WO1996012018A2 - Nouvelles immunophillines et acides nucleiques correspondants - Google Patents

Nouvelles immunophillines et acides nucleiques correspondants Download PDF

Info

Publication number
WO1996012018A2
WO1996012018A2 PCT/US1995/012632 US9512632W WO9612018A2 WO 1996012018 A2 WO1996012018 A2 WO 1996012018A2 US 9512632 W US9512632 W US 9512632W WO 9612018 A2 WO9612018 A2 WO 9612018A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
lys
glu
seq
gly
Prior art date
Application number
PCT/US1995/012632
Other languages
English (en)
Other versions
WO1996012018A3 (fr
Inventor
Suzanne H. Bourgeois Cohn
Gail A. Baughman
Original Assignee
The Salk Institute For Biological Studies
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Salk Institute For Biological Studies filed Critical The Salk Institute For Biological Studies
Priority to AU37616/95A priority Critical patent/AU3761695A/en
Publication of WO1996012018A2 publication Critical patent/WO1996012018A2/fr
Publication of WO1996012018A3 publication Critical patent/WO1996012018A3/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to novel immunophilin proteins and uses therefor.
  • novel immunophilin proteins can be employed for identifying compounds useful as i munosuppressive agents.
  • the present invention also relates to nucleic acids encoding the invention immunophilin proteins, antibodies specific for such proteins, and uses therefor.
  • FK-506 and cyclosporin A are potent immunosuppressive drugs that inhibit T-lymphocyte activation by selectively blocking transcription of early lymphokine genes. Drug action is mediated by binding to intracellular binding proteins. Although their effects upon T-lymphocyte activation are similar, FK-506 and CsA bind to distinct members of the immunophilin protein family.
  • FK-506 binding proteins FKBPs
  • Cyclophilins are members of a class of immunophilins that form complexes with CsA.
  • FKBP12 an abundant cytosolic immunophilin of M r 11,800. More recently, FKBP13 (Jin et al., Proc . Natl . Acad . Sci .
  • FKBP25 (Galat et al. , Biochemistry 31:2427-2434 (1991)) have been characterized as immunophilins that bind both FK-506 and rapamycin.
  • FKBP59 has been characterized as an immunophilin that binds to a 90 kDa heat shock protein (hsp90) and associates with steroid receptor complexes (Ruff et al., J . of Biol . Chem . 267:21285-21288 (1992)).
  • FKBP12.6 has been purified and characterized as the immunophilin most closely related to FKBP12 (Sewell et al., J . of Biol . Chem . 269:21094-21102 (1994)).
  • FKBP12 Of five FKBPs isolated and characterized, only two bind to FK-506 to form complexes which inhibit calcineurin. These are FKBP12 and FKBP12.6.
  • the phosphatase activity of calcineurin is a critical factor in the signal transduction pathway that leads to the expression of early lympokine genes, and activation of T-lymphocytes. Accordingly, the identification of FKBPs which bind FK-506 and (when complexed with ligand) inhibit calcineurin, will enable development of compounds which inhibit T-lymphocyte activation by selectively blocking transcription of early lymphokine genes.
  • FKBP12 and FKBP12.6 represent the only immunophilins to date that operate on a well defined pathway leading to clearly identified events that result in inhibition of T-cell activation.
  • the identification of additional immunophilins which are involved in a well defined pathway leading to clearly identified events that result in inhibition of T-cell activation would be of great value in the development of compounds which inhibit transcription of early lymphokine genes.
  • inventions allow the identification of compounds useful as immunosuppressive agents that prevent T-cell activation.
  • Invention immunophilin proteins are characterized by being predominantly expressed in T-cells and capable of inhibiting calcineurin phosphatase activity when bound to ligand.
  • the invention proteins are further characterized as corresponding to mRNAs induced by glucocorticoids.
  • nucleic acids encoding invention proteins and fragments thereof, antibodies specific for invention proteins and uses of invention nucleic acids and specific antibodies.
  • isolated mammalian immunophilin proteins characterized as being expressed predominantly in T-lymphocytes and capable of inhibiting the phosphatase activity of calcineurin when complexed with ligands.
  • invention proteins are further characterized as corresponding to mRNAs induced by glucocorticoids.
  • the proteins of the invention belong to a class of immunophilins designated FKBPs, i.e. they bind to the structurally related ligands FK-506 and rapamycin, as well as analogs thereof.
  • the present invention provides isolated glucocorticoid inducible nucleic acids encoding the mammalian immunophilin proteins of the invention.
  • Glucocorticoids and cyclic AMP induce dramatic biochemical and morphological changes in T-lymphocytes through unknown mechanisms.
  • a cDNA library was prepared from poly (A) RNA isolated from a glucocorticoid-sensitive murine thymoma cell line treated with glucocorticoids and forskolin, an agent which increases intracellular levels of cAMP.
  • the cell line used to construct the library is a thioguanine resistant derivative of a glucocorticoid-sensitive BALB/c murine thymoma cell line.
  • the thioguanine resistant cell line, designated WEHI-7TG, and the glucocorticoid sensitive cell line, designated EHI-7, are described by Bourgeois and Newby, (Cell 11:423-430 (1977)) and Harris et al. , (J . Immunol . 110:431-438 (1973)).
  • the cDNA library constructed in lambda vector, comprised 5x10 lambda recombinants.
  • the library was screened with a subtracted cDNA probe enriched for sequences induced by glucocorticoid/forskolin treatment of WEHI-7TG cells. Positive cDNA clones corresponding to mRNAs induced by this treatment were subjected to Northern analysis to verify that the positive cDNA clones represented genes induced by glucocorticoid and/or forskolin.
  • CXG56D3 cells are a variant of EHI-7TG cells selected for resistance to cAMP and dexamethasone by a two-step procedure described by Gruol et al., (J . Biol . Chem . 261:4904-4914 (1986)).
  • DNA probes for Northern analysis were prepared from cDNA inserts obtained from the previously described lambda cDNA library. Radioactive probes representing each lambda cDNA insert were hybridized to Northern blots of total cellular RNA. Thirteen positive clones were identified. These cDNA clones correspond to genes regulated by glucocorticoid and cAMP in the EHI-7TG cell line.
  • Clone 213 contained a cDNA insert of approximately 2.2kb.
  • a radiolabeled probe prepared from a fragment from the 5' end of the 2.2kb insert, was used to screen a murine thymus cDNA library for full length cDNAs.
  • a clone of approximately 3.5kb was isolated.
  • a second radiolabeled probe prepared from a fragment from the 5' end of the 3.5kb clone, was used to rescreen the murine thymus cDNA library.
  • a cDNA clone, designated 213-12A was obtained upon rescreening the murine thymus cDNA library.
  • Clone 213-12A represents a glucocorticoid inducible nucleic acid of the present invention.
  • the open reading frame of clone 213-12A was sequenced in its entirety.
  • the sequence of the coding strand which is 2226 nucleotides, is set forth in SEQ ID NO:l.
  • the amino acid sequence, from amino terminus to carboxyl terminus, is set forth in SEQ ID NO:2.
  • the protein has 456 amino acid residues and an M r of about 50,961.
  • the receptor-encoding cDNAs described herein can be employed to probe library(ies) (e.g., cDNA, genomic, and the like) for additional sequences encoding novel immunophilins.
  • Such screening is initially carried out under low-stringency conditions, e.g., a temperature of less than about 42°C, a formamide concentration of less than about 50%, and a moderate to low salt concentration.
  • One such set of screening conditions comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X standard saline citrate (SSC; 2OX SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0).
  • Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology for the identification of a stable hybrid.
