FR2809105A1 - MODIFIED AMPLIFIER PRIMERS AND USES THEREOF - Google Patents

Abstract

The present invention relates to the design of modified amplification primers and their uses for Strand Displacement Amplification (SDA), Thermophilic Strand Displacement Amplification (tSDA) or tSDA by fluorescent real time tSDA, and with optional use of a microelectronic chip.

Description

<Desc / Clms Page number 1>

The present invention relates to the design of a modified amplification primer and to the uses of modified amplification primers for amplification by strand displacement.
Amplification or SDA), amplification by displacement of thermophilic strands (thermophilic Strand Displacement Amplification or tSDA) or tSDA by fluorescence in real time (fluorescent real time tSDA), and with optional use of a microelectronic chip.

Strand Displacement Amplification
Amplification or SAD) is an in vitro isothermal nucleic acid amplification method based on the ability of a restriction enzyme to break the unmodified strand of a hemi-phosphorothioate nucleic acid duplex at its recognition site. DNA polymerase is used to extend from the 3 'end of the hyphen and to move the DNA strand downstream of the template.

 The displaced product is used as a matrix in the following cycles of SDA.

SDA requires four primers. Two primers bind to each strand of DNA. Primer 1 (amplification primer, AA) has a restriction enzyme recognition site (eg BsoBI from Bacillus stearothermophilus), immediately followed by a target-specific sequence usually long
15 to 20 nucleotides. On the 5 'side of the restriction enzyme recognition site is a short sequence (18-24 nucleotides) used to provide a flanking region at the restriction enzyme recognition site. Primer 2 (bumper primer, AB), hybridizes with the target upstream of primer AA. Extension of the primer AB displaces the extension product of AA from the target. Successive SDA cycles result in a specific exponential amplification of the target.

 For previous designs of the AA primers, a non-specific target sequence on the 5 'side of the restriction enzyme recognition site was used as the 5' flanking region and a target specific sequence on the 3 'side of the recognition site. recognition of the restriction enzyme. During the initial SDA cycles, primer-target hybridization is carried out by the portion of the target-specific AA primer. As SDA is performed at a moderately elevated temperature (50 to 60 C), a reasonably long target specific sequence is required for stable specific target hybridization and efficient amplification. However, longer target-specific sequences on the 3 'side of the

<Desc / Clms Page number 2>

 Recognition of the restriction enzyme leads to a greater potential for interactions between primers and the creation of primerdimer (PD) amplification products. PD amplification is one of the main causes of non-specific amplification in PCR (Polymerase Chain Reaction) (Brownie, J. et al., 1997, Nucleic Acids Res. 25: 3235-3241.) The situation may be worse for SDA since (1) higher primer concentrations are usually used in SDA than in PCR, which increases the risk of interactions between primers and PD amplification, (2) once a PD is formed between AA sequences on the 3 'side of the restriction enzyme recognition site, the PD product will be amplified exponentially as it contains a breakable restriction enzyme recognition site at both ends and ( 3) the PD amplifications can preferably be amplified because the products of the PD amplification are shorter than the products of the specific amplification of the target.

 These problems worsen with multiplex nucleic acid amplification because there are more amplification primers present in a single amplification reaction. As already described, there is a greater risk of competition between nonspecific amplifications and specific amplifications of the target in SDA than in PCR. It is for these reasons that no report has been published on the co-amplification of multiple DNA targets with multiplex primer sets. Walker et al. (1994. Nucleic Acids Research 22: 2670-2677; US Patent 5,422,252) described primers for SDA designed to amplify multiplex DNA targets using a single pair of primers after addition of common primer sequences at the ends 5 'of each primer sequence in order to minimize the interactions between primers and PD amplifications.

 The optimal DNA for hybridization and nucleic acid sequencing is single stranded DNA (ssDNA). Currently, four methods are used to obtain ssDNA: (1) denaturation of double stranded DNA (dsDNA); (2) asymmetric Polymerase Chain Reaction (PCR); (3) exonuclease digestion of phosphorylated strands of dsDNA and (4) affinity binding of one of the DNA strands to an insoluble template (Gyllensten, U. B and Erlich, H. A., 1988. Proc. Natl. Acad.

Sci. USA 85: 7652-7656; Mitchel, L. G. and Merril, C. R., 1989. Anal. Biochem.

17: 239-242; Rehbein, H. et al., 1998. Electrophoresis 8-9: 1381-1384; Sambrook, J. et al., 1989. Molecular Cloning: A Laboratory Manual, 2nd edition.

CSH Laboratory Press, Cold Spring Harbor, NY). In asymmetric PCR,

<Desc / Clms Page number 3>

a primer is present in a limited quantity and is completely used during the initial PCR cycles. In the following cycles, only the abundant primer is present, which causes excess production of a strand.
The use of the principle of asymmetric PCR for the creation of ssDNA by
SDA has been tested without success.

 Although SDA has found important applications, there are still problems with the original design of the primer as described above.

 Recall that the first problem is the fact that the amplification is not very effective. The low efficiency of SDA with the original design of the primer is mainly due to a lower hybridization efficiency because SDA is performed at a relatively high temperature with primers whose only 3 'ends are specific sequences of target. The second problem is the formation of PD product and the amplification of this product. This is due to the fact that the last few nucleotides of the 3 'end of an amplification primer exhibiting homology with any sequence at the 3' end of another amplification primer (or of it- even), and not only with the last few nucleotides of this primer, can form a primer-dimer product and this product can be amplified exponentially. This primer-dimer formation in SDA is different from that of PCR, which requires primer homology between the last few nucleotides of the 3 'ends of the two primers for there to be primer-dimer amplification.

 The object of the present invention is therefore to improve the SDA technique, to improve multiplex amplification and to allow the fabrication of single-stranded DNA using SDA by modifications of the design of the invention. primer of SDA. The sensitivity, specificity and result of target amplification have been increased by the novel primer design of the present invention, in which a target specific sequence is included at the 5 'end of the primers. The new primer design, while improving SDA, is also useful for SDA multiplex analysis and SDA fabrication of single stranded DNA.

 The design of the primer of the present invention presents several improvements over the standard design of the primer for SDA. In both cases, the SDA primers contain target specific sequences and non-target specific sequences (see Figures 1A and 1B).

In standard design, specific target sequences are found

<Desc / Clms Page number 4>

 on the 3 'side of the restriction enzyme recognition site. Primer-primer interactions between the 3 'ends of different primers have been shown to lead to the creation of non-specific amplification products. In order to minimize these interactions linked to the standard design, it is advantageous to design the specific regions of the target of the primers so that they are as short as possible while retaining them with suitable Tf characteristics in terms of hybridization of a target sequence. Since SDA is performed at a high temperature (50 - 65 C), it is important to design specific target regions of sufficient length to allow efficient hybridization with the target. The primer design of the present invention overcomes these limitations by the use of long target specific sequences located on the 5 'side of the restriction enzyme recognition site. The increase in the length of the target specific sequence allows efficient hybridization with the target at elevated temperatures without contributing to the formation of non-specific products. In this new design, short sequences are used on the 3 'side of the restriction enzyme recognition site, which minimizes the formation of non-specific products.

The following terms are defined as follows:
An amplification primer is a primer for the amplification of a target sequence by extension of the primer by hybridization with the target sequence. The amplification primers can have a length of between 10 and 75 nucleotides, preferably between 15 and 50 nucleotides. The total length of an amplification primer for SDA is typically between 25 and 50 nucleotides. Generally, the 3 'end of an amplification primer for SDA (target binding sequence) specifically hybridizes to the target sequence. The target binding sequence is approximately 10 to 25 nucleotides in length and gives the amplification primer its specific hybridization. The amplification primer for SDA further includes a recognition site for a restriction endonuclease on the 5 'side of the target binding sequence. The recognition site is intended for an endonuclease which will break a strand of duplex DNA when the recognition site is hemimodified, as described by G. Walker et al. (1992. Proc. Natl. Acad. Sci. USA 89: 392-396 and 1992 Nucl. Acids Res. 20: 1691-1696). The nucleotides located on the 5 'side of the restriction endonuclease recognition site (the "tail") function

<Desc / Clms Page number 5>

 as a polymerase re-priming site when the rest of the amplification primer is broken and displaced during SDA. The tail nucleotide priming function maintains the SDA reaction and allows the synthesis of multiple amplicons from a single target molecule. The tail is generally between 10 and 25 nucleotides in length. Its length and sequence are generally not critical and can be routinely selected and changed. However, in the context of the present invention, the amplification primer has been modified so that the tail also contains a target binding sequence. As the target binding sequence located on the 3 ′ side of the restriction site of the restriction endonuclease is a part of the primer which determines its target specificity, for the amplification methods which do not require specialized sequences at the ends of the target, the amplification primer generally consists essentially only of this target binding sequence on the 3 ′ side. For example, the amplification of a target sequence in accordance with the invention using PCR (Polymerase Chain Reaction) will use amplification primers comprising the target binding sequences 3 ′ side of the amplification primers described here. For amplification methods requiring specialized sequences added to the target other than the restriction endonuclease recognition site and the SDA tail (e.g. an RNA polymerase promoter for Self-Sustained techniques Sequence Replication (3SR), Nucleic Acid Sequence-Based Amplification (NASBA) and Transcription-Based Amplification Sytstem (TAS)), the specialized sequence required may be linked to the target binding sequence by the use of routine methods for the preparation of oligonucleotides without modifying the specificity of hybridization of the primer.

 A bumper or external primer is a primer used to displace the primer extension products in isothermal amplification reactions. The "bumper" primer forms an annealing with a target sequence upstream of the amplification primer so that extension of the "bumper" primer displaces the amplification primer downstream and its product. extension.

 The terms target or target sequence designate the nucleic acid sequences to be amplified. These include the original nucleic acid sequence to be amplified, the second strand complementary to the original nucleic acid sequence to be amplified and one of the two strands of a copy of the original sequence

<Desc / Clms Page number 6>

 produced by the amplification reaction. These copies serve as amplifiable targets due to the fact that they contain copies of the sequence with which the amplification primers hybridize.

 The copies of the target sequence created during the amplification reaction are called amplification products, amplimers or amplicons.

 The term extension product denotes the copy of a target sequence produced by hybridization of a primer and extension of the primer by the polymerase, the target sequence serving as a template.

 The species-specific term designates the detection, amplification or hybridization of oligonucleotides with a species of organism or a group of related species without substantial detection, amplification or hybridization of oligonucleotides with other species of the same genre or a different genre.

 The term test probe refers to any oligonucleotide used to facilitate the detection or identification of a nucleic acid. Detector probes, detection primers, capture probes, signal primers and "reporter" probes described below are examples of test probes.

 The term amplicon -designates the product of the amplification reaction generated by extension of one or two primers of a pair of amplification primers. An amplicon can contain exponentially amplified nucleic acids if the two primers used hybridize with a target sequence. Amplicons can also be made by linear amplification if one of the primers used does not hybridize with the target sequence. So this term is used generically here and does not imply the presence of exponentially amplified nucleic acids.

 A micro-electronic network (or electronic micro-network) is a device comprising a network of self-addressing microscopic locations. Each microscopic location contains an underlying micro-electrode operating in direct current (DC) carried by a substrate. The surface of each location has a permeable layer for the free transport of small counterions and a fixing layer for the covalent coupling of specific binding entities.

 A network or matrix is a particular arrangement of locations on the device. The locations can be arranged in two-dimensional, three-dimensional networks or in other matrix formats. The

<Desc / Clms Page number 7>

 number of locations can range from several to at least hundreds of thousands.

