WO1996015264B1 - Method for identifying nucleic acid sequences from different biological sources through amplification of the same - Google Patents
Method for identifying nucleic acid sequences from different biological sources through amplification of the sameInfo
- Publication number
- WO1996015264B1 WO1996015264B1 PCT/GB1995/002654 GB9502654W WO9615264B1 WO 1996015264 B1 WO1996015264 B1 WO 1996015264B1 GB 9502654 W GB9502654 W GB 9502654W WO 9615264 B1 WO9615264 B1 WO 9615264B1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- seq
- fragment
- sequence
- amplification
- Prior art date
Links
- 150000007523 nucleic acids Chemical group 0.000 title claims abstract 16
- 229920001850 Nucleic acid sequence Polymers 0.000 title claims abstract 15
- 230000003321 amplification Effects 0.000 title claims abstract 10
- 238000003199 nucleic acid amplification method Methods 0.000 title claims abstract 10
- 239000003155 DNA primer Substances 0.000 claims abstract 8
- 239000007795 chemical reaction product Substances 0.000 claims abstract 4
- 239000012472 biological sample Substances 0.000 claims abstract 3
- 108090000623 proteins and genes Proteins 0.000 claims abstract 2
- 102000004169 proteins and genes Human genes 0.000 claims abstract 2
- 239000002773 nucleotide Substances 0.000 claims 10
- 125000003729 nucleotide group Chemical group 0.000 claims 10
- 229920000272 Oligonucleotide Polymers 0.000 claims 9
- 150000001413 amino acids Chemical class 0.000 claims 8
- 230000000295 complement Effects 0.000 claims 6
- 238000004458 analytical method Methods 0.000 claims 1
- 239000003153 chemical reaction reagent Substances 0.000 claims 1
- 101700022893 csp Proteins 0.000 claims 1
- 108020004707 nucleic acids Proteins 0.000 claims 1
- 238000003752 polymerase chain reaction Methods 0.000 claims 1
- 239000000523 sample Substances 0.000 claims 1
- 230000035939 shock Effects 0.000 abstract 1
Abstract
A method of identifying a nucleic acid sequence in a biological sample comprises using a pair of universal oligonucleotide primers to amplify the nucleic acid sequence and characterising the amplification reaction products. Preferred universal primers are derived from conserved regions of cold shock or Y-box proteins and hybridise to the genes that code for the peptide sequences GXVKWFNXXKGFGFI and GPXAXNVTXX.
Claims
1. A method of identifying a nucleic acid sequence in a biological sample, which method comprises using at least one pair of oligonucleotide primers to amplify the nucleic acid sequence, and characterising the amplification reaction products, characterised in that the or each pair of oligonucleotide primers hybridises to a nucleic acid that codes for a cold shock protein or a eukaryotic Y-box protein and is operable to enable the amplification of nucleic acid sequences from different biological sources.
2. A method as claimed in claim 1 , wherein the amplification is performed by the polymerase chain reaction.
3. A method as claimed in claim 1 or claim 2, wherein the characterising is performed by sequencing or by single-strand conformation polymorphism analysis or by the use of a labelled probe which binds to the amplification reaction products.
4. A method as claimed in any one of claims 1 to 3, wherein a first oligonucleotide primer used is substantially complementary to a nucleic acid sequence that codes for the peptide sequence
GXVKWFNXXKGFGFI (SEQ ID NO: 1) where X is any amino acid, or for a fragment thereof that includes at least four identified amino acids.
5. A method as claimed in claim 4, wherein another oligonucleotide primer used is substantially complementary to a nucleic acid sequence that codes for the peptide sequence GPXAXNVTXX
(SEQ ID NO: 3) where X is any amino acid, or for a fragment thereof that includes at least four identified amino acids.
6. A method as claimed in claim 4, wherein the oligonucleotide primer used has the sequence GGTANAGTAAAATGGTTNAACNC 18
(SEQ ID NO: 2) where N is any nucleotide, or a fragment thereof containing at least twelve nucleotides.
7. A method as claimed in claim 5, wherein the oligonucleotide primer used has the sequence GGTTACGTTANCNGCTNNNGGNCC (SEQ ID NO: 4) where N is any nucleotide, or a fragment thereof containing at least twelve nucleotides.