  • the phrase "substantial similarity" refers to sequences which share at least 50% homology.
  • hybridization conditions will be selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe.
  • a human thymus library first with an 870 base pair fragment obtained from clone 213-12A (corresponding to nucleotides 463-1333 as shown in SEQ ID N0:1), then with a 561 base pair fragment derived from a different portion of clone 213-12A (corresponding to nucleotides 1-561 as shown in SEQ ID NO:l), led to the identification of a human clone corresponding to clone 213-12A.
  • the nucleotide sequence of a full length human clone corresponding to clone 213-12A, and the deduced amino acid sequence thereof is set forth in SEQ ID NO:3. See also Examples 9-11 herein.
  • Isolated glucocorticoid inducible nucleic acids of the present invention comprise (a) nucleic acids encoding the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:4; (b) nucleic acids that hybridize to the nucleic acids of (a) wherein said nucleic acids encode biologically active immunophilin proteins; or (c) nucleic acids which are degenerate with respect to either (a) or (b) wherein said nucleic acids encode biologically active protein.
  • nucleic acid refers to ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) .
  • DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a gene encoding an immunophilin protein of the invention.
  • nucleic acids can be produced by a variety of methods well known in the art, e.g. the methods described in Examples 1, 2, 3 and 9, and by PCR amplification using oligonucleotide primers from various regions of SEQ ID NO:l or SEQ ID NO:3.
  • Nucleic acids described herein are particularly useful for producing invention immunophilin proteins when such nucleic acids are incorporated into protein expression systems such as are known to those of skill in the art.
  • nucleic acids or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of related genes or mRNA transcripts.
  • the nucleic acids described herein, and fragments thereof are also useful as primers and/or templates in PCR reactions for amplifying genes encoding the immunophilin proteins described herein.
  • Proteins contemplated for use in the practice of the present invention can be produced recombinantly in suitable hosts, e.g. E. coli and the like.
  • suitable hosts e.g. E. coli and the like.
  • a cDNA encoding the open reading frame of an invention immunophilin protein obtained by PCR amplification of plasmid DNA, can be subcloned into a suitable vector such as pGEM-3X (Pharmacia) .
  • pGEM-3X Pharmacia
  • expression of recombinant protein can be induced using isopropyl ⁇ -D-thiogalactopyranoside.
  • the immunophilin protein product is isolated and purified utilizing affinity chromatography.
  • native immunophilin protein corresponding to the recombinately produced invention protein
  • native immunophilin protein can be isolated from thymus cell extracts and purified using a drug affinity column.
  • rapamycin a potent immunosuppressant known to bind invention proteins
  • the rapamycin affinity matrix can then be contacted with thymus cell extracts to obtain isolated native immunophilin protein, corresponding to invention protein.
  • Isolated immunophilin proteins of the present invention comprise protein having the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:4, as well as homologues and equivalents thereof (e.g. proteins which have substantially the same amino acid sequence and retain comparable functional and biological activity of the protein defined by the reference amino acid sequence) .
  • the present invention further includes peptide fragments of invention proteins which fragments retain the functional and/or biological activity of invention proteins.
  • antibodies raised against invention immunophilin proteins can be prepared employing standard techniques, as are well known to those of skill in the art, using invention proteins, or fragments thereof, as antigens for antibody production as described in Example 8.
  • Antibodies of the present invention are typically produced by immunizing a mammal with an inoculum containing an invention immunophilin protein, or fragment thereof, thereby inducing the production of antibody molecules having immunospecificity for the immunizing agent.
  • Invention antibodies can be used to block binding of ligands to invention immunophilin proteins and thereby reverse the inhibitory effect of such proteins on calcineurin phosphatase activity.
  • Antibodies to invention proteins can be obtained, for example, by immunizing New Zealand white rabbits with a suitable synthetic peptide fragment to which Tyr has been added at the C-terminus in order to couple it to KLH
  • BDB (BDB) linkage. Animals are immunized with the peptide coupled antigen and then bled two weeks post injection.
  • Antiserum is examined for its capacity to bind recombinant invention immunophilin protein in E. coli cells and endogenous immunophilin protein produced in EHI-7TG cells and thymus tissue. Antisera are then collected from the mammal and purified to the extent desired by well known techniques.
  • the enzymatic properties of the immunophilin proteins of the invention can be assessed using known methods. As described in Example 12, the assay of Fischer et al. (Nature 337:476-478 (1989)) was used to measure peptidyl prolyl cis-trans isomerization (PPIase) activity of recombinant immunophilin protein of the invention.
  • Immunophilin proteins of the invention are active catalysts of the PPIase reaction which employs N-succinyl-Ala-X-Pro-Phe-p-nitroanilide (SEQ ID NO:5) as a substrate, where X is Leu, Phe, Val or Ala.
  • invention protein is inhibited by rapamycin and FK-520.
  • affinity of invention protein for these drugs indicates that the immunophilin proteins of the invention could bind to the drugs at systemic concentrations (blood levels) achieved during clinical use of these drugs.
  • a competitive binding assay for identifying compounds which bind to immunophilin proteins of the invention.
  • the assay is conducted by contacting invention immunophilin protein with labeled immunosuppressive compound such as, for example, labeled FK-506, which is known to bind invention immunophilin protein, in the presence or absence of test compound. Thereafter, protein bound compound and unbound compound are separated and the amount of label associated with protein in the presence of test compound relative to the amount associated with protein in the absence of test compound is quantified.
  • Prescreening of potential candidate "ligands" for invention immunophilin proteins is preferably done with this binding assay prior to evaluation of such ligands in the calcineurin phosphatase inhibition assay.
  • the proteins of the invention are characterized by their ability, when complexed with immunosuppressive ligands, to inhibit calcineurin phosphatase activity. This inhibition is related to blockage of calcium associated events necessary for transcription of early lymphokine genes such as interleukin-2 (IL-2) .
  • IL-2 interleukin-2
  • IL-2 interleukin-2
  • IL-2 interleukin-2
  • a Ca * dependent signal is generated.
  • This Ca 2+ signal acti.vates calci.neuri.n, a protein phosphatase.
  • Activated calcineurin dephosphorylates the T-cell transcription factor, NF-AT, thereby activating transcription of IL-2.
  • proteins of the invention When proteins of the invention are complexed with suitable immunosuppressive ligands, such complexes have the ability to bind to calcineurin and inhibit its phosphatase activity. This results in the inhibition of lymphokine production which produces a compromised immune system.
  • invention immunophilin proteins are predominantly expressed in T-lymphocytes, such proteins can be utilized in screening for agents which are selective for T-cell mediated events. Agents identified by such methods should be less likely to exhibit adverse reactions than agents identified employing previously described immunophilin proteins which are ubiquitous in mammalian species.
