invention for the preparation of syn-CODP or cis-abienol or derivatives thereof. of these.  The present invention finally relates to a non-human transgenic cell or organism, characterized in that the synthesis pathway of cis-abienol is blocked by inactivation of the gene coding for a syn-COPS according to the present invention or of the gene coding for a cis-abienol synthase according to the present invention or both genes.  Brief Description of the Figures Figure 1: Diagram of the biosynthesis of cis-abienol from geranylgeranyl diphosphate according to Carman and Duffield (1993).  syn-CODP: syn-copalyl-8-ol diphosphate; cis-Abienol: cis-labda-12,14-dien-8 alpha-ol; A: syn-copalyl-8-ol diphosphate synthase (syn-COPS); B: cis-Abienol synthase (ABS) C: Phosphatase.  Figure 2: Tobacco gene fragment expression level coding for CPS and KS related proteins.  Quantitative analysis of the expression was performed on cDNAs by quantitative PCR in real time with primers specific for each of the 20 genes.  The cDNAs were synthesized from total RNA isolated from leaves and trichomes of tobacco leaves.  Figure 2A) Level of gene expression in trichomes relative to leaves.  The y-axis represents the ratio of the value obtained in the trichomes to that obtained in the leaves.  Figure 2B) Level of gene expression relative to the NtCBTS-02 gene whose expression is trichome specific.  The y-axis represents the ratio of the values obtained in trichomes on the value obtained for the CBTS gene in trichomes.  NtCBTS-02: CBT-ol synthase (NID: AF401234); NtCYP71 D 16B: CBT-ol hydroxylase similar to CYP71D16 (NID: AF166332).  Figure 3: Schematic representation of T-DNAs carrying NtCPS2 and NtKSL3 transgenes.  km: kanamycin resistance gene; e35S: cauliflower mosaic virus 35S promoter enhancer.  CBTSter: terminator of the CBTS gene; eCBTS 1. 0: 1 kb promoter of the CBTS gene fused with the 35S promoter of cauliflower mosaic virus.  NtCPS2: coding phase of the gene coding for tobacco CPS 2903703 (N.  tabacum); NtKSL3: coding phase of the gene coding for tobacco SPC (N.  tabacum).  Figure 3A) T-DNA fragment of the binary vector pLIBRO58; Figure 3B) T-DNA fragment of the binary vector pLIBRO68; Figure 3C) T-DNA fragment of the pLIBRO69 binary vector.  Figure 4: Analysis of plant exudates by gas chromatography.  The exudates from the plant leaves were extracted with a pentane solution and analyzed by gas chromatography coupled with mass spectrometry.  Example of chromatographic profiles obtained from extracts of leaves of N.  tobacco [Figure 10 4A], N.  sylvestris [Figure 4B] and a transgenic line TO # 3513 bearing transgenes NtCPS2 and NtKSL3 [Figure 4C].  The transgenic line # 3513 was obtained from a transgenic line carrying an antisense transgene of the ihpRNAi type of the CBTS gene.  [1] cis-abienol.  Retention time = 40. 5 min ; [2] CBT-diol Retention time = 43 min.  Figure 5: Mass spectrum of the peak corresponding to cis-abienol obtained after gas chromatography carried out from the exudates of the plant # 3513 carrying the transgenes NtCPS2 and NtKSL3.  Figure 5A) Mass spectrum of a cisabienol standard.  Figure 5B) Mass spectrum corresponding to the peak N 1 of Figure N 4.  Figure 6: Analysis of in vitro activity tests with NtCPS2.  Figure 6A) GC / MS of the compounds extracted from the reaction medium.  Figure 6B) GC / MS exsudates of N tabacum leaves extracted with pentane solution.  [1] cis-abienol, retention time = 41 min; [2] CBT-diol, retention time = 43.4 min; [3] 9-beta labda-13-en-8,15-diol, retention time = 48.1 min.  Figure 7: Mass spectrum of peak N 3 of Figure 6 corresponding to 9-beta labda-13-en-8,15-diol Figure 7A) Exudates of N tabacum.  Figure 7B) Activity test performed with NtCPS2.  Abbreviations CBT-ol: cembratrien-ol CBTS: cembratrien-ol synthase cis-abienol: cis-labda-12,14-dien-8 alpha-ol 2903703 7 syn-DOCO: 9-beta labda-13-en-8 -ol-15-yl trihydrogen diphosphate or syn-copalyl-8-ol diphosphate syn-COPS: syn-copalyl-8-ol diphosphate synthase or 9-beta labda-13-en-8-ol-15-yl trihydrogen diphosphate synthase or syn-CODP synthase CPS: copalyl diphophosphate synthase GC: gas chromatography GGPP: geranyl geranyl diphosphate KS: kaurene synthase ihpRNAi: intron hairpin interfering RNA MS: mass spectrometry RACE: rapid amplification of cDNA ends SSC: Sodium chloride-Sodium Citrate Detailed Description of the Invention The present invention thus describes for the first time the genes encoding the enzymes involved in the cis-abienol synthesis pathway.  In particular, the present invention relates to the characterization of tobacco cis-labda-12,14-dien-8 alpha-ol synthase (cis-abienol synthase, ABS) which allows the production of cis-labda-12,14-dien 8-alpha-ol (cisabienol), a diterpene belonging to the labdane family, from 9-beta-labda-13-en-8-o-15-yl trihydrogen diphosphate (syn-copalyl-8-ol); diphosphate, syn-CODP).  In addition, it also relates to the characterization of tobacco syn-copalyl-8-ol diphosphate synthase (syn-COPS) which allows the production of 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate. (syn-copalyl-8-ol-diphosphate, syn-CODP) from GGPP.  These enzymes can be used for the production of cis-abienol or syn-CODP, in vitro or in vivo in transgenic organisms or recombinant cells or microorganisms.  Transgenic organisms, cells or microorganisms such as bacteria, yeasts, animal, insect or plant cells and transgenic plants or animals are considered.  They also allow the production of compounds derived from syn-CODP.  The methods of the present invention are more particularly applicable to the production of cis-abienol in plants having secretory glandular trichomes.  The production of cis-abienol can also be decreased or suppressed in plants, for example tobacco, by gene extinguishing techniques.  The present invention thus relates to a method for producing cis-abienol or derivatives thereof from GGPP in a cell having a source of GGPP, comprising: a) introducing into said cell a bearing construct an expression cassette comprising a gene encoding a syn-COPS, said synthase having at least 80% identity with SEQ ID No. 22 and a construct carrying an expression cassette comprising a gene coding for a cis albenol synthase, said synthase having at least 80% identity with SEQ ID No. 24; B) culturing the transformed cell under conditions appropriate for gene expression; and, c) optionally, harvesting cis-abienol or derivatives thereof contained in said cell and / or in the culture medium.  In a particular embodiment, the cis-abienol product is harvested in step c).  In another particular embodiment, the cis-abienol product is the starting material to obtain another compound of interest such as Ambrox.  