8. A method as claimed in any one of claims 4 to 7, wherein another oligonucleotide primer used has the sequence
GATGTATTCGTACATTTCTCTGCTATCC (SEQ ID NO: 6) or its reverse complement GGATAGCAGAGAAATGTACGAATACATC (SEQ ID NO: 7) or a fragment of either containing at least twelve nucleotides
9. A pair of oligonucleotide primers, operable to enable the amplification of nucleic acid sequences from different biological sources, comprising a first oligonucleotide primer substantially complementary to a nucleic acid sequence that codes for the peptide sequence GXVKWFNXXKGFGFI (SEQ ID NO: 1) where X is any amino acid, or for a fragment thereof that includes at least four identified amino acids, and another oligonucleotide primer substantially complementary to a nucleic acid sequence that codes for the peptide sequence GPXAXNVTXX (SEQ ID NO: 3) where X is any amino acid, or for a fragment thereof that includes at least four identified amino acids.
10. A set of oligonucleotide primers, operable to enable the amplification of nucleic acid sequences from different biological sources, comprising a first oligonucleotide primer having the sequence GGTANAGTAAAATGGTTNAACNC (SEQ ID NO: 2) where N is any nucleotide, or a fragment thereof containing at least twelve nucleotides, and at least one other oligonucleotide primer having a sequence selected from (i) GGTTACGTTANCNGCTNNNGGNCC (SEQ ID NO: 4) where N is any nucleotide, or a fragment thereof containing at least twelve nucleotides and (ii) GATGTATTCGTACATTTCTCTGCTATCC (SEQ ID NO: 6) or its reverse complement GGATAGCAGAGAAATGTACGAATACATC (SEQ ID NO: 7) or a fragment of either containing at least twelve nucleotides
11. A kit for identifying a nucleic acid sequence in a biological sample by the method of any one of claims 1 to 8, which kit comprises reagents, including at least one pair of oligonucleotide primers operable to enable the amplification of nucleic acid sequences from different biological sources, for amplifying the nucleic acid sequence, and means for characterising the amplification reaction products.
12. A kit as claimed in claim 11 , wherein the at least one pair of oligonucleotide primers is a pair or set of oligonucleotide primers as claimed in claim 9 or claim 10.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/666,493 US5948649A (en) | 1994-11-12 | 1995-11-13 | Method for identifying nucleic acid sequences from different biological sources through amplification of the same |
| EP95936670A EP0731850A1 (en) | 1994-11-12 | 1995-11-13 | Method for identifying nucleic acid sequences from different biological sources through amplification of the same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB9422891A GB9422891D0 (en) | 1994-11-12 | 1994-11-12 | Improvements in and relating to the amplification and identification of nucleotide sequences |
| GB9422891.3 | 1994-11-12 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO1996015264A2 WO1996015264A2 (en) | 1996-05-23 |
| WO1996015264A3 WO1996015264A3 (en) | 1996-08-29 |
| WO1996015264B1 true WO1996015264B1 (en) | 1996-10-03 |
Family
ID=10764324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB1995/002654 WO1996015264A2 (en) | 1994-11-12 | 1995-11-13 | Method for identifying nucleic acid sequences from different biological sources through amplification of the same |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US5948649A (en) |
| EP (1) | EP0731850A1 (en) |
| GB (1) | GB9422891D0 (en) |
| WO (1) | WO1996015264A2 (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9615516D0 (en) * | 1996-07-24 | 1996-09-04 | Jsd Tech Ltd | Bacillus cereus |
| US7534568B2 (en) | 1999-10-29 | 2009-05-19 | Hologic Inc. | Methods for detection of a target nucleic acid by forming a cleavage structure with a cleavage resistant probe |
| US6528254B1 (en) * | 1999-10-29 | 2003-03-04 | Stratagene | Methods for detection of a target nucleic acid sequence |
| US7118860B2 (en) | 1999-10-29 | 2006-10-10 | Stratagene California | Methods for detection of a target nucleic acid by capture |
| WO2001048242A2 (en) | 1999-12-29 | 2001-07-05 | Mergen Ltd. | Methods for amplifying and detecting multiple polynucleotides on a solid phase support |
| AU2001232485A1 (en) | 2000-01-13 | 2001-07-24 | Amsterdam Support Diagnostics B.V. | A universal nucleic acid amplification system for nucleic acids in a sample |
| US6376191B1 (en) | 2000-03-22 | 2002-04-23 | Mergen, Ltd. | Microarray-based analysis of polynucleotide sequence variations |
| EP1418241A1 (en) * | 2002-11-08 | 2004-05-12 | PrimaGen Holding B.V. | Method for quantifying a ratio between at least two nucleic acid sequences |
| JP4773338B2 (en) * | 2003-03-07 | 2011-09-14 | ルビコン ゲノミクス， インコーポレイテッド | Amplification and analysis of whole genome and whole transcriptome libraries generated by the DNA polymerization process |
| US8206913B1 (en) | 2003-03-07 | 2012-06-26 | Rubicon Genomics, Inc. | Amplification and analysis of whole genome and whole transcriptome libraries generated by a DNA polymerization process |
| EP2380993B1 (en) | 2004-03-08 | 2015-12-23 | Rubicon Genomics, Inc. | Method for generating and amplifying DNA libraries for sensitive detection and analysis of DNA methylation |
| EP1924705A1 (en) | 2005-08-02 | 2008-05-28 | Rubicon Genomics, Inc. | Isolation of cpg islands by thermal segregation and enzymatic selection-amplification method |
| US20070031857A1 (en) | 2005-08-02 | 2007-02-08 | Rubicon Genomics, Inc. | Compositions and methods for processing and amplification of DNA, including using multiple enzymes in a single reaction |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4965188A (en) * | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| FR2596774B1 (en) * | 1986-04-04 | 1988-07-22 | Pasteur Institut | OLIGONUCLEOTIDE PROBES AND METHODS FOR HYBRIDIZED DETECTION OF NUCLEIC ACIDS FROM BACTERIA AND OTHER LIVING BEINGS |
| FR2636075B1 (en) * | 1988-09-07 | 1991-11-15 | Biotechnologie Ste Europ | METHOD FOR DETECTING BACTERIA, YEAST, PARASITES AND OTHER EUKARYOTS, ESPECIALLY IN FOOD PRODUCTS |
| CA2033718A1 (en) * | 1990-01-19 | 1991-07-20 | Ronald M. Atlas | Process for detection of water-borne microbial pathogens and indicators of human fecal contamination in water samples and kits therefor |
| CA2026264A1 (en) * | 1990-09-26 | 1992-03-27 | William Scott Davidson | Test to determine an organism's species and/or population identity by direct nucleotide sequence analysis of defined segments of its genome |
| US5470971A (en) * | 1991-03-11 | 1995-11-28 | The University Of Medicine And Dentistry Of New Jersey | Stress-induced proteins, genes coding therefor, transformed cells of organisms, methods and applications |
| US6232061B1 (en) * | 1992-04-01 | 2001-05-15 | Cambridge Neuroscience, Inc. | Homology cloning |
-
1994
- 1994-11-12 GB GB9422891A patent/GB9422891D0/en active Pending
-
1995
- 1995-11-13 EP EP95936670A patent/EP0731850A1/en not_active Withdrawn
- 1995-11-13 WO PCT/GB1995/002654 patent/WO1996015264A2/en not_active Application Discontinuation
- 1995-11-13 US US08/666,493 patent/US5948649A/en not_active Expired - Fee Related
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5935825A (en) | Process and reagent for amplifying nucleic acid sequences | |
| US6514706B1 (en) | Linear amplification mediated PCR (LAM PCR) | |
| JP2622255B2 (en) | Alternative nucleotide sequence identification method | |
| US6238866B1 (en) | Detector for nucleic acid typing and methods of using the same | |
| Brightwell et al. | Development of internal controls for PCR detection ofBacillus anthracis | |
| EP0676476A1 (en) | Isothermal strand displacement nucleic acid amplification | |
| NZ227688A (en) | Amplification and detection of nucleic acid sequences by synthesis of specific rna transcripts | |
| WO1999063112A8 (en) | Pcr techniques for detecting microbial and viral contaminants in foodstuffs | |
| WO2007023461A2 (en) | Method for detection of micro-organisms and antibiotic resistance markers and nucleic acid oligonucleotides therefor | |
| WO1996015264B1 (en) | Method for identifying nucleic acid sequences from different biological sources through amplification of the same | |
| US5654144A (en) | Detection of Yersinia using the polymerase chain reaction | |
| CA2358992A1 (en) | Method for controlling the extension of an oligonucleotide | |
| US6136533A (en) | Additives for use in cycling probe reactions | |
| Wahlberg et al. | Automated magnetic preparation of DNA templates for solid phase sequencing | |
| US5948649A (en) | Method for identifying nucleic acid sequences from different biological sources through amplification of the same | |
| US20020102660A1 (en) | Method for synthesis of nucleic acids | |
| WO1998011259A3 (en) | Composition, method and kit for detection and identification of sexually transmitted disease microorganisms | |
| US6156512A (en) | Allelic ladders for short tandem repeat loci | |
| US5393657A (en) | Detection of residual host cell DNA by PCR | |
| WO1996013608A3 (en) | Polynucleic acid sequences for use in the detection and differentiation of prokaryotic organisms | |
| EP0751226B1 (en) | Process for amplifying nucleic acid sequences | |
| EP1300473B1 (en) | Method of detecting nucleotide polymorphism | |
| JP4186269B2 (en) | Nucleic acid synthesis method | |
| Rudi et al. | Protocols for 16S rDNA array analyses of microbial communities by sequence‐specific labeling of DNA probes | |
| US6306592B1 (en) | Process for detecting and quantifying nucleic acid molecules |