WO1995032719A1

WO1995032719A1 - Use of oligonucleotide phosphorothioate for depleting complement and for reducing blood pressure

Info

Publication number: WO1995032719A1
Application number: PCT/US1995/006161
Authority: WO
Inventors: Wayne M. Galbraith; Sudhir Agrawal
Original assignee: Hybridon, Inc.
Priority date: 1994-05-27
Filing date: 1995-05-19
Publication date: 1995-12-07
Also published as: EP0760666A1; JPH10501224A; AU2591495A; CA2191192A1

Abstract

Disclosed are methods of reducing the blood pressure, stimulating vasodilation, and depleting complement, in a primate. These methods involve administering an oligonucleotide to the primate, and then measuring the decrease in blood pressure or complement activity. The oligonucleotide being administered is 2 to 50 nucleotides in length and has at least one phosphorothioate internucleotide linkage.

Description

Use of ol igonucl eotide phosphorothloate for depleting complement and for reducing blood pressure

BACKGROUND OF THE INVENTION

This invention relates to the effect of synthetic oligonucleotides on in vivo complement activation and the results thereof . More specifically, this invention relates to methods of depleting complement , using synthetic oligonucleotides , which will lower blood pressure and trigger vasodilation.

The complement system is a cascading series of about 20 different plasma enzymes, enzyme precursors, regulatory proteins, and proteins capable of cell lysis and involved in the normal immune system response to foreign cells and in the abnormal immune system response to the individual's own cells. All of these proteins are normally present in the plasma and among the plasma proteins that leak out of capillaries into tissue spaces. The enzyme precursors are normally inactive, but can be activated via two separate pathways: the classical pathway utilizing complement components Cl, C4, and C2; and the alternate pathway, via factors D, C3, and B. Both modes of activation lead to cleavage and activation of component C3. Fragment C3b split from C3, is necessary for the activation of the terminal complement components C5-C9. These form the membrane attack complex which, when inserted into cell membranes, brings about osmotic lysis of foreign cells, and in the case of autoimmune states, lysis of the affected organism's own cells.

Activation of the complement cascade results not only in cell lysis, but also in opsomization and phagocytosis of bacteria by macrophages and neutrophils, agglutination of invading organisms, neutralization of some viruses, chemotaxis of neutrophils and macrophages caused by C5a, activation of basophils and mast cells, and inflammation (Guyton, Textbook of Medical Physiology , .B. Sauders Co., Philadelphia (1991) pp. 374-384) . Mast cell and basophil activation, followed by histamine release, are triggered by fragments C3a, C4a, and C5a, which are enzymatically split off from C3, C4, and C5. Neutrophil margination, hemocentration, and release of vasoactive peptides have also been reported following rapid activation of the complement pathways. (Arnaout et al. (1985) N. Eng. J. Med. 312:457-462) .

The lytic and other activities of complement are also involved in a number of disease states including various autoimmune disorders such as rheumatoid arthritis. Rheumatoid arthritis is a chronic multisystem disease whose common clinical manifestation is persistent inflammatory synovitis of the peripheral joints resulting in proliferation of synovial cells and subsequent pannus formation, cartilage destruction, bone erosion, and ultimately joint deformity and loss of joint function. This disorder affects approximately 1% of the population of the United States and Europe as well as 0.2 to 0.4% of the Japanese population, with women being affected about three times more often than men.

Therapy has included salicylic acid and other nonsteroidal anti-inflammatory drugs, simple analgesics, and low dose glucocorticoids to control symptoms of the inflammatory process, but none of these have been successful in arresting the progression of rheumatoid arthritis (Lipsky in Harrison's Principles of Internal Medicine (llth ed.)

(Braunwald et al. , eds.) McGraw-Hill Book Co., New York, New York (1987) pp. 1423-1428) . A number of different disease-modifying drugs such as gold compounds, D-penicillamine, glucocorticoids, cytotoxic immunosuppressive drugs, and antimalarials have been used alone and in combination with nonsteroidal anti-inflammatory drugs for analgesic and anti-inflammatory effects (Lipsky, ibid. ) . However, the drugs used thus far are somewhat toxic and have failed to demonstrate a consistent advantage of one over the other. Furthermore, none of these drugs have been demonstrated to alter the course of the disease. Thus, there is a need for treatments which not only reduce the symptom of rheumatoid arthritis, but also which arrest the disease.

Certain complement factors are potent vasodilators which can affect blood pressure and disorders related thereto such as hypertension.

