WO1996001327A1

WO1996001327A1 - Nucleic acid sequence amplification method

Info

Publication number: WO1996001327A1
Application number: PCT/FR1995/000891
Authority: WO
Inventors: Fabrice David
Original assignee: Labimap S.A.
Priority date: 1994-07-04
Filing date: 1995-07-04
Publication date: 1996-01-18
Also published as: AU2929495A; FR2721945A1; FR2721945B1

Abstract

A nucleic acid target sequence amplification method using oligonucleotide primers consisting of a 3' portion hybridisable with said target sequence, and a 5' portion including at least one inverted repeat capable of being folded into a hairpin structure.

Description

METHOD OF AMPLIFYING NUCLEIC ACID SEQUENCES. The invention relates to a method for amplifying target sequences of nucleic acids, and to its applications. Is used to detect, identify and assay for particular nucleic acids, nucleic acid sequences complementary to the desired sequences, which specifically bind to them by hybridization. Such probes are made detectable and / or assayable by means of special labeling. This labeling can be carried out by incorporating radioactive isotopes or chemical or biochemical methods.

In the case where probes labeled by a non-radioactive method are used (cold probes), it is necessary, most of the time, to artificially increase the concentration of DNA in a specific way (Amplification) before being able to detect it by fixing these labeled probes. In the description which follows, reference will essentially be made to the detection of DNA sequences; it is understood that this also relates to the detection of RNA, since the prior conversion of RNA into DNA is possible thanks to an enzyme: reverse transcriptase.

Among the amplification reactions described, mention should be made of the polymerase chain reaction or gene amplification (PCR). Thanks to PCR, it is possible to multiply the quantity of a given nucleic sequence by a factor reaching a million times or more. His sensitivity is therefore extremely- -. high: only one copy of a given nucleic sequence can be detected. As a result, PCR has made it possible to obtain major advances, particularly in the area of gene identification and study. However, this extreme sensitivity sometimes becomes annoying, especially since the amplification products (amplicons) are often small and can easily contaminate laboratories. A few amplicons are thus sufficient to contaminate the samples not yet tested or the reagents and thus produce false positives.

The small size of the amplification products is also a disadvantage in the case of tests using the so-called in si tu amplification technique. In fact, the primers used and the amplification products have sizes of the same order of magnitude (typically 30 base pairs for the primers, and 200 base pairs for the amplicons). In the in situ amplification technique, cells fixed on microscope slides (or fixed on a suitable support, or else suspended in a suitable medium) are treated so that a specific amplification reaction of DNA contained in these cells could take place. For example, we use this method to detect the presence of a given virus. Then the positive cells are identified by their fluorescence in the presence of a specific dye of DNA or by a hybridization step in if you following the amplification step. One of the most difficult problems to overcome when implementing the in situ amplification technique stems from the fact that it is necessary to permeabilize the cell membranes by an appropriate treatment so that the primers can diffuse through of the membrane to reach the target DNA. Due to the similar size of the amplicons and the primers, the amplicons then tend to diffuse through the membranes as the amplification takes place; we thus lose sensitivity and contrast during observation at microscope or using an automated cell counting device.

On the other hand, PCR, like other amplification techniques, requires a device capable of moving the temperature of the reaction medium between three working temperatures: in general 55 ° C (hybridization of primers; 72 "C ( extension of new DNA strands by thermostable polyase), and 94 "C (denaturation of new strands). LCR (ligase chain reaction) also uses such a programmable device to vary the temperature (thermocycler).

There are techniques operating at a single temperature, but they use several enzymes of different types, and their relative complexity did not allow them to obtain the diffusion they deserved.

It happens also that during the period of the cycle where the temperature is low (55 ^° C) in the tubes, the primers hybridize non-specifically to other sequences as the query sequence. We then observe the formation of parasitic amplification products. The user risks being misled if he is content to carry out a control by agarose or acrylamide gel electrophoresis, and that the fragments obtained have an apparent size close to that of the expected fragment.

If the hybridization temperature is increased so as to avoid these mismatches mentioned above, then the amplification yield decreases considerably.

In addition, it is difficult to carry out assays using PCR: in fact, the amplification of DNA taking place according to a logarithmic law, small variations in the operating conditions will have very significant effects. It therefore appears that although PCR is irreplaceable for many applications, in particular in the context of research, the defects listed above limit its use for routine tests.