 Electronic addressing (or targeting) is the placement of charged molecules on specific test sites. Since DNA has a strong negative charge, it can be moved to a positively charged area. A test site or row of test sites on the microchip is electronically activated with a positive charge. A solution of DNA probes is introduced into the microchip. The negatively charged probes move quickly to positively charged sites, where they concentrate and chemically bond to the site. The microchip is then washed and another solution of separate DNA probes can be added. Site by site, row by row, a network of specifically linked DNA probes can be assembled or addressed on the microchip. Thanks to the possibility of electronically addressing the capture probes at specific sites, the system allows the production of custom networks by placing specific capture probes on a microchip. In this context, the term "electronically addressable" refers to an ability of a microchip to direct materials such as nucleic acids and enzymes and other amplification components from one location to another on the microchip by polarization. electronic capture sites on the chip. "Electronic polarization" means that the electronic charge at a capture site or elsewhere on the microchip can be manipulated between a net positive charge and a net negative charge so that the molecules in solution and in contact with the microchip can be directed to or repelled from one location on the microchip or from one location to another.

 Electronic concentration and hybridization use electronics to move and focus target molecules to one or more test sites (or capture sites) on the microchip. The electronic concentration of sample DNA at each test site allows rapid hybridization of the sample DNA with the complementary capture probes. Unlike the passive hybridization process, the electronic concentration process has the distinct advantage of significantly accelerating the speed of hybridization.

To remove any unbound or non-specifically bound DNA from each site, the polarity or charge of the site is reversed and made negative, which forces any unbound or non-specifically bound DNA to return to solution away from

<Desc / Clms Page number 8>

 catch probes. In addition, since the test molecules are concentrated electronically at the test site, a lower concentration of target DNA molecules is required, which limits the time and labor otherwise required for preparing the sample before testing. The term "capture site" designates a specific location on an electronically addressable microchip, where electron polarization is initiated and where molecules such as nucleic acid probes and target molecules are attracted or addressed by this influence.

 Electronic stringency control is the reversal of the electrical potential aimed at removing unbound or non-specifically bound DNA quickly and easily as part of the hybridization process. Electronic stringency allows quality control of the hybridization process and ensures that all linked DNA pairs are truly complementary. The precision, mastery and accuracy of platform technology, through the use of controlled current input in the process of electronic stringency, allow the detection of single point mutations, mismatches of pairs of unique bases or other genetic mutations that can have important implications for many diagnostic or research applications. Electronic stringency is obtained without the heavy processing or manipulation necessary to achieve the same results by conventional methods. Unlike passive networks, this technology can be used for both short and long single-stranded DNA fragments. Using longer probes increases the certainty that the DNA that hybridizes to the capture probe is the correct target. Controlling electronic stringency reduces the number of necessary probes and therefore test sites on the microchip in comparison with conventional DNA networks. Conversely, traditional passive hybridization processes are difficult to master and require more replicants of each possible corresponding base pair so that the possible matches can be identified with certainty.

 Electronic multiplexing allows the simultaneous analysis of multiple tests from a single sample. Electronic multiplexing is facilitated by the possibility of independently controlling individual test sites (for addressing capture probes or capture molecules and the concentration of molecules in the test sample) which allows the simultaneous use of molecules biochemically unrelated on the same

<Desc / Clms Page number 9>

 microchip. Sites on a conventional DNA network cannot be mastered individually and therefore the same process steps must be followed throughout the network. The use of electronics as part of this technology allows greater versatility and flexibility compared to these conventional methods.

The present invention relates to the design of modified amplification primer and to the uses of modified amplification primers for strand displacement amplification.
SDA), amplification by displacement of thermophilic strands (thermophilic Strand
Displacement Amplification or tSDA) or tSDA by fluorescent real time (fluorescent real time tSDA), and with optional use of a microelectronic chip.

 In one of the modes of application of the present invention, the amplification primers for SDA are designed such that they contain target-specific sequences on the 5 ′ side and on the 3 ′ side of the recognition site of the restriction enzyme. The use of target specific sequences on the 5 ′ side and on the 3 ′ side of the restriction enzyme recognition site increases the efficiency of target specific hybridization. This design makes it possible to reduce the length of the non-specific 3 ′ portion of the AA target, limiting the risks of interactions between primers.

With primers designed in accordance with the present invention, the specificity, sensitivity and result of SDA are increased and PD amplifications are limited compared to SDA using the conventional design of primers. The target-specific amplification products were detected from 10 copies of target DNA after 10 minutes of reaction by SDA at 60 C. The maximum amplification was obtained from 10 copies of template after 30 minutes of SDA.

 In a second embodiment, multiplex SDA amplifications are possible using amplification primers designed in accordance with the present invention. Multiplex amplification is a strategy for simultaneously amplifying two or more target sequences. Each amplification reaction is specific, but several targets are amplified in a single reaction mixture. Using the primers designed in accordance with the present invention and adjusting the primer concentrations for each template, we were able to co-amplify and detect as few as 10 copies

<Desc / Clms Page number 10>

 of each matrix. A preferred version of this embodiment allows amplified products to be detected using a microelectronic network. The entire procedure, from amplification to detection, took approximately two hours. The combination of speed, simplicity and sensitivity of SDA amplification and detection on a microelectronic network provide a method for detecting clinical bacterial pathogens and other diseases.

 In a third embodiment, primers designed in accordance with the present invention can be used to generate single stranded DNA by SDA. In particular, it has been observed that the target-specific product cannot be generated by SDA using amplification primers having only a target-specific sequence three base pairs long (bp ) on the 3 'side of the restriction enzyme recognition site.

 The use of identical molar amounts of an amplification primer designed in accordance with the present invention and of a primer designed in accordance with the present invention having only three bp on the 3 'side of the enzyme recognition site restriction (called stop primer) to bind to one strand of DNA and a conventional amplification primer to bind to the other strand of DNA in the context of an amplification by SDA makes it possible to manufacture ssDNA. The stop primer was used to compete with the conventional amplification primer on the target such that the two strands of target DNA are unevenly amplified. This method produces single stranded DNA that can be used for hybridization and nucleic acid sequencing.

 In a fourth embodiment of the present invention, amplification primers for use in connection with other amplification methods are designed to contain target specific sequences on the 5 'and 3' sides of a non-specific sequence target.

 In a fifth embodiment of the present invention, an amplification primer for the discrimination of two closely related sequences is designed to avoid one or more mismatches (in relation to the target) in the specific 3 'target sequence.

 SEQ ID NOs: 1 to 4 are oligonucleotide sequences used as primers (1 and 2) and "bumper" (3 and 4) for the amplification of the gene

<Desc / Clms Page number 11>

Yersinia enterocolitica yst which are designed according to the conventional design of primers for SDA. SEQ ID NOs: 5 to 10 are oligonucleotide sequences used as primers for amplification of the yst gene which are designed according to an embodiment of the present invention. SEQ ID NO: 11 is the sequence of a nucleotide used as a capture probe for the yst gene. SEQ ID NO: 12 is the sequence of a nucleotide used as a "reporter" probe for the yst gene. SEQ ID
NO: 13 is the nucleotide sequence of the Staphylococcus aureus femA gene used as a non-specific capture probe. SEQ ID NOs: 14 and 15 are sequences of oligonucleotides used as primers for the amplification of the yst gene which were designed according to the second embodiment of the present invention. SEQ ID NOs: 16 to 19 are sequences of oligonucleotides used as primers (16 and 17) and "bumpers" (18 and 19) for the amplification of the gene for Shiga toxin 1 (SLTI) of Escherichia coli which have been designed in accordance with the present invention. SEQ ID NO: 20 is the sequence of an oligonucleotide used as a capture probe for the SLTI gene. SEQ ID NO: 21 is the sequence of an oligonucleotide used as a "reporter probe for the SLTI gene. SEQ ID NOs: 22 to 25 are sequences of oligonucleotides used as primers (22 and 23) and" bumper "( 24 and 25) for the amplification of the Salmonella enterica invA gene which have been designed in accordance with the present invention. SEQ ID NO: 26 is the sequence of an oligonucleotide used as capture probe for the invA gene. SEQ ID NO: 27 is the sequence of an oligonucleotide used as a "reporter" probe for the invA gene.

SEQ ID NO: 28 is a sequence of an oligonucleotide used as a primer according to the third embodiment of the present invention. SEQ ID NO: 29 is a sequence of an oligonucleotide used as a captive probe for the yst gene. SEQ ID NO: 30 is a sequence of an oligonucleotide used as a reporter probe for the yst gene. SEQ ID NOs: 31 to 34 are sequences of oligonucleotides used as primers for the amplification of the Camylobacter sodB gene which have SEQ ID NOs: 35 to 38 are oligonucleotide sequences used as primers for amplification of the E. coli SLTII gene which have been designed according to the present invention.

SEQ ID NOs: 39 to 42 are sequences of oligonucleotides used

<Desc / Clms Page number 12>

 as primers for amplification of the Shigella ipaH gene which have been designed in accordance with the present invention.

Figures 1A and 1B show a comparison of the design of the standard amplification primer (AA) (Fig. 1A) and the new design of the AA primer (Fig. 1 B). The restriction enzyme recognition site
BsoBI is marked by a gray semicircle. The target specific sequence is used at the 3 'end of the BsoBI enzyme recognition site for both designs. The non-specific target sequence (standard AA design, Fig. 1A) or the target specific sequence (new AA design, Fig. 1B) is used at the 5 'end of the recognition site. the enzyme BsoBl.

Figure 2 shows the influence of the new primers AB and AA on the
SDA. Genomic DNA from Yersinia enterocolitica was used as the template. 1 *: ystAA1s, ystAA1A, ystAB1 and ystAB2A were used as the primer set. 2 *: ystAA1s, ystAA2A, ystAB1s and ystAB2A were used as the primer set. 3 *: ystAA1s, ystAA1A, ystAB1s and ystAB1A were used as the primer set. ystAA1s, ystAA1A, ystAB1s and ystAB1A were designed according to the original SDA method. ystAA2A and ystAB2A were designed by the method presented here. NT: negative control without matrix. M: molecular weight. Target specific products contained 111 bp (unbroken) and 87 bp (broken).

 Figure 3 compares the SDA results obtained with the original design primer set and the results obtained with the new design primer set of the present invention. Genomic DNA from Y. enterocolitica was used as a template. 1 *: the original primer set (ystAA1s, ystAA1A, ystAB1s and ystAB1A) was used for the SDA. 2 *: a new set of primers in accordance with the present invention (ystAA2s, ystAA2A, ystAB2s and ystAB2A) was used for SDA. 3 *: a new set of primers in accordance with the present invention (ystAA3s, ystAA3A, ystAB2s and ystAB2A) was used for SDA. NT: negative control without matrix. M: molecular weight.

 Figures 4A to 4B show the evolution over time of the SDA reaction. The SDA was carried out at 60 ° C. for different durations as indicated. Genomic DNA from Y. enterocolitica was used as the template and the new design primers according to the present invention

<Desc / Clms Page number 13>

(ystAA3s, ystAA3A, ystAB2s and ystAB2A) were used as the primer set.
Figure 4A: 5 l of sample from each time point was used to perform non-denaturing gel electrophoresis. After electrophoresis, the gel was stained with ethidium bromide. Figure 4B: a chip test was used to detect the specificity of the SDA products. NT1: negative control without matrix without external DNA. NT2: negative control without matrix with 0.5 g of genomic DNA from calf thymus. M: molecular weight marker.

 FIGS. 5A and 5B show the results of SDA with the primer design in accordance with a second embodiment of the present invention, according to which the primer comprises 6 nucleotides of non-target specific sequence and 6 nucleotides of target specific sequence. target on the 3 'side of the BsoBl recognition site. Figure 5A: gel electrophoresis for yst. Figure 5B: chip detection for yst.