By syn-copalyl-8-ol diphosphate (syn-CODP) synthase or syn-COPS is meant an enzyme capable of producing 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate 20 (syn- copalyl-8-ol-diphosphate, syn-CODP) from GGPP (geranyl geranyl diphosphate).  By cis-labda-12,14-dien8 alpha-ol synthase or cis-abienol synthase or ABS is meant an enzyme capable of producing cis-abienol or cis-labda-12,14-dien-8 alpha25 ol from 9 -beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate.  In a preferred embodiment, said cell produces GGPP.  In another embodiment, the GGPP is provided to the cell.  In a particular embodiment, the two expression cassettes are carried by the same construction.  In another embodiment, the two expression cassettes are carried by two distinct constructions.  The present invention thus relates to a method for producing cis-abienol or derivatives thereof from GGPP in a recombinant cell having a GGPP source and comprising a heterologous gene encoding syn-copalyl-8-ol. diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 and a heterologous gene encoding a cis-abienol synthase having at least 80% identity with SEQ ID No. 24.  By heterologous is meant that this gene has been introduced by genetic engineering into the cell.  It can be present in episomal or chromosomal form.  The origin of the gene may be different from the cell into which it is introduced.  For example, the gene is said to be heterologous because it is under the control of a promoter other than its natural promoter, it is introduced in a different place from where it is located naturally.  The host cell may contain a copy of the endogenous gene prior to the introduction of the heterologous gene or it may not contain an endogenous copy.  The present invention relates to an isolated or recombinant polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and having a sequence of at least 80%, 85%, 90%, 95% or 98% d identity with SEQ ID No. 22.  Preferably, the polypeptide has at least 90 or 95% identity with SEQ ID No. 22.  In a particular embodiment, the polypeptide comprises or consists of the sequence SEQ ID No. 22.  This polypeptide probably has a plastid targeting sequence.  It is located at the N-terminus of the protein and generally comprises about the first 50 amino acids.  Such a truncated polypeptide of the plastid targeting sequence is also considered.  Thus, the present invention relates to a polypeptide according to the present invention having a deletion of the N, terminal 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or 55 amino acids.  This polypeptide may also comprise an additional sequence making it possible to facilitate the purification of the enzyme, for example a tag sequence comprising several consecutive histidine amino acids.  The present invention also relates to an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and having a sequence of at least 80%, 85%, 90% , 95% or 98% identity with SEQ ID No. 22.  An exemplary nucleic acid is the nucleic acid comprising or consisting of a sequence having at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 21 or a sequence complementary thereto. 2903703 10 ci.  The present invention relates to an isolated nucleic acid capable of hybridizing under conditions of high stringency to a nucleic acid which encodes a polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and whose sequence is present. at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 22.  In a particular embodiment, the nucleic acid comprises or consists of the sequence SEQ ID No. 21.  The present invention also relates to an expression cassette, a vector, a host cell or a transgenic organism comprising a nucleic acid according to the present invention.  High stringency conditions include a wash step of about 0.1 x SSC at 65 C.  The nucleic acids may be genomic DNAs, complementary DNAs (cDNAs) or synthetic DNAs.  They can be in simple chain or duplex form or a mixture of both.  In the context of the present invention, the transcribed nucleic acids are preferably cDNAs devoid of introns.  The transcribed nucleic acids may be synthetic or semi-synthetic, recombinant, optionally amplified or cloned in vectors, chemically modified or comprising non-naturally occurring bases.  These are typically isolated DNA molecules, synthesized by recombinant techniques well known to those skilled in the art.  The present invention relates to an isolated or recombinant polypeptide having cis-abienol synthase activity and whose sequence has at least 95% or 98% identity with SEQ ID No. 24.  In a particular embodiment, the polypeptide comprises or consists of the sequence SEQ ID No. 24.  This polypeptide probably has a plastid targeting sequence.  It is often located at the N-terminus of the protein and generally comprises about the first 50 amino acids.  Such a truncated polypeptide of the plastid targeting sequence is also considered.  Thus, the present invention relates to a polypeptide according to the present invention having a deletion of the 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or 55 N-terminal amino acids.  In this case, the present invention relates to an isolated or recombinant polypeptide having cis-abienol synthase activity and whose sequence has at least 98% identity with SEQ ID No. 24.  This polypeptide may also comprise an additional sequence making it possible to facilitate the purification of the enzyme, for example a tag sequence comprising several consecutive histidine amino acids.  The present invention also relates to an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having cis-abienol synthase activity and whose sequence has at least 95% or 98% identity with SEQ ID No. 24.  An exemplary nucleic acid is the nucleic acid comprising or consisting of a sequence having at least 95% or 98% identity with SEQ ID No. 23 or a complementary sequence thereof.  The present invention relates to an isolated nucleic acid capable of hybridizing under conditions of high stringency to a nucleic acid which encodes a polypeptide having cis-abienol synthase activity and whose sequence has at least 95% or 98% identity. with SEQ ID No. 24.  In a particular embodiment, the nucleic acid comprises or consists of the sequence SEQ ID No. 23.  The present invention also relates to an expression cassette, a vector, a host cell or a transgenic organism comprising a nucleic acid according to the present invention.  The present invention is particularly directed to a vector, host cell or transgenic organism comprising a nucleic acid comprising a heterologous sequence encoding a polypeptide having cis-abienol synthase activity and having a sequence of at least 80%, 85%, 90 %, 95% or 98% identity with SEQ ID No. 24 and a nucleic acid comprising a heterologous sequence encoding a polypeptide having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and whose sequence has at least 80%, 85%, 90%, 95% or 98% identity with SEQ ID No. 22.  