^"For medical applications, however, extreme sensitivity in most cases has no specific advantage, in particular for screening methods. For example, in the detection of viral infections, the detection of a few dozen copies of 'viral DNA is of uncertain diagnostic value in the current state of our medical knowledge. An infection with a given virus actually results in the presence of tens of thousands to several billion copies per sample.

The author has helped demonstrate, in the case of HIV infection, that hybridization with radioactive probes without amplification already gives superior results to immunological techniques

(Detection of H.I.V. Sequences by DNA hybridization, S.

Berriche, F. David, V. Ganne, M. Mariotti and G. Lucotte.

Molecular probes; Technology and medical application,

Raven press, New York 1989). To obtain the same results with cold probes, an amplification of the target DNA by a few orders of magnitude is a sufficient objective.

The subject of the invention is a method of amplifying a target nucleic acid sequence, using a DNA polymerase, characterized in that it implements the extension of at least one oligonucleotide primer consisting of a part (3 ') which can hybridize specifically with the target sequence, and of a part (5') comprising at least one inverted repeat sequence. The term “target sequence” is understood to mean any nucleic acid sequence which it is desired to amplify: it may be initially DNA as well as RNA; it can also be a single-stranded or double-stranded sequence.

The portions of the primers complementary to the target DNA may correspond to regions of the latter separated by a few tens to a few thousand nucleotides. Primers are generally used in pairs, oriented so that replication takes place from one to the other, (Figure 1, Figure 5b and 5f).

The complementary part of the target sequence may have the characteristics (length, percentage of mismatches tolerated) of any oligonucleotide which can be used for amplification by PCR of said target sequence. These characteristics essentially depend on the experimental conditions in which one wishes to operate. For example, it is particularly advantageous if it is desired to improve the specificity of the reaction, performing hybridization at a temperature of about 60 ^° C, that is to say greater than that which is usually used for PCR, and with a sequence complementary to the target DNA a little longer than in the case of primers generally used for PCR. Preferably, this sequence complementary to the target DNA has a length of between 40 and 60 bp.

The inverted repeat sequences (also called palindromic sequences) allow self-matching to form a double-stranded structure in the shape of a hairpin.

The inverted repeat sequences of the two primers used can be identical or different between them, - preferably, they will be different, to avoid hybridization between these primers. Reverse repeat sequences can measure from a few tens to several hundred base pairs. The melting temperature of the hairpin-shaped double-strand structure resulting from 1 ^; self-pairing of these sequences will preferably be less than a few degrees at the melting temperature of the partia of the primer hybridizing specifically with the target; it can thus be lower by 1 to 30 ° C, preferably by 5 to 20 ° C, and advantageously by approximately 10 ° C.

The method according to the present invention will hereinafter be called amplification reaction by gene augmentation.

To implement this method, it is possible, for example, to heat to 95 ° C. a reaction mixture containing the test sample, the primers, as defined above, specific to the genetic sequence sought, a DNA polymerase, the four nucleotides triphosphates, and salts and reagents providing optimal operating conditions for DNA polymerase.

The reaction medium is then cooled to a temperature allowing the primers to hybridize under conditions of sufficient specificity (this temperature depends on the sequence and the length of the primers), to allow the elongation by DNA polymerase.

In general, the reagents and reaction conditions which can be used to carry out the PCR amplification are also used for carrying out the method according to the invention. A primer hybridizes to each of the DNA strands

(Figure 5b). The DNA polymerase used binds to the target DNA / primer complex and begins the extension of a new DNA chain (FIG. 5c). After a suitable time (a few minutes for example, so as to allow a sufficient elongation of the neo-synthesized chain to include the entire sequence- target), the solution is heated so as to separate the matrix from the neo-synthesized chain (Figure 5e).

A DNA chain is thus obtained which comprises one of the strands of the target sequence, flanked in 5 ′ by one or more inverted repeat sequences, belonging to one of the members (PI) of the primer pair. . The other member (P2) of the primer pair hybridizes to the newly synthesized strand, and DNA polymerase can replicate this strand again, (Figure 5f). When reaching the end of the strand, the DNA polymerase detaches.

The product resulting from this amplification step consists of a DNA molecule comprising the target sequence, said DNA molecule being double-stranded over at least the length of this target sequence, the 5 'end of one of the strands being constituted by the inverted repeat sequence (s) belonging to the primer Pi (the 3 ′ end being constituted either by one end of the target sequence, or by a sequence which was adjacent to the target sequence in the DNA fragment which included this target sequence), and the 5 ′ end of the other strand being constituted by the inverted repeat sequence (s) belonging to the primer P2, and its 3 ′ end being constituted by the or the inverted repeat sequences belonging to the primer PI (Figures 5h and 5i).