 Figures 6A to 6D show the detection of SDA products by single matrix amplification for triplex primer sets. The first three sets of primers (SLTI + invA + yst) were present at standard concentrations (AA / AB 500 nM / 50 nM). A genomic matrix of E. coli was used for SLTI, of S. enterica for invA and of Y. enterocolitica for yst. Figure 6A: results of gel electrophoresis for SLTI. The arrows indicate the expected bands of amplified product (broken and not broken), M = molecular weight marker. Figure 6B: chip detection results for SLTI. Figure 6C: chip detection for yst. Figure 6D: chip detection for invA. The numbers above the signal bars are the ratio specific signals / non-specific signals.

 Figure 7 shows the detection of SDA products from the co-amplification of three matrices in triplex primer sets. The conditions were the same as for FIGS. 6A to 6D except for the primer concentrations, which were as follows. For SLTI primer sets, AA / AB = 200 nM / 20 nM. For yst primer sets, AA / AB = 400 nM / 40 nM. For invA primer sets, standard concentrations were used (AA / AB = 500 nM / 50 nM).

 Figures 8A and 8B show the detection of SDA products for the manufacture of single stranded DNA. Genomic DNA from Yersinia enterocolitica has

<Desc / Clms Page number 14>

 been used as a matrix. Figure 8A: detection of passive hybridization with yst antisense capture probes (ystCA) and yst antisense reporter probes (ystRA) or with yst sense capture probes (ystCs) and yst sense reporter probes (ystRs) . Figure 8B: detection results by electronic hybridization for desalted and denatured samples with ystCA capture probes and ystRA reporter probes. PT: classic SDA.

Strand Displacement Amplification (SDA) is an in vitro nucleic acid amplification technique to obtain an X 1010 amplification product in 15 minutes.
60 C (Spargo, CA et al., 1996. Mol. Cell. Probes 7: 247-256). interactions between primers and PD amplifications are the main competitive reactions of target specific amplifications. Certain PD amplification products were sequenced and the results showed that some of the products resulted from interactions between 2 or 3 bp of primers. Interactions between primers can be minimized by carefully choosing the target region to be amplified. This strategy does not always work due to other constraints. This becomes more difficult for the design of primers for the multiplex SDA since the number of primers involved increases. With SDA primer designs already published, primer-target hybridization depends on the interaction between the target-specific portion of the AA primer and the target. The 5 ′ part of the restriction enzyme recognition site does not participate in this specific hybridization. The only function of this part is to provide a flanking region for the restriction enzyme recognition site (Walker GT, 1993. PCR Methods Appl. 3: 1-6).

 The fact that the AA sequence on the 5 'side of the restriction enzyme recognition site is not involved in exponential primer-dimer amplification has been used to design new amplification primers to improve the specificity, sensitivity and results of the SDA. According to the present invention, the specific target sequence (eg from 1 to 50 nucleotides, preferably from 10 to 40 nucleotides, or better still from 15 to 30 nucleotides), is used in this part of the primer. amplification to provide a flanking region around the restriction enzyme recognition site. This sequence is also involved in primer-target hybridization of the initial cycles of SDA. This primer design also pulls

<Desc / Clms Page number 15>

advantage of the fact that part of the restriction endonuclease recognition site, e.g. ex. 5 bp from the restriction enzyme recognition site if
BsoBI is the restriction endonuclease used, is incorporated into the broken matrix displaced within the framework of SDA. AAs with shorter 3 'side sequences (eg 5 to 30 nucleotides, preferably 6 to 20 nucleotides or better 9 to 12 nucleotides) of the restriction enzyme recognition site are designed to reduce interactions between primers between these parts. Better specificity, sensitivity and better results are obtained with primers designed according to the present invention despite the use of shorter 3 'sequences. The competition between target specific amplification and non-specific matrix independent amplification during the initial cycles of SDA is believed to be an important factor determining the outcome of overall amplification by SDA. A more marked primer-target hybridization and fewer interactions between primers during these SDA cycles will surely increase the specificity and sensitivity of the overall reactions. A large amount of amplification products is produced from 10 copies of a DNA template after 30 minutes of SDA at 60 C. This result indicates that the entire amplification is in fact favorable for amplification. specific. In addition, the primer design of the present invention makes the primer design for multiplex SDA much easier since shorter sequences are required on the 3 'side of the restriction site.

 It has also been observed that a non-specific target sequence can be included on the 3 'side of the restriction enzyme recognition site adjacent to the site specific sequence without adversely affecting the amplification reaction. In this embodiment, the nonspecific target sequence comprises 1 to 40 nucleotides, preferably 5 to 30 nucleotides or better 10 to 20 nucleotides and it is located between the recognition site of the restriction enzyme and the 3 'sequence target specific.

 Gel electrophoresis is a rapid method for visualizing the size of the amplification products but does not allow the specificity of these products to be confirmed. The on-chip test using micro-electronic networks is a rapid and sensitive detection system for nucleic acid. The on-chip test can be used to identify specific target products. The system takes less than an hour to complete the entire detection process. The combination of speed, simplicity

<Desc / Clms Page number 16>

 and sensitivity of the SDA system and the on-chip test represent a potential method for detecting clinical bacterial pathogens since current culture diagnostic methods for detecting bacterial pathogens require several days to several weeks due to the growth rate extremely limited of certain pathogens (Spargo, CA et al., 1993 Mol. Cell. Probes 7: 395-404).

 Multiplex amplification is a strategy of using several sets of amplification primers in order to amplify one or more target sequences in a single reaction. Each amplification reaction is specific, but several targets are amplified in a single reaction mixture. Using primers designed according to the present invention (i.e., primers having a target sequence on the 5 'side of the restriction enzyme recognition site and shorter target sequences on the 3' side of the site restriction enzyme recognition) and by adjusting primer concentrations for each template, it was possible to co-amplify and detect numbers as low as 10 copies of each template. Primer concentrations are determined empirically using conventional techniques. A preferred aspect of this mode of administration consists in detecting the amplified products using a microelectronic network. The whole procedure, from amplification to detection, took around two hours. the combination of the speed, simplicity and sensitivity of SDA amplification with detection on a microelectronic network provide a method for detecting clinical bacterial pathogens and diseases. Thus, the design of the primers according to the present invention can be used to amplify two or three or more target sequences in the context of SDA, with a sensitivity similar to that of multiplex PCR.

 The optimal DNA for hybridization and nucleic acid sequencing is single stranded DNA. When designing improved primers for SDA amplification, it was observed that it was not possible to make a target specific product by SDA using amplification primers having a target specific sequence of three base pairs only (bp) located on the 3 'side of the restriction enzyme recognition site. This fact is useful for the manufacture of single stranded DNA by SDA. In particular, single stranded DNA is generated by SDA using (1) equal molar amounts of (a) a conventional amplification primer designed in accordance with

<Desc / Clms Page number 17>

 present invention and (b) a primer designed in accordance with the present invention having a target specific sequence of three nucleotides only on the 3 'side of the restriction enzyme recognition site (called a stop primer) for binding to a strand of DNA and (2) a conventional amplification primer in accordance with the present invention to bind to the other strand of DNA. The stop primer was used to compete on the target with the conventional amplification primer so that the two strands of target DNA were amplified unevenly.

Preferred methods are the use of SDA, tSDA or homogeneous tSDA by real-time fluorescence. These methods are known to those skilled in the art and presented on p. ex. in US patents 5,547,861,
5,648,211,5,846,726, 5,919,630,5,928,869, 5,935,791 and 6,054,279, the results of which are specifically incorporated into the present patent by reference. the use of micro-electronic networks for the analysis of nucleic acids is known to those skilled in the art and presented in patents
US 5,605,662 and 5,632,957 and in the published PCT applications WO 96/01836 and WO 97/12030.

 Since nucleic acids do not need to be fully complementary to hybridize, it should be understood that the probe and primer sequences can be altered to some extent without loss of utility as probes and primers for SDA. For example, in the primer design of the present invention, the restriction endonuclease recognition site is between the 5 'target binding portion and the 3' target binding portion of the primer AA and may or may not be involved in hybridization with the target nucleic acid. As those skilled in the art are aware, hybridization of complementary and partially complementary nucleic acid sequences can be achieved by adjusting the hybridization conditions to increase or decrease strigence (e.g., adjusting pH or hybridization temperature or salt content of the buffer). This type of minor modification of the primer and probe sequences and any necessary adjustment of the hybridization conditions require only routine experimentation and remain within the scope of ordinary knowledge of the art.

 The amplification products generated using the primers presented here can be detected by a characteristic size, for example, on polyacrylamide or agarose gels stained with ethidium bromide. The sequences

<Desc / Clms Page number 18>

 amplified targets can also be detected using a test probe, namely an oligonucleotide carrying a detectable label. In one mode of application, at least one labeled test probe can be used for the detection of target sequences amplified by hybridization (detector probe) by hybridization and extension as described by Walker et al. (1992, Nucl. Acides Res. 20: 1691-1696) detector) or by hybridization, extension and conversion into a double-stranded form as described in European patent EP 0 678 582 (signal primer). Preferably, the test probe is selected to hybridize to a sequence of the target lying between the amplification primers, c. i.e. that it must be an internal test probe. An amplification primer or the target binding sequence of this primer can also be used as a test probe. Amplification and / or detection can be done on a micro-electronic network.

 The detectable marker of the test probe is a group which can be detected either directly or indirectly as an indication of the presence of the target nucleic acid. For direct detection of the marker, the test probes can be labeled with a radioisotope and detected by autoradiography or labeled with a fluorescent group and detected by fluorescence in accordance with known techniques. Test probes can also be detected indirectly by a label requiring the addition of additional reagents to be detected. Indirectly detectable markers include, for example, chemiluminescent agents, enzymes which produce visible reaction products and ligands (e.g. haptens, antibodies or antigens) which can be detected by binding to specific labeled binding molecules ( e.g. antibodies or antigens / haptens). Ligands are also used to immobilize the ligand-labeled oligonucleotide (capture probe) to the solid phase to facilitate its detection. Particularly useful markers are, inter alia, biotin (detectable by binding to avidin or labeled streptavidin) and enzymes such as horseradish peroxidase or alkaline phosphatase (detectable by adding enzyme substrates to produce colored reaction). The methods for adding this type of marker or for including this type of marker in the oligonucleotides are well known to those skilled in the art and all these methods are suitable for the present invention.

<Desc / Clms Page number 19>

 As an example of specific detection methods that can be used, a chemiluminescence method in which the amplified products are detected using a capture probe labeled with biotin and an detector probe conjugated to an enzyme as described in US Patent 5,470,723. After hybridization of these two test probes with different sites in the test region of the target sequence (between the binding sites of the two amplification primers), the complex is captured on a microtiter plate lined with streptavidin with using the capture probe and the chemiluminescent signal is developed and read in a luminometer. Another possibility of detection of the amplification products is a signal primer described in patent EP 0 678 582 and can be included in the reaction by SDA. In this application mode, the labeled secondary amplification products are created during SDA in a manner dependent on the amplification of the target and can be detected as an indication of amplification of the target using the associated marker.

 For commercial purposes, the amplification primers for the detection and specific identification of nucleic acids can be presented in the form of kits. In general, this type of kit contains at least one pair of amplification primers. Reagents for carrying out a nucleic acid amplification reaction can also be included with the target-specific amplification primers: buffers, additional primers, nucleoside triphosphates, enzymes, etc. The elements of the kit are presented together in a single package possibly including instructions for the realization of a specific mode of application of the methods of the invention. Other optional elements can also be included in the kit, such as p. ex. an oligonucleotide labeled with a marker suitable for use as a test probe and / or reagents or means for detecting the marker.