  • identifying compounds capable of binding to invention proteins and inhibiting the phosphatase activity of calcineurin comprises independently contacting labeled phosphorylated substrate with test compound, increasing amounts of invention protein and sufficient amounts of calcineurin and calmodulin to produce reaction mixtures containing free labeled phosphate. Free labeled phosphate is then determined in each reaction mixture.
  • Test compounds capable of inhibiting calcineurin phosphatase activity will be those compounds which cause decreased production of free labeled phosphate in the presence of increasing amounts of invention protein.
  • Another such method comprises independently contacting labeled phosphorylated substrate with invention protein and with sufficient amounts of calcineurin and calmodulin to produce free labeled phosphate. Thereafter, the foregoing step is repeated in the further presence of test compound. The amount of free labeled phosphate generated in the presence of invention protein alone, relative to the amount generated in the further presence of test compound is determined. Test compounds capable of inhibiting calcineurin phosphatase activity will be those compounds which cause decreased production of free labeled phosphate.
  • FK-506 refers to 17-allyl-l, 14-dihydroxy-12-[2-(4-hydroxy-3-methoxycyclo- hexyl)-l-methylvinyl]-23,25-dimethoxy-13,19,21,27-tetra- methyl-11, 28-dioxa-4-azatricyclo[22.3.1.0*' 9 ]octacos- 18-ene-2,3,10,16-tetraone.
  • FK-520 refers to 17-ethyl-l,14-dihydroxy-12-[2-(4-hydroxy-3-methoxycyclo- hexyl)-1-methylvinyl]-23,25-dimethoxy-13,19,21,27-tetra- methyl-11,28-dioxa-4-azazatricyclo[22.3.1.0 4 ' 9 ]octacos- 18-ene-2,3,10,16-tetraone.
  • Moderately stringent hybridization employed in the present invention refers to conditions that permit target-DNA to bind a complementary nucleic acid that has about 60%, preferably about 75%, more preferably about 85%, homology to the target DNA; with greater than about 90% homology to target-DNA being especially preferred.
  • moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 65°C.
  • High stringency hybridization employed in the present invention refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65°C (i.e., if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein) .
  • Preferable, high stringency conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhart's solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.1X SSPE, and 0.1% SDS at 65°C.
  • Low stringency hybridization employed in the present invention refers to conditions equivalent to hybridization in 10% formamide, 5X Denhart's solution, 6X SSPE, 0.2% SDS at 42°C, followed by washing in IX SSPE, 0.2% SDS, at 50°C.
  • Denhart's solution and SSPE are well known to those of skill in the art as are other suitable hybridization buffers.
  • an alternate set of conditions suitable to accomplish low stringency hybridization comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X SSC.
  • the term “degenerate” refers to codons that differ in at least one nucleotide from a reference nucleic acid, e.g., SEQ ID NO:l, but encode the same amino acids as the reference nucleic acid.
  • codons specified by the triplets "UCU”, “UCC” , “UCA”, and “UCG” are degenerate with respect to each other since all four of these codons encode the amino acid serine.
  • a nucleic acid "probe” is single-stranded DNA or RNA, or analogs thereof, that has a sequence of nucleotides that includes at least 14, preferably at least 20, more preferably at least 50, contiguous bases that are the same as (or the complement of) any 14 or more contiguous bases set forth in any of SEQ ID NO:l or SEQ ID NO:3.
  • the entire cDNA encoding region of an invention protein may be used as a probe. Probes may be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits.
  • label and “labeling means” refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or labeling means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer.
  • Suitable fluorescent labeling agents are fluorochromes such as fluorescein isocyanate (FIC) , fluorescein isothiocyanate (FITC) , 5-dimethylamine-l-naphthalenesulfonyl chloride (DANSC) , tetramethylrhodamine isothiocyanate (TRITC) , lissamine, rhodamine 8200 sulfonyl chloride (RB-200-SC) , and the like.
  • fluorochromes such as fluorescein isocyanate (FIC) , fluorescein isothiocyanate (FITC) , 5-dimethylamine-l-naphthalenesulfonyl chloride (DANSC) , t
  • the labeling means can also be an enzyme, such as horseradish peroxidase (HRP) , glucose oxidase, and the like.
  • HRP horseradish peroxidase
  • additional reagents are required for the production of a detectable signal.
  • additional reagents for HRP include hydrogen peroxide and an oxidation dye precursor such as diaminobenzidine.
  • An additional reagent useful with glucose oxidase is 2,2'-azino-di-(3-ethyl-benzthiazoline-G-sulfonic acid) (ABTS) .
  • Radioactive elements are also commonly employed as labeling agents.
  • An exemplary radiolabeling agent is a radioactive element that produces gamma ray emissions.
  • Elements which emit gamma rays, such as I, I, I, I and Cr, represent one class of radioactive element indicating groups. Particularly preferred is I.
  • Another group of useful labeling means are those elements such as
  • positrons C, F, O and N which emit positrons.
  • the positrons so emitted produce gamma rays upon encounters with electrons present in the animal's body.
  • a beta emitter such as P, indium or H.
  • an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al., Meth . Enzymol . 73:3-46 (1981). Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable. See, for example, Aurameas et al., Scand. J. Immunol . Vol. 8, Suppl. 7:7-23 (1978), Rodwell et al., Biotech . 3:889-894 (1984) and U.S. Patent No. 4,493,795.
  • WEHI-7TG cells were used as the source of RNA for the construction of a cDNA library enriched in sequences induced by glucocorticoids.
  • WEHI-7TG is a thioguanine-resistant derivative of the glucocorticoid-sensitive BALB/c murine thymoma line WEHI-7 (Bourgeois and Newby, Cell 11:423-430 (1977); Harris et al., J . Immunol . 110:431-438 (1973)).
  • Cells are grown in Dulbecco modified Eagle medium supplemented with 10% fetal calf serum (GIBCO Laboratories, Grand Island, N.Y.).
  • WEHI-7TG cells were treated for 5 hours with 1 mM tria cinolone acetonide and 12 mM forskolin (an agent which increases intracellular levels of cAMP) .
  • Total cellular RNA was extracted from cells and BALB/c mouse tissues according to the single step method of RNA isolation by acid guanidinium thiocyanate -phenol- chloroform extraction described by Chomczynski and Sacchi (Anal. Biochem 162:156-159 (1987)).
  • Poly (A) + RNA was isolated by affinity chromatography on oligo (dT) cellulose by standard procedures.
  • Double-stranded cDNA was synthesized from poly (A) + RNA using the Amersham cDNA synthesis kit (Amersha Corp.) The cDNA was methylated prior to ligation with EcoRI linkers to protect internal EcoRI sites. After removal of excess linkers, a portion of the cDNA was inserted into ⁇ ZAP vectors (Stratagene) to produce a library of 5 x 10 independent recombinants. The unamplified library was plated at 50,000 pfu (plaque forming units) per 150 mm dish in 0.7% top agarose supplemented with 30% glycerol, and filter lifts were prepared with Hybond-N (Amersham Corp.). The plates were stored at -70°C.
  • Single-stranded [ 32P] cDNA was prepared using poly (A) * RNA isolated from WEHI-7TG cells treated with triamcinolone acetonide and forskolin as described above.
  • the first strand synthesis reaction mixture was modified to contain 0.5 mM each of dATP, dGTP, and dTTP, 0.1 mM dCTP, 50 mg of actinomycin D per ml, and 200 mCi of [ ⁇ - P] dCTP (3,889 Ci/mmol) .
  • the template RNA was removed by incubation in 0.2 N NaOH at 70°C for 20 minutes.
  • the reaction was neutralized with HC1, and the cDNA was ethanol precipitated in the presence of 2.5 M ammonium acetate.
  • the specific activity of the cDNA was approximately 1 x 10 8 to 2 x 108 cpm/mg.
  • the [32P] cDNA was hybridized to a 40-fold mass excess of poly (A) * RNA from uninduced CXG56D3 cells.
  • CXG56D3 is a variant of WEHI-7TG resistant to both glucocorticoids and cAMP.