This DNA molecule serves both as a template and as primers for the next stages of amplification. From this moment, and contrary to what happens in the case of PCR, the amplification takes place spontaneously and at constant temperature.

Indeed, under the effect of thermal agitation, the (or) sequence (s) palindromic (s) which ends (s) the double strand of DNA enters (s) in a dynamic equilibrium between two forms: Double - normal strand => double hairpin (Figures 5h and 5i). DNA polymerase can attach to end 3 ^! of one of the strands folded into a double pin, and begin to replicate it, using the folded end as a primer (Figure 5j). In doing so, it moves the complementary strand, and the two strands are thus separated, without the need to raise the temperature (Figure 5j). From this step, one of the strands can initiate a new replication cycle, by hybridizing with a new primer P2 (Figure 5f). The other undergoes an increase in size, theoretically doubling its length with each cycle (Figures 5k, 51, 5m).

The reaction temperature, which will be kept constant throughout it, is chosen so as to allow the priming to hybridize, the balance of the inverted repeat sequences between the unfolded form and the folded hairpin form, and on the other hand, the extension of the strands by the chosen polymerase. Generally this temperature will be between 45 and 75 "C, preferably between 50 and 65 ^* C.

Simultaneously, a strand of very high molecular weight comprising multiple copies of the target sequence, and strands of size equal to the template, can in turn be used as template. When the initial target sequence is double-stranded, these steps take place simultaneously for each of the strands, exactly according to the same process, by simply reversing the role of the primers PI and P2.

When the initial target DNA is in small quantity, it is of course possible to carry out, prior to the implementation of the method according to the invention, a conventional amplification of exponential type by PCR, by carrying out several thermal cycles of denaturation / renaturation at the start of the manipulation, so as to increase the number of molecules initials which will undergo the increase during the subsequent isothermal step.

Moderate agitation can also increase the number of molecules: as soon as it reaches a sufficient size, DNA tends to fragment spontaneously and each fragment can be the basis of new cycles of growth.

The cuts which take place in the center of the target sequence lead to a stop of the increase. The cuts which take place in the vicinity of the palindromic sequences on the contrary allow the increase to continue.

In another embodiment of the invention, it is also possible to use a thermostable endonuclease cutting the primer in the vicinity of the palindromic sequence.

Among the DNA polymerases which can be used for the implementation of the present invention, mention will be made of E.Coli DNA polymerase, preferably the Klenow fragment, or a bacterial phage DNA polymerase (ex: T4) or a yeast DNA polymerase (Bag char omy ces cerevisiae, Saccharomyces pombe, for example).

Advantageously, use will be made of a DNA polymerase extracted from a mesophilic organism, for example from certain yeasts or industrial microorganisms, which grow around 50 ° C.

If one wishes to work at a relatively high temperature, one can either use a thermostable DNA polymerase, such as Taq polymerase, or use the DNA polymerase in excess, or add it after each of the two heating steps necessary for the denaturation of DNA prior to the implementation of the growth method in accordance with

1 'Invention. Under certain conditions, it can happen that certain DNA polymerases do not completely complete the replication of the DNA strand which they copy. After a few cycles, the ability to form hairpins disappears, and the growth stops. This phenomenon can be prevented by placing several repeated inverted sequences one after the other. Examples of embodiments are given in FIGS. 4a and 4b.

In any case, after 8 or 9 growth cycles, the limiting factor is time, because doubling the size of the growth products requires an increasingly long duration.

The growth products resulting from the implementation of the method according to the invention have a large size: a DNA molecule produced by increasing a target sequence by 400 base pairs would have a (theoretical) size of 409 kb after only ten increase cycles. In fact, these growth products are broken by thermal agitation, and their average size in solution is about 60 kilobases. Consequently, the physical behavior of the growth products (even broken) differs enormously from that of the primers, and even that of the target DNA, if the latter is of small size (virus for example).

In a particular way of carrying out the invention, the reaction is carried out in a solution containing a low concentration of a gelable compound (agarose or polyacrylamide gel or of a suitable polymer: it may for example be a hot-melt gel such as 0.2% agarose). The gelable compound solution can also be added at the end of the reaction.