 The target binding sequences of the amplification primers confer specificity for species hybridization on the oligonucleotides and therefore species specificity for the amplification reaction. Thus, the target binding sequences of the amplification primers of the invention are also useful in other nucleic acid amplification protocols such as PCR techniques, conventional SDA (reaction scheme essentially identical to that tSDA but leads to lower temperatures using mesophilic enzymes), 3SR, NASBA and

<Desc / Clms Page number 20>

 TAS. In particular, any amplification protocol using specific cyclic hybridization of primers with the target sequence, extension of the primers using the target sequence as template and separation or displacement of the extension products from the target sequence, may employ the target binding sequences of the invention. For amplification methods that do not require specialized sequences that do not bind to the target (e.g.

PCR), the amplification primers may be only the target binding recognition sequences of the amplification primers, the site of the restriction endonuclease being replaced by a non-specific sequence of any target. According to this mode of application of the invention, amplification primers comprising a 5 ′ target binding sequence a non-target binding sequence - a 3 ′ specific target binding sequence are provided.

 Another mode of application of the present invention is directed to the above primers useful for amplification reactions other than SDA in which a primer has one or more mismatches (with respect to the target) in the specific region of target 3 ', p. ex. 1 to 10 nucleotides, preferably 1 to 3 nucleotides. These modified primers are useful for amplification and detection of mismatches (SNP assay) (Sommer S.S. et al., 1989 Mayo Clin. Proc. 64: 1361-1372).

 Other sequences, necessary for carrying out a selected amplification reaction, can also be added to the target binding sequences presented here without modifying the species specificity of the oligonucleotide. For other amplification reactions (eg 3SR, NASBA and TAS), the amplification primers may consist of the target binding sequence and other sequences necessary for the selected amplification reaction ( e.g. sequences required for SDA as described above or promoter recognized by RNA polymerase for the 3SR technique). The adaptation of the binding sequences to the target of the invention for amplification methods other than the SDA method is done by routine methods of preparation of amplification primers such as chemical synthesis and well known structural requirements. primers of the selected amplification reaction. The target binding sequences of the invention can therefore easily be adapted to the amplification and detection of the specific target Y. enterocolitica in numerous reactions

<Desc / Clms Page number 21>

 amplification using only routine methods for production, screening and optimization.

 In the context of SDA, bumper primers are essential for species specificity because they act to displace the primer products; species-specific downstream amplification of the target. It is necessary that the "bumpers" primers hybridize with the target upstream of the amplification primers so that when they are extended they displace the amplification primer and its extension product. The particular sequence of the “bumper” primer is therefore generally not critical and can be derived from any target sequence upstream which is sufficiently close to the binding site of the amplification primer to allow displacement of the product. extension of the amplification primer by extension of the "bumper" primer. Occasional mismatches with the target in the bumper primer sequence or cross hybridization with non-target specific sequences generally do not adversely affect the efficiency of amplification as long as the bumper primer remains able to hybridize with the specific target sequence.

 Amplification reactions using the primers of the invention may incorporate thymine as suggested by Walker et al. (1995, Nucl. Acids Res. 20: 1691-1696) entirely or partially replace TTP with 2'-deoxyuridine 5'-triphosphate in the reaction in order to limit cross-contamination of the following amplification reactions, p. ex. as disclosed in patent EP 0 624 643. dU (uridine) is incorporated into the amplification products and can be excised by treatment with UDG (uracil DNA glycosylase). These abasic sites prevent amplification of the amplification product in the following amplification reactions. UDG can be inactivated by the uracil DNA glycosylase inhibitor (UGI) before the next amplification is performed in order to prevent excision of dU in newly formed amplification products.

 SDA is an isothermal method of nucleic acid amplification during which the extension of primers, the break of a recognition / cleavage site of a hemimodified restriction endonuclease, the displacement of single-stranded extension products , the annealing of the primers to the extension products (or to the original target sequence) and the subsequent extension of the primers occur simultaneously in the reaction mixture. This is different from PCR, in which the stages of the

<Desc / Clms Page number 22>

The reaction takes place in separate phases or cycles due to the characteristics of the temperature cycles of the reaction. The SDA is based on
1) the capacity of a restriction endonuclease to break the unmodified strand of a hemiphosphorothioate form of the recognition / cleavage of its double strand and 2) the capacity of certain polymerases to initiate replication at the caesura and to displace upstream extension products. After an initial incubation at a high temperature (approximately 95 ° C.) to denature the double-stranded target sequences for annealing the primers, the polymerization and subsequent displacement of the newly synthesized strands take place at a constant temperature. The production of each new copy of the target sequence comprises five steps: 1) binding of the amplification primers to an original target sequence or to a previously polymerized displaced single-stranded extension product; 2) extension of the primers by a polymerase deficient in 5'-3 'exonuclease incorporating an α-thio-deoxynucleoside triphosphate (α-thio dNTP); 3) hyphenation of a hemimodified double strand restriction site; 4) dissociation of the restriction enzyme from the gap and 5) extension of the 3 'end of the gap by the polymerase deficient in 5'-3' exonuclease with displacement of the newly synthesized downstream strand. Hyphenation, polymerization and displacement occur simultaneously and continuously at a constant temperature because the extension of the hyphenation generates another breakable restriction site. When a pair of amplification primers is used, each of which hybridizes to one or both strands of the double stranded target sequence, the amplification is exponential. This is due to the fact that the sense and antisense strands serve as matrices for the opposite primer in subsequent cycles of amplification. When a single amplification primer is used, amplification is linear because a single strand serves as a template for primer extension. Examples of restriction endonucleases breaking their double-strand recognition / cleavage sites when an α-thio dNTP is incorporated: HINcII, Hindll, Downstream, Ncil and Fnu4HI. All of these restriction endonucleases and others which exhibit the required hyphenation activity can be used in conventional SDA. However, they are relatively thermolabile and lose their activity from around 40 C.

 SDA amplification targets can be prepared by fragmenting longer nucleic acids by restriction with an endonuclease which does not break the target sequence. However, it is generally preferred that the target nucleic acids having

<Desc / Clms Page number 23>

 recognition / cleavage of the restriction endonuclease selected for the hyphenation in the SDA reaction are generated as described by Walker, et al. (1992, Nucl. Acides Res. 20: 1691-1696) in US Patent 5,270,184 (attached for reference). In short, if the target sequence is double stranded, four primers are hybridized there. Two of the primers (S, and S2) are amplification primers for SDA and two (B1 and B2) are external primers or "bumper". S1 and S2 bind to opposite strands of double-stranded nucleic acids flanking the target sequence. B, and B2 bind to the target sequence on the 5 'side (upstream) of S1 and S2, respectively. The exonuclease deficient polymerase is then used to simultaneously extend the four primers in the presence of three deoxynucleoside triphosphates and at least one modified deoxynucleoside triphosphate (eg 2'-deoxyadenosine 5'-O- (1- thiotriphosphate), "dATPaS" ). The extension products of S, and S2 are thus displaced from the matrix of the original target sequence by extension of B, and B2.

 The single-stranded extension products displaced from the amplification primers serve as targets for binding of the opposite amplification primer and the bumper primer (eg, the product of S1 binds to S2 and B2) The following extension and displacement cycle results in the formation of double-stranded nucleic acid fragments having a hemimodified restriction endonuclease recognition / cleavage site at each end. These are substrates suitable for amplification. As in SDA, the individual steps of the target generation reaction are successive and continuous, generating target sequences having the recognition / cleavage sequences at the ends necessary for the hyphenation by the restriction enzyme in SDA. As all the components of the SDA reaction are already present in the target manufacturing reaction, the automatically and continuously produced target sequences enter the cycl e of SDA and are amplified.

 To avoid cross-contamination of one SDA reaction by amplification products of another, dUTP can be incorporated into DNA amplified by SDA in place of dTTP without inhibition of the amplification reaction. Nucleic acids modified by uracil can then be specifically recognized and inactivated by treatment with uracil DNA glycosylase (UDG). Thus, if dUTP is incorporated into DNA amplified by SDA during a previous reaction, all of the following SDA reactions can be treated with UDG before amplification of the double-stranded targets and any DNA

<Desc / Clms Page number 24>

 containing dU from previous amplified reactions will become impossible to amplify. The target DNA to be amplified in the following reaction does not contain dU and will not be affected by UDG. UDG can then be inhibited by treatment with UGI before amplification of the target. UDG can also be inactivated by heat. In tSDA, the higher temperature of the reaction itself (# 50 C) can be used simultaneously to inactivate the UDG and amplify the target.

 SDA requires a polymerase having no 5'-3 'exonuclease activity, initiating polymerization on a single-stranded break for double-stranded nucleic acids and moving the strand downstream of the break while generating a new complementary strand by using the intact strand as a template. The polymerase must extend by adding nucleotides to a free 3'-OH group. To optimize the SDA reaction, it is also desirable that the polymerase be highly reactive to maximize the length of the target sequence that can be amplified. The highly reactive polymerases are capable of polymerizing new strands of considerable length before dissociation and stopping the synthesis of the extension product. The displacement activity is essential to the amplification reaction because it makes the target available for synthesis of additional copies and generates the single-stranded extension product with which a second amplification primer can hybridize in the reactions. exponential amplification. The hyphenation activity of the restriction enzyme is also of great importance since it is the hyphenation which perpetuates the reaction and allows the initiation of the following cycles of amplification of the target.

 TSDA is essentially performed like the SDA described by Walker et al. (1992, Proc. Natl. Acad. Sci. USA 89: 392-396 and 1992, Nucl. Acids Res. 20: 1691-1696), with substitution of the desired thermostable polymerase and the thermostable restriction endonuclease. Of course, the reaction temperature will be adjusted to the higher temperature suitable for the substituted enzymes and the recognition site / cleavage of the restriction endonuclease Hincll will be replaced by the recognition / cleavage site of the restriction endonuclease suitable for the thermostable endonuclease selected. Also, unlike Walker et al., The practitioner may include the enzymes in the reaction mixture before the initial denaturation step if they are sufficiently stable at the denaturation temperature. The preferred restriction endonucleases for tSDA are

<Desc / Clms Page number 25>

BsrI, BstNI, BsmAl, BslI and BsoBI (New England BioLabs) and BstOI (Promega).
Preferred thermophilic polymerases are Bca (Panvera) and Bst (New
England Biolabs).

 Homogeneous tSDA by real-time fluorescence is a modification of tSDA. It uses detector oligonucleotides to produce fluorescence quenching in a target-dependent manner. The detector oligonucleotides contain a pair of donor / acceptor dyes linked so that fluorescence quenching occurs in the absence of a target. The unfolding or linearization of a secondary structure with intramolecular base pairings in the detector oligonucleotide in the presence of the target increases the distance between the dyes and reduces the quenching of fluorescence. Unfolding of the secondary structure with base pairing conventionally involves intermolecular base pairing between the sequence of the secondary structure and a complementary strand so that the secondary structure is at least partially destroyed. It can be completely linearized in the presence of a complementary strand of sufficient length. In a preferred embodiment, a restriction endonuclease recognition site (RERS) is present between the two dyes so that the intermolecular base pairing between the secondary structure and a complementary strand also makes the RERS double stranded. cleavable or breakable by a restriction endonuclease. Cleavage or hyphenation by the restriction endonuclease separates the donor and acceptor dyes into separate nucleic acid fragments, further contributing to a decrease in extinction. In both embodiments, an associated change in a fluorescence parameter (e.g., increased intensity of donor fluorescence, decreased intensity of acceptor fluorescence, or fluorescence ratio before and after unfolding) is followed as an indication of the presence of the target sequence. Detection of a change in the intensity of the fluorescence of the donor is preferred since this change is generally more important than the change in the intensity of the fluorescence of the acceptor.