  • Hybridization was performed at a R 0 t of 1,000 (mol/liter) x sec. in 0.5 M sodium phosphate buffer (pH 7), 0.1% sodium dodecyl sulfate (SDS) and 1 mM EDTA (ethylenediaminetetraacetic acid) .
  • Unhybridized cDNA was collected by hydroxylapatite chromatography (Bio-Rad) in 0.12 M phosphate buffer-0.1%
  • Library filters prepared as described in Example 1 were hybridized at 42°C in a solution containing the radiolabeled cDNA subtraction probe (prepared as described in Example 2) in 50% formamide, 5 x SSPE (1 x SSPE is 0.18 M NaCl, 0.01 M NaHP0 4 , 1 mM EDTA), 0.5% SDS, 5% (wt/vol) dextran sulfate, 7 x Denhardt solution (1 x Denhardt solution is 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin) , and 200 mg of denatured salmon sperm DNA per ml.
  • Total cellular RNA was prepared from untreated CXG56D3 cells, untreated WEHI-7TG cells, WEHI-7TG cells treated for 5 hours with either dexamethasone (1 mM) , forskolin (12 mM) , or both drugs in combination, or from BALB/c mouse tissues (brain, heart, kidney, liver, lung, spleen, and thymus) according to the procedure described in Example 1.
  • the RNA (10 mg) was fractionated in 1% agarose gel containing 2.2 M formaldehyde and transferred to Hybond-N. The resulting filters were hybridized with radioactive [ P] labeled probe prepared from each insert.
  • Hybridization was carried out at 42°C in 50% formamide, 0.5 M sodium phosphate buffer (pH 7.2), 1 mM EDTA, 1% bovine serum albumin and 5% SDS. Filters were washed in 0.3 x SSPE-0.1% SDS at 65°C and exposed to Kodak XAR film at -70°C. cDNA clones were identified that represent 13 different glucocorticoid- and cAMP- regulated genes in the WEHI-7TG cell line (Harrigan et al., Mol . Cell . Biol . 9:3438-3446 (1989); Baughman et al., Mol . Endocrinol . 5:637-644 (1991)).
  • clone 213 represents an approximately 3.5 to 4 kb mRNA that is induced by glucocorticoids and slightly repressed by forskolin in the WEHI-7TG cell line and expressed predominantly in thymus tissue.
  • Clone 213 contained a cDNA insert of approximately 2.2 kb. Sequence determination and analysis was performed by the dideoxy chain termination method (Sanger et al., Proc . Natl . Acad. Sci . USA 74:5463-5467 (1977)) using the Sequenase DNA sequencing kit (US Biochemicals) and commercial primers for the pBluescript (SK-) vector. Preliminary sequence data was obtained by sequencing one strand from each end of the cDNA insert to determine if the sequence gene is a new or previously described gene. The presence of a poly(A) tail confirmed that the cDNA insert originated from the 3' portion of the corresponding mRNA.
  • GenBank version 65 nucleotide data base was searched using the FASTA program of Pearson and Lip an (Proc. Natl . Acad . Sci . USA 85:2444-2448 (1988). Search results failed to identify any sequences having significant similarity.
  • an approximately 600 base pair fragment from the 5' end of the 3.5kb clone was isolated by restriction enzyme digestion with Sad, gel purified, radiolabeled with P, and used as a hybridization probe to rescreen the same library.
  • the nucleotide sequence of clone 213-12A contains 2226 nucleotides (see SEQ ID NO:l) .
  • Computer analysis of clone 213 reveals the presence of an open reading frame (ORF) encoded by nucleotides 161 - 1528, as shown in SEQ ID NO:l.
  • ORF open reading frame
  • Analysis of this open reading frame reveals a protein of 456 amino acid residues with a molecular weight of about 50,969 Da and a pKi of 7.8.
  • the amino acid sequence, from amino to carboxyl terminus, is shown in SEQ ID NO:2.
  • Searches of the SwisProt data base using the FASTA program reveal that the deduced protein is a member of the family of proteins (FKBPs) that bind immunosuppressive drugs FK-506 and rapamycin.
  • FKBPs family of proteins
  • Uncapped RNA corresponding to the cDNA insert of clone 213-12A was synthesized in vitro using Riboprobe transcription system (Promega Corporation) and the pBluescript(SK-) vector-encoded T3 or T7 transcription initiation control regions.
  • the RNA was incubated in a rabbit reticulocyte lysate (Promega Corporation) in the presence of 7.5 mCi [ 5 S] methionine (1053 Ci/mmol, Amersham Corp.) and the translation products were visualized by separation on 10% SDS-polyacrylamide gels followed by treatment with Fluorohance (Research Products International) , drying, and autoradiography. A protein product corresponding to the open reading frame of clone 213-12A was detected.
  • the protein migrated at an apparent molecular weight of approximately 51 kDa.
  • a cDNA corresponding to the open reading frame of clone 213-12A was expressed in E. coli using the pGEM-3X (Pharmacia) vector that produces proteins in E . coli with an amino terminal glutathione S-transferase (GST) tag that allows purification of the recombinant protein by glutathione sepharose affinity chromatography.
  • GST glutathione S-transferase
  • the pGEM-3X vector also contains a protease factor Xa cleavage recognition site which permits removal of the glutathione S-transferase tag from the recombinant protein after purification.
  • cDNA corresponding to the open reading frame of clone 213-12A was amplified by PCR technology using suitable primers that include restriction digestion sites for subcloning into the pGEM-3X vector.
  • the forward primer [CGGGATCCGGACAATGACTACTGATGAG, 28-mer; SEQ ID NO:8] contains a BamHI restriction site 5' to 5 nucleotides which precede (1) the translational initiation site (ATG) of the open reading frame, and (2) the sequence corresponding to the first 4 amino acids of the protein.
  • SEQ ID NO:9 contains an EcoRI restriction site 5' to 2 nucleotides which precede (1) the sequence complementary to the stop codon for translation (TCA) and (2) the last ⁇ 5 nucleotides of the open reading frame.
  • the cDNA was amplified using these primers in a thermocycler (EriComp) under the following cycle conditions: 5 min initial denaturation at 94°C, followed by 35 cycles of 30 sec primer annealing at 60°C, 1 minute extension at 72°C, and 30 sec. denaturation at 94°C, followed by a final extension at 72°C for 10 minutes.
  • the amplified product was purified by agarose gel electrophoresis, digested with EcoRI and BamHI, repurified by electrophoresis and cloned into EcoRI-BamHI digested pGEM-3X vector DNA.
  • the resultant recombinant plasmid was transformed into BL21 E . coli cells and selected by ampicillin resistance.
  • An ampicillin-resistant transformed colony was inoculated into 500 ml Terrific Broth (Gibco BRL) containing 100 mg ampicillin per ml and grown with aeration at 37°C until the culture reached an optical density at 600 nm of 0.5.
  • IPTG isopropyl-b-D-thiogalactopyranoside
  • the resulting cell pellet was washed with 1 x PBS containing 5 mM MgCl 2 , repelleted as described above and then resuspended in 20 ml lysis buffer containing 50 mM Tris HC1 (pH 7.9), 100 mM KCl, 1% Triton X-100, 12.5 mM MgCl 2 , 10 mM dithiothreitol (DTT) , 0.1 mM phenylmethylsulfonylfluoride (PMSF) , 2 mg/ml benzamidine, 1 mg/ml pepstatin A, 4 mg/ml leupeptin, lOmg/ml aprotonin, and 20 mg/ml soybean trypsin inhibitor.
  • the cells were lysed by 3 cycles of freeze-thawing in dry ice, followed by clearing of the lysate by centrifugation (100,000g, 30 minutes, 4°C) .
  • Recombinant protein in the lysate was bound to Glutathione Sepharose 4B (Pharmacia, 2 ml beads per 500 ml culture) by batch incubation at 4°C for 2 hours with rotation. Sepharose beads containing the bound protein were collected by centrifugation (400g, 5 minutes, 4°C) and washed at 4°C with 3 volumes of wash buffer per ml of beads, as follows: Wash I: 1 x PBS, 0.1% Triton X-100, 2 mM DTT,
  • Wash II 0.3 M NaCl, 50 mM Tris HCl (pH 7.9), 2 mM DTT, 0.1 mM PMSF; and Wash III: same as Wash I.
  • the beads were collected between washes by centrifugation (400 g, 5 minutes, 4°C) .
  • Purified recombinant protein was eluted from the beads by incubation for 5 minutes at 4°C in 50 mM Tris HC1 (pH 7.9), 10 mM glutathione, 2 mM DTT, and 0.1 mM PMSF.
  • factor Xa cleavage buffer Tris HC1 (pH 8.0), 100 mM NaCl, 1 mM CaCl 2