Hypertension is a prevalent health problem in many developed countries. Many patients with hypertension die prematurely, with the most common cause of death being heart disease, stroke, and renal failure. Treatment typically consists of nondrug therapeutic intervention including stress relief, diet, weight reduction, regular aerobic exercise, and the administration of antihypertensive drugs including diuretics, antiadrenergic agents, vasodilators, calcium channel blockers, and angiotensin-converting enzyme (ACE) inhibitors. (Gordon Williams in Harrison 's Principles of Internal Medicine, 131h

Ed. (Isselbacher, et al. , eds. ) (1994) McGraw-Hill, Inc., NY) , pp. 1116-1131.

There is a need to develop means for controlling the complement system which enable components of the system to be channeled into constructive uses, such as in treating complement- sensitive autoimmune and blood pressure related disorders.

Various animal models have been used to study the complement system and diseases resulting from the lack or overproduction of various complement components. These models have been prepared by the administration of cobra snake venom, which results in the depletion of their complement . However, the venom contains components other than those which interact with the complement system. Thus, the resulting animal response may not be due solely to the presence of complement-interacting components.

Accordingly, a better complement-deficient animal model is needed whose disease state has only been caused by interaction with complement- depleting factors.

SUMMARY OF THE INVENTION

It has been discovered that rapid, bolus infusion of an oligonucleotide with phosphorothloate intemucleotide linkages results in a depletion of complement in a recipient primate. This depletion of complement has been found to reduce the blood pressure of a recipient primate, while transiently decreasing its neutrophil and total white blood cell counts. These surprising discoveries have been exploited to develop the present invention which includes methods of depleting complement, reducing the blood pressure, and stimulating vasodilation in a primate.

The methods each involve the administration of an oligonucleotide phosphorothloate (a"PS- oligonucleotide") having a sulphur substitution for one of the oxygens in at least one non- bridging phosphodiester intemucleotide linkage. In some aspects of the invention, the oligonucleotide has only phosphorothloate intemucleotide linkages.

As used herein, the term "oligonucleotide" is meant to encompass two or more nucleotides wherein the 5' end of one nucleotide and the 3' end of another nucleotide are covalently linked. The oligonucleotides useful in the methods of the invention are from 2 to 50 nucleotides in length, with oligonucleotides having 6 to 50, and more preferably, 20 to 33 nucleotides in length being most useful in some embodiments. In other embodiments of the invention, the oligonucleotide has at least one deoxyribonucleotide or at least one ribonucleotide. In yet other embodiments, the oligonucleotides are chimeric, i.e., have a combination of both deoxyribonucleotides and ribonucleotides in any location or order in the molecule.

In some embodiments of the invention, the oligonucleotides are modified. The term "modified oligonucleotide" is used herein as an oligonucleotide in which at least two of its nucleotides are covalently linked via a synthetic linkage, i.e., a linkage other than a phosphodiester between the 5' end of one nucleotide and the 3' end of another nucleotide in which the 5' nucleotide phosphate has been replaced with any number of chemical groups. Preferable synthetic linkages include, in addition to phosphorothioates, linkages such as alkylphosphonates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphoramidites, phosphate esters, carbamates, carbonates, phosphate triesters, acetamidate, 2-0- methyls, and carboxymethyl esters. These linkages can be present anywhere in the oligonucleotide structure, and more than one type of linkage can be present in a single oligonucleotide (i.e., a hybrid oligonucleotide) . The term "modified oligonucleotide" also encompasses oligonucleotides with a modified base and/or sugar. For example, a 3', 5' -substituted oligonucleotide is a modified oligonucleotide having a sugar which, at both its 3' and 5' positions is attached to a chemical group other than a hydroxyl group (at its 3' position) and other than a phosphate group (at its 5' position) . A modified oligonucleotide may also be a capped species. In addition, unoxidized or partially oxidized oligonucleotides having a substitution in one nonbridging oxygen per nucleotide in the molecule are also considered to be modified oligonucleotides. Also considered as modified oligonucleotides are oligonucleotides having nuclease resistance-conferring bulky substituents at their 3' and/or 5' end(s) and/or various other structural modifications not found in vivo without human intervention are also considered herein as modified.

Oligonucleotides which are self-stabilized are also considered to be modified oligonucleotides useful in the methods of the invention (Tang et al. (1993) Nucleic Acids Res.

21:2729-2735) . These oligonucleotides comprise two regions: a target hybridizing region; and a self-complementary region having an oligonucleotide sequence complementary to a nucleic acid sequence that is within the self- stabilized oligonucleotide.

In preferred embodiments, the oligonucleotide is administered as a bolus intravenous infusion at a constant rate of about 30 to 120 milligram oligonucleotide per kilogram recipient per hour (mg/kg/hr) . In some methods, the oligonucleotide is administered at a constant rate of about 30 mg/kg/hr, while in others, it is administered at about 40 mg/kg/hr. Yet other methods of the invention require the administration of about 5 to 20 mg/kg oligonucleotide over a 10 minute period, while others require about 80 mg/kg over a 120 minute period.