Other fluorescence parameters, such as a change in the lifetime of the fluorescence, can also be followed.

 A detector oligonucleotide for homogeneous tSDA by real-time fluorescence is an oligonucleotide containing a 5 ′ or 3 ′ single-stranded section which hybridizes with the target sequence (target binding sequence) as well

<Desc / Clms Page number 26>

 as a secondary structure with intramolecular base pairings adjacent to the target binding sequence. The detector oligonucleotides of the invention further comprise a pair of donor / acceptor dyes linked to the detector oligonucleotide so that there is extinction of the fluorescence of the donor when the secondary structure is paired intramolecularly by base and so that the unfolding or linearization of the secondary structure results in a decrease in the extinction of fluorescence. The cleavage of an oligonucleotide designates the rupture of the phosphodiester bonds of the two strands of duplex DNA or the rupture of the phosphodiester bond of a single strand DNA. This is different from the hyphenation which designates the breaking of the phosphodiester linkage of a single strand of duplex DNA.

 The detector oligonucleotides of the invention for homogeneous tSDA by real-time fluorescence comprises a sequence which forms a secondary structure paired by bases intramolecularly under the reaction conditions selected for the extension or the hybridization of the primer. The secondary structure is adjacent to the target binding sequence of the detector oligonucleotide such that at least a portion of the target binding sequence forms a 3 'or 5' single stranded tail. The term "adjacent to the target binding sequence" is used herein in the sense that all or part of the target binding sequence is left single stranded in a 5 'or 3' tail available for hybridization with the target. That is, the secondary structure does not have the entire target binding sequence. Part of the target binding sequence may be involved in the intramolecular base pairing in the secondary structure, it may include all or part of a first sequence involved in the intramolecular base pairing in the secondary structure, it can include all or part of a first sequence involved in the intramolecular base pairing in the secondary structure but preferably does not extend into its complementary sequence. For example, if the secondary structure is a rod-loop structure (eg "hairpin") and if the target binding sequence of the detector oligonucleotide is present in the form of a 3 'single stranded tail , the target binding sequence can also extend via all or part of the first arm of the rod and, optionally, via all or part of the loop. However, the target binding sequence preferably does not extend into the second arm of the sequence involved in the intramolecular base pairing of the stem. That is, it is desirable to avoid

<Desc / Clms Page number 27>

 that the two sequences are involved in the intramolecular base pairing in a secondary structure capable of hybridizing with the target. Mismatches in the intramolecularly paired portion of the secondary structure of the detector oligonucleotide can reduce the magnitude of the fluorescence modification in the presence of the target, but this is acceptable if the sensitivity of the test is not problematic.

 Mismatches in the target binding sequence of the single-stranded tail are also acceptable but may also reduce the sensitivity of the assay and / or its specificity. However, it is a feature of the present invention that perfect base pairing in the secondary structure and in the target binding sequence does not compromise the reaction. Perfect matches in the sequences involved in the hybridization improve the specificity of the test without negative effects on the kinetics of the reaction.

 Once added to the amplification reaction, the signal primer detector oligonucleotides of the invention are converted into double-stranded form by hybridization and extension as described above. The strand displacement by the polymerase also results in an unfolding or linearization of the secondary structure and converts it into double strand form by synthesis of a complementary strand. The RERS, if present, also becomes double strand and cleavable or breakable by the restriction endonuclease. When the secondary structure is unfolded or linearized by the strand displacement activity of the polymerase, the distance between the donor dye and the acceptor dye is increased, which reduces the extinction of the fluorescence of the donor. The associated change in fluorescence of the donor dye or the acceptor dye can be followed or detected as an indication of amplification of the target sequence. Cleavage or hyphenation of the RERS generally further increases the importance of the fluorescence modification by producing two separate fragments of the double stranded secondary amplification product, each having one of the two dyes attached. These fragments are free to diffuse into the reaction solution, which further increases the distance between the dyes of the donor / acceptor pair. An increase in the intensity of the fluorescence of the donor or a decrease in the intensity of the fluorescence of the acceptor can be detected and / or followed as indicators that the amplification of the target is in progress or has taken place, but other fluorescence parameters that are affected by the proximity of the donor / acceptor dye pair

<Desc / Clms Page number 28>

 can also be followed. A change in the intensity of the fluorescence of the donor or the acceptor can also be detected in the form of a change in the ratio of the fluorescence intensities of the donor and / or the acceptor. For example, a change in fluorescence intensity can be detected in the form of a) an increase in the fluorescence ratio of the donor fluorophore after linearization or unfolding of the secondary structure and the fluorescence of the donor fluorophore in the oligonucleotide detector before linearization or unfolding, or b) an increase in the fluorescence ratio of the acceptor dye after linearization or unfolding and of the fluorescence of the acceptor dye in the detector oligonucleotide before linearization or unfolding.

 It will be apparent that the detector oligonucleotides of the invention will be suitable, in addition to SDA, for use as signal primers in other methods of amplification by primer extension (eg PCR, 3SR, TMA or NASBA). For example, the methods can be adapted for use in PCR using PCR amplification primers and DNA polymerase moving the strand without exonuclease activity 5 '-> 3' (eg Sequencing Grad Taq from Promega or exo Vend or exo Deep Vent from New England Biolabs) in the PCR. The signal primer detector oligonucleotides hybridize with the target downstream of the PCR amplification primers, are displaced and become double stranded essentially as described for SDA. In the PCR, any RERS can be selected for use in the detector oligonucleotide since there is no modified deoxynucleoside triphosphates present capable of inducing a hyphenation rather than a cleavage of the RERS. Since thermal cycles are one of the characteristics of PCR amplification, the restriction endonuclease is preferably added at low temperature after the final cycle of annealing the primer and extending the primer for the final detection of amplification. However, a thermophilic restriction endonuclease remaining active during the high temperature PCR phases may be present during amplification to allow for real-time testing. As in SDA systems, separation of the pair of dyes reduces fluorescence quenching with a change in a fluorescence parameter such as the intensity serving as an indication of target amplification.

 The change in fluorescence resulting from the unfolding or linearization of the detector oligonucleotides can be detected at a time

<Desc / Clms Page number 29>

 chosen from the reaction. However, since the linearized secondary structures are produced at the same time as the hybridization or the primer extension, the change in fluorescence can also be followed during the reaction, ie "in real time". This homogeneous method in real time can be used to provide semi-quantitative or quantitative information regarding the initial quantity of target present. For example, the rate at which the fluorescence intensity changes during the unfolding or linearization reaction (either as part of target amplification or in detection methods without amplification) is an indication of initial target concentrations. As a result, when a greater quantity of initial copies of the target sequence is present, the fluorescence of the donor more quickly reaches a selected threshold value (that is to say shorter time until positivity). The time required to decrease the fluorescence of the acceptor to reach positivity, defined as the time required to reach a selected minimum value, is also shorter. In addition, the rate of modification of the fluorescence parameters during the reaction is faster for samples containing larger initial amounts of target than for samples containing smaller initial amounts of target (i.e. slope more significant fluorescence curve). These or other measurements known to those skilled in the art can be used as indications of the presence of a target or as an indication of the amplification of the target. The initial quantity of target is typically determined by comparison of the experimental results for known quantities of target.

 Tests for the presence of a target sequence selected according to the methods of the invention can be carried out in solution or in the solid phase. Real-time or homogeneous end-point tests in which the detector oligonucleotide functions as a primer are typically carried out in solution. Hybridization tests using the detector oligonucleotides of the invention can also be carried out in solution (eg homogeneous tests in real time) but are also particularly well suited to solid phase tests for detection in real time or in target end point. In a solid phase test, the detector oligonucleotides can be immobilized in the solid phase (eg beads, membranes or test tube) by internal or terminal markers using methods known to those skilled in the art. For example, a detector oligonucleotide labeled with the

<Desc / Clms Page number 30>

 Biotin can be immobilized on a solid phase modified by avidin where it will produce a modification of fluorescence when it is exposed to the target under appropriate hybridization conditions. The capture of the target by this means facilitates the separation of the target from the sample and allows the elimination of substances in the sample which may interfere with the detection of the signal or any other aspect of the test. An example of a solid phase system that can be used is an electronic micro-network, that is to say a hybridization system on a programmable electronic matrix.

 A simplified version of the hybridization system on a programmable electronic matrix which can be used with the present invention is described as follows. Generally, a substrate carries a matrix or network of electronically addressable micro-locations. A permeable layer is placed on the individual electrodes. The permeable layer allows the transport of relatively small charged entities but prevents larger entities, such as DNA, from coming into direct contact with the electrodes. The permeable layer avoids the electrochemical degradation which would occur in DNA by direct contact with the electrodes. It also serves to avoid the strong non-specific adsorption of DNA to the electrodes. Attachment regions are provided on the permeable layer and provide specific binding sites for the target materials.

 For operation, a reservoir includes the space between the attachment regions which contains the desired (and unwanted) materials for detection, analysis or use. Charged entities, such as charged DNA, are located in the reservoir. In one aspect, the programmable active matrix system includes a method of transporting charged materials to one of the specific micro-locations. Once activated, a micro-location generates free field electrophoretic transport of any specific functionalized charged bonding entity towards the electrode. For example, if one electrode is made positive and the other negative, electrophoretic lines of force run between these two electrodes. The electrophoretic lines of force entail the transport of charged bonding entities which have a net negative charge towards the positive electrode. Charged materials with a net positive charge move under the action of the electrophoretic force towards the negatively charged electrode. When the negatively charged bonding entity which has been functionalized comes into contact with the fixing layer following this movement under the electrophoretic force,

<Desc / Clms Page number 31>

 the specific functionalized binding entity covalently binds to the fixing layer corresponding to the first electrode.

 Electrophoretic transport generally results from the application of a voltage, which is sufficient to allow electrolysis and the transport of ions in the system. Electrophoretic mobility results and current flows through the system, so that the ions are transported in the electrolytic solution. Thus, a complete circuit can be formed via the current flow of the ions, the rest of the circuit being completed by traditional electronic components, such as the electrodes and the controlled circuit assembly. For example, for an aqueous electrolytic solution containing conventional materials such as sodium chloride, neutral sodium phosphate, buffers and ionic species, the voltage which causes electrolysis and ion transport is greater than or equal to about 1 , 2 volts.

 It is possible to protect the fixing layers which are not subjected to the reaction by making the corresponding electrodes negative.

 This results in electrophoretic lines of force emanating from these attachment regions. The electrophoretic lines of force make it possible to separate the negatively charged bonding entities from the non-reactive fixing layer and towards the fixing layer corresponding to the first electrode. Thus, a "force field" protection is formed around the fixing layers which it is desired to be non-reactive with the molecules charged at this given time.

 One of the extremely advantageous results of this system is that the loaded bonding materials can be highly concentrated in regions adjacent to the signal binding layer. For example, if an individual micro-location is positively charged and the other micro-locations are negatively charged, the electrophoretic lines of force will cause the transport of link entities with a negative net charge to the positively charged micro-location. Thus, a method for concentrating and reacting analytes or products in reaction on a specific micro-location of the device can be obtained. After fixing the specific binding entities to the fixing layer, the underlying microelectrode can continue to operate in direct current (DC) mode. This unique feature allows relatively dilute charged analytes or free reaction molecules in the solution to be transported quickly, concentrated and reacted serially or

<Desc / Clms Page number 32>

 parallel to any micro-location maintained at the opposite charge to that of the analyte or reaction molecules. This possibility of concentrating a diluted analyte or of the reaction molecules on selected micro-locations greatly accelerates the reaction rates on these micro-locations.