  • factor Xa cleavage buffer containing 1% mass ratio of factor Xa (Prozyme Inc.) to recombinant protein for 2 hours at room temperature, with rotation.
  • This alternate procedure resulted in recombinant protein containing 4 non-native amino acids at the amino terminus. Both protein products were analyzed on SDS-polyacrylamide gel electrophoresis. The recombinant protein and the factor Xa cleaved protein migrated at apparent molecular weights of 79 and 51 kDa, respectively.
  • Polyclonal rabbit antisera specific for protein encoded by cDNA corresponding to the open reading frame of clone 213-12A was prepared against a synthetic peptide coupled to KLH (Pierce Chemical Company) .
  • the synthetic peptide had the amino acid sequence YGESQAMEEGKAKGHV (SEQ ID NO:10), which corresponds to the 14 carboxyl terminal amino acids residues of the amino acid sequence shown in SEQ ID NO:2, plus two residues (YG) important for coupling.
  • the peptide was synthesized according to manufacturer's protocol on the Synergy peptide synthesizer (Applied Biosystems) .
  • BDB reagent was removed following coupling by dialysis against 0.9% NaCl.
  • New Zealand white rabbits were injected subcutaneously at 3 week intervals with 0.5 mg (injections 1,2, and 3) or 0.25 mg (injections 4 and 5) coupled peptide in Freunds complete (injection 1) or incomplete (injections 2-5) adjuvant.
  • Bleeds were taken 2 weeks post injection, the blood allowed to clot, and the serum collected by centrifugation (500g, 10 minutes) .
  • the antisera were used in Western analyses to detect the recombinant immunophilin protein produced in E . coli cells and the endogenous protein produced in WEHI-7TG cells and thymus tissue, which protein corresponds to the amino acid sequence shown in SEQ ID NO:2.
  • Murine tissues (brain, heart, kidney, liver, lung, spleen and thymus) were excised, frozen in liquid nitrogen, and disrupted by homogenation in a lysis buffer containing 25 mM Tris HCl (pH 7.5), 5 mM DTT, 50 mM NaF, 2 mM PMSF, and 0.015% Triton X-100 using a Polytron (Brinkman Instruments) . Tissue extracts were clarified by centrifugation (20,000g, 30 minutes, 4°C) . Protein concentrations were determined by the Coomassie Blue dye binding assay (Bio-Rad protein assay) .
  • Extract proteins (50 ⁇ g) were heated in 1 x SDS sample buffer for 2 minutes at 90°C followed by separation on a 10% SDS-PAGE. The resolved proteins were transferred to nitrocellulose (BA85, Schleicher and Schuell) using a semidry transfer apparatus (LKB) in 1 x SDS gel running buffer containing 20% methanol at 1mA per cm for 1 hour. The filters were blocked in 1 x PBS containing 5% powdered milk overnight at 4°C, followed by incubation with 213-peptide specific antisera (1:500 dilution) in 1 x PBS containing 1% powdered milk for 2 hours at room temperature.
  • LLB semidry transfer apparatus
  • the filters were incubated with alkaline phosphatase conjugated goat anti-rabbit IgG (BioRad) at a 1:7500 dilution for 1 hour at room temperature in 1 x PBS containing 1% powdered milk.
  • the filters were washed, first with 1 x PBS containing 0.05% Tween-20 and then with 1 x PBS alone.
  • the immobilized antibody complexes were detected by a colori etric assay using the NBT/BCIP color development reagent (BioRad) .
  • the peptide antisera prepared in this Example specifically recognize the recombinant immunophilin protein produced in E . coli, and the invention protein present in WEHI-7TG cells and predominant in thymus tissue.
  • Clontech human thymus 5'-stretch ⁇ gtll cDNA library (Catalog #HL1074b) was used as a source of human cDNA clones corresponding to the mouse immunophilin protein encoded by clone 213-12A.
  • the library (2.25 x 10 6 representatives) was plated at 75,000 pfu (plaque forming units) per 150 mm dish according to the instructions provided by the manufacturer and filter lifts were prepared with Hybond-N (Amersham Corp.).
  • An 870 base pair fragment corresponding to nucleotides 463-1333 as shown in SEQ ID NO:l was isolated by Bglll restriction enzyme digestion, gel purified and radiolabeled with [ 32 P] dATP to 1-2 x 10 9 cpm/ ⁇ g using the Multiprime DNA labeling kit (Amersham Corp.) . Hybridization to the above filters was carried out at 42°C in 50% formamide, 0.25 M NaHP0 4 (pH 7.2), 0.25 M NaCl, 1 mM EDTA, 7% SDS, and 100 ⁇ g/ml denatured salmon sperm DNA for 20 hours.
  • Human cDNA inserts were isolated from purified plaques giving a positive hybridization signal using protocols designed to obtain DNA from lambda lysates as described by the manufacturer (Clontech) .
  • Y1090r ' bacterial host cells were incubated at 37°C overnight in 15 ml of LB broth (pH 7.5) containing 10 mM MgS0 4 and 0.2% maltose. The cells were then pelleted, and resuspended in 10 mM MgS0 4 , then stored at 4°C for a maximum of 2-3 days before use.
  • the ratio of phage to bacterial host must be empirically determined. Typically, a yield of 100-200 ⁇ g of phage DNA can be expected from 500 ml of phage lysate.
  • An appropriate number of lytic phage (typically 600-800 plaques per 90-mm plate) are plated in the presence of 200 ⁇ l of host cells, so that a single plaque can be easily removed. The plates are then incubated overnight at 37°C. An agar plug containing a single plaque is transferred to a microfuge tube containing 200 ⁇ l of IX lambda dilution buffer. Transfer is accomplished, for example, with the end of a pasteur tube.
  • IX lambda dilution buffer Ten ml of IX lambda dilution buffer is then added to the plate, and incubated at 4°C overnight. A few drops of chloroform are then added to the plate, which is swirled briefly. The liquid is then poured from the plate into a sterile 50 ml polypropylene tube. Two ml of chloroform are then added to the plate lysate, which is then vortexed for ⁇ 2 min. Sample is then centrifuged at -7,200 xg for -10 min.
  • the high titer stock ssuuppeerrnnaattaanntt ((wwhhiicchh sshhoouulldd hhaa ⁇ ve a titer of about 10 pfu/ml) is then collected and saved.
  • Lysate dilutions are then prepared from the high titer stock such that approximately 10 pfu/ml are obtained on each 150-mm LB agarose plate containing 10 mM MgS0 4 .
  • a single, isolated colony is picked from an E. coli Y1090r " host cell plate and used to inoculate LB broth containing 10 mM MgS0 4 and 0.2% maltose. This is then incubated on the shaker at -200 rpm at 37°C overnight.
  • the appropriate number of tubes are then set up with 600 ⁇ l of bacterial culture and diluted lysate. This is then incubated in a 37°C water bath for -15 min.
  • IX lambda dilution buffer 12 ml of IX lambda dilution buffer is added to each plate, and the plates stored at 4°C overnight. The plates are then incubated at room temperature for 1 hr with constant shaking. The IX lambda dilution buffer solution is removed and saved; and the plate surface is rinsed with an additional 2 ml of IX lambda dilution buffer. The lambda dilution buffer solutions are pooled. This is the plate lysate.
  • 1-3 ml of phage stock (1-3 x 10 pfu) are added to 1 L of host cells grown in LB broth to an OD 500 of 0.6.
  • the culture is shaken at 37°C in a 4-L flask until lysis is apparent (6-10 hr, depending upon the vector) .
  • 10 ml of chloroform are added, and the flask shaken for an additional 15 min.
  • the flask is removed from the shaker.
  • the lysate is centrifuged at -7,200 xg for -10 min at 4°C in polypropylene bottles. The supernatants are combined, and titer checked. This is the liquid lysate which is now ready for DNA extraction.
  • the ratio of phage to bacteria should be increased. If lysis appears complete within 2-3 hr, the ratio of phage to bacteria is too high, and the bacterial population has been lysed prematurely. If lysis occurs too quickly, the above steps should be repeated.
  • the bottled, pooled lambda dilution buffer solutions (obtained either from plate or liquid lysates) are centrifuged at -10,000 xg for 10 min in order to pellet debris.
  • DNase 1 is added to the supernatant to 1 ⁇ g/ml and RNase A is added to 5 ⁇ g/ml.
  • the resulting mixture is incubated at room temperature for 30 min. 100% chloroform is then added to a final concentration of 5%, and the solution vortexed for 30 sec. Sample is then centrifuged at -10,000 xg for 10 min at 4°C to pellet the debris.