It is also possible, for example, to place a high-concentration agarose ball in each well of microtiter plates. This ball is melted by passing it at 80/90 "C at the end of the reaction, the plate is agitated to mix the reagents, the wells are left to freeze (Figure 6a).

The reaction may for example take place in 96-well microtiter plates (or 384 wells) or in any container of suitable capacity. At the end of the reaction, the plates are placed at low temperature (4 ° C.) so as to freeze the agarose. The plates are then placed to incubate in a large volume of a buffered solution containing a fluorescent dye specific for DNA (Ethidium bromide for example). The primers diffuse outside the wells, but the growth products remain blocked in the gels

(Figure 6b). The wells positive for the presence of the DNA sought therefore appear fluorescent under UV lighting (FIG. 6c) (or else when a mixture of reagents capable of exciting the luminescence of the dye by chemiluminescence is allowed to diffuse therein). It is therefore no longer necessary to perform electrophoresis, which allows rapid tests. Possible confirmation of the tests may take place by carrying out a control hybridization, according to a technique known per se. This hybridization will advantageously be carried out in the form of a sandwich hybridization in the same well where the amplification takes place, a capture probe being fixed on the bottom of the well.

An amplification reaction by PCR can also be followed by an increase reaction in accordance with the invention, so as to take advantage of the advantages of the rapid detection method which has just been described above.

One of the most useful applications of the invention is the screening of large numbers of biologically active compounds. Thus, to search for products active on the reverse transcriptase of the HIV virus, the procedure will be as follows: the reaction solution placed in the wells of a plate of microtitration contains sufficient RNA strands, virus reverse transcriptase, specific primers for cDNA synthesized by the action of viral reverse transcriptase on specific RNA in the solution, nucleotide triphosphates, a DNA polymerase, a hot-melt gel (possibly added after the end of the reaction). Wells serve as controls: they will only contain these reagents. In each other well, a certain quantity of the compounds whose activity is to be tested for the reverse transcriptase of the HIV virus will be placed. Before the stages of gene growth, the reaction mixture will be incubated at physiological temperatures allowing the action of reverse transcriptases. The cDNAs produced in this way will then be subjected to the gene enhancement reaction.

Some wells will not show fluorescence, a sign of the presence of a reverse transcriptase inhibitor. This method can be easily automated and allow the screening of a large number of potentially active products (chemotheques, plant extracts, algae extracts, mushroom extracts, animal extracts, etc.).

Many viruses and various pathogens synthesize a specific reverse transcriptase, whose activity is essential to them. Retroviruses, for example lentiviruses (HIV), oncornaviruses (HTLV) and spumaviruses are obviously the first to be affected. But the HBV virus (hepatitis B) also requires the action of a specific reverse transcriptase, although it is a DNA virus. Plas odia malaria also synthesize large amounts of specific reverse transcriptase. It should be noted that Plasmodia are currently becoming resistant to all of the active products known in the pharmacopoeia. Inhibitors of all these reverse transcriptases would be of immense help in the fight against many pathogens. However, these are often difficult to grow, which prohibits extensive screening of many products. Endogenous reverse eukaryotic transcriptases are also involved in the process of certain conditions. Let us quote for memory the phenomenon of amplification of the genes of resistance to the chemotherapy drugs observed during the treatment of many cancers. Similarly, the invention can be used to test the activity of DNA polymerases.

In another way of applying the invention, the ability of the method to allow the amplification of DNA at relatively low temperature is also used, since no denaturation step is essential. Under physiological conditions, inside cells, protein cofactors involved in the phenomena of gene replication and expression allow the hybridization of growth primers to take place without heating, although with a yield. low. The entire growth reaction can then take place at 37 ° C. However, the synthesized DNA is degraded fairly quickly. However, if we manage to bring in primers of sufficient quantity into the cells, and to avoid their degradation, it is theoretically possible to sufficiently alter the cellular mechanisms to specifically cause the death of the cells containing sequences d 'Specific primers DNA. This alteration takes place by competition with cellular reactions and the depletion of certain compounds and also by the mechanical action of high molecular weight DNA produced by the growth reaction. For example, we could specifically kill cells containing the HIV virus (to purify bone marrow samples for reimplantation for example).