 Once the desired reaction is complete, the potential of the electrode can be reversed, which creates an electrophoretic force in the direction opposite to the previous attractive force. Thus, non-specific analytes or non-reaction molecules can be excluded from the micro-location. Specific analytes or reaction products can be released from any micro-location and transported to other locations for further analysis, stored at other addressable locations or completely eliminated from the system. This withdrawal or deconcentration of materials by inversion of the field improves the system's ability to discriminate by causing the removal of non-specifically linked materials. By controlling the amount of non-repulsive electrophoretic force for nonspecifically bonded materials on the fixing layer, one can obtain control of electronic stringency. By increasing the electrical potential at the electrode so that a sufficient field is created to eliminate partially hybridized DNA sequences, which allows the identification of hybridizations with simple mismatches, mutations can be identified punctual.

 Operations can be carried out in parallel or in series on the different layers of fasteners. For example, a reaction may occur first on a first fixing layer, using the potentials as shown. The potential of a first electrode can be reversed, i.e. made negative, and the potential of the second adjacent electrode can be made positive. Thus, a serial reaction occurs. Materials which were not specifically bound to the first fixing layer will be transported by electrophoretic force to the fixing layer. Thus, the concentration aspect is used to provide high concentrations on this specific fixing layer when subjected to the positive electrophoretic force. The concentrated materials can then be transported to an adjacent fixing layer or the like. Several fixing layers can also be unprotected in the sense that there is a net electrophoretic force field emanating from the electrode by the fixing layer

<Desc / Clms Page number 33>

 towards the tank. By deprotecting the multiple fixing layer, multiplex reactions are carried out. Each individual site can serve in itself as a biological "test tube" since the particular environment treated by a given fixing layer may differ from the environments surrounding the other fixing layers.

In one embodiment, the permeable layer contains avidin and one of the SDA primers contains biotin. After amplification, the amplicons are sent electronically to the network and bind to avidin.
One or more labeled detector probes are then added and hybridize with the amplicons. The presence of hybridized detector probes is then detected. In a second embodiment, one or more capture probes are designed to hybridize with the amplified nucleic acid. Each capture probe contains biotin and is either linked to or addressed electronically to an array in which the permeable layer contains avidin. The amplicons are then sent electronically to the network and hybridize with the capture probes. One or more labeled detector probes are then added and hybridize with the amplicons. The presence of hybridized detector probes is then detected.

Further details regarding the electronic microgrid and associated systems are given by Heller et al. (1997, US Patent N
5,605,662; 1997, U.S. Patent No. 5,682,957; 1997, published PCT application N W097 / 12030) and Sosnowski et al. (1998, published PCT application N W098 / 10273) whose findings are specifically included here for reference.

 In addition, techniques using SDA and electronic micro-networks, including several test formats, are presented in the concurrently pending application, Serial No. 09 / 290,632, filed April 12, 1999, included here for reference. In one embodiment, described in this application, a sandwich test is used in which a single-stranded capture probe is electronically deposited on the network and is used to capture a strand of a charged molecule such as a target nucleic acid or an amplicon of this nucleic acid. Many molecules such as nucleic acid capture probes can be deposited electronically on different places in the network. Preferably, the hybridization of the target molecule or of the amplicon and of the capture probe must be carried out electronically. After capture of the charged molecule at the sites of

<Desc / Clms Page number 34>

 capture, the captured molecule can be detected by a labeled reporter probe that binds to the captured molecule.

 In a second embodiment described in this application, an electronic amplification is carried out on the micro-network. In this embodiment, the target nucleic acid is concentrated electronically near the anchored primers located at a capture site and used in SDA or another amplification method. Electronic hybridization is used to hybridize template molecules with anchored SDA primers. The microchips are then incubated with a reaction mixture for SDA which contains the components of SDA other than the matrix and the amplification primers.

After stopping the reaction, the products are denatured and the microchip is incubated with the reporter probes to detect the presence of target nucleic acid. These embodiments show that (a) the amplification can be practiced on an electronic micro-network and followed by an analysis and (b) that the amplification can be practiced in solution and followed by an analysis practiced on a microphone. - electronic network.

 The following examples illustrate specific embodiments of the invention described herein. As will be obvious to those skilled in the art, various changes and modifications are possible and are contemplated within the scope of the invention described.

EXAMPLE 1 Analysis of the Design of the Primer for Amplifications by SDA 1. Material K2HP04 (pH 7.6) MgOAc, deoxynucleotide 5'-triphosphate (dATP, dGTP, dTTP), 2'-deoxycytosine 5'-O- ( 1-thiotriphosphate) (dDTPaS), trehalose, BSA, restriction enzyme BsoB1, exo Bst DNA polymerase, genomic DNA from Yersinia enterocolitica (type 3, strain 89A7489), genomic DNA from human placenta, courtesy of Becton Dickinson (Becton Dickinson Microbiology Systems, Sparks, MD, USA). Calf thymus genomic DNA acquired from Sigma (St. Louis, MO, USA). All the oligonucleotides were synthesized by Synthetic Genetics (San Diego, CA, USA) and are presented in Table 1. The AAs were purified by PAGE

<Desc / Clms Page number 35>

and the other oligonucleotides were purified by HPLC. The reporter oligonucleotide probes were synthesized with a 5 'amine and conjugated to Texas Bodipy Red (BTR) by Nanogen. The capture probes were labeled with biotin at the 5 'end. Non-denaturing gels (TBE gel with 10% acrylamide) were purchased from Novex (San Diego,
CA, USA). The DNA molecular weight marker VIII was acquired from Boehringer Mannheim (Indianapolis, IN, USA). The Micro Bio-Spin chromatography column was purchased from Bio-Rad (Hercules,
CA, USA). Oligo Primer Analysis software, version 5.0, was acquired from
Wojcinch Rychlik National Biosciences (Plymouth, MN).

TABLE 1
Oligonucleotides
Primer sequence (SEQ ID NO :) ystAA1s CGATTCCGCTCCAGACTTCTCGGGCATCATTTGGAGCATTC (1) ystAA1A ACCGCATCGAATGCATGTCTCGGGTATACCTCAGCGGTTATT (2) ystAB1s TTGTTCTTGTGTTAA (3) ystAB1A AGGATCACAAGCTTG (4) ystAA2s AATGCTGTCTTCATTTGGAGCCTCGGGCCAAGAAACAGT (5) ystAA3s AATGCTGTCTTCATTTGGAGCCTCGGGCCAAGAAAC (6) ystAA2A GGAACGGAGGATCACAAGCTCTCGGGTATACCTCGAGCG (7) ystAA3A GGCAACGGAGGATCACAAGCTCTCGGGTATACCTCA (8) ystAB2s ATGAAAAAGATAGTTTTTGTTC (9) ystAB2A ATCCCAATCACTACTGAC (10) ystCs (Biot-) TCAGTGATGCATTATCGACA (11) YstRs (BTR-) CCAAGAAACAGTTTCAGGGC (12) Cs no (Biot-) CCAGCATCTTCAGCATCTTCTGTAAATTTACCACTAAC (13)
AA: amplification primer; AB: "bumper"primer; C: capture probe; R: reporter probe; S: sense: A: antisense; the BsoBI recognition site is in bold.

2. Amplification reactions by strand displacement
Genomic DNA from Y. enterocolitica was serially diluted in 100 ng / µl of calf thymus genomic DNA or genomic DNA from

<Desc / Clms Page number 36>

 human placenta. The final concentration of external genomic DNA was 0.5 g per reaction. The amplification reactions were carried out under the conditions described by Spargo et al. (1993, Mol. Cell. Probes 10: 247-256) with certain modifications. The SDA reactions were carried out in a volume of 50 l with a final concentration of 9.75 mM of MgOAc, 1.4 mM of dATP, dGTP, dTTP and dCTPaS respectively, 35 mM of K2HPO4, 4 g of BSA, 1 , 8% (w / v) of trehalose, 500 nM respectively of AA, 50 nM respectively of AB, 1.8 U of BsoB1 and 3.8 U of exo Bst. Before adding the mixture of enzymes (10 l containing 1.8 U of BsoB1, 3.8 U of exo Bst, 9% (w / v) of trehalose, 2 g of BSA and 87.5 mM of K2HP04), the incomplete reaction mixture (40 l) containing varying amounts of target genomic DNA was heated to 95 ° C for five minutes to denature the template, then two minutes to 60 ° C to cause annealing of the primers to the templates. After adding the mixture of enzymes, the reaction mixture was incubated at 60 ° C. for 30 minutes and then placed one to two minutes on ice to stop the reaction.

3. Detection of SDA products
After SDA, 5 l of the amplification reaction were poured onto a 10% denaturing gel and visualized by staining with ethidium bromide. The specificity of the products was detected by electronic hybridization with biotin-labeled capture probes located on a microelectronic network (Sosnowski et al., 1997. Proc. Nat. Acad. Sci. USA. 94: 1119-1123) . For the microelectronic network test (chip test), the sample was first desalted using Micro Bio-Spin chromatography columns according to the procedures described in the manufacturer's instructions for use. L-histidine was used as an exchange buffer. An aliquot of the desalted sample (20 l) was heated in boiling water for 5 minutes to denature the DNA and was placed on ice until use. The denatured sample was sent electronically to designated locations and the locations were washed with 50 mM L-histidine. A reporter probe labeled with BTR dissolved in 1xSTE was hybridized with the targets for 5 minutes at 22 C. After washing with STE, the cartridge was examined and the results were noted.

<Desc / Clms Page number 37>

4. Results
The original yst primer set (ystAA1s, ystAA1A, ystAB1s and ystAB1A, Table 1) used in this example is one of the most sensitive primer sets designed for use with the standard SDA method. There was no foreseeable interaction of the 3 'ends between these two AAs. The original primer set and the new design primer sets amplify a similar target region to minimize variation that may be due to amplification of different target sequences. The same reporter and capture probes were used for the on-chip tests. When the AAs were designed according to the method described here, an increase in the specific amplifications of the target and a decrease in the non-specific amplifications independent of the matrix were observed in comparison with the results obtained with the original primer set ( figure 3). To demonstrate that this increase in sensitivity and specificity was due to the use of the new AAs and not to the use of the new ABs, one of the original ABs was first replaced by one of the news AB. The results showed that there was no significant difference in SDA results between these two ABs (Figure 2.3 * versus 1 *). To see if the improvement observed was due to the differences in length of the amplified products, the method was used by replacing one of the original ABs and AAs with one of the new AAs and ABs. Products amplified after this substitution have exactly the same length as the original products. The results indicated that more target specific products were produced with the substituted primer set (Figure 2.2 * versus 1 *). Based on these results, it appears that the increase in sensitivity, specificity and results was due to the use of the new AA design scheme.

 As the 3 'portion of AA is involved in the interactions between primers and exponential PD amplifications, it was desirable to minimize the length of this portion in order to reduce the risk of interactions between primers and non-specific PD amplifications. AAs were designed having the same sequence on the 5 'side of the BsoBI recognition site but having different lengths at the 3' ends. The results indicated that effective target-specific amplifications were obtained with 3 'portion lengths between 12 and 9 bp (Figure 3). Efficiency was reduced when AAs having 3 'portions 6 bp in length were used. It is not surprising to find that

<Desc / Clms Page number 38>

 the efficiency of the amplification with the set of primers ystAA3s and ystAA3A is higher than that of the amplification with the set of primers ystAA2s and ystAA2A because there is an interaction of the 3 'end of the primers for 2 bp between ystAA2s and ystAA2A and there is no predictable interaction of the 3 'ends between ystAA3s and ystAA3A according to the Oligo software.