  • the aqueous phase is transfered to a new centrifuge tube.
  • An equal volume of 20% PEG/2.0 M NaCl is added to the aqueous phase, which is incubated on ice for at least 1 hr.
  • Sample is then centrifuged at -10,000 xg for 10 min at 4°C to pellet the phage.
  • the precipitated phage are then centrifuged at -10,000 xg for 15 min at 4°C, and the supernatant discarded.
  • a grayish smear should be evident on the side of each bottle.
  • the pellets are resuspended in 32 ml of IX lambda dilution buffer.
  • the phage suspension is then transfered into two 50-ml polypropylene tubes, and an equal volume of chloroform added.
  • the resulting mixture is then vortexed for 30 sec, then centrifuged at -7,200 xg for 10 min. The supernatant is collected, being careful to leave the PEG interface behind.
  • 0.5 g of CsCl are added per ml of phage suspension, which is then poured into a 40-ml UltraClearTM tube, and centrifuged at -90,000 xg for 2 hr at 20°C. The supernatant is poured off, and the clear, sticky phage pellet resuspended in 1 ml of IX lambda dilution buffer. The resulting mixture is then transfered to a 1-ml microcentrifuge tube, and debris spun down at 15,000 rpm for 10 min.
  • EDTA is added to the phage DNA to 20 mM, SDS to 0.5%, and proteinase K to 50 ⁇ g/ml final concentrations.
  • the resulting mixture is then incubated at 65°C for 1 hr.
  • An equal volume of phenol:chloroform is added, and the solution mixed by gentle inversion for 10 min.
  • the resulting mixture is then centrifuged at 7,000 rpm for 10 min at room temperature (or for 5 min in a microcentrifuge for smaller volumes) .
  • the supernatant is collected, and the above steps are repeated until the interface is clean (usually one extraction is suf icient) .
  • the pellet is allowed to dry until the edges of the pellet begin to turn clear. If the DNA is not completely dry, it will resuspend well in TE buffer. If the DNA is dry, 1 ml of TE buffer should be added, and the pellet allowed to resuspend at 4°C overnight.
  • the DNA should form a sharp band on an agarose gel with some contaminating RNA.
  • RNase A can be added along with restriction enzymes, thus eliminating an additional digestion.
  • a spectrophotometer reading should give characteristic curves, with a maximum absorption at 260 nm.
  • the A 260/280 ratio should be >1.8.
  • E . coli host cells selected by ampicillin resistance, and positive clones identified by restriction enzyme analysis.
  • Clone Hm51-35 was identified to contain an approximately 2.3 kb human cDNA insert.
  • the nucleotide sequence of approximately 1619 base pairs of this clone was determined by automated sequence analysis (Applied Biosystems) using a succession of synthetic primers employing well known gene-walking methodology.
  • the peptidyl-propyl isomerization activity o recombinant invention immunophilin protein is measure using an assay described by Fischer et al...
  • the Fischer assay measures th immunophilin catalyzed cis-trans isomerization of a N-succinyl-Ala-Ala-Pro-Phe-p-nitroanilide (SEQ ID NO:6) substrate by coupling the reaction to the specific cleavage of the trans isoform of the substrate and release of p-nitroanilide by chymotrypsin.
  • SEQ ID NO:6 N-succinyl-Ala-Leu-Pro-Phe-p-nitroanilide
  • chymotrypsin is used at a concentration of 6 ⁇ VL.
  • Release of p-nitroanilide by chymotrypsin is quantified by measuring the increase in absorbance at 405 nm by spectroscopy.
  • Protein concentrations of stock solutions of the recombinant invention immunophilin protein are determined by the Coomassie Blue dye binding assay (BioRad). Increasing concentrations (0.5-5 mg/ml) of the protein are added to a reaction mixture (1.5 ml) containing substrate 0.1 M Tris-HCl (pH 7.8). The mixture is incubated at 15°C for 15 minutes, followed by addition of chymotrypsin. The generated data are fitted to a simple first-order rate equation.
  • Inhibition of PPIase activity is performed in the presence of increasing concentrations (l-iooo nM) of the immunosuppressant drugs, i.e. rapamycin and FK-520. Assays are performed as described above except that the amount of recombinant protein is kept constant (7.5 mg) .
  • the recombinant invention immunophilin protein exhibits PPIase activity which is inhibited by immunosuppressive drugs such as rapamycin and FK-506 like compounds.
  • Binding and displacement of [ H] dihydro FK-506 from invention immunophilin protein is measured by a modification of the LH-20 method (Handschumacher et al., Science 226:544-547 (1984)). Reaction mixtures (100 ⁇ l) containing at least 1 nM invention immunophilin protein and 34
  • Radioactivity in the unfractionated portion B (representing total bound and free) and the eluted material from portion A are quantified by liquid scintillation counting to obtain values of relative drug binding.
  • Drug and protein concentration dependent binding of [ H] dihydro FK-506 to invention immunophilin is observed in this assay.
  • phosphatase activity of calcineurin is determined in a modified assay described by Liu et al., Cell 66:807-815 (1991) and Manalan and Klee, Proc. Natl . Acac . Sci . USA 80:4291-4295 (1983) in which a phosphorylated peptide fragment (RII) from the regulatory subunit of cAMP-dependent kinase acts as substrate.
  • RII phosphorylated peptide fragment
  • Reaction mixtures (60//1) containing 40 mM Tris-HCl (pH 7.5), 100 mM NaCl, 6 mM MgCl 2 , 0.1 mM CaCl 2 , 0.1 mg/ml BSA, 0.5 mM DTT, 0.1 ⁇ g bovine brain calmodulin (Sigma Chemical Company) , 0.05 units bovine brain calcineurin, 30 ⁇ M FK-520 and increasing concentrations of recombinant invention immunophilin protein (0.1 nM to 10 ⁇ l ) are incubated at 30°C for 30 minutes prior to addition of phosphorylated substrate peptide.
  • Reactions are initiated by addition of the peptide (40 ⁇ M [ P] RII peptide (432 cpm/pmol) , and the dephosphorylation reaction is allowed to proceed for 10 minutes at 30°C. Reactions are terminated by the addition of 0.5 ml of 5% trichloroacetic acid containing 100 mM sodium phosphate (stop buffer) and applied to 0.5 ml Dowex AG 50W-X8,H * column. Free [ P] phosphate is eluted from the column with 0.5 ml of stop buffer and quantified by liquid scintillation counting.
  • SEQ ID NO:l is the nucleic acid sequence and the amino acid sequence of cDNA encoding a murine-derived immunophilin protein of the present invention.
  • SEQ ID NO:2 is the amino acid sequence of an immunophilin protein of the present invention encoded by SEQ ID NO:l.
  • SEQ ID NO:3 is the nucleic acid sequence and the amino acid sequence of cDNA encoding an human-derived immunophilin protein of the present invention.
  • SEQ ID NO: 4 is the amino acid sequence of the immunophilin protein of the present invention encoded by SEQ ID NO:3.
  • SEQ ID NOs:5, 6 and 7 are substrates for immunophilin catalyzed cis-trans isomerization reactions.
  • SEQ ID NOS:8 and 9 are forward and reverse PCR primers, respectively, for amplification of the open reading frame of clone 213-12A.
  • SEQ ID NO:10 is the amino acid sequence of a synthetic peptide used for the preparation of polyclonal rabbit antisera specific for protein encoded by clone 213-12A.
  • ADDRESSEE Pretty, Schroeder, Brueggemann & Clark
  • MOLECULE TYPE DNA (genomic)
  • IMMEDIATE SOURCE
  • AAA AGA GTG GGG ACT AGT GAC GAG GCC CCA ATG TTT GGT GAC AAA GTT 319 Lys Arg Val Gly Thr Ser Asp Glu Ala Pro Met Phe Gly Asp Lys Val 40 45 50
  • AGT CAT GAC AGA AAG AAG CCA TTT GCC TTT AGC CTT GGC CAA GGC CAG 415 Ser His Asp Arg Lys Lys Pro Phe Ala Phe Ser Leu Gly Gin Gly Gin 70 75 80 85
  • GCT GGC AAA CAA CAC GAG AGT CAG GCC ATG GAA GAA GGA AAG GCC AAA 1519 Ala Gly Lys Gin His Glu Ser Gin Ala Met Glu Glu Gly Lys Ala Lys 440 445 450 GGC CAT GTA TGACGCTGCG CCACGGAGGG AAGAGAGTCC TAATGAACTC 1
  • Trp Glu Met Asp Thr Lys Glu Lys Leu Thr Gin Ala Ala He Val Lys 260 265 270
  • MOLECULE TYPE DNA (genomic)
  • GAG GCC AAT AAA GCA ATG GGC AAG AAG ACT TCA GAA GGG GTC ACT AAT Glu Ala Asn Lys Ala Met Gly Lys Lys Thr Ser Glu Gly Val Thr Asn 425 430 435
  • Trp Glu Met Asp Thr Lys Glu Lys Leu Glu Gin Ala Ala He Val Lys 260 265 270