In this embodiment of the invention, the amplification primers will be synthesized in a DNA synthesizer using analogs of nucleotide triphosphates leading to oligonucleotides not degradable by cellular enzymes (phosphorothioates, for example). The total electrical charge of the growth primers will be reduced by a chemical method (by coupling of amino groups according to a method already described for example, or by using for the synthesis of nucleotide analogs whose charge carried by the phosphate group will have been removed ) so that they can pass through the membranes.

The resistant growth primers can also be included in the liposomes, the surface of these possibly containing markers serving to guide them specifically to a particular category of cells.

This could for example be achieved by synthesizing liposomes comprising on their surface parts of the recombinant proteins of the surface of the HIV virus. Such liposomes bind specifically to CD4 receptors. Such liposomes containing large quantities of growth primers will specifically fuse with the surface of certain cells (T4, T8 lymphocytes, red cells, cells of the immune system specific for certain tissues, such as astrocytes, Langerhans cells or Peyer's plates). In cells contaminated by the HIV virus, the growth reaction will divert part of the stock of nucleotide triphosphates, cells, and enzymes from the replication cycle, decreasing the replication rate of the virus. If gene growth takes place with sufficient yield, it is possible that the vital functions of the cell are affected and cell death is accelerated. We thus have a process mimicking specific cellular immunity.

As an example, one can also cite the possibility of producing liposomes containing primers specific to malaria Plasmodia (primers specific to genomic DNA, mitochondrial, kinetoplasmic or episomal DNA). The surface of these liposomes containing the recombinant proteins specific for the surface receptors of red blood cells

(anti-A, anti-B, anti-duffy antibodies, etc.). Recombinant proteins specific to the surface of the malaria infectious stages can also be used, or recombinant proteins containing all or part of the GP120 protein of HIV. In fact, the membrane of the red blood cells in some cases has a sufficient number of residual CD4 receptors to allow the fusion of the liposomes carrying proteins receptors for these receptors. However, the most effective method is to attach anti-marker antibodies to blood groups (A or B) to the surface proteins of the liposomes.

Once introduced into the red blood cells, the primers of diffusion diffuse towards the cytoplasm of the hematozoary by using the pores connecting it with the cytoplasm of the red blood cell. Gene growth interferes with the development of the hematozoan, going as far as disorganizing it.

It is important to note that the sequence of gene growth in vivo proceeds all the better as the cells where this reaction takes place divide all the more quickly, or harbor a rapidly dividing parasite. DNA is all the more easily accessible and cofactors (polymerases, unwindings, topoisomerases, destabilizing proteins of double helices, stabilizing proteins of single strands, etc.) are present in an amount all the more large as the cells are in a stage of rapid division. Considering this fact, liposomes containing growth primers corresponding to a given gene and carrying on their surface proteins recognized by membrane receptors specific for a certain class of cells may be the basis for the treatment of cancerous tumors killing or inhibiting the growth of rapidly dividing cancer cells, and remaining without action on normal cells. This technique therefore benefits from a double specificity, tissue on the one hand, depending on the rate of cell division on the other.

Another particular application of the invention is the prenatal detection of the sex of unborn children. It has been shown that the Y chromosome carries specific sequences, which can be detected by hybridization (see in particular, Nucleotide sequence of 49 a, a genomic probe detecting multiples RFLP on the Y chromosome, Gérard LUCOTTE, Martine MARIOTTI and Fabrice DAVID. Molecular & Cellular Probes,

5, 359-363, (1991). Early in pregnancy, fetal cells cross the placenta to enter the mother's general circulation. The presence of these cells can be demonstrated by PCR, but the method is extremely sensitive to contamination due to laboratory dust. Indeed, a significant part of this dust is made up of desiccated flaking cells. If researchers or technicians mix with the technicians in the premises where the tests are carried out, all the samples quickly become positive.

It is possible to practice the gene augmentation method in if you are on a white cell pellet smear made from a blood sample. Fetal cells appear fluorescent under UV observation. We can also operate in solution, and count the fluorescent cells using a liquid flow counting device.

The growth products can also be used as size markers in pulsed field electrophoresis experiments. The increase reaction products obtained are mixed after variable reaction times, the end of each reaction being carried out at relatively low temperature. Agarose is added to the mixture to avoid DNA fragmentation by shear forces. The mixture obtained can be marketed as it is, ready to use, in the form of small strips of solid agarose the size of the wells of the electrophoresis system. After depositing in a well and electrophoresis, a series of bands corresponding to DNA fragments of multiple size than that of the amplified DNA, and of perfectly known sequence, will be obtained.