 SDA using primers designed according to the method described above was also compared to SDA using primers of standard design for the socB gene of Campylobacter, of the Shiga I toxin of E. coli and for the invA Salmonella gene. The results obtained are very similar to the results presented here. The time course of the SDA reaction was also tested. The results indicated that the target specific amplification products detectable were obtained after only 10 minutes of SDA at 60 C from 10 copies of the target. The number of products obtained reached its maximum in 25 to 30 minutes (Figure 4). Target specific detectable products were also obtained from 5 copies of target matrix. calf thymus genomic DNA or human placenta genomic DNA was used as external DNA to simulate clinical samples. There was a strong 115 bp amplification product band for the template-less negative control when genomic calf thymus DNA was present in this negative control (Figure 4A). This band also appeared when a lower number of copies of the target were used with the primer set ystAA3s and ystAA3A (Figure 3). The results of the chip tests showed that the product of this band did not interfere with specific target detection (Figure 4B). The product is believed to be the product of nonspecific interactions and amplifications between the background DNA and the primer set used.

 Primers were designed as described above and also containing a non-specific target sequence on the 3 'side of the BsoBI site between the BsoBI site and the specific target sequence 3'. The amplification primers ystAA5s and ystAA5A contained 6 nucleotides of a non-specific target sequence and 6 nucleotides of a target specific sequence on the 3 'side of the BsoB1 site. These primers have the following sequences in which the BsoBI recognition site is in bold, the random sequence is underlined and the target specific (binding) sequence is in italics: ystAA5s - AATgCTgTCTTCATTTggAgCCTCgggAggTCTCgggAggTCCAACAgT (SEQ ID NO: 14)

<Desc / Clms Page number 39>

ystAA5A - CggCTggTggCAACggAggATCTCgggTgCTCgTgTATA (SEQ
ID NO: 15)
An SDA using these amplification primers with “bumper” primers (ystAB2s and ystAB2A) was carried out and the results are presented in FIGS. 5A (gel electrophoresis) and 5B (detection on a chip). In comparison with SDA using amplification primers without specific target sequence 3 ′, it is seen that the same results were obtained for each reaction of SDA.

EXAMPLE 2
DNA mutliplex amplification and detection
1. Material.

 K2HP04 (pH 7.6) MgOAc, dATP, dGTP, dTTP, 2'-deoxycytosine 5'-0- (1-thiotriphosphate) (dDTPaS), trehalose, BSA, restriction enzyme BsoBI, exo Bst DNA polymerase, genomic DNA Yersinia enterocolitica (type 3, strain 89A7489), genomic DNA of Salmonella enterica (ATCC 10749), genomic DNA of E. coli (ATCC 43890) and genomic DNA from human placenta, courtesy of Becton Dickinson (Becton Dickinson Microbiology Systems, Sparks, MD, USA). The oligonucleotides were synthesized by Synthetic Genetics (San Diego, CA, USA) and are presented in Table 2. The amplification primers (AA) were purified by PAGE and the other oligonucleotides were purified by HPLC. The reporter probes were synthesized with 5 'amine and conjugated to Texas Bodipy Red (BTR). The capture probes were labeled with biotin at the 5 'end. The Micro Bio-Spin chromatography columns were purchased from Bio-Rad (Hercules, CA, USA). The non-denaturing gels (TBE gels containing 10% acrylamide) were purchased from Novex (San Diego, CA, USA). The DNA molecular weight marker VIII was acquired from Boehringer Mannheim (Indianapolis, IN, USA).

<Desc / Clms Page number 40>

TABLE 2 Oligonucleotide Primer Sequence (SEQ ID NO :) ystAA3s AATGCTGTCTTCATTTGGAGCCTCGGGGCCAAGAAAC (6) ystAA3A GGCAACGGAGGATCACAAGCTCTCGGGTATACCTCA (8) ystAB2s ATGAAAAAGATAGTTTTTGTTC (9) ystAB2A ATCCCAATCACTACTGAC (10) ystCs (Biot-) CATTATCGACACCAATAACC (11) ystRs (BTR) TTCAGGGCAGTTCAGTGATG (12) SLTIAAS TTATATGTGGCAGGATTTGTTCTCGGGACAAATAATG (16) SLTIAAA AGCTACTGTCACCAGACAATGCTCGGGCTGTTGTACCT (17) SLTIABS ACGGCTTATTGTTGAACGAA (18) SLTIABA CTGCAACACGCTGTAACGTG (19) SLTICs (Biot-) GGGATTCACATGTTACCTTTC (20) SLTIRs (BTR) TTTTTTATCGCTTTGCTGATT (21) invAAAs GTGTTTATGGGGTCGTTCTACCTCGGGAGAATCCTC (22) invAAAA TCAATCAAGATAAGACGGCTGCTCGGGATCGATAATG (23) invAABs CTGAATATCGTACTGGCGAT ( 24) invAABA TGGCGATAATTTCACCGGCATCG (25) invACs (Biot-) ACCACGCTCTTTCGTCTG (26) invARs (BTR-) TGCGGTACTGTTAATT (27) femAs (Biot-) CCAGCATCTTCAGCATCTTCTGTAAATTTACCACTAAC (13)
AA: amplification primer; AB: "bumper"primer; C: capture probe; R: reporter probe; S: sense; A: antisense; the BsoBI recognition site is in bold.

2. Amplification by strand displacement
The SDA amplification reactions were carried out under the conditions described in Example 1. Briefly, a standard SDA reaction was carried out in a volume of 50 l with a final concentration of 9.75 mM of MgOAc, 1, 4 mM of dATP, dGTP, dTTP and dCTPaS respectively, 35 mM of K2HP04 (pH 7.6), 4 g of BSA, 1.8% (w / v) of trehalose, 500 nM of each AA, 50 nM of each bumper primer (AB), 1.8 U of BsoB1, 3.8 U of exo Bst and various amounts of target genomic DNA. The

<Desc / Clms Page number 41>

Target DNA concentration was determined by measuring absorption at A260 and the DNA was diluted in 100 ng / l of genomic human placenta DNA. Human placenta genomic DNA (0.5 g) was used in each
SDA as external genomic DNA to simulate clinical samples.

 Before adding the enzyme mixture (10 l containing 1.8 U of BsoB1, 3.8 U of exo Bst, 9% (w / v) of trehalose, 2 g of BSA and 87.5 mM of K2HP04), the incomplete reaction mixture (40 l, containing all the other components of the SDA) was heated at 95 ° C. for 5 minutes to denature the matrices, then incubated for 2 minutes at 60 ° C. to allow annealing of the primers to the matrices. Then the enzyme mixture at room temperature was added to the incomplete reaction mixture. The reaction mixture was incubated at 60 ° C for 30 minutes and then placed one to two minutes on ice to stop the reaction.

3. Detection of SDA products
After the SDA reaction, the SDA products were visualized with ethidium bromide dye by electrophoresis on non-denaturing acrylamide gel with final confirmation by electronic hybridization to immobilized target-specific biotin-labeled capture probes on a network of Nanogen micro-electrodes as described in Example 1. A probe labeled with nonspecific biotin of the target (femA gene of Staphylococcus aureus) was also immobilized on the network as a negative control. For the on-chip test, aliquots of SDA samples were first desalted using Micro Bio-Spin chromatography columns according to the procedures described in the manufacturer's manual. Lhistidine (50 mM) was used as an exchange buffer. The desalted sample (20 l) was heated in boiling water for 5 minutes to denature the DNA and was left on ice until use. The denatured samples were sent electronically to designated locations for 30 seconds at 400 nA / location. The reporter probe labeled with BTR (500 nM in 1 XSTE) was added to the cartridge and hybridized with the DNA samples for 5 minutes at 22 C. After several washes with 0.2XSTE, the fluorescence of the cartridge was reviewed and the results noted.

<Desc / Clms Page number 42>

4. Results
Multiplex amplification is a strategy for simultaneously amplifying two or more sequences. Each amplification reaction is specific but several targets are amplified in a single reaction mixture. During multiplex amplification, the amplification efficiency of each matrix is different and some products are produced with greater efficiency than others. It is difficult to co-amplify several matrices without adjusting some of the conditions, especially when the number of copies used is low (Chamberlain & Chamberlain, 1994. The Polymerase
Chain Reaction, Mullis et al. (eds), Birkhauser, Boston, p. 38-46). One of the most effective methods is to adjust the concentration of each primer set. The amplification efficiency for each matrix of the triplex primer sets with the standard primer concentrations was first tested. Results indicated that the most effectively amplified gene was the gene
SLTI and that the least efficiently amplified was the invA gene (Figure 5). There are several reasons that may explain the variations in effectiveness. First, the melting temperature (Tf) of each set of primers is different.

 Second, Bst DNA polymerase may not incorporate dCsTP as effectively as native dCTP and different percentages of C in the arrays result in differences in amplification efficiency. Third, the efficacy of SDA is closely related to the size of the amplicon, the efficiency of amplification decreasing by 5 to 100 times for each 50 bp increase in target length (Walker, 1993, PCR Methods and Applications 3: 1-6). length of the unbroken amplicon is 93 bp for SLTI, 96 bp for yst and 103 bp for invA. Fourth, the interactions between primers are different for each individual primer set.

 Based on the results of SDA for monoplex amplification in triplex primer sets, several concentrations of primers were tested for co-amplification by keeping the primer concentration for invA intact and by changing the concentration of primers for yst and SLTI. An equivalent co-amplification of two or three targets was more successful when the AA / AB concentrations were reduced to 400 nM / 40 nM for yst and to 200 nM / 20 nM for SLTI. Other reaction parameters were not adjusted because we obtained results consistent with these reaction parameters to amplify several different target genes from different organisms, from bacteria to humans. With primer concentrations

<Desc / Clms Page number 43>

 described above, the three matrices were very well co-amplified and the target specific signals were detected from only 10 copies of the target (FIG. 7). It was also noted that the fluorescence signals for each target of co-amplifications of three matrices were stronger than those of co-amplifications of two matrices in triplex primer sets. Gel electrophoresis showed that there were fewer background bands in the amplification reaction of three arrays than in the amplification reaction of two arrays. It is estimated that this is due to a larger number of primers used for the target specific amplifications in the amplification reaction of three matrices and thus the number of free primers left for the interactions between primers and PD amplifications was less. When two arrays were amplified in triplex primer sets, the number of free primers left for non-specific amplification was greater.

 In summary, to design primers aimed at avoiding interactions between the primers and by adjusting the concentrations of primers, it is possible to amplify three or more target sequences by SDA and to obtain a sensitivity close to that of multiplex PCR without further adjustment of the reaction parameters.

 EXAMPLE 3 Manufacture of ssDNA by SDA 1. Methods K2HP04 (pH 7.6) MgOAc, dATP, dGTP, dTTP, 2'-deoxycytosine 5'-0- (1-thiotriphosphate) (dDTPaS), trehalose, BSA, restriction enzyme BsoBI, exo Bst DNA polymerase, genomic DNA from Yersinia enterocolitica and genomic DNA from human placenta, courtesy of Becton Dickinson (Becton Dickinson Microbiology Systems, Sparks, MD, USA). The primers were designed according to the method described here). The oligonucleotides were synthesized by Synthetic Genetics (San Diego, CA, USA) and are presented in Table 3. All the amplification primers were purified by PAGE and the other oligonucleotides were purified by HPLC. The reporter probes were synthesized with 5 'amine and conjugated to Texas Bodipy Red (BTR). The capture probes were labeled with biotin at

<Desc / Clms Page number 44>

 the 5 'end. The Micro Bio-Spin chromatography columns were acquired from Bio-Rad (Hercules, CA, USA).

TABLE 3 Oligonucleotide Primer Sequence (SEQ ID NO :) ystAA3s AATGCTGTCTTCATTTGGAGCCTCGGGGCCAAGAAAC (6) ystAA3A GGCAACGGAGGATCACAAGCTCTCGGGTATACCTCA (8) ystAA4A GGCAACGGAGGATCACAAGCTCTCGGGTAT (28) ystAB2s ATGAAAAAGATAGTTTTTTGTTC (9) ystAB2A ATCCCAATCACTACTGAC (IO) ystCA (Biot-) GGTTATTGGTGTCGATAATG (29) Ystra (BTR) CATCACTGAACTGCCCTGAA (30) ystCs (Biot-) CATTATCGACACCAATACC (11) ystRs (BTR-) TTCAGGGCAGTTCAGTGATG (12)
AA: amplification primer; AB: "bumper"primer; C: capture probe; R: reporter probe; S: sense; A: antisense; the BsoBI recognition site is in bold.

2. Amplification reactions by strand displacement
The amplification reactions were carried out under the conditions described in Example 1. Briefly, the SDA reactions were carried out in a volume of 50 l with a final concentration of 9.75 mM of MgOAc, 1.4 mM respectively dATP, dGTP, dTTP and dCTPaS, 35 mM K2HP04 (pH 7.6), 4 g of BSA, 1.8% (w / v) of trehalose, 500 nM of amplification primer 1 (ystAA3s), 250 nM stop primer (ystAA4A), 50 nM of each bumper primer, 1.8 U of BsoBI restriction enzyme, 3.8 U of exo Bst DNA polymerase and various copies of genomic DNA from Y. enterocolitica diluted in 100 ng / l of genomic DNA from human placenta. The final concentration of human placenta genomic DNA was 0.5 g per reaction. These components have been divided into two mixtures. Mix 1 (40 μl, containing MgOAc, dNTPs, matrices, primers, half of BSA and K2HPO4) was heated at 95 ° C. for 5 minutes to denature the matrix, then at 60 ° C. for two minutes to entrain the annealing of the primers and the dies then 10 l of the mixture 2 (containing the

<Desc / Clms Page number 45>

 rest of the SDA components) have been added. The reaction mixture was incubated at 60 ° C for thirty minutes and then placed one to two minutes on ice to stop the reaction.

3. Detection of SDA products
The SDA products were detected by passive or electronic hybridization with biotin-labeled capture probes placed on microelectrode arrays as described in Example 1. Briefly, the specific target oligonucleotide capture probe to biotin and the nonspecific target probe were addressed electronically to designated locations. Aliquots of the SDA samples were desalted using Micro Bio-Spin chromatography columns according to the procedures described in the manufacturer's instructions for use. L-histidine (50 mM) was used as an exchange buffer. For passive target hybridization, samples of
Non-desalted non-denatured SDA (20 l) were loaded into the cartridge and passively hybridized with the probes for 20 minutes at 37 C. For electronic hybridization, the desalinated samples were first denatured by heating in boiling water for five minutes. The samples were sent electronically to designated locations. The locations were washed with 50 mM L-histidine. The reporter probe labeled with BTR was passively hybridized with DNA. After washing with STE, the fluorescence of the cartridge was examined and the results were noted.

4. Results
If ssDNA has been produced, signals should only be detected when the reporter probe and the strand-specific capture probe of the amplified DNA have been used to detect SDA products by passive hybridization. No signal should be detected when another strand specific reporter and capture probes have been used. The experiment described in this example was designed to make sense ssDNA. The results indicated that signals were detected when reporter and capture antisense probes were used (Figure 8A). No signal was detected from the reporter and sense capture probes. The results demonstrated that ssDNA was made by this method. Weak signals also

<Desc / Clms Page number 46>

 were detected with conventional SDA for a starting target copy number of 102 (FIG. 8A). It is believed that the weak signals detected with conventional SDA were due to a slightly irregular amplification of the two strands.

Electronic hybridization is influenced by the salt concentrations in the samples. Desalination of the sample is necessary for electronic hybridization. When desalinated samples were used for electronic hybridization, the signals were stronger in comparison with the results of passive hybridization (Figure 8B), which means that part of the amplified DNA was double stranded well that the numbers of absolute signals can sometimes be misleading due to the different cartridges and the different hybridization conditions. The signals from asymmetric SDA products were stronger than the signals from conventional SDA products even by electronic hybridization because a certain percentage of denatured DNA again forms annealing with dsDNA under our hybridization conditions and because the amount of dsDNA generated by asymmetric SDA was lower. Using the same principles to make ssDNA for the sense strand of the yst gene and the SLTI gene of E. coli, similar results have been obtained.

 In summary, this example describes a simple SDA method for generating ssDNA. No optimization of the conditions was necessary for the individual DNA templates. This method can be used to fabricate detectable amounts of ssDNA for on-chip testing. This method provides more information to develop a fully integrated instrument capable of practicing amplification and detection.

EXAMPLE 4 Primers for Amplification by SSDA
In accordance with the present invention, primers have been designed for the Campylobacter sodB gene, for the E. coli Shiga II toxin gene (SLTII) and for the Shigella ipaH gene. These primers are shown in Table 4. Successful SDA amplifications were performed using these primers.

<Desc / Clms Page number 47>

TABLE 4 sets of primers Primer Sequence (SEQ ID NO :) sodBAAs gCTACAggAgTTTTTggTTCACTCgggTTTTggTTAgT (31) sodBAAA TAAAggAACTTTATCTTCAgTCTCgggTgTAgCTgCgT (32) sodBABs CAAAgCTgAATTTATCAAAg (33) sodBABA CATgTTCCCAAACATCTACA (34) SLTIIAAs CCACTCTgCAACgTgTCgCAgCTCgggAACCTTCCggAA (35) SLTIIAAA ATTACCACTgAACTCCATTAACTCgggATAAgATgAAA (36) SLTIIABs TCCATgACAACggACAgCAg (37) SLTIIABA TCTggATgCATCTCTggTCA (38) ipaHAAs ggTTCCCggAAAACAAACAATCTCgggTATCACAgA (39) ipaHAAA gAgACggTATCggAAAggCggCTCgggGggggggggggggggggggggggggggg
AA: amplification primer; AB: "bumper"primer; C: capture probe; R: reporter probe; S: sense; A: antisense; the 3soBI recognition site is in bold.

Claims (24)

1. Oligonucleotide useful for a primer extension reaction characterized in that it comprises a 5 ′ target binding sequence, a sequence which does not bind to the target and a 3 ′ target binding sequence. 2. Oligonucleotide according to claim 1 characterized in that the 5 ′ target binding sequence comprises 1 to 50 nucleotides. 3. Oligonucleotide according to claim 1 characterized in that the 3 ′ target binding sequence comprises 5 to 30 nucleotides. 4. Oligonucleotide according to claim 1 characterized in that the sequence not binding to the target comprises 1 to 30 nucleotides. 5. Oligonucleotide according to claim 1 characterized in that the primer extension reaction is the amplification by strand displacement and whose sequence not binding to the target is the recognition site of a restriction enzyme broken by a restriction enzyme during strand displacement amplification. 6. Oligonucleotide according to claim 1 characterized in that 1 to 10 nucleotides of the 3 ′ target binding sequence is (are) a mismatch. 7. Pair of amplification primers characterized in that it comprises: a) a first primer comprising a 5 ′ target binding sequence, a sequence which does not bind to the target and a target binding sequence 3 'and b) a second primer comprising a 5' target binding sequence, a non-target binding sequence and a 3 'target binding sequence. 8. Kit characterized in that it comprises: a) a pair of amplification primers according to claim 7 and b) one or more detectors capable of detecting an amplified product. <Desc / Clms Page number 49> 9. Method for detecting the presence or absence of a target nucleic acid in a sample, characterized in that it comprises the following steps: a) processing of said sample using a pair of primers nucleic acid by a primer extension reaction in which a first primer comprises a 5 'target binding sequence, a non-target binding sequence and a 3' target binding sequence and a second primer comprises a 5 'target binding sequence, a non-target binding sequence and a 3' target binding sequence and b) the detection of any amplified nucleic acid product, in which the detection of the amplified product indicates the presence of target nucleic acid.  10. The method of claim 9 characterized in that said 3 ′ target binding sequences include mismatches.  11. The method of claim 9 characterized in that said primer extension reaction is a strand displacement amplification and said sequence not binding to the target is the recognition site of a restriction enzyme broken by a restriction enzyme during amplification by strand displacement. 12. Method for amplifying a target nucleic acid sequence of a target nucleic acid, characterized in that it comprises the following steps: a) hybridization with nucleic acid i) of a first primer d 'amplification comprising a 5' target binding sequence, a non-target binding sequence and a 3 'target binding sequence and ii) a second amplification primer comprising a binding sequence 5 ′ target, a sequence which does not bind to the target and a 3 ′ target binding sequence and b) the extension of the first and second amplification primers hybridized to the target nucleic acid sequence during a primer extension reaction by which the target nucleic acid sequence is amplified. <Desc / Clms Page number 50> 13. The method of claim 12 characterized in that said target binding sequences 3 'include mismatches.  14. The method of claim 12 characterized in that it further comprises the detection of the target nucleic acid amplified by hybridization with a detector probe. 15. The method of claim 12 characterized in that said primer extension reaction is an amplification by strand displacement and said sequence not binding to the target is the recognition site of a restriction enzyme broken by a restriction enzyme during amplification by strand displacement. 16. Method for manufacturing single-stranded DNA during a primer extension reaction, characterized in that it comprises the following steps: a) hybridization with a nucleic acid i) of a first primer of amplification comprising a 5 ′ target binding sequence, a sequence which does not bind to the target and a 3 ′ target binding sequence, ii) of a second amplification primer comprising a binding sequence to the 5 ′ target, a sequence which does not bind to the target and a 3 ′ target binding sequence for which the 3 ′ target binding sequence comprises 2 to 7 nucleotides of the 3 ′ target binding sequence said first primer and iii) a third amplification primer comprising a 5 'target binding sequence, a non-target binding sequence and a 3' target binding sequence; and b) extending the first, second and third amplification primers with the target nucleic acid sequence during a primer extension reaction in which single stranded DNA complementary to the sequence of target nucleic acid is amplified. 17. The method of claim 16 characterized in that said primer extension reaction is amplification by strand displacement and said sequence not binding to the target is the recognition site of an enzyme <Desc / Clms Page number 51>  restriction broken by a restriction enzyme during strand displacement amplification.  18. DNA molecule characterized in that it comprises an oligonucleotide selected from the group comprising the oligonucleotides of sequences SEQ I D Nos: 1 to 42.  19. DNA molecule according to claim 18 characterized in that said oligonucleotide is chosen from the group comprising oligonucleotides of sequences SEQ ID Nos: 1, 2, 5-8, 14-17.22, 23, 28.31, 32.35, 36.39 and 40. 20. DNA molecule according to claim 18 characterized in that said oligonucleotide is chosen from the group comprising oligonucleotides of sequences SEQ ID Nos: 3, 4, 9,10, 18, 19, 24, 25, 33, 34, 37, 38, 41 and 42 21. DNA molecule according to claim 18 characterized in that said oligonucleotide is chosen from the group comprising the oligonucleotides of sequences SEQ ID Nos: 11, 20, 26 and 29. 22. DNA molecule according to claim 18 characterized in that said oligonucleotide is chosen from the group comprising the oligonucleotides of sequences SEQ ID Nos: 12, 21, 27 and 30. 23. DNA molecule according to claim 18 characterized in that said oligonucleotide is chosen from the group comprising the oligonucleotides of sequences SEQ ID No: 13. 24. DNA molecule according to claim 19 characterized in that the restriction site of the restriction endonuclease CTCGGG is replaced by a sequence which does not bind to the target.