In the methods of reducing blood pressure and of causing vasodilation, the blood pressure of the recipient primate is measured after the administration of the oligonucleotide. In preferred embodiments, the blood pressure, is measured 15 to 35 minutes after administration.

In the method of depleting complement, complement activity in a blood sample taken from the recipient primate is measured after the administration of the oligonucleotide. In preferred embodiments, the complement activity is measured 10 to 60 minutes after administration.

BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. 1 is a mean arterial blood pressure profile of animals following intravenous administration of PS-oligonucleotide over a 10 minute period, beginning at time zero;

FIG. 2 is a mean arterial blood pressure profile of animals following intravenous administration of PS-oligonucleotide over a 120- minute period, beginning at time zero;

FIG. 3A is a graph showing the heart rate

(-) and mean arterial pressure (♦) of monkeys following administration of a single dose of saline over a 10 min. period;

FIG. 3B is a graph showing the heart rate

(-.) and mean arterial pressure (♦) of monkeys following administration of a single dose of PS- oligonucleotide at 0.5 mg/kg of the mammal over a 10 min. period; FIG. 3C is a graph showing the heart rate (_) and mean arterial pressure (♦) of monkeys following administration of a single dose of PS- oligonucleotide at 1 mg/kg of the mammal over a 10 min. period;

FIG. 3D is a graph showing the heart rate (-) and mean arterial pressure (♦) of monkeys following administration of a single dose of PS- oligonucleotide at 2 mg/kg of the mammal over a 10 min. period;

FIG. 3E is a graph showing the heart rate (-) and mean arterial pressure (♦) of monkeys following administration of a single dose of The

GG oligonucleotide at 5 mg/kg of the mammal over a ten min. period;

FIG. 3F is a graph showing the heart rate (-) and mean arterial pressure (♦) of monkeys following administration of a single dose of PS- oligonucleotide at 10 mg/kg of the mammal over a 10 min. period;

FIG. 3G is a graph showing the heart rate

(-) and mean arterial pressure (♦) of monkeys following administration of a single dose of PS- oligonucleotide at 20 mg/kg of the mammal over a 10 min. period; FIG. 4 is a graph showing the level of complement (CH50) activity in animals following administration of various doses of PS- oligonucleotide intravenously over a ten minute period,-

FIG. 5 is a graph showing the level of complement (C5a) in animals following intravenous administration of various doses of PS- oligonucleotide over a 10 minute period;

FIG. 6A is a graph showing the level of complement (CH50) activity in human serum following the administration of various concentrations of PS-oligonucleotide; and

FIG. 6B is a graph showing the level of complement (CH50) activity in serum from animals following administration of various concentrations of PS-oligonucleotide.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The following description is intended to further illustrate certain preferred embodiments of the invention and is not intended to limit the scope of the invention. The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued U.S. patent and allowed applications and references cited herein are hereby incorporated by reference.

The present invention provides methods of depleting complement in a primate, which are useful, for example, in producing animal models that lack complement . Such animal models are of great value in examining the role of complement in various types of immune and other responses. Methods of depleting complement are also useful in slowing or inhibiting inflammation, and in reducing the lytic effects of various autoimmune disorders such as rheumatoid arthritis. The present invention also provides methods of decreasing blood pressure and causing vasodilation in a primate. Such methods are useful in treating acute hypertension, a disease common in developed countries.

In the present invention, complement is depleted, blood pressure is reduced, and vasodilation is induced in a subject, by the administration of an oligonucleotide phosphorothloate having a sulphur substitution for one of the oxygens at least one non-bridging oxygen of a phosphodiester intemucleotide linkage (PS-oligonucleotide) .

PS-oligonucleotides display resistance to enzymatic degradation, and have been studied extensively in the development of antisense oligonucleotide-based therapeutics (see e.g. , Zamecnik, Prospects for Antisense Nucleic Acid Therapy of Cancer and AIDS, Wickstrom, E., Ed., Wiley-Liss, Inc., New York, New York, Vol. 1, 1991) . For example, PS- oligonucleotides have been used as antiviral agents (see, e.g. , Agrawal (1992) Trends Biotech.

10:152-158) , anti-cancer agents (see, e.g. , Ratajczak et al. (1991) Proc. Natl. Acad. Sci. (USA) 89:11823-11827; Bayever (1993) Antisense Res. Dev. 3:383) and anti-parasitic agents (see, e.g. , Rappaport et al. (1993) Proc. Natl. Acad. Sci. (USA) 89:8577-8580) in various in vitro model systems. In addition, PS-oligonucleotides have been employed in regulating the expression of a number of cellular gene targets (see, e.g. , Stein et al . (1993) Science 261:1004) .