Preferably, the transgenic organism is a plant, particularly a plant with glandular trichomes.  The present invention relates to a method of producing cis-abienol or derivatives thereof from GGPP comprising contacting GGPP with a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 and a cis-abienol synthase having at least 80% identity with SEQ ID No. 24 under appropriate conditions and harvesting cis-abienol or derivatives thereof obtained.  It relates to the use of a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 and a cis-abienol synthase having at least 80% identity. identity with SEQ ID No. 24 for the preparation of cis-abienol or derivatives thereof from GGPP.  The present invention relates to a method for producing syn-copalyl-8-ol diphosphate or derivatives thereof from GGPP comprising contacting GGPP with syn-copalyl-8-ol diphosphate (syn- CODP) synthase having at least 80% identity with SEQ ID No. 22 under appropriate conditions and harvesting syn-dialalyl-8-ol diphosphate or derivatives thereof.  Optionally, the method further comprises incubating the obtained syn-copalyl-8-ol diphosphate with a phosphatase and harvesting 9-beta-labda-13-en-8,15-diol.  The present invention relates to the use of a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 for the preparation of 9-beta-labda-13- en-8-ol-15-trihydrogen diphosphate or derivatives thereof from GGPP.  The present invention relates to a method for producing cis-abienol or derivatives thereof from syn-copalyl-8-ol diphosphate comprising contacting syncopalyl-8-ol diphosphate with a cis-abienol synthase exhibiting less than 80% identity with SEQ ID No. 24 under appropriate conditions and harvesting cisabienol or derivatives thereof.  It relates to the use of a cis-abienol synthase having at least 80% identity with SEQ ID No. 24 for the preparation of cis-abienol or derivatives thereof from syn-copalyl-8-ol diphosphate.  In general, an expression cassette comprises all the elements necessary for the transcription and translation of the gene into a protein.  In particular, it comprises a promoter, possibly an amplifier, a transcription terminator and the elements allowing the translation.  The promoter is adapted to the host cell.  For example, if the cell is prokaryotic, the promoter may be selected from the following promoters: LacI, LacZ, pLacT, ptac, pARA, pBAD, T3 or T7 bacteriophage RNA polymerase promoters, the polyhedrin promoter, the promoter PR or PL of lambda phage.  If the cell is eukaryotic and animal, the promoter may be selected from the following promoters: CMV early promoter, HSV thymidine kinase promoter, SV40 early or late promoter, mouse metallothioneinL promoter, and regions LTR of some retroviruses.  In general, for the choice of a suitable promoter, the skilled person can advantageously refer to the book by Sambrook and Russell (2000) or the techniques described in the book by Ausubel et al.  (2006) 2903703 The vector may be a plasmid, a phage, a phagemid, a cosmid, a virus, a YAC, a BAC, an Agrobacterium pTi plasmid, etc.  The vector may preferably comprise one or more elements selected from an origin of replication, a multiple cloning site and a marker.  The marker may be a reporter gene that generates a detectable signal.  The detectable signal may be a fluorescent signal, a color, a light emission.  The marker may therefore be GFP, EGFP, DsRed, betagalactosidase, luciferase, etc. . .  The marker is preferably a selection marker providing the cell with antibiotic resistance.  For example, the gene may be a resistance gene to kanamycin, neomycin, etc. . . In a preferred embodiment, the vector is a plasmid.  Examples of prokaryotic vectors are listed in the following non-exhaustive list: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene) ); ptrc99a, pKK223-3, pKK233-3, pDR540, pBR322, and pRIT5 (Pharmacia), pET (Novagen) and pQE30 (QIAGEN).  Examples of eukaryotic vectors are included in the following list which is not exhaustive: pWLNEO, pSV2CAT, pPICZ, pcDNA3. 1 (+) Hyg (Invitrogen), pOG44, pXT1, pSG (Stratagene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia);  The viral vectors may be non-exhaustively adenoviruses, AAVs, HSVs, lentiviruses, etc.  Preferably, the expression vector is a plasmid or a viral vector.  The host cell may be a prokaryote, for example Escherichia coli, Bacillus subtilis, Streptomyces sp, and Pseudomonas sp or a eukaryotic.  The eukaryote may be a lower eukaryote such as a yeast (eg, Saccharomyces cerevisiae) or a filamentous fungus (eg Aspergillus) or a higher eukaryote such as an insect, mammalian or plant cell.  The cell may be a mammalian cell, for example COS, CHO (US 4,889,803; US 5,047,335).  In a particular embodiment, the cell is non-human and non-embryonic.  The cell can be isolated, for example in a culture medium.  Cells may also be included in organisms, for example transgenic non-human animals or transgenic plants.  The present invention thus relates to a method for producing 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate or derivatives thereof from GGPP in a cell having a GGPP source. comprising: a) introducing into said cell a construct carrying an expression cassette comprising a gene encoding a syn-copalyl-8-ol diphosphate (syn-CODP) synthase, said synthase having at least 80% identity with SEQ ID No. 22; b) culturing the transformed cell under conditions appropriate for the expression of the gene; and, c) optionally, harvesting the syn-copalyl-8-ol diphosphate or derivatives thereof contained in said cell and / or in the culture medium.  In a particular embodiment, the syn-copalyl-8-ol diphosphate product is harvested in step c).  In another particular embodiment, the syn-copalyl-8-ol diphosphate product is the starting material for obtaining another compound of interest such as 9-beta- labda-13-en-8,15-diol.  For example, syn-copalyl-8-ol diphosphate can be converted to 9-beta-labda-13-en-8,15-diol by phosphatase.  Thus, the method may further comprise in step a) the introduction of a construct carrying an expression cassette comprising a gene coding for a phosphatase, thus allowing the harvest of 9-betalabda-13-en-8, 15-diol in step c).  Among other derivatives of interest of syn-copalyl-8-ol diphosphate is sclareol.  The present invention thus relates to a method for producing syn-copalyl-8-ol diphosphate or derivatives thereof from GGPP in a recombinant cell having a GGPP source and comprising a heterologous gene encoding a syn-copalyl- 8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22.  