The present invention will be better understood using the additional description which follows, which refers to an example of implementation of the process according to the invention.

It should be understood, however, that this example is given solely by way of illustration of the subject of the invention of which it in no way constitutes a limitation.

Example; Amplification and detection of a specific sequence of the HIV virus:

The target DNA is a vector containing a sequence of the HIV gag gene. The following oligonucleotides are used, which allow the amplification of a portion of the HIV gag gene. This part is relatively conserved among the different strains. Al: C G TGGTCATACGAACTACATTTCAGA 5 '

TA ACCAGTATGCTTGATGTAAAGTCT ATAATCCACCTATCCCAGTAGGAGAAAT 3 ' A2:

C 3 CGTCAGAATTCTTCACTAATTAGC 5

T A GCAGTCTTAAGAAGTGATTAATCG TTTGGTCCTTGTCTTATGTCCAGAATGC 3 '

These oligonucleotides comprise, from 5 'to 3': an inverted repeat sequence, around a GCTA sequence, which allows the folding of the hairpin structure, and a specific sequence of the gag gene.

The inverted repeat sequences were chosen so as to have a Tm of 66 "C; they were composed by lot.

The specific sequences of the GAG part of the HIV genome have a Tm of 78 ° C.

About 10 ⁵ to 10 ° copies of target plasmid containing the HIV gag gene are used. The reaction is carried out under standard PCR conditions, namely:

200 pmol. of each primer

20mM Tris HC1 (ph 8.3)

1.5 mM MgC12 25 mM KC1

0.05% Tween 20

100 μg / ml autoclaved gelatin.

50 MU of each dNTP

3 units of Taq polymerase. The plasmid containing the HIV gag gene, is denatured for the first time by incubation at 95 ° C. for 1 min;

The reaction mixture is cooled and incubated for 5 minutes to allow hybridization and elongation of the first primer for each strand; we proceed to a new denaturation,

95 ^* C for lmn.

Incubate at 63 ° C for 2 hours.

The reaction product is deposited on a 0.8% agarose gel. At the end of migration, a band appears at the top of the gel in the positive samples. corresponding to high molecular weight DNA (greater than or equal to 50kb); below, there are bands of lower intensity corresponding to DNA of decreasing size, the size of each fragment being theoretically double that of the fragment immediately below; the smallest fragment in this series corresponds to the target sequence.

Claims

1) Method for amplifying a target nucleic acid sequence characterized in that it comprises at least one step during which the extension is carried out, by means of a DNA polymerase, and in using as template a strand of DNA carrying said target sequence, at least one oligonucleotide primer consisting of a part (3 ') which can hybridize specifically with the target sequence, and of a part (5') comprising at least one inverted repeat sequence.

2) Method for amplifying a target nucleic acid sequence according to claim 1, characterized in that it comprises: a) hybridization of the oligonucleotide primer with a matrix which comprises the target sequence, flanked in 5 ′ by at least one inverted repeat sequence, b) extension of said oligonucleotide primer by means of DNA polymerase, in order to obtain an extension product comprising a sequence complementary to the target sequence, flanked in 3 'and 5' by inverted repeat sequences; c) the extension, by DNA polymerase, of the primer constituted by the inverted repeat sequence of the 3 'end of the hairpin folded extension product, using said extension product as a template; d) repeating step c) using the extension product from this step as a matrix, and as a primer the 3 'end of said extension product folded back into a hairpin; all of these steps being carried out while maintaining the temperature of the reaction medium at a constant value allowing the hybridization of a primer, and the replication of the target sequence. 3) Method according to any one of claims 1 or 2, characterized in that it further comprises a step during which one proceeds to the incubation of a DNA chain comprising the target sequence, in the presence a first nucleotide primer consisting of a part (3 ') capable of hybridizing specifically with said target sequence, and of a part (5') comprising at least one inverted repeat sequence, under conditions allowing replication of said target sequence by extension of said primer.

4) Amplification method according to any one of claims 1 to 3, characterized in that one ε-oute to the reaction mixture a gelable compound capable of specifically trapping the amplification products, while allowing the primers to diffuse.

5) Diagnostic kits containing the primers and the reagents necessary for their implementation of a method according to any one of claims 1 to 4.

6) Pair of primers for the implementation of an amplification method according to any one of claims 1 to 3. 7) Use of a pair of primers according to claim 6 for obtaining a medicament.