The PS-oligonucleotides used in the methods of the invention are composed of deoxyribonucleotides, ribonucleotides, or a combination of both, with the 5' end of one nucleotide and the 3' end of another nucleotide being covalently linked. These oligonucleotides are at least 6 nucleotides in length, but are preferably 10 to 50 nucleotides long, with 20 to 33mers being the most common. Some useful PS-oligonucleotides have one phosphorothloate linkage located between any two neighboring nucleotides in the molecule. Other PS-oligonucleotides have more than one phosphorothloate linkage between nucleotides scattered throughout the molecule or contiguously located. Yet others have only phosphorothloate linkages.

The oligonucleotides useful in the methods of the invention may also be modified in a number of ways without compromising their ability to function in the methods of the invention. For example, the oligonucleotides may contain, in addition to at least one phosphorothloate linkage, an intemucleotide linkage other than a phosphorothloate inte ucleotide linkage between the 5' end of one nucleotide and the 3' end of another nucleotide. In such a linkage, the 5' nucleotide sulfur (in the case of a phosphorothloate) has been replaced with any number of chemical groups. Examples of such chemical groups include alkylphosphonates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters .

Other modifications include those which are internal or at the end(s) of the oligonucleotide molecule and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins . Examples of such modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3', 5' -substituted oligonucleotide having a sugar which, at both its 3' and 5' positions is attached to a chemical group other than a hydroxyl group (at its 3' position) and other than a phosphate group (at its 5' position) . Other modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3' and/or 5' end(s) , or have a substitution in one nonbridging oxygen per nucleotide. Such modifications can be at some or all of the intemucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule.

Yet other useful oligonucleotides include those that are self-stabilized, as described in Tang et al. (Nucleic Acids Res. (1993) 21:2729-2735) .

Such oligonucleotides have a target hybridizing region and a self-complementary region having an oligonucleotide sequence complementary to a nucleic acid sequence that is within the self- stabilized oligonucleotide.

The preparation of these unmodified and modified oligonucleotides is well known in the art (reviewed in Agrawal et al. (1992) Trends Biotechnol. 10:152-158) . For example, nucleotides can be covalently linked using art-recognized techniques such as phosphoramidate, H-phosphonate chemistry, or methylphosphoramidate chemistry (see, e.g., Uhlmann et al. (1990) Chem. Rev. 90:543-584; Agrawal et al . (1987) Tetrahedron. Lett. 28 : (31) :3539-3542) ; Caruthers et al. (1987) Meth. Enzymol. 154:287-313; U.S. Patent 5,149,798) . Oligomeric phosphorothloate analogs can be prepared using methods well known in the field such as methoxyphosphoramidite (see, e.g. , Agrawal et al . (1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083) or H-phosphonate (see, e.g. , Froehler (1986) Tetrahedron Lett. 27:5575-5578) chemistry. The synthetic methods described in Bergot et al . (J. Chromatog. (1992) 559:35-42) can also be used.

Examples of useful oligonucleotide used in this study include those listed below in TABLE 1 and set forth in the Sequence Listing as SEQ ID NOS:1-6.

TABLE 1

Oliqo Sequence SEQ ID

NO: GG (25mer) CTCTCGCACCCATCTCTCTCCTTCT 1 20mer CTCTCGCACCCATCTCTCTC 2

20mer CUCUCGCACCCAUCUCUCUC 3

27mer ATCGAATATTTCAGAGATATCTTCCAT 4 27mer AUCGAATATTTCAGAGATATCTUCCAT 5 33mer CTCTCGCACCCATCTCTCTCCTTCTGGAGAGAG 6

However, other useful oligonucleotides can have any nucleotide sequence, as the effects caused by the administration of these oligonucleotides is not sequence specific. The "GG" oligonucleotide (SEQ ID N0:1) is complementary to the gag initiation codon of HIV-1 (Agrawal and Tang (1992) Antisense Res. Dev. 2:261) . The other five oligonucleotides are phosphorothioates varying in length from 20 to 33 nucleotides. The 25mers tested were a mixture of 4²⁴ 25mer random sequences (25mer random) . The 25-mer random was synthesized by using a mixture of A, C, G, and T for each coupling during synthesis.

In the methods of the invention, the oligonucleotides are administered via intravenous injection to the subject in the form of a therapeutic formulation which contains at least one PS-oligonucleotide as described above, along with a physiologically acceptable carrier.

As used herein, a "physiologically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art . Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile. It must be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacterial and fungi. The carrier can be a solvent or dispersion medium. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents. Prolonged absorption of the injectable therapeutic agents can be brought about by the use of the compositions of agents delaying absorption.

The therapeutic formulation is injected intravenously in one bolus, which may be repeated at various time intervals as needed. The rate of injection is dependent on the amount of oligonucleotide being administered, with 30 to 120 mg per kg weight of the recipient per hour being in the acceptable range. For example, a bolus administration of 5 to 20 mg/kg over a 10 minute period, or 80 mg/kg over a 120 minute period results in the lowering of blood pressure, vasodilation, and depletion of complement.

In some methods of the invention, the blood pressure of the primate is measured after it has been treated with the oligonucleotide and a drop in blood pressure is ascertained. This may be accomplished by any known means of measuring blood pressure. For example, blood pressure may be measured by placing a catheter in the femoral artery or by extracorporeal monitoring with a blood pressure gauge. As the largest decrease in blood pressure is seen 15 to 35 minutes after administration of the oligonucleotide to the primate, this time period is preferred for taking such measurements.

In other methods of the invention, complement activity in the blood or serum of the primate is measured after it has been treated with the oligonucleotide and a decrease in complement activity is ascertained. This may be accomplished by any known means of assaying for complement components of activity. For example, complement CH50 can be measured by complement-dependent lysis of sheep red blood cells as described in Kabat et al . (Expt. Immunochem. (1961) Charles C. Thomas, New York) , while C5a can be measured by radioimmunoassay. As the largest depletion of complement is seen 10 to 60 minutes after administration of the oligonucleotide to the primate, this time period is preferred for taking such measurements.

PS-oligonucleotides have been found to be well tolerated in mice (Agrawal, Prospects for Antisense Nucleic Acid Therapy for Cancer and AIDS , W. Liss, New York, (1991) p.143) and rats; however, in monkeys, acute hemodynamic toxicity has been observed under certain circumstances. There is a recent report of hypotension and death in the Rhesus monkey following bolus administration of a PS- oligonucleotide directly into the aorta (Cornish (1993) Pharm. Comm. 3:239-247) . This invention demonstrates the effects of the administration of PS-oligonucleotides of varying lengths and sequences in primates.

5 In one study, when the GG oligonucleotide

(SEQ ID NO:l) was administered to primates over a 10 minute time interval at doses of 0 (saline) or 1.25 mg/kg, there was no detectable effects on mean arterial blood pressure (FIG. 1) or heart 0 rate. On the other had, a 10 minute infusion of 5 mg/kg produced a transient increase in mean blood pressure by the end of the infusion period (FIG. _._ .1) , followed by a more prolonged decreased pressure. A dose of 20 mg/kg of GG over 10 5 minutes produced a similar transient blood pressure increase, followed by a more pronounced and more prolonged hypotension.

In contrast to the effects observed with 0 these doses of oligonucleotide infused over 10 minutes, neither 5 nor 20 mg/kg infused over 120 minutes influenced blood pressure in any clinically meaningful way (FIG. 2) . Only at 80 mg/kg infused over 120 minutes was any significant 5 effect on blood pressure observed. A slight transient increase in blood pressure followed by a decreased blood pressure was observed with changes resembling those seen following 5 mg/kg over 10 minutes. fr

In general, heart rate changes were reciprocal to the changes seen in blood pressure. Careful beat-to-beat evaluation of electrocardiograms from each animal which demonstrated a blood pressure change did not reveal any significant electrocardiographic changes indicative of a direct cardiac effect of the oligonucleotide. Furthermore, gross and microscopic examinations of cardiac tissue from deceased monkeys did not reveal any evidence of cardiotoxicity.

A shorter infusion period of 10 minutes administering 0.5, 1, and 2 mg/kg of oligonucleotides had no clinically significant effect on blood pressure (FIGS. 3A - FIG. 3C) or heart rate. In contrast, with infusions of 5, 10, and 20 mg/kg, increases in blood pressure followed by more prolonged and profound drops in blood pressure were observed (FIGS. 3D - 3F) . Changes in blood pressure were accompanied by reciprocal changes in heart rate.

Hematological parameters remained relatively constant throughout the infusion period and thereafter at doses of 2 mg/kg of GG or lower (TABLE 2A-2C.

TABLE 2A TIME from start of infusion (minutes)

TIME -10 2 5 10 20 40 60 24 hr

Saline Control

(10 minute infusion)

Platelet Count 489.0 475.0 444.0 484.0 452.0 432.0 442.0 389.0 (Thsd/mm³)

Hematocrit (%) 34.2 34. .5 35.6 33.2 33. .4 33.7 32.7 34.7

WBC (Thsd/mm³) 8.4 7. .9 8.0 7.6 7. .8 8.0 8.7 16.1

Neutrophil (%) 57.0 51. .0 49.0 56.0 51. .0 57.0 63.0 73e0 I t t

Dose 0.5 mg/kg I

(10 minute infusion)

Platelet Count 382.0 382.0 382.0 373.0 371.0 363.0 332.0 407.0 (Thsd/mm³)

Hematocrit (%) 34.3 34.7 34.3 33.6 33.5 34.1 33.4 34.8

WBC (Thsd/mm³) 7.0 6.9 6.5 6.5 6.4 7.5 6.9 8.8

Neutrophil (%) 53.0 50.0 52.0 51.0 49.0 49.0 50.0 38.0

Dose 1 mg/kg

(10 minute infusion)

Platelet Count 419.0 444.0 425.0 395.0 433.0 432.0 438.0 393.0

(Thsd/mm³)

TABLE 2C TIME from start of infusion (minutes)

TEST -10 2 5 10 20 40 60 24 hr

Dose 10 mg/kg

(10 minute infusion)

Platelet Count 391.0 397.0 267.0 192.0 226.0 270.0 282.0 353.0 (Thsd/mm³)

Hematocrit (%) 39.6 39.0 37.7 36.4 38.6 43.2 40.4 33.1

I

WBC (Thsd/mm³) 10.1 10.0 9.7 3.7 2.5 11.9 16.3 8.7 CO α^*-

I

Neutrophil 40.0 34.0 38.0 3.0 6.0 51.0 47.0 76.0

Dose 20 mg/kg

(10 minute infusion)

Platelet Count 346.0 33.0 165.0 179.0 175.0 225.0 245.0 331.0 (Thsd/mm³)

Hematocrit (%) 40.5 39.0 39.4 37.6 46.0 48.1 47.8 41.2

WBC (Thsd/mm³) 10.8 10.0 8.4 4.0 5.0 26.0 33.7 28.7

Neutrophil 37.0 40.0 34.0 2.0 2.0 46.0 51.0 88.0

The sole change involved a slight, gradual drop in hematocrit attributable to the frequent blood sampling. At doses of 5 mg/kg or greater, a number of consistent changes were observed in hematological values. For example, a marked increase in total white blood cells (WBCs) was noted beginning before the end of the infusion with a rebound to values above baseline by 40 minutes. The neutrophil count exhibited a concomitant marked drop to almost zero with a rebound increase thereafter, while there was little change in platelet count.

Also noted was an increase in hematocrit over baseline in most animals by 40 to 60 minutes.

Concentrations of serum complement CH50 (a general measure of total complement activity) decreased at doses greater than or equal to 10 mg/kg, beginning within 5 minutes of the start of treatment (FIG. 4) . In FIG. 4, the blood samples were drawn at 10 minutes prior to dosing and at 2, 5, 10, 20, 40, 60 minutes and 25 hours post-dosing and analyzed for level of CH50 complement. C5a split products of complement increased markedly, beginning within 2 minutes of infusion at doses greater than or equal to 5 mg/kg; the higher the dose, the earlier the appearance of increased C5a (FIG. 5) . At doses less than or equal to 2 mg/kg, no changes were observed.

Similar results were found when human and monkey sera were treated with PS-oligonucleotide and then measured for complement activity (FIGS. 6A and 6B) . Furthermore, human serum (FIG. 6A) responded in the same way as did monkey serum (FIG. 6B) , indicating that the complement systems in primates are similar and respond in like fashion to PS-oligonucleotide administration.

In summary, hypotension induced by intravenous oligonucleotide is clearly dose- and infusion ratedependent. Thus, the dose-response curve can be marked shifted to the right by decreasing the rate of oligonucleotide infusion. A dose of 80 mg/kg over 10 minutes (or 30 mg/kg/hr) produces a similar blood pressure response as a dose of 5 mg/kg over 10 minutes (or 30 mg/kg/hr) . The effects of the oligonucleotide on hemodynamics appear to the mediated by peripheral vascular changes since there is no evidence of direct effects on the heart.

The changes in blood pressure are accompanied or preceded by complement activation with decreases in total complement activity and appearance of C5a split products. In addition, there are decreases in peripheral total WBC and neutrophil counts and hemoconcentration which have been described following rapid activation of the complement pathways (Arnaout et al . (1985) N. Engl. J. Med. 312:457) . Thus, the hemodynamic changes seen with intravenous administration of oligonucleotide are produced by effect on complement activation and release of endogenous vasoactive substances.

These hemodynamic effects are clearly not restricted to the administration of an oligonucleotide with a particular size nucleotide sequence, as a similar decrease in blood pressure following 10 minute intravenous infusion of other PS-oligonucleotides (a 20-mer (SEQ ID N0:2) , a 27- mer (SEQ ID NO:4) , a 33-mer (SEQ ID NO:5) , and 25- er random sequences) have been obtained.

The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLES

1. Oligonucleotide Synthesis

The GG and other oligonucleotide were

synthesized on a 1 mmole scale using 9-cyanoethyl phosphoramidite chemistry by automated synthesis

(Padmapriya et al . (1994) Antisense Res. ά Dev. (in press) The purification of the crude oligonucleotide was carried out by reversed phase liquid chromatography, followed by detritylation and precipitation. The precipitated oligonucleotide was resuspended in water, passed through Dowes-5 OTM

(Na+ form: Dowex-50 X 2-200 ion exchange resin

(Aldrich, Milwaukee, WI) packed in 5 cm ID x 30 cm column and finally desalted using Sephadex^Tm G-15

(Sigma Chemical Co., St. Louis, MO) . The purified GG

(Na@ form) was passed through a 0.02 μ sterile filter and lyophilized. The percentage of the full length PS-oligonucleotide was greater than or equal to 87 (as confirmed by capillary gel electrophoresis and ion exchange HPLC) , and the product was 99% DNA (based on A₂₆₀/mass ratio) . ³¹P NMR analysis confirmed the product to be greater than 99% phosphorothloate.

The oligonucleotide with SEQ ID N0S: 1 , 3, 5, and 6 were prepared, as well as a 25-mer mixture of 4₂₄ sequences (25-mer random) . The 25-mer random was synthesized by using a mixture of A, C, G, and T for each coupling during synthesis (Lisziewicz et al. (1993) Proc. Natl. Acad. Sci. (USA) 90:3860) .

2. In Vivo Studies

Animals

Forty-six Rhesus monkeys (Macaca mulatto) , 26 males and 20 females, were acclimatized to laboratory conditions for at least 7 days prior to study. At the time of study, body weights ranged from 2.20 to 3.76 kg in Study A, and from 4.06 to 8.88 kg in Study B.

B. Cardiovascular Monitoring

On the day of study, each animal was lightly sedated with ketamine HCl (10 mg/kg) and diazepam

(0.5 mg/kg) . Surgical level anesthesia was induced and maintained by continuous ketamine intravenous drip during the entire cardiovascular recording procedure. A catheter was placed in the femoral artery for recording central arterial (blood) pressure, and animals were instrumented for continuous electrocardiographic recording.

C. Administration of PS-oligonucleotide

GG (SEQ ID N0:1) or other PS-oligonucleotide was dissolved in normal saline and infused intravenously via a cephalic vein catheter using a programmable infusion pump. In all cases, the concentration of GG was such as to allow the dose to be delivered at a rate of 0.42 ml/min.

In Study A, GG doses of 0 (saline only) , 1. 25,

5, and 20 mg/kg were administered to 4 monkeys each over a 10 minute infusion period, and doses of 0, 5,

20, and 80 mg/kg were administered to 4 monkeys each over a 120 minute period.

In Study B, GG doses of 0, 0.5, 1, 2, 5, 10, and 20 mg/kg were administered to 2 animals each over a 10 minute infusion period.

Arterial blood samples were collected 10 minutes prior to GG infusion, and 2, 5, 10, 20, 40, and 60 minutes after the start of the 10 minute infusion, as well as 24 (+/-4) hours later. Hematological values were determined by Sierra Nevada Laboratories (Reno, Nevada) . Serum was used for the determination of complement CH50 and C5a. Complement CH50 was measured by complement dependent lysis of sheep red blood cells as described in Kabat et al. (Expt. Immunochem. (1961) Charles C. Thomas, New

York) . C5a was measured by radioimmunoassay (Amersham PLC, U.K.) . 3. In Vitro Studies

50 ml serum from human or monkey blood was incubated for 30 minutes at 37C with an equal volume of saline or saline containing 1 tig/ml, 10 pg/ml, 100 pg/ml, 1 mg/ml, or 10 mg/ml PS-oligonucleotide. Complement (CH50) activity was measured by complement-dependent lysis of sheep red blood cells as described in Rabat et al. (Experimental Immunochemistry (1961) Charles C. Thomas, New York) The results are shown in FIGS. 6A and 6B.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Galbraith, Wayne M. , Agrawal, Sudhir (ii) TITLE OF INVENTION: Method of Depleting Complement (iii) NUMBER OF SEQUENCES: 6

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Lappin & Kusmer

(B) STREET: 200 State Street

(C) CITY: Boston

(D) STATE: Massachusetts

(E) COUNTRY: USA

(F) ZIP: 02109

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Kerner, Ann-Louise

(B) REGISTRATION NUMBER: 33,523

(C) REFERENCE/DOCKET NUMBER: HYZ-021PCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 617-330-1300

(B) TELEFAX: 617-330-1311

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1 :

CTCTCGCACC CATCTCTCTC CTTCT 25

(2) INFORMATION FOR SEQ ID NO:2 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: CDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

CTCTCGCACC CATCTCTCTC 20

(2) INFORMATION FOR SEQ ID NO:3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: RNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3 :

CUCUCGCACC CAUCUCUCUC 20 (2) INFORMATION FOR SEQ ID NO:4 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: CDNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4 :

ATCGAATATT TCAGAGATAT CTTCCAT 27

(2) INFORMATION FOR SEQ ID NO:5 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: CDNA/RNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5 : AUCGAATATT TCAGAGATAT CTUCCAT 27

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: CDNA (iii) HYPOTHETICAL: NO

(iv) ANTI -SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6

CTCTCGCACC CATCTCTCTC CTTCTGGAGA GAG 33

Claims

What is claimed is:

1. A method of reducing the blood pressure of a primate comprising:

(a) administering an oligonucleotide to the primate, the oligonucleotide being 2 to 50 nucleotides in length and having at least one phosphorothloate intemucleotide linkage; and

(b) measuring a decrease in the blood pressure of the primate.

2. The method of claim 1 wherein the oligonucleotide is administered as a bolus intravenous infusion at a constant rate of about 30 to 120 mg/kg/hr.

3. The method of claim 2 wherein the oligonucleotide is administered at a constant rate of about 30 mg/kg/hr.

4. The method of claim 2 wherein the oligonucleotide is administered at a constant rate of about 40 mg/kg/hr.

5. The method of claim 1 wherein 5 to 20 mg oligonucleotide per kg primate is administered over a 10 minute period.

6. The method of claim 1 wherein about 80 mg oligonucleotide per kg primate is administered over a 120 minute period.

7. The method of claim 1 wherein the oligonucleotide is about 6 to 50 nucleotides in length.

8. The method of claim 7 wherein the oligonucleotide is 20 to 33 nucleotides in length.

9. The method of claim 1 wherein the oligonucleotide comprises at least one deoxyribonucleotide.

10. The method of claim 1 wherein the oligonucleotide comprises at least one ribonucleotide.

11. The method of claim 9 wherein the oligonucleotide comprises at least one ribonucleotide.

12. The method of claim wherein the oligonucleotide is modified.

13. The method of claim 1 wherein a decrease of at least 50% is measured.

14. A method of stimulating vasodilation in a primate comprising:

(b) measuring a decrease in blood pressure in blood pressure of at least 50% in the primate.

15. The method of claim 14 wherein the oligonucleotide is administered as a bolus intravenous infusion at a constant rate of about 30 to 120 mg/kg/hr.

16. The method of claim 15 wherein the oligonucleotide is administered at a constant rate of about 30 mg/kg/hr.

17. The method of claim 15 wherein the oligonucleotide is administered at a constant rate of about 40 mg/kg/hr.

18. The method of claim 14 wherein 5 to 20 mg oligonucleotide per kg primate is administered over a 10 minute period.

19. The method of claim 14 wherein about 80 mg oligonucleotide per kg primate is administered over a 120 minute period.

20. The method of claim 14 wherein the oligonucleotide is 6 to 50 nucleotides in length.

21. The method of claim 20 wherein the oligonucleotide is about 20 to 33 nucleotides in length.

22. The method of claim 14 wherein the oligonucleotide comprises at least one deoxyribonucleotide.

23. The method of claim 14 wherein the oligonucleotide comprises at least one ribonucleotide .

24. The method of claim 22 wherein the oligonucleotide comprises at least one ribonucleotide .

25. The method of claim 14 wherein the oligonucleotide is modified.

26. The method of claim 1 wherein a decrease in blood pressure of at least 50% is measured.

27. A method of depleting complement in a primate comprising:

(a) administering an oligonucleotide to the primate, the oligonucleotide being 2 to 50 nucleotides in length and having at least one phosphorothloate intemucleotide linkage; and -

(b) measuring a decrease in complement activity in a sample of blood.

28. The method of claim 27 wherein the oligonucleotide is administered as a bolus intravenous infusion at a constant rate of about 30 to 120 mg/kg/hr.

29. The method of claim 28 wherein the oligonucleotide is administered at a constant rate of about 30 mg/kg/hr.

30. The method of claim 28 wherein the oligonucleotide is administered at a constant rate of about 40 mg/kg/hr.

31. The method of claim 28 wherein 5 to 20 mg oligonucleotide per kg primate is administered over a 10 minute period.

32. The method of claim 28 wherein about 80 mg oligonucleotide per kg primate is administered over a 120 minute period.

33. The method of claim 28 wherein the oligonucleotide is about 6 to 50 nucleotides in length.

34. The method of claim 33 wherein the oligonucleotide is about 20 to 33 nucleotides in length.

35. The method of claim 28 wherein the oligonucleotide comprises at least one deoxyribonucleotide.

36. The method of claim 28 wherein the oligonucleotide comprises at least one ribonucleotide.

37. The method of claim 35 wherein the oligonucleotide comprises at least one ribonucleotide.

38. The method of claim 28 wherein the oligonucleotide is modified.

39. The method of claim 28 wherein a decrease in complement activity of at least 50% is measured.