The present invention thus relates to a method for producing cis-abienol or derivatives thereof from syn-copalyl-8-ol diphosphate in a cell having a syn-copalyl-8-ol diphosphate source, comprising a) introducing into said cell a construct carrying an expression cassette comprising a gene coding for a cis-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with SEQ ID No. 24; b) culturing the transformed cell under conditions appropriate for gene expression; and, c) optionally, harvesting cis-abienol or derivatives thereof contained in said cell and / or in the culture medium.  In a particular embodiment, the cis-abienol product is harvested in step c).  In another particular embodiment, the cis-abienol product is the starting material to obtain another compound of interest such as Ambrox.  The present invention thus relates to a method for producing cis-abienol or derivatives thereof from syncopalyl-8-ol diphosphate in a recombinant cell having a syn-copalyl-8-ol diphosphate source and comprising a heterologous gene. coding for a cis-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with SEQ ID No. 24.  The cell may also be part of a multicellular organism, for example a non-human plant or animal.  In this case, the method comprises: a) introducing into a cell of the body a construct carrying an expression cassette comprising a gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 and a construct carrying an expression cassette comprising a gene encoding a cis-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with SEQ ID No. 24; b) reconstituting an organism from said cell and selecting transgenic organisms expressing both introduced genes; and, c) harvesting cis-abienol product or derivatives thereof in said transgenic organisms.  In one embodiment, the organism is a non-human animal.  For example, the body can be a mouse, a rat, a guinea pig, a rabbit, etc.  In another preferred embodiment, the organism is a plant, preferably a glandular trichome plant.  The method makes it possible to produce cis-abienol in organisms which do not produce this compound or to increase the amount of cis-abienol produced by organisms already producing it.  The present invention also relates to a method for producing 9-beta-labda-13-en-8-ol-15-yl trihydrogen diphosphate or derivatives thereof comprising: a) introducing into a cell of the organism of a construct carrying an expression cassette comprising a gene encoding a syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22; b) reconstituting an organism from said cell and selecting the transgenic organisms expressing the two introduced genes; and, c) harvesting the syn-copalyl-8-ol diphosphate product or derivatives thereof in said transgenic organisms.  In one embodiment, the organism is a non-human animal.  For example, the body can be a mouse, a rat, a guinea pig, a rabbit, etc.  In another preferred embodiment, the organism is a plant, preferably a glandular trichome plant.  The method makes it possible to produce syn-copalyl-8-ol diphosphate in organisms which do not produce this compound or to increase the amount of syn-copalyl-8-ol diphosphate produced by organisms.  The present invention also relates to a method of producing cis-abienol or derivatives thereof comprising: a) introducing into a cell of the body a construct carrying an expression cassette comprising a gene coding for a cis-abienol synthase having at least 80% identity with SEQ ID No. 24; b) reconstituting an organism from said cell and selecting transgenic organisms expressing both introduced genes; and, c) harvesting cis-abienol product or derivatives thereof in said transgenic organisms.  In one embodiment, the organism is a non-human animal.  For example, the body can be a mouse, a rat, a guinea pig, a rabbit, etc.  In another preferred embodiment, the organism is a plant, preferably a glandular trichome plant.  The method makes it possible to produce cis-abienol to organisms that do not produce this compound or to increase the amount of cis-abienol produced by organisms.  The invention is particularly applicable to all plants of families having glandular trichomes, for example Asteraceae (sunflower, etc.). ), Solanaceae (tomato, tobacco, potato, pepper, eggplant, etc.) ), Cannabaceae (ex Cannabis sativa) and Lamiaceae (mint, basil, lavender, thyme, etc.) ).  It is particularly suitable for plants of the Solanaceae family, such as, for example, genera Solanum, Capsicum, Petunia, Datura, Atropa, etc. , and in particular of the Nicotiana genus, for example cultivated tobacco (Nicotiana tabacum), and more particularly wild tobacco Nicotiana sylvestris.  In a nonlimiting manner, the invention can be applied to plants of the following genera: Populus, Nicotiana, Cannabis, Pharbitis, Apteria, Psychotria, Mercurialis, Chrysanthemum, Polypodium, Pelargonium, Mimulus, Matricaria, Monarda, Solanum, Achillea, Valeriana , Ocimum, Medicago, Aesculus, Plumbago, Pityrogramma, Phacelia, Avicennia, Tamarix, Frankenia, Limonium, Foeniculum, Thymus, Salvia, Kadsura, Beyeria, Humulus, Mentha, Artemisia, Nepta, Geraea, Pogostemon, Majorana, Cleome, Cnicus, Parthenium , Ricinocarpos, Hymennaea, Larrea, Primula, Phacelia, Dryopteris, Plectranthus, Cypripedium, Petunia, Datura, Mucuna, Ricinus, Hypericum, Myoporum, Acacia, Diplopeltis, Dodonaea, Halgania, Cyanostegia, Prostanthera, Anthocercis, Olearia, Viscaria.  Preferably, the plant is a plant of the family Asteraceae, Cannabaceae, Solanaceae or Lamiaceae.  In an even more preferred embodiment, the plant is of the genus Nicotiana, preferably Nicotiana sylvestris or Nicotiana tabacum.  In this embodiment, the genes are placed under the control of a promoter allowing expression, preferably specific, in the trichomes of the plant.  Such promoters are known to those skilled in the art.  Within the meaning of the invention, the term "specific" promoter means a promoter mainly active in a given tissue or cell group.  It is understood that a residual expression, generally lower, in other tissues or cells can not be entirely excluded.  A particular feature of the invention resides in the ability to construct specific promoters of the glandular trichome secretory cells, permitting a modification of the composition of the foliar secretions of the plant, and in particular to express the genes of the present invention allowing to prepare cisabiénol.  Thus, syn-copalyl-8-ol diphosphate, cis-abienol or derivatives thereof can be harvested from the trichomes of these plants, particularly in the exudate of trichomes.  For example, it has been shown that a 1852 bp regulatory sequence, located upstream of the ATG of the CYP71D16 gene, makes it possible to direct the expression of the uidA reporter gene specifically in the secretory cells of tobacco trichomes (application US2003 / 0100050 Al, Wagner et al. , 2003).  On the other hand, several