Abstract

La présente invention concerne de nouvelles protéines d'immunophillines exprimées en prépondérance par des lymphocytes T. Ces protéines appartiennent à la classe des protéines de liaison de FK-506 (FKBP), et sont capables de se lier à la FK-506 (ou à ses analogues) et à la rapamycine. Ces protéines inhibent l'activité calcineurine phosphatase lorsqu'elles sont liées à un ligand, et leur ARNm est induit par des glucocorticoïdes (la dexaméthazone par exemple). Ces protéines ont une activité peptidyle-prolyle cis/trans isomérase. L'invention concerne également le codage des acides nucléiques pour ces immunophilines, des anticorps contre ces immunophilines et leur utilisation dans cette perspective, par exemple pour identifier ou détecter des composés utiles en tant qu'agents immunodépresseurs.
PCT/US1995/012632 1994-10-14 1995-09-28 Nouvelles immunophillines et acides nucleiques correspondants WO1996012018A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU37616/95A AU3761695A (en) 1994-10-14 1995-09-28 Novel immunophilins and corresponding nucleic acids

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US32336794A 1994-10-14 1994-10-14
US08/323,367 1994-10-14
US44128595A 1995-05-15 1995-05-15
US08/441,285 1995-05-15

Publications (2)

Publication Number Publication Date
WO1996012018A2 true WO1996012018A2 (fr) 1996-04-25
WO1996012018A3 WO1996012018A3 (fr) 1996-06-20

Family

ID=26983919

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/012632 WO1996012018A2 (fr) 1994-10-14 1995-09-28 Nouvelles immunophillines et acides nucleiques correspondants

Country Status (2)

Country Link
AU (1) AU3761695A (fr)
WO (1) WO1996012018A2 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1135149A1 (fr) * 1998-12-01 2001-09-26 Dana-Farber Cancer Institute Pgc-1: un coactivateur du recepteur ppar gamma des tissus adipeux bruns
JP2010521419A (ja) * 2007-01-29 2010-06-24 ワイス エルエルシー イムノフィリンおよびカルシウムチャネル活性を調整するためのイムノフィリンリガンドおよび方法
US7883855B2 (en) 2006-07-21 2011-02-08 Abbott Laboratories Immunosuppressant drug extraction reagent for immunoassays
US7914999B2 (en) 2006-12-29 2011-03-29 Abbott Laboratories Non-denaturing lysis reagent
US7993851B2 (en) 2006-12-29 2011-08-09 Abbott Laboratories Lysis reagent for use with capture-in-solution immunoassay
US8129127B2 (en) 2006-12-29 2012-03-06 Abbott Laboratories Assay for immunosuppressant drugs
US8221986B2 (en) 2006-12-29 2012-07-17 Abbott Laboratories Diagnostic test for the detection of a molecule or drug in whole blood

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992018527A1 (fr) * 1991-04-09 1992-10-29 Children's Research Institute Analyse de detection de la rapamycine
FR2688227A1 (fr) * 1992-03-04 1993-09-10 Inst Nat Sante Rech Med Proteines formant des complexes avec des chaperones et leurs ligands, leurs fragments, leur obtention et leurs applications biologiques.
WO1993023548A2 (fr) * 1992-05-20 1993-11-25 Vertex Pharmaceuticals Incorporated Procede de detection d'arn messagers codant la proteine de liaison fk506 a specificite tissulaire et ses utilisations
WO1993025533A1 (fr) * 1992-06-05 1993-12-23 Abbott Laboratories Procedes et reactifs pour le dosage d'immnosuppresseurs
WO1994015964A1 (fr) * 1993-01-15 1994-07-21 Dana-Farber Cancer Institute, Inc. PROTEINE DE LIAISON D'ADN DE LYMPHOCYTE T ACTIVE, NF-AT¿p?

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992018527A1 (fr) * 1991-04-09 1992-10-29 Children's Research Institute Analyse de detection de la rapamycine
FR2688227A1 (fr) * 1992-03-04 1993-09-10 Inst Nat Sante Rech Med Proteines formant des complexes avec des chaperones et leurs ligands, leurs fragments, leur obtention et leurs applications biologiques.
WO1993023548A2 (fr) * 1992-05-20 1993-11-25 Vertex Pharmaceuticals Incorporated Procede de detection d'arn messagers codant la proteine de liaison fk506 a specificite tissulaire et ses utilisations
WO1993025533A1 (fr) * 1992-06-05 1993-12-23 Abbott Laboratories Procedes et reactifs pour le dosage d'immnosuppresseurs
WO1994015964A1 (fr) * 1993-01-15 1994-07-21 Dana-Farber Cancer Institute, Inc. PROTEINE DE LIAISON D'ADN DE LYMPHOCYTE T ACTIVE, NF-AT¿p?