  Promoter sequences from different species have been identified as being capable of directing the expression of a heterologous gene in tobacco trichomes. Gene Gene Name Plants References Abbreviation LTP3 Lipid transfer protein Cotton Liu et al., 2000, BBA, 1487: 106111 LTP6 Cotton Hsu et al., 1999, Plant science, 143: 6370 wax9D B. oleracea Pyee and Kolattukudy, 1995, Plant J. 7: 4559 LTP 1 Arabidopsis Thoma et al., 1994, Plant Physiol.

3545 CYC71D16 CBTo1 hydroxylase Tobacco Wang et al., 2002, J.of Exp. Bot.

In a preferred embodiment of the present invention, the promoter used in the cassette is derived from the Nicotiana sylvestris NsTPS-02a, 02b, 03, and 04 genes with strong sequence similarity to CYC-2 ( CBT-ol cyclase, NID: AF401234). These promoter sequences are more fully described in the patent application WO2006040479.

Preferred terminator sequences include the NOS terminator (Bevan et al., 1983), and the terminator of the histone gene (EPO 633 317). In a particular embodiment, the expression cassette may comprise a sequence for increasing expression (enhancer), for example certain elements of the CaMV35S promoter and octopine synthase genes (US 5,290,924). Preferably, the activating elements of the CaMV35S promoter are used. The introduction of constructs carrying one or both of the genes of the invention into a plant cell or tissue, including a seed or plant, can be carried out by any technique known to those skilled in the art, including in episomal form. or chromosome. Plant transgenesis techniques are well known in the art, and include, for example, the use of the bacterium Agrobacterium tumefaciens, electroporation, biolistic techniques, transfection with a viral vector in particular, and any other technique known to humans. job.

A commonly used technique relies on the use of the bacterium Agrobacterium tumefaciens, which consists essentially of introducing the construct of interest (nucleic acid, cassette, vector, etc.) into the A. tumefaciens bacterium, and then contact this bacterium transformed with leaf discs of the chosen plant. The introduction of the expression cassette into the bacterium is typically carried out using the Ti (or T-DNA) plasmid as vector, which can be transferred to the bacterium for example by thermal shock. Incubation of the transformed bacterium with the leaf disks makes it possible to obtain the transfer of the Ti plasmid into the genome of the cells of the disks. These may optionally be grown under conditions suitable for reconstituting a transgenic plant whose cells comprise the construction of the invention. For further details or alternative embodiments of the A. tumefaciens transformation technique, reference may be made, for example, to Horsch et al. (1985) or Hooykaas and Schilperoort (1992). Thus, in a particular embodiment, the thus constituted expression cassette is inserted between the left and right borders of the transfer DNA (T-DNA) of a disarmed Ti plasmid for transfer into plant cells by Agrobacterium tumefaciens. T-DNA also includes a gene whose expression confers resistance to an antibiotic or a herbicide and which allows the selection of transformants. Once regenerated, the transgenic plants can be tested for heterologous expression of the genes of the present invention or the production of cis-abienol or syncopalyl-8-ol diphosphate in trichomes. This can be done by harvesting leaf exudate and testing for the presence of the product of interest in this exudate. This can also be done by analyzing the presence of one or more heterologous enzymes of the present invention in the leaves and, more particularly, in the trichome cells (for example by analyzing mRNA or genomic DNA using probes or specific primers). Plants can optionally be selected, crossed, processed, etc. to obtain plants with improved levels of expression. Another subject of the invention is also a plant or seed comprising a nucleic acid, an expression cassette or a vector as defined above. The present invention finally relates to a non-human transgenic cell or organism, characterized in that the synthesis pathway of cis-abienol is blocked by inactivation of the gene coding for a syn-copalyl-8-ol diphosphate (syn-CODP) synthase According to the present invention or the gene coding for cis-abienol synthase according to the present invention or both genes. The expression of these genes can be blocked by many techniques available and known to those skilled in the art. The genes can be deleted, mutated (for example by chemical mutagenesis by ethyl methane sulphonate or ionizing radiation) or interrupted (insertional mutagenesis). Moreover, the blocking of the expression of these genes can also be achieved by gene silencing by expressing an inhibitory transcript. The inhibitory transcript is an RNA which can be in the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or specificity 10 with the transcript of the gene to be blocked. The present invention also relates to a nucleic acid capable of decreasing or suppressing the expression of a gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase. Indeed, an inhibitory RNA which may be in the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or specificity with the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase can be prepared based on the teaching of the present invention. Thus, the present invention relates to an inhibitory RNA of the gene encoding a syn-copalyl-8-ol diphosphate (syn-CODP) synthase comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of the SEQ ID No. 21 or a complementary sequence thereof. Similarly, it relates to the use of a polynucleotide comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 21 or a complementary sequence thereof to inhibit expression of the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase. Inhibition of this enzyme may be useful in stopping or slowing down the cis-abienol synthesis pathway and making GGPP available for another synthetic route of interest requiring GGPP delivery. For example, the inhibition of this enzyme may make it possible to increase the production rate of CBT-diol by the glandular cells of tobacco leaf trichomes. The present invention thus relates to transgenic cells or organisms in which the gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase has been inactivated. Inactivation can be performed by interfering RNA, gene deletion, chemical mutation or homologous recombination inactivation techniques. Thus the level of syn-copalyl-8-ol diphosphate or cis-abienol can be decreased in these cells or transgenic organisms.

In addition, the present invention also relates to a nucleic acid capable of decreasing or suppressing the expression of a gene encoding cis-abienol synthase. Indeed, an inhibitory RNA which may be in the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or Specificity with the gene encoding cis-abienol synthase can be prepared based on the teaching of the present invention. Thus, the present invention relates to an inhibitory RNA of the gene encoding a cis-abienol synthase comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 23. Likewise, it relates to the use of a polynucleotide comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 23 for inhibiting the expression of the gene encoding cis-abienol synthase. Inhibition of this enzyme may be useful for stopping the synthesis pathway of cis-abienol and making syn-copalyl-8-ol diphosphate available for another synthetic route of interest requiring an addition of this compound, for example to Preparing derivatives of syn-copalyl-8-ol diphosphate, for example, sclareol, or 9-beta labda-13-en-8,15-diol. Sclareol is used industrially for the synthesis of ambroxides, such as Ambrox, which are ingredients of the perfume industry. The present invention thus relates to transgenic cells or organisms in which the gene encoding cis-abienol synthase is inactivated. Inactivation can be performed by interfering RNA, gene deletion, chemical mutation or homologous recombination inactivation techniques. Thus the level of cis-abienol can be decreased in these cells or transgenic organisms. Other aspects and advantages of the present invention will become apparent from the following examples, which should be considered as illustrative and not limiting.

EXAMPLES Identification of Candidate Gene Fragments Encoding CPS and Tobacco KS Specifically Expressed in Tobacco Trichome Cells. The sequences encoding the kaurene synthase (KS) and copalyl diphosphate synthase (CPS) related enzymes belong to the same phylogenetic family while constituting two distinct groups. The protein sequences of the representative members of these two families have been aligned with the ClustalX software (Thompson et al., 1997). Alignment made it possible to define a conserved pattern, YDTAWV (pattern A, SEQ ID No. 1), for both families, and patterns retained for each of the two families, namely, PWYASL (pattern B, SEQ ID No. 2) for the CPS and CAMAFR family (pattern C, SEQ ID No 3) for the KS family. Degenerate primers corresponding to conserved motifs A, B, and C, respectively, were designed (Table 1). DNA amplification was performed by PCR with the primer pairs corresponding to the A / B and A / C motifs from tobacco leaf trichome cDNA (N. tabacum) to amplify cDNA fragments. coding for CPS and KS type sequences, respectively. Two and three sequences having a strong homology with the CPS and KS sequences respectively have been identified and respectively denoted NtCPS1, NtCPS2, NtKSL1, NtKSL2, NtKSL3.

Table 1 Degenerate primer sequences corresponding to conserved motifs of CPS and KS encoding proteins. Pattern AA Pattern # Family Sequence leader 5 '-> 3' SEQ ID No YDTAWV A CPS / KSL_ TAYGAYACNGCNTGGGT 4 PWYASL B CPS AGNGANGCRTACCANGG 5 PWYASL B CPS YAANGANGCRTACCANGG 6 PWYASL B CPS AGRCTNGCRTACCANG 7 PWYASL B CPS AARCTNGCRTACCANG 8 CAMAFR C KSL CGRAANGCCATNGCRCA 9 CAMAFR C KSL CTRAANGCCATNGCRCA Specific primers of each of the genes were defined to determine the level of gene expression in the leaves and trichomes. The analysis was performed by real-time quantitative PCR from tobacco leaf cDNA and trichomes (N. tabacum). The genes encoding cembratriene-ol synthase (CBTS-02) (NID: AF401234), and CBT-ol hydroxylase (CYP71D16B) (NID: AF166332), which express themselves strongly and specifically in glandular trichome cells tobacco, were used as positive controls. Figure 2A shows that the NtCPS2 gene expresses more specifically in tobacco trichomes than in the leaf while the level of expression of the NtCPS1 gene is virtually identical in both tissues. FIG. 2A also shows that the NtKSL2 and NtKSL3 genes express themselves specifically in trichomes, whereas NtKSL1 is not specific for trichomes. FIG. 2B indicates that the expression of the NtCPS2 gene in trichomes is comparable to that of the CBTS and CYP71D16B genes, since the expression ratio of the NtCPS2 gene on CBTS is close to 1, unlike the ratio NtCPS1 on CBTS which is very weak (104). The same analysis concluded that the NtKSL3 gene expresses strongly and specifically in tobacco leaf trichome cells (Fig.

2A and 2B). Identification of the complete coding nucleic sequences of NtCPS2 and NtKSL3. The coding and complete nucleic sequences for both NtCPS2 and NtKSL3 genes were identified by standard 5 'RACE and 3' RACE PCR techniques using primers specific for each sequence (Table 2). CDNAs isolated from tobacco leaf trichomes (N. tabacum) were used as a template for PCR amplification. The 5 'and 3' fragments obtained for each of the different genes were assembled to form the NtCPS2 coding sequences of 2409 bases (SEQ ID No. 21) and of NtKSL3 (SEQ ID No. 23) of 2379 bases respectively coding for 802 AA (SEQ ID N 22) and 792 AA (SEQ ID N 24). NtKSL3-like sequences were searched for in the SwissProt protein library using the BlastP program (Altschul et al., 1997). The highest percentage identity was obtained with pumpkin entkaurene synthase (45%) and cranberry (44%) (Table 3). It may also be noted that the NtKSL3 sequence has a very high degree of identity (90%) with a putative tobacco terpene cyclase (Wang and Wagner, 2005, PID AAS98912.1). Indeed, the segment 1-722 of this sequence of 759 residues corresponds to segment 46-766 of the sequence NtKSL3, the remaining segment 723-759 having no relation with the sequence NtKSL3. The function of this protein, however, has not been demonstrated.

Table 2: Primer sequence for amplifying the 5 'and 3' regions of the coding phases of the NtCPS2 and NtKSL3 genes. Target Name Description Sequence primer 5 '-> 3' SEQ ID NO NtCPS2 8E03 5'RACE AAGACAAGATGGAAACATAGGTCTTTGA 11 NtCPS2 8E04 5'RACE CTCCCCATGAACCATCAGAAAGTTGA 12 NtCPS2 8E05 5'RACE GCAGAATACAATCTCCTCTCCCCATGA 13 NtCPS2 8C01 3 'RACE CCTGATGGTTCATTCTTAATATCCCCTG 14 NtCPS2 8CO2 3' RACE CAATACCCGTTCGACTTGGTAACACGA 15 NtKSL3 8G04 5'RACE ATGCTGTGTCATAGGAAGAAGGAGATAG 16 NtKSL3 8G05 5'RACE AACATGGTTGGTTCATAGAATATCTTGA 17 NtKSL3 8G06 5'RACE GTCTTTTACAAGCAATGGATGGCTAGGA 18 NtKSL3 8CO5 3 'RACE CCTGCATGATCAACTATGCAGAGAAACTTA 19 NtKSL3 8C06 3' RACE CCTTGTAAATATGATGCTCTGCGAACGT 20 Table 3: Sequences having the best percent identity obtained by looking homology with the program BlastP 2.2.13 (Altschul et al., 1997) against the SwissProt bank with the sequence NtKSL3. Description Organism N accession Function% identity CmKS entKaurene B Cucurbita maxima L. AAB39482 ent-kaurene synthase 45 AtGA2 Arabidopsis thaliana AAC39443 ent-kaurene synthase 44 AgE-a-bisabolene synthase Abies grandis AAC24191 E-alpha-bisabolene synthase 34 AgAbietadiene synthase Abies grandis AAB05407 Abietadiene synthase 27 TbTaxadiene synthase taxus baccata Q93YA3 Taxadiene synthase 26 5 2903703 Table 4: Sequences presenting the highest percentage identity obtained by homology search with the BlastP 2.2.13 program (Altschul et al., 1997) against SwissProt Bank and Genbank, respectively, with the sequence NtCPS2. Description Organism Entkaurene synthase A, Pisum sativum chloroplast precursor ent-kaurene synthase A, Arabidopsis thaliana chloroplast precursor Abietadiene synthase, Abies grandis chloroplast precursor Alpha-bisabolene synthase Abies grandis Description Organism copalyldiphosphate Lactuca sativa synthase No1 copalyl pyrophosphate Stevia rebaudiana synthase copalyl diphosphate Croton sublyratus copalyl diphosphate Lycopersicon synthase esculentum putative copalyl Scoparia dulcis diphosphate synthase N Function% identity / accession NtCPS2 004408 Ent-copalyldiphosphate synthase 44 Q38802 Ent-copalyldiphosphate synthase 45 Q38710 Abietadiene synthase 42 081086 (E) -alpha-bisabolene synthase 34 N Function% accession identity with NtCPS2 BAB12440.1 Putative Copalyldiphosphate 48 Synthase AAB87091.1 Putative Copalyldiphosphate 48 Synthase BAA95612.1 Putative Copalyldiphosphate 48 Synthase BAA84918.1 Putative Copalyldiphosphate 47 Synthase BAD91286.1 Ent-Copalyldiphosphate Synthase Identification of the function of the protein encoded by NtCPS2 In order to establish the function of the NtCPS2 protein, the production of the recombinant enzyme NtCPS2-HisTAG by E. coli was performed, to identify its activity (s). ) potential. The nucleic sequence coding for NtCPS2 (sequence ID N 21) was introduced into the pET-30b expression vector (Novagen). To facilitate purification of the protein, the STOP codon of the sequence was removed to create a C-terminal histidine tail fusion protein. The vector NtCPS2-pET30b was introduced by electroporation into expression E. coli cells (BL21-CodonPlus, Stratagene). The production of the protein in these cells was induced by addition of 1 mM IPTG at 16 C from 500 ml of culture. After 18 hours of induction, the cells are collected by centrifugation and lysed by a shock of depression (AP: 19 bar). Soluble proteins desalted on a PD10 column (Amersham) are applied to a nickel-nitrilotriacetic agarose affinity resin (Ni-NTA) according to the manufacturer's protocol (Qiagen). Activity tests were performed on the protein fraction enriched in NtCPS2-HisTag in buffer containing 50 mM Hepes, 100 mM KC1, 7.5 mM MgCl2, 5% glycerol, and 5 mM DTT. The following substrates GPP, FPP, GGPP were tested separately at a concentration of 65 M with 25 or 50 g of proteins, incubated at 32 C for 2 hours. The reaction products were then dephosphorylated by adding 20 units of calf intestinal alkaline phosphatase (New England Biolabs) for 1 hour at 37 ° C. The products were extracted with chloroform: methanol: water (5%). : 1: 4). The aqueous and organic phases are separated by centrifugation, the organic phase is dried under a stream of nitrogen, taken up in pentane and analyzed by GC / MS.

The enzymatic function of NtCPS2 was studied by the production of the recombinant enzyme NtCPS2-HisTAG from E. coll. The soluble enzyme mixture obtained from the E. coli disruption was then loaded onto an affinity column. An enrichment factor of 15 to 20 is evaluated by SDS gel electrophoresis. To demonstrate its function, NtCPS2-HisTAG was incubated with 3 different substrates: GPP, FPP and GGPP.

No new products were detected with GPP or FPP showing that NtCPS2-HisTAG does not utilize these substrates. On the other hand, when GGPP has been used, a new diterpen-diol appears. The molecular ion 308 is very minor, but the 290 ion corresponding to the loss of an alcohol function by removal of a molecule of water (M-18) is identifiable on the mass spectrum (Figure 7). The peak was identified as 9-beta labda-13-en-8,15-diol in comparison with the naturally occurring 9-beta labda-13-en-8,15-diol peak in the exudate of leaves of N. tabacum (Figure 6). The mass spectrum and the retention time of the new compound are identical to those in N. tabacum (Fig. 7). The product obtained corresponds to the dephosphorylation product of 9-beta labda-13-en-8-o-15-yl trihydrogen diphosphate (syn-CODP).

Identification of the function of proteins encoded by NtKSL3 and NtCPS2. To determine the function of the NtKSL3 and NtCPS2 genes, their sequences were introduced by genetic transformation into N sylvestris, a wild tobacco that does not produce cis-abienol and in a transgenic N sylvestris line (ihpCBTS source line) whose CBTS gene expression was inhibited by RNA interference (Tissier et al., 2005). In this line, the amount of CBT-diol of the leaves is very small. A specific trichome tobacco promoter (eCBTS1.0, Tissier et al., 2004) was put upstream of the coding sequences NtCPS2 and NtKSL3 to form the constructs eCBTS 1.0-NtCPS2 [# 1] and eCBTS1.0-NtKSL3 [# 2 ]. These two constructs were introduced into a single binary vector containing a kanamycin resistance gene to yield the binary vector pLIBRO-58 (Fig.

3A). Constructs # 1 and # 2 were also independently introduced into the same vector to form the pLIBRO-68 binary vectors (Fig.

3B) and pLIBRO-69 (FIG.

3C), respectively. The vectors were introduced into the Agrobacterium strain LBA4404 by electroporation. The strains containing the different vectors were used to carry out the genetic transformation of N. sylvestris by the leaf disk method (Horsch et al., 1985). About 25 kanamycin resistant plants were obtained for each construct. The presence of transgenes in each plant was confirmed by PCR from 10-leaf genomic DNA. The expression level of the transgenes was verified by RT-PCR from tobacco leaf mRNA. The plant exudates that express the transgenes were extracted by immersion in pentane solution for 1 min. The extracts were analyzed by gas chromatography coupled to a mass spectrum (GC / MS). An example of a chromatographic profile of plant exudates obtained by GCIMS is presented in FIG. 4. It shows that the exudate of a transgenic line containing the NtCPS2 and NtKSL3 genes contains an additional peak noted at 40.5 min. The exact superimposition of the retention times and peak mass spectra at 40.5 min with that of cis-abienol naturally produced by N. tabacum (FIGS. 4A and 5A), demonstrates the authenticity of the peak n 1 as being cis-abienol. Plants that express both the NtCPS2 and NtKSL3 transgenes produce significant amounts of cis-abienol in the ihpCBTS line (Table 5). Transgenic lines that have integrated the NtCPS2 gene alone or the NtKSL3 gene alone do not produce cis-abienol. These results indicate that the presence of both genes is necessary for the synthesis of cis-abienol. In conclusion, NtKSL3 and NtCPS2 allow the biosynthesis of cis-abienol from GGPP.

Table 5: Rates of cis-abienol and CBT-diol in the exudates of transgenic plants having integrated and expressing the transgenes NtCPS2 and NtKSL3. Quantification of cis-abienol was performed by GC / MS in comparison with a purified cis-abienol standard from N. tabacum leaf exudate. N sylvestris ihpCBTS: Transgenic line whose expression of the CBTS gene was inhibited by RNA interference. Plants Original plant cis-abienol CBT-diol [pgIG Fie] [pgIG FW-1] 3385 N. sylvestris ihpCBTS 117 158 3408 N. sylvestris ihpCBTS 55 586 3380 N. sylvestris ihpCBTS 49 734 3379 N. sylvestris ihpCBTS 45 1033 3396 N. sylvestris ihpCBTS 44 8 3387 N. sylvestris ihpCBTS 29 99 3398 N. sylvestris ihpCBTS 14 169 3403 N. sylvestris ihpCBTS 13 53 3388 N. sylvestris ihpCBTS 8 550 3397 N. sylvestris ihpCBTS 7 References Altschul, Stephen F., Thomas L. Madden , Alejandro A. Schafer, Jinghui Zhang, Zheng Zhang, Miller Webb, and David J. Lipman (1997), Gapped BLAST and PSI-BLAST: Nucleic Acids Res. 25: 3389-3402.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. (2006) Current Protocols in Molecular Biology, John Wiley & Sons, Inc. Bevan M, Barnes WM, Chilton MD. (1983) Structure and transcription of the nopaline synthase gene region of T-DNA. Nucleic Acids Res. 11: 369-385. Cane DE. (1999) Sesquiterpene biosynthesis: Cyclization mechanisms. In "Comprehensive natural products chemistry, isoprenoids including carotenoids and steroids" Vol. 2, D.D. Cane, ed (Amsterdam, The Netherlands, Elsevier), pp.155-200 Carman RM, Duffield AR (1993) The Biosynthesis of Labdanoids - The Optical Purity of Naturally-Occurring Manool and Abienol. Aust. J. Chem. 46: 1105-1114 Eisenreich W, Bacher A, Arigoni D, Rohdich F. (2004) Biosynthesis of isoprenoids via the non-mevalonate pathway. Cell. Mol. Life Sci. 61: 1401-1426. Guo Z, Severson RF, Wagner GJ. (1994) Biosynthesis of the cis-abienol diterpene in cell-free extracts of tobacco trichomes. Arch Biochem Biophys. 308 (1): 103-8. Hooykaas PJ, Schilperoort RA (1992) Agrobacterium and plant genetic engineering. Plant Mol Biol 20: 175 Horsch RB, Rogers SG, Fraley RT (1985) Transgenic plants. Cold Spring Harb Symp Quant Biol. 50: 433-7 McMillan J., and Beale M.H. (1999) Dipterpene biosynthesis. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids Vol. 2, DD Cane, ed 15 (Amsterdam, The Netherlands, Elsever), pp.217-243 Sakamoto T, Miura K, Itoh H, Tatsumi T, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Agrawal GK, Takeda S, Abe K, Miyao A, Hirochika H, Kitano H, Ashikari M, Matsuoka M. An overview of gibberellin metabolism enzyme genes and their related mutants in rice.

Plant Physiol. 2004 134 (4): 1642-53 Sambrook J, Russell D. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, third edition (1989).

Sun T, Kamiya Y The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosynthesis. Plant Cell. 1994 6 (10): 1509-18. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by 30 quality analysis tools. Nucleic Acids Research 24: 4876-4882. Tissier A, Sallaud C, Rontein D (2004) Plant promoters and uses PCT / FR 05/02530.

Tissue A, Sallaud C, Rontein D (2005) Terpenes production system in plants Patent application France FR 05 00855. Wagner GJ, Wang E., Shepherd RW (2004) New approaches for studying and exploiting 5 years old protuberance, the plant trichome. Annals of Botany 93: 3-11 Wise ML, Croteau RA (1999). Monoterpene biosynthesis. In "Comprehensive natural products chemistry, isoprenoids including carotenoids and steroids" Vol. 2, D.D. Cane, ed (Amsterdam, The Netherlands; Elsever), pp.97-153 Yamaguchi S, Sun T, Kawaide H, Kamiya Y. The GA2 locus of Arabidopsis thaliana encodes ent-kaurene synthase of gibberellin biosynthesis. Plant Physiol. 1998 116 (4): 1271-8. 15

Claims (12)

claims   A method of producing cis-abienol or derivatives thereof from geranyl geranyl diphosphate (GGPP) in a cell having a GGPP source, comprising: a) introducing into said cell a construction bearing a expression cassette comprising a gene encoding syn-copalyl-8-ol diphosphate (syn-CODP) synthase having at least 80% identity with SEQ ID No. 22 and a construct carrying an expression cassette comprising a gene encoding a cis-labda-12,14-dien-8 alpha-ol synthase having at least 80% identity with SEQ ID No. 24; b) culturing the transformed cell under conditions appropriate for gene expression; and, a) optionally, harvesting cis-abienol or derivatives thereof contained in said cell and / or in the culture medium.   2- Isolated or recombinant protein having cis-labda-12,14-dien-8 alpha-ol synthase activity and having a sequence having at least 95% identity with SEQ ID No. 24.   3- Isolated or recombinant protein having syn-copalyl-8-ol diphosphate (syn-CODP) synthase activity and having a sequence having at least 80% identity with SEQ ID No. 22.   A nucleic acid comprising a nucleotide sequence encoding a protein according to claim 2, or a sequence capable of hybridizing thereto under stringent conditions and having cis-labda-12,14-dien-8 alpha activity. -ol synthase.   Nucleic acid comprising a nucleotide sequence coding for a protein according to claim 3, or a sequence capable of hybridizing thereto under stringent conditions and having syn-copalyl-8-ol diphosphate (syn-CODP) activity synthase.   An expression cassette comprising a nucleic acid according to claim 4 or 5.   A vector comprising a nucleic acid according to claim 4 or 5 or an expression cassette according to claim 6.   A host cell comprising a nucleic acid according to claim 4 or 5, an expression cassette according to claim 6, or a vector according to claim 7.   A non-human transgenic organism comprising a nucleic acid according to claim 4 or 5, an expression cassette according to claim 6, a vector according to claim 7, or a cell according to claim 8.   10- transgenic organism according to claim 9, characterized in that the organism is a plant with glandular trachoma, preferably of the genus Nicotiana.   11- Use of a protein according to claim 2 or 3, a nucleic acid according to claim 4 or 5, a host cell according to claim 8 or a transgenic organism according to claim 9 or 10 for the preparation syn-copalyl-8-ol diphosphate or cis-abienol or derivatives thereof.   12- Non-human transgenic cell or organism, characterized in that the synthesis route of cis-abienol is blocked by inactivation of the gene coding for a protein according to claim 2 or the gene coding for a protein according to claim 3 or both Genoa.