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
BIOCHEM.- BIOPHYS. RES. COMMUN., vol. 192, no. 3, 1993 pages 1388-1394, ASAMI ET AL. 'Detection of the FK-506-FKBP-calcineurin complex by a simple binding assay' *
BIOCHEMISTRY, vol. 31, no. 16, 1992 pages 3896-3901, LIU ET AL. 'Inhibition of T cells signaling by immunophilin-ligand complexes correlates with loss of calcineurin phosphatase activity' *
BIOCHEMISTRY, vol. 33, no. 35, 6 September 1994 pages 10666-10671, TAI ET AL. 'Potentiation of progesterone receptor-mediated transcription by the immunosupressant FK 506' *
CELL, vol. 66, 23 August 1991 pages 807-815, LIU ET AL. 'Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes' cited in the application *
CLIN. CHEM., vol. 39, no. 6, 1993 page 1230 MURTHY ET AL. 'Identification of a 14 KDa immunophilin from calf thymus which binds to both rapamycin and FK506 (distinct from 10-12 KDa FK-506 binding protein.' *
J. EXP. MED., vol. 176, no. 3, September 1992 pages 751-760, DUMONT ET AL. 'The immunosuppressive and toxic effects of FK-506 are mechanistically related : pharmacology of a novel antagonist of FK-506 and rapamycin' *
J. IMMUNOLOGY, vol. 150, no. 7, 1 April 1993 pages 2591-2598, DUTZ ET AL. 'A role for calcineurin in degranulation of murine cytotoxic T lymphocytes' *
JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, no. 30, 1992 pages 21753-21760, WIEDERRECHT ET AL. 'Characterization of high molecular weight FK-506 binding activities reveals a novel FK-506-binding protein as well as a protein complex' *
JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 269, no. 30, 29 July 1994 pages 196109-19616, PARSONS ET AL. 'Regulation of calcineurin phosphatase activity and interaction with FK-506/FK-506 binding protein complex' *
JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 269, no. 33, 19 August 1994 pages 21094-21102, SEWELL ET AL. 'Inhibition of calcineurin by a novel FK-506-binding protein' *
MOL. CELL. BIOL., vol. 15, no. 8, August 1995 pages 4395-4402, BAUGHMAN ET AL. 'FKBP51, a novel T-cell-specific immunophilin capable of calcineurin inhibition' *
NATURE, vol. 341, 26 October 1989 pages 758-760, HARDING ET AL. 'A receptor for the immunosuppressant FK506 is a cis/trans peptidyl-prolyl isomerase' *
NATURE, vol. 346, 16 August 1990 pages 671-674, STANDAERT ET AL. 'Molecular cloning and overexpression of the human FK506-binding protein FKBP' *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6908987B2 (en) 1997-05-30 2005-06-21 Dana-Farber Cancer Institute, Inc. PCG-1, a novel brown fat PPARγ coactivator
EP1135149A1 (fr) * 1998-12-01 2001-09-26 Dana-Farber Cancer Institute Pgc-1: un coactivateur du recepteur ppar gamma des tissus adipeux bruns
EP1135149A4 (fr) * 1998-12-01 2003-05-07 Dana Farber Cancer Inst Inc Pgc-1: un coactivateur du recepteur ppar gamma des tissus adipeux bruns
EP1657252A3 (fr) * 1998-12-01 2006-06-21 Dana-Farber Cancer Institute, Inc. PGC-1, un nouveau coactivateur du récépteur PPAR gamma des tissus adipeux bruns
US8541554B2 (en) 2006-07-21 2013-09-24 Abbott Laboratories Immunosuppressant drug extraction reagent for immunoassays
US7883855B2 (en) 2006-07-21 2011-02-08 Abbott Laboratories Immunosuppressant drug extraction reagent for immunoassays
US7914999B2 (en) 2006-12-29 2011-03-29 Abbott Laboratories Non-denaturing lysis reagent
US7993851B2 (en) 2006-12-29 2011-08-09 Abbott Laboratories Lysis reagent for use with capture-in-solution immunoassay
US8129127B2 (en) 2006-12-29 2012-03-06 Abbott Laboratories Assay for immunosuppressant drugs
US8221986B2 (en) 2006-12-29 2012-07-17 Abbott Laboratories Diagnostic test for the detection of a molecule or drug in whole blood
US8329415B2 (en) 2006-12-29 2012-12-11 Abbott Laboratories Lysis reagent for use with capture-in-solution immunoassay
US8404452B2 (en) 2006-12-29 2013-03-26 Abbott Laboratories Assay for immunosuppressant drugs
US8440416B2 (en) 2006-12-29 2013-05-14 Abbott Laboratories Diagnostic test for the detection of a molecule or drug in whole blood
US8697365B2 (en) 2006-12-29 2014-04-15 Abbott Laboratories Non-denaturing lysis reagent
JP2010521419A (ja) * 2007-01-29 2010-06-24 ワイス エルエルシー イムノフィリンおよびカルシウムチャネル活性を調整するためのイムノフィリンリガンドおよび方法

Also Published As

Publication number Publication date
AU3761695A (en) 1996-05-06
WO1996012018A3 (fr) 1996-06-20

Similar Documents

Publication Publication Date Title
Nonaka et al. Complete complementary DNA sequence of the third component of complement of lamprey. Implication for the evolution of thioester containing proteins.
JP4185126B2 (ja) ラパマイシンのエフェクタータンパク
Smit-McBride et al. Sequence determination and cDNA cloning of eukaryotic initiation factor 4D, the hypusine-containing protein
US5326857A (en) ABO genotyping
CA2102117A1 (fr) Rfkbp, une nouvelle prolyl isomerase et proteine fixatrice de rapamycine/fk506
JPH09509160A (ja) Ｆｋ−５０６細胞質ゾル結合蛋白質
AU682506B2 (en) Extracellular signal-regulated kinase, sequences, and methods of production and use
AU683299B2 (en) Nucleotide sequences for novel protein tyrosine phosphatases
WO1996012018A2 (fr) Nouvelles immunophillines et acides nucleiques correspondants
US5447852A (en) DNA encoding cyclophilin C, and recombinant methods employing it
US5643778A (en) RNA editing enzyme and methods of use thereof
US5763590A (en) Isolation of an Mr 52,000 FK506 binding protein and molecular cloning of a corresponding human cDNA
US6734283B1 (en) Human proteins responsible for NEDD8 activation and conjugation
EP0595860A1 (fr) ADNs CODANT DES PROTEINES ACTIVES DANS LA CYTOTOXICITE INDUITE PAR DES LYMPHOCYTES
US5808028A (en) Molecular clone of a P58 receptor protein and uses thereof
US5789558A (en) Protein prenyltransferase
US6649395B1 (en) Tyrosine-containing cyclophilin and related methods
WO2002070696A2 (fr) Molecules d'acides nucleiques cd109, polypeptides et methodes d'utilisation associees
US5459063A (en) Plasmodium falciparum ribonucleotide reductase DNA
EP0950189A1 (fr) Proteine bap-1 associee a la brca1 et ses utilisations
CA2179908A1 (fr) Procede de detection de carence en methylthioadenosine-phosphorylase dans des cellules mammaliennes
WO1997019167A1 (fr) Molecule d'acide nucleique codant pour une 11-cis-retinol deshydrogenase
US6297368B1 (en) Myc homology region II—associated protein and uses thereof
US5349058A (en) Nucleic acid encoding human mevalonate kinase
JP2000224992A (ja) 新規ホスホジエステラーゼ及びその遺伝子

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TT UA UG US US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A3

Designated state(s): AM AT AU BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IS JP KE KG KP KR KZ LK LR LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TT UA UG US US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): KE MW SD SZ UG AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase