CA2191192A1 - Use of oligonucleotide phosphorothioate for depleting complement and for reducing blood pressure - Google Patents

Abstract

Disclosed are methods of reducing the blood pressure, stimulating vasodilation, and depleting complement, in a primate. These methods involve administering an oligonucleotide to the primate, and then measuring the decrease in blood pressure or complement activity.
The oligonucleotide being administered is 2 to 50 nucleotides in length and has at least one phosphorothioate internucleotide linkage.

Description

wossl327l9 r~l~u~ .r~l6l 2l5ll12 Use of oligonucleot1de ~,I.G,~ 10ate for deplet1ng complement and for reduc~ng blood pressure BACKGROUND OF THE INVBNTION
.

This invention relates to the ef f ect of synthetic oligonucleotides on in vivo complement activation and the results thereof. More specifically, this invention relates to methods of depleting complement, using synthetic oligonucleotides, which will lower blood pressure and trigger vasodilation.
The complement system is a r~ ; n~ series of about 2 0 dif f erent plasma enzymes, enzyme ple~_uL~3~r~ regulatory proteins, and proteins capable of cell lysi8 and involved in the normal immune system respon8e to ~oreign cells and in the abnormal immune system response to the -individual ' 8 own cells . All of these proteins are normally present in the plasma and among the plasma proteins that leak out of capillaries into tissue spaces. The enzyme precursors are normally inactive, but can be activated via two separate pathways: the classical pathway ut i l; 7; n~
complement component8 C1, C4, and C2; and the alternate pathway, via factors D, C3, and B. Both modes of activation lead to cleavage and activation of ~ r~n~nt C3 . Fragment C3b split from C3, is n~c~ ry for the activation of the tPrmin;-l complement c ~n~n~s C5-C9. These form the membrane attack complex which, when inserted into cell membranes, brings about osmotic lysis of foreign cells, and in the case of autoimmune WO 9~/32719 ~ 61 ~1192 etates, lysis ef the affected organism~ s own cells. ~ii i ' '~s Activation of the complement cascade results not only in cell lysis, but also in opsomization and phagocytosis of bacteria by macrophages and neutrophils, agglutination of invading organisms, neutralization of some viruses, chemotaxis of neutrophils and macrophages caused by C5a, activation of basophils and mast cells, and inflammation (Guyton, Textbook of Medical Physiology, W.B.
Sauders Co., Philiqfl~lph;is (1991) pp. 374-384~.
Mast cell and basophil activation, followed by histamine release, are triggered by fragments C3a, C4a, and C5a, which are enzymatically split off from C3, C4, and C5. Neutrophil margination, hemocentration, and release of vasoactive peptiaes have also been reported following rapid activation of the complement pathways. (Arnaout et al.
(1985) N. Eng. J~ Med. 312:457-462) .
~he lytic and other activities of complement are also involved in a number of disease states including var1ous i9llt~; ? disorders such as rheumatoid arthritis. Rheumatoid arthritis is a chronic multisystem disease whose common clinical manifestation is persistent ;~li tory synovitis of the peripheral joints resulting in proliferation of synovial cells and subsequent pannus formation, cartilage destruction, bone erosion, and ultimately joint deformity and loss of joint function. This t~ r~ r affects approximately 196 of the population of the United States and Europe as well as 0.2 to 0.496 of the Wo9SI32~l9 F~llu..,'. 161 2191 ~92 Japanese population, with women being affected about three times more often than men.
Therapy has ; nt~ d salicylic acid and other nonsteroidal anti-inflammatory drugs, simple analgesics, and low dose glucocorticoids to control symptoms of the inflammatory procese, but none of these have been successful in arresting the progression of rheumatoid arthritis (Lipsky in Harrison's Principles of lnternal Medicine (llth ed. ) (Braunwald et al ., eds . ) McGraw-Hill Book Co., New York, New York (1987) pp. 1423-1428). A number of different disease-modifying drugs such as gold compounds, D-rPn; c; 1 l amine, glucocorticoids, cytotoxic immunosuppressive drugs, and ~nt;r~l~rials have been used alone and in combination with nonsteroidal anti-inflammatory drugs for analgesic and anti-~n~l tory effects (Lipsky, ibid. ) . However, the drugs used thus far are somewhat toxic and have failed to demonstrate a consistent advantage of one over the other.
3~urthf- ~, none of these drugs have been demonstrated to alter the course of the disease.
Thus, there is a need for treatments which not only reduce the symptom of rheumatoid arthritis, but also which arrest the disease.
Certain complement factors are potent vasodilators which can af f ect blood pressure and disorders related thereto such as hypertension.
Hypertension is a prevalent health problem in many developed countries. Many patients with hypertension die prematurely, with the most common Wo 95/32719 F~ ~ 161 192 :: --cause of death being heart disea6e, stroke, and renal failure Treatment typically consists of nondrug therapeutic intervention including stress relief, diet, weight reduction, regular aerobic exercise, and the administration of antihypertensive drugs including diuretics, antiadrenergic agents, vasodilators, calcium channel blockers, and angiotensin-converting enzyme (ACE) inhibitors. (Gordon Williams in Harrison's Principles of Internal Medicine, 13th Ed. (IssPlh~hf~r, et al., eds.) (1994) McGraw-E~ill, Inc., NY), pp. 1116-1~31.
There is a need to develop means for controlling the complement system which enable components of the system to be channeled into constructive uses, such as in treating complement-sensitive autoimmune and blood pressure related di sorders .
Various animal models have been used to study the complement system and diseases resulting from the lack or overproduction of various complement cnmrnnf~nts. These models have been prepared by the administration of cobra snake venom, which results in the ~l~rl et; nn of their complement .
EIowever, the venom contains components other than those which interact with the complement system.
Thus, the resulting animal response may not be due 3 0 solely to the presence of complement - interacting cn~.rnn~nt s .
Accordingly, a better complement-deficient animal model is needed whose disease state has only been caused by interaction with complement-depleting factors.
SIJMMARY OF TE~E INVENTION
It has been discovered that rapid, bolus infusion of an oligonucleotide with phosphorothioate internucleotide linkages results in a depletion of complement in a recipient primate. This depletion of complement has been found to reduce the blood pressure of a recipient primate, while transiently decreasing its neutrophil and total white blood cell counts.
These surprising discoveries have been exploited to develop the present invention which includes uses of medicaments for depleting complement, reducing the blood pressure, and stimulating vasodilation in a primate.

2 0 The uses each involve as a medicament an oligonucleotide phosphorothioate (a~PS-oligonucleotide" ) having a sulphur substitution for one of the oxygens in at least one non-bridging phosphodiester; ntf-rn~ eotide linkage.
In some aspects of the invention, the oligonucleotide has only phosphorothioate 1 nt~rnl~t l ef~tide linkages .
As used herein, the term ~oligonucleotide~ is meant to fnf ~-c8 two or more nucleotides wherein the 5 ' end of one nucleotide and the 3 ' end of another nucleotide are covalently linked. The oligonucleotides useful in the methods of the invention are from 2 to 50 nucleotides in length, AMENDED SHEET
~PEA/EP

Wo95/327l9 r~ J..,'.c:l6l with oligonucleotides having 6 to 50, and more .-preferably, 20 to 33 nucleotides in length being most u3eful in some embodiments. In other embodiments of the invention, the oligonucleotide has at least one deoxyribonucleotide or at least one ribonucleotide. In yet other embodiments, the oligonucleotides are chimeric, i.e., have a combination of both deoxyr; I ~nllrl .or,tides and ribonucleotides in any lbcation or order in the molecule.
In some embodiments of the invention, the oligonucleotides are modified. The term ~Imodified oligonucleotide" is used herein as an oligonucleotide in which at least two of its nucleotides are covalently linked via a synthetic linkage, i.e., a linkage other than a phosphodiester between the 5 ' end of one nucleotide and the 3 ' end of another nucleotide in 2 0 which the 5 ' nucleotide phosphate has been replaced with any number of chemical groups.
Preferable synthetic linkages include, in addition to phosphorothioates, 1 ;nk;lrJ~ such as alkylphosphonates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphoramidites, phosphate esters, carbamates, carbonates, phosphate triesters, acetamidate, 2-O-methyls, and carboxymethyl esters. These linkages can be present anywhere in the oligonucleotide structure, and more than one type of linkage can be present in a single oligonucleotide (i.e., a hybrid ol igonucleotide ) .

WO9S/32719 2~t~tg2 1~ J.. 616 The term "modified oligonucleotide~ also encompasses oligonucleotides with a modif ied base and/or sugar. For example, a 3', 5'-substituted oligonucleotide is a modified oligonucleotide having a sugar which, at both its 3 ' and 5 ~
positions i9 attached to a chemical group other than a hydroxyl group (at its 3 ' position) and other than a phosphate group (at its 5' position).
A modified oligonucleotide may also be a capped ~=
species. In addition, unoxidized or partially oxidized oligonucleotides having a substitution in one nonbridging oxygen per nucleotide in the molecule are also considered to be modified oligonucleotides . Also rrnf:; rlPred as modif ied oligonucleotides are oligonucleotides having _~
nuclease resistance-conferring bulky substituents at their 3~ and/or 5' end(s) and/or various other structural modifications not found i~l vivo without human intervention are also considered herein as 2 0 modi f ied .
Oligonucleotides which are self-stabilized are also considered to be modif ied oli~r,nllrl ertides useful in the methods o~ the invention (Tang et al. (1993) NucleicAcidsRes.
21:2729-2735). These oligonucleotides comprise two regions: a target hybridizing region; and a self-complementary region having an oligonucleotide ~eriuence complementary to a

3 0 nucleic acid sequence that is within the self -stabilized oligonucleotide.
In preferred embodiments, the oligonucleotide is administered as a bolus intravenous infusion at 2~ 2 a constant rate of about 30 to 60 milligram oligonucleotide per kilogram recipient per hour (mg/kg/hr) . In some methods, the olis~ n~ .tide is administered at a constant rate of about 3 0 mg/kg/hr, while in others, it i~i admïnistered at about 40 mg/kg/hr. Yet other methods of the invention require the administration of about 5 to 10 mg/kg oligonucleotide over a 10 minute period, while others require about 80 mg/kg over a 120 minute period.
In the use of an oligonucleotide as a medicament for reducing blood pressure and of causing vasodilation, the blood pressure of the r~ r; Pn~ primate is measured after the administration of the oligonucleotide. In preferred ~ R, the blood pressure is measured 15 to 35 minutes after administration.
In the use of an oligonucleotide as a medicament for depleting complement, complement activity in a blood sample taken f rom the recipient primate is measured af ter the administration of the oligonucleotide. In preferred f.mh~ul; tR, the complement activity is measured 10 to 60 minutes after adm~nistration.

AMENDE~) Sl IE~
IPE~/EP

WO gS132719 r~ 6l6l BRIEF DESCRIP~ION OF T~E DR~WTNr~s The f oregoing and other ob; ects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read to~thl~r with the accompanying drawings in which:
FIG. 1 is a mean arterial blood pressure profile of animals following intravenous administration of PS-oligonucleotide over a 10 minute period, beginning at time zero;
FIG. 2 is a mean arterial blood pressure profile of animals following intravenous administration of PS-oligonucleotide over a 120-minute period, beginning at time zero;
2 o FIG . 3A is a graph showing the heart rate ~_) and mean arterial pressure (~) of monkeys following administration of a single dose of saline over a 10 min. period;
FIG. 3B is a graph showing the heart rate (_) and mean arterial pressure (~) of monkeys following administration of a single dose of PS-oligonucleotide at 0 . 5 mg/kg of the mammal over a --10 min. period;

FIG . 3 C is a graph showing the heart rate ~_) and mean arterial pressure (-) of monkeys following administration of a single dose of PS-oligonucleotide at 1 mg/kg of the mammal over a 10 min. period;
FrG. 3D is a graph showing the heart rate ~_) and mean arterial pressure ( ) of monkeys foll owing administration of a single dose of PS-oligonucleotide at 2 mg/kg of the mammal over a 10 min. period;
FIG. 3E is a graph showing the heart rate (_) and mean arterial pressure (~) of monkeys following administration of a single dose of The GG oligonucleotide at 5 mg/kg of the mammal over a ten min. period;
FIG. 3F is a graph showing the heart rate (_) and mean arterial pressure (-) of monkeys following administration of a single dose of PS-oligonucleotide at 10 mg/kg of the mammal over a 10 min. period;

wo95/32719 2191192 r~ (n61 FIG. 4 is a graph showing the level of complement (CX50) activity in animals following ;~
administration of various doses of PS-oligonucleotide intravenously over a ten minute period;
FIG. 5 i8 a graph showing the level of complement (C5a) in animals following intravenous administration of various doses of PS-oligonucleotide over a lO minute period;
FIG. 6A is a graph showing the level of complement (C~I50) activity in human serum following the administration of various concentrations of PS-oligonucleotide; and FIG. 6B is a graph showing the level of complement (C~I50) activity in serum from animals following administration of various concentrations of PS-oligonucleotide.
-WO 95/32719 219119 ~ r~ 61 ~TTT~'n DESI ~TVLl~N OF T~E l:'KJ~ KIC~iL) EBODTIU~NTS
The following description is intended to further illustrate certain preferred embodiments of the invention and is not intended to limit the scope of the invention . The patent and scientif ic literature referred to herein es~;~hl; ~h~ the knowledge that is available to those with skill in the art . The issued U. S . patent and allowed applications and references cited herein are hereby incorporated by reference.
The present invention provides methods of depleting complement in a primate, which are 1~ useful, for example, in producing animal models that lack complement. Such animal models are of great value in ~ m;nin~ the role of complement in various types of immune and other responses.
Methods of depleting complement are also useful in slowing or inhibiting; nf 1 i tion, and in reducing the lytic effects of various autoimmune disorders such as rheumatoid arthriti~. The present invention also provides methods of decreasing blood pressure and causing vasodilation in a primate. Such methods are useful in treating acute hypertension, a disease common in developed countries .
In the present invention, complement is depleted, blood pressure is reduced, and vasodilation is induced in a sub]ect, by the administration of an oligonucleotide phosphorothioate having a sulphur substitution for one of the oxygens at least one non-bridging Wo ss/327l9 P~ r -16l oxygen of a phosphodiester internucleotide linkage (PS-oligonucleotide) .
PS-oligonucleotides display resistance to enzymatic degradation, and have been studied extensively in the development of antisense oligonucleotide-based therapeutics (see e.g., Zamecnik, Prospectsfor Antisense Nl~cleic Acid Therapy of Cancer andAIDS, Wickstrom, ~., Ed., Wiley-Liss, Inc, New York, New York, Vol. 1, 1991). For example, PS-oligonucleotides have been used as antiviral agents (see, e.g., Agrawal (1992) Trends Biotech.
10:152-158), anti-cancer agents (see, e.g., Rata!czak et al. (1991) Proc. Natl. Acad. Sci. (USA) 89 :11823-11827; Bayever (1993) Antisense Res. Dev.
3:383) and anti-parasitic agents (see, e.g., Rappaport et al. (1993) Proc. Natl. Acad. Sci. (USA) 89:8577-8580) in various invitro model systems. In addition, PS-oligonucleotides have been employed in regulating the expression of a number of ::
cellular gene targets (see, e.g., Stein et al.
(1993) Science 261:1004).
The PS-oligonucleotides used in the methods of the invention are composed of deoxyribonucleotides, ribonucleotides, or a combination of both, with the 5 ' end of one nucleotide and the 3 ' end of another nucleotide being covalently linked. These ol i ~f~nllcl eotides are at least 6 nucleotides in length, but are preferably 10 to 50 nucleotides long, with 20 to 33mers being the most common.

WO 95/3271g ~ ,,., S161 219119~

Some useful PS-oligonucleotides have one phosphorothioate linkage located between any two neighboring nucleotides in the molecule. Other PS-oligonucleotides have more than one phosphorothioate linkage between nucleotides scattered throughout the molecule or contiguously located. Yet others have only phosphorothioate linkages .
The oligonucleotides useful in the methods of the invention may also be modif ied in a number of ways without compromising their ability to function in the methods of the invention. For example, the oligonucleotides may contain, in addition to at least one phosphorothioate linkage, an internucleotide linkage other than a phosphorothioate internucleotide linkage between the 5 ~ end of one nucleotide and the 3 ' end of another nucleotide . In such a linkage, the 5 nucleotide sulfur (in the~case of a phosphorothioate) has been replaced with any number of chemical groups. Examples of such chemical groups include alkylphn~hnn~tes, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphate esters, carbamates, acetamidate, caL~ thyl esters, carbonates, and phosphate triesters.
Other mo~ifications include those which are internal or at the end(s) of the oligonucleotide molecule and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino Wo 95/32719 P~l~u_ _ 161 219~192 groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins. Examples of such modified oligonucleotides include oligonucleotides with a modif ied base and/or sugar such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide having a sugar which, at both its 3 ' and 5 ' positions is attached to a chemical group other than a hydroxyl group (at its 3 ' position) and other than a phosphate group (at its 5~ position). Other modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3' and/or 5~ end(s), or have a substitution in one nonbridging oxygen per nucleotide . Such modif ications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule.
Yet other useful oligonucleotides include those that are self-stabilized, as described in Tang et al. (lVucleicAcidsRes. (1993) 21:2729-2735).
Such oligonucleotides have a target hybridizing region and a Eielf-complementary region having an oligonucleotide sequence complementary to a nucleic acid sequence that is within the self-stabilized oligonucleotide.
The preparation of these unmodified and modif ied oligonucleo'cides is well known in the art (reviewed in Agrawal et al. (1992) Trends ~i(7t~r~
10:152-158). For example, nucleotides can be covalently linked using art-recognized techniques 9I192 r r such as phosphoramidate, H-phosphonate chemistry, or methylphosphoramidate chemistry (see, e.g., Uhlmann et al. (1990) Chem. Rev. 90:543-584; Agrawal et al.
(1987) Tefrahedron. Lett. 28: (31) :3539-3542); Caruthers et al. (1987) Meth. En~ymol. 154:287-313; U.S. Patent 5,149,798). Oligomeric phosphorothioate analogs can be prepared using methods well known in the field such as methoxyphosphoramidite (see, e.g., Agrawal et al. (1988) Proc. Natl. Acad. Sci. (USA) 85: 7079-7083 ) or X-phosphonate (see, e.g., Froehler (1986) Tetrahed~onLett 27:5575-5578) chemistry. The synthetic methods described in Bergot et al. (J.
Chromatog (1992) 559:35-42) can also be used.
Examples of useful oligonucleotides used in this study include those listed below in TABLE 1 and set forth in the Sequence l:isting as SEQ ID
NOS:1-6.
TA~3LE 1 Oliqo Se~uence SEO ID ~=
NO:
GG (25mer) CTCTCGCACCCAL~:L~ C~:L~
2520mer CTCTCGCACCCATCTCTCTC 2 20mer CUCUCGCACCCAu~:u~:u-:uC 3 27mer ATcGAATATTTr~r~r-~T~TcTTccAT 4 27mer AUCGAATATTTCAGAGATATCTUCCAT 5 3 3 mer CTCTCGCACCCATCTCT~: l C~ L~XiAGAGAG 6 However, other useful oligonucleotides can have any nucleotide sequence, as the effects caused by EN;)~2 S~.E~
AM IPEAI~?

Wo 9sl327l9 P~ ~ 161 ~17 -the administration of these oligonucleotides is not sequence specific. The "GG" oligonucleotide (SBQ ID N0:1) is complementary to the gag initiation codon of ~IV-l (Agrawal and Tang (1992) Antisense Res. Dev. 2:261) . The other five oligonucleotides are rhrRrh~rothioates varying in length from 20 to 33 nucleotideE. The 25mers tested were a mixture of 4'~ 25mer random sequences (25mer random). The 25-mer random was synthesi~ed by using a mixture of A, C, G, and T
for each coupling during synthesis.
In the methods of the invention, the nllrl eotideg are administered via intravenous injection to the subject in the form of a therapeutic formulation which c~ntA~nR at least one PS-oligonucleotide as described above, along with a physiologically acceptable carrier.
As used herein, a "physiologically acceptable carrier~ includes any and all solvents, dispersion media, roAt;n~Rl antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art . Except insof ar as any conventional media or agent is ; nrl ~Lt; hle with the active ingredient, its use in the therapeutic compositions is r~lnt~ 1 Ated. Supplementary active ingredients can also be incorporated into the compositions.
The pharmace~lticAl forms suitable for inj ectable use include sterile aqueous solutions ~ ~Ig~Ig~

or dispersions and sterile powders for the extemporaneous preparation of sterile inj ectable solutions or dispersions. In all cases the form must be sterile. It must be stable under the conditions of manufacture and storage and may be preserved against the ~-nnt~ml n~ting action of microorganisms, such as bacteria and fungi. The - carrier can be a solvent or dispersion medium.
The prevention of the action of. microorganisms can be brought about by various antibacterial and antifungal agents. Prolonged absorption of the inj ectable therapeutic agents can be brought about by the use of the compositions of agents delaying absorption .
The therapeutic formulation is injected intravenously in one bolus, which may be repeated at various time intervals as needed. The rate of inj ection is dependent on the amount of oligonucleotide being administered, with 30 to 120 mg per kg weight of the recipient per hour being in the acceptable range. For exam~?le, a bolus administration of 5 to 20 mg/kg over a 1o minute period, or 80 mg/kg over a 120 minute period results in the lowering of blood pressure, vasodilation, and depletion of complement.
In some methods of the invention, the blood pressure of the primate is measured af ter it has been treated with the oligonucleotide and a drop in blood pressure is ascertained. This may be accomplished by any known means of measuring blood pressure. For example, blood pressure may be measured by placing a catheter in the femoral AMr~ t .i`' S'.IE~
IPE~_?

Wo ssn27ls r~ 161 219119z artery or by extracorporeal monitoring with a blood pressure gauge. A8 the largest decrease in blood pressure is seen 15 to 35 minutes after administration of the oligr~n~ otide to the primate, this time period is preferred for taking such mea~uL ~ntR.
In other methods o~ the invention, complement activity in the blood or serum of the primate is measured after it has been treated with the oligonucleotide and a decrease in complement activity is ascertained. This may be accomplished by any known means of assaying for complement ==
components of activity. For example, complement CH50 can be measured by complement-dependent lysis of sheep red blood cells as described in Kabat et al. (Expt. ~ ~ ' (1961) Charles C. Thomas, New York), while C5a can be measured by radio; ~RRay. A8 the largest depletion of complement is seen lO to 60 minutes after administration of the oligonucleotide to the primate, this time period is preferred for taking such meayuL~ ' R, - 25 PS-oligonucleotides have been found to be well tolerated in mice (Agrawal, ProspectsforAntisense NucleicAcid TherapyforCancerandA~DS, w. Liss, New York, (1991) p.l43) and rats; however, in monkeys, acute hemodynamic toxicity has been observed under 3 0 certain circumstances . There is a recent report o~ hypotension and death in the Rhesus monkey following bolus administration of a PS-oligonucleotide directly into the aorta (Cornish (1993) Pharm. Corn~n. 3:239-247). This invention f~2 demonstrates the effects of the administration of PS-oligonucleotides of varying lengths and sequences in primates.
.5 In one study, when the GG oligonucleotide (SEQ ID NO:1) was administered to primates over a 10 minute time interval at doses of 0 ~saline) or 1.25 mg/kg, there was no detectable effects on mean arterial blood pressure (FIG. 1) or heart rate. On the other had, a 10 minute infusion of 5 mg/kg produced a transient increase in mean blood pressure by the end of the infusion period (FIG.
1), followed by a more prolonged decreased pressure .
In contrast to the effects observed with these doses of oligonucleotide infused over 10 minutes, neither 5 nor 20 mg/kg infused over 120 minutes influenced blood pressure in any clinically meaningful way (FIG. 2) . Only at 80 mg/kg infused over 120 minutes was any significant effect on blood pressure observed. A slight transient increase in blood pressure followed by a decreased blood pressure was observed with changes re~ ' l ;n5 those seen following 5 mg/kg over 10 minutes .
In general, heart rate changes were reciprocal to the changes seen in blood pressure.
Careful beat-to-beat evaluation of =
electrocardio~rams f rom each animal which demonstrated a blood pressure change did not reveal any signif icant electrocardiographic changes indicative of a direct cardiac effect of AMENDED StlEE~
IPEAtEP

the oligonucleotide. Fl~rth~ , gross and microscopic examinations of cardiac tissue _rom deceased monkeys did not reveal any evidence of cardiotoxicity .

A shorter iIlfusion period of lO minutes administering O . 5, l, and 2 mg/kg of oligonucleotides had no clinically si~n1 f; ~ ~nt effect on blood pressure (FIGS. 3B - FIG. 3D) or heart rate. In contrast, with infusions of 5 and lO mg/kg, increases in blood pressure followed by more prolonged and prof ound drops in blood pressure were observed (FIGS. 3E - 3F). Changes in blood pressure were accompanied by reciprocal changes in heart rate.
Xematological parameters l, ; n~cl relatively constant throughout the infusion period and thereaf ter at doses of 2 mg/kg of GG or lower (TA}3LE 2A-2C) .

Al\/IE~DED SHEET
IPEAJEP

WO 95/32719 P~,l/u,,~
2~Ig~

,~ O t~ ~ O ~ 0 0 ~D O 1` ~ a) ~ ~
o t` ~ o o ~ ol o o V~ ~ N ~ (~ ,D O ~
~ r~
o r o o u~ o o , ~ O
o '- O N U~ O O ~D U) . .
O ~D O O ~ r~ Ln o o V ~ 1 N
c~ o m ~ o o r ~ o o D O
lU ~ ~ ~
o .1 ~ ~ o ~ o o o ~J _ _ V
-- 7' 7 ~ L7 C7 U~ I ~ ~ b7 ~1 U~ ~ 7~ UO_ 7 7~7 L ~ S 7n ~ C
7L7 o ~ ~ E~ o o ~L ~ _ ,7 ~L
'7~ ~ ' U 717 r S7 ~ ~.7 ~ C7 p E~ ~: CO S

wo gSr327l9 2 ~ F~ '161 .C r o~ 0 O rl o o o ~ O
r'l ~ N O O r~
~r r O ~D ~ ~ ~ ~ ~ r O 0~ ~ O O r o o ~D N ~ ('') r r ~ ~D r ~D ~
'1 N N ~ H r ~`1 a\ r'l N '1 o o o 0. ~ ~ O O U~ U~ O
~ ~ ~ N a~ r Ln a~ r ~ Lr~
,~ r ~ N r~ ~1 N ~ U) o ~ r o o o o o oo~ o r o ~ N C:~
r ~ r o In al o, o, ~ ,1 .
m ~~1 o ~ o r o N ~I N 1 li3 ' ~m ~ O ~ O O O ~ ~1 0 ~: ~ r r o ~ N ~D O
h Ln o r ~ N ~D d' d' JJ
o h ~ ~ ~ N N d~ ~O
H 111 N O O N r o o ~ ~ o ~ rl ~ r ~ ~ ~ ~ ~D
~ , ~
V _ _ _ L) ,_ _ _ =
U _ ~ U _ ~ ~ ~
r.~ o .- E~ Ul o ~ ~ E~
a ~ -- ~ ~ a n rA rA r C C) ~11 r ~ C~
~ ~ O ~ O

2l9lI92 ` ` "

O ~1 ~ O' ~ ~7 - o ~ ~ o o ~
o ~ ~ o O ~i ~
O ~C In O
, o ~D ~ ~ ~o o ~ I~ o o ~
W' ~ o t` t` o 8 ~ cn o ~

4, ~ ~
O ~D ~ O
E~ ' ~ `
U~ , ~, m ,1 o ~ ~ 1 ~I C
E-l ~I) , ,,~ U
~ O ~ ~ ~
E~ a .~ME.~I~ED StlE~

WO9~132719 21~t~? r~ l6l .

The sole change involved a slight, gradual drop in hematocrit attributable to the fre~uent blood sampling. At doses of 5 mg/kg or greater, a number of consistent changes were observed in hematological values. For example, a marked increase in total white blood cells (WBCs) was noted beginning before the end of the infusion with a rebound to values above baseline by 40 minutes. The neutrophil count exhibited a concomitant marked drop to almost zero with a rebound increase thereafter, while there was little change in platelet count.
Also noted was an increase in hematocrit over baseline in most animals by 40 to 60 minutes.
Concentrations of serum complement C~50 (a general measure of total complement activity) decreased at doses greater than or equal to 10 mg/kg, beginning within 5 minutes of the start of treatment (FIG.
4). In FIG. 4, the blood samples were drawn at 10 minutes prior to dosing and at 2, 5, 10, 20, 40, 60 minutes and 25 hours post-dosing and analyzed for level of CH50 .~ m~nt. C5a split products of complement increased markedly, beginning within 2 minutes of infusion at doses greater than or equal to 5 mg/kg; the higher the dose, the earlier the appearance of increased C5a (FIG. 5) . At doses less than or equal to 2 mg/kg, no changes were observed.
Similar results were ~ound when human and monkey sera were treated with PS-oligonucleotide and then measured for complement activity (FIGS.
6A and 6B) . Furthermore, human serum (FIG. 6A) WO 9!il3Z719 1 ~ C161 2191192 ~

responded in the same way as did monkey serum (FIG. 6s), indicating that the complement systems in primates are similar and respond in like fashion to PS-oligonucleotide administration.

In summary, hypotension induced by intravenous ol~gonucleotide i8 clearly dose- and infusion ratedependent. Thus, the dose-response curve can be marked shifted to the right by decreasing the rate of ~ n~ tide infusion.
A dose of 80 mg/kg over 10 minutes (or 30 mg/kg/hr) produces a similar blood pressure response as a dose of 5 mg/kg over 10 minutes (or 30 mg/kg/hr). The ef~ects of the oligonucleotide on hemodynamics appear to the mediated by peripheral vascular changes since there is no evidence of direct ef fects on the heart .
The changes in blood pressure are ;3~ n;f~rl 2 0 or preceded by complement activation with decreases in total complement activity and appearance of C5a split products. In addition, there are decreases in peripheral total WBC and neutrophil counts and hemor~n~ntration which have been described following rapid activation of the complement pathways (Arnaout et al. (1985) N. Engl.
~1. Med 312 :457) . Thus, the hemodynamic changes seen with intravenous administration of oligonucleotide are produced by effect on 3 0 complement activation and release of endogenous vasoactive substances.
These hemodynamic ef fects are clearly not restricted to the administration of an oligonucleotide with a particular 8ize nucleotide sequence, as a similar decreage in blood pressure following 10 minute intravenous in~usion of other PS-oligonucleotides (a 20-mer (SEQ ID NO:2), a 27-mer (SEQ ID NO:4), a 33-mer (SEQ ID NO:5), and 25-mer random sequences) have been obtained.
The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.
EXAMPLES
1. Oligonucleotide Synthesis The GG and other oligonucleotide were synthesized on a 1 mmole scale using 9-cyanoethyl phosphoramidite chemistry by automated synthesis (Padmapriya et al. (1994) Antisense Res. ~ Dev. (in press) The purification of the crude oligonucleotide was carried out by reversed phase liquid chromatography, followed by detritylation and precipitation. The precipitated oligonucleotide was resuspended in water, passed through Dowes-5 OTM
(Na+ form: Dowex-50 X 2-200 ion exchange resin (Aldrich, Milwaukee, WI) packed in 5 cm ID x 30 cm column and ~inally l~l t~l usin~ SephadexT= G-15 (Sigma Chemical Co., St. Louis, MO) . The puri~ied GG
(Na6~ form) was passed through a 0 . 02 ~ sterile filter and lyophilized. The percentage of the full length PS-oligonucleotide was greater than or equal to 87 (as confirmed by capillary gel electrophoresis ~ v'~ SHEEr .1,~,. ~e~

2l9Il~
.

and ion exchange HPLC~, and the product was 999~ DNA
(based on A260/mass ratio) . 3~P NMR analysis confirmed the product to be greater than 9996 phosphorothioate .

The oligonucleotide with SEQ ID NOS :1, 3, 5, and 6 were prepared, as well as a 25-mer mixture of 4,; sequences (25-mer random). The 25-mer random was synthesized by using a mixture of A, C, G, and T for each col~rl; n~ during synthesis (Lisziewicz et al. (1993) Proc. Natl. Acad. Sci. (USA) 90:3860) .
2. In Vvo Studies A. Animals Forty-six Rhesus monkeys (Macaca mulatta), 26 males and 20 females, were acclimatized tD
laboratory conditions for at least 7 days prior to study. At the time of study, body weights ranged from 2.20 to 3.76 kg in Study A, and from 4.06 to 8 . 8 8 kg in Study B .
~3. Cardiovascular Monitoring On the day of study, each animal was lightly sedated with k~tAm;nP HCl (10 mg/kg) and diazepam (0.5 mg/kg). Surgical level anesthesia was induced and m;-;nt:I;nPd by r~(~nt;nll~us ketamine i~Ltravenous drip during the entire cardiovascular recording procedure. A catheter was placed in the femoral artery for recording central arterial (blood) " ' - `1 jE
SHEET

21911~2 pressure, and animals were instrumented for continuous electrocardiographic recording.
C. Administration of PS-oligonucleotide GG (SEQ ID NO:l) or other PS-oligonucleotide was dissolved in normal saline and infused intravenously via a cephalic vein catheter using a p,uyr hle infusion pump. In all cases, the concentration of GG was such as to allow the dose to be delivered at a rate of 0 . 42 ml/min.
In Study A, GG doses of 0 (saline only), 1. 25,

5, and 20 mg/kg were administered to 4 monkeys each over a 10 minute infusion period, and doses of 0, 5, 20, and 80 mg/kg were administered to 4 monkeys each over a 120 minute period.
In Study B, GG doses of 0, 0.5, 1, 2, 5, and 10 mg/kg were administered to 2 animals each over a 10 minute infusion period.
Arterial blood samples were collected 10 minutes prior to GG infusion, and 2, 5, 10, 20, 40, and 60 minutes after the start of the 10 minute infusion, as well as 24 (+/-4) hours later.
Hematological values were determined by Sierra Nevada Laboratories (Reno, Nevada) . Serum was used for the determination of complement CH50 and C5a.
Complement CH50 was measured by complement dependent lysis o~ sheep red blood cells as described in Kabat et al. (E~pt. ~ ~h~",. (1961) Charleg C. Thomas, New York) . C5a was measured by radio;r~ lno~say (Amersham PJ,C, U.R. ) .
~ S~E7 . i ~ 2l 9 l l 9 2 '; ' ' 3. In Viiro Studies 5 0 ml serum f rom human or monkey blood was incubated for 30 minutes at 37C with an equal volume of saline or saline ~ nt~;n;n~ 1 pg/ml, 10 pg/ml, 100 pg/ml, 1 mg/ml, or 10 mg/ml PS-oligonucleotide. Complement (CH50) activity was measured by complement-dependent lysis of sheep red blood cells as described in Kabat et al.
(~perirnemal r ~ ry (1961) Charles C. Thomas, New York) The results are shown in FIGS. 6A and 6B .
EOIJIVA~ENTS
Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specif ic substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the f ollowing claims .

A~EI~DEC~ SHEt LPE~lE~

WO 95/32719 PcrruS9S/06161 21911g2 SEQUENCE LISTING
( 1 ) GENERAL INFORMATION:
(i) APPLICANT: Galbraith, Wayne M., Agrawal, Sudhir (ii) TITLE OF INVENTION: Method o:E Depleting Complement (iii) NUMBER OF ~;(,2U~;N~:~;S: 6 (iv) CORRESPONDENCE ADDRESS:
(A) l~llllRR~ST~'.T'.: Lappin ~ Kusmer (B) STREET: 200 State Street (C) CITY: Boston (D) STATE: r~l~RE~ etts ( E ) COUNTRY: USA
(F) ZIP: 02109 (v) COMPUTER T?T~ RT.~ FORM:
(A) MEDIUM TYPE: Floppy disk (B) O~ U1~;~: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Relea~e #1. 0, Version #1. 25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Kerner, Ann-Louise (B) REGISTRATION NUMBER: 33,523 (C) ~;~ ;N~:~/DOCKET NUMBER: HYZ-021PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 617-330-1300 (B) TELEFAX: 617-330-1311 (2) INFORMATION FOR SEQ ID NO:l:
U~;N 1:~ CHARACTERI ST I CS:
(A) LENGTH: 25 base pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: linear (ii) MOLEC~LE TYPE: cDNA
( i i i ) HYPOTHET I CAL: NO
(iv) ANTI-SENSE: YES

W0 95132719 P~ 6I
21~ 2 (Xi ) ~ U~;N( :~:; DE~SCRIPTION: SEQ ID NO :1: - -CTCTCGCACC CAT~ CTTCT 25 (2) INFORM~TION FOR SEQ ID NO:2:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 ba~e pairs (B) TYPE: nucleic acid ( C) STR Z~NnRnNR.C.C: ~3 ingle (D) TOPOLOGY: linear ~ -( i i ) MOLECULE TYPE: CDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE. YES
(xi) ~;UU~;N~; DESCRIPTION: SEQ ID NO:2:
CTCTCGCACC CA~ C 2 0 (2) INFORMATION FOR SEQ ID NO:3:
(i) ~:i~;UU~;N(~ r~Z~RZ~rT~RT.CTICS:
(A) LENGTH: 2 0 ~ase pairs (B) TYPE: nucleic acid (C) STR~Nn~n~l~cc: ~ingle ( D ) TOPOLOGY: l inear ( i i ) MOLECULE TYPE: RNA
(iii) ~Y~rln~lCAL: NO
(iv) ANTI-SENSE- YES
(xi) ~l;Uu~:N~; D13SCRIPTION: SEQ ID NO:3:
CUCIJCGC;~CC Cl~u~u~,u~:u~: ~

WO 95/32719 r~ 5161 2~ 2 (2) INFORMATION FOR SEQ ID NO:4:

(i) ~ ,?U~N~; rlTZ~Rl~rT~RTSTICS:
(A) LENGTH 27 base pairs (B) TYPE nucleic acid - (C) ST~ANn~.nN~S single (D) TOPOLOGY: linear ( i i ) MOLECULE TYPE CDNA
( i i i ) HYPOTHETI CAL NO
(iV) ANTI-SENSE: YES
(Xi) ~ U~;N~; DESCRIPTION SEQ ID NO 4 ATCGAATATT Tr~r.~.AT~T CTTCCAT 27 ( 2 ) INFORMATION FOR SEQ ID NO 5 (i) ~;~S,~U~;N(~:~; CHAR~CTERISTICS
(A) LENGTH 27 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single (D) TOPOLOGY linear (ii) MOLEC~LE TYPE CDNA/RNA
(iii) ~Y~L~ 1CAL NO
( iV ) ANT I - SENSE YES
(Xi) ~ .2U~;N~; DESCRIPTION SEQ ID NO 5 AUCGAATATT Tr~r~ T~T CTUCCAT 27 (2) INFORMATION FOR SEQ ID NO:6:
(i) ~i~;5~U~;N~:~; CHARACTERISTICS
(A) LENGTH 33 base pairs (B) TYPE nucleic acid (C) STRANDEDNESS single ( D ) TOPOLOGY 1 inear ( i i ) MOLECULE TYPE CDNA

Wo 95132719 r~ u.. .r~l6l 21~ 2 (iii) HYPOTHETICAL: NO
(iv) ANTI-SBN-SE: YES
(xi) ~;l;UU~;N(:~: DESCRIPTIO~: SEQ ID NO:6:
CTCTCGCACC CATCTCTCTC ~~ iAGA GAG 33

Claims (13)

1. Use of oligonucleotide to deplete complement in a primate, the oligonucleotide being 2 to 50 nucleotides in length and having at least one phosphorothioate internucleotide linkage; and the oligonucleotide causing a measurable decrease in complement activity in a sample of blood.

2. The use of claim 1 wherein the oligonucleotide is administered as a bolus intravenous infusion at a constant rate of about 30 to 60 mg/kg/hr.

3. The use of claim 2 wherein the oligonucleotide is administered at a constant rate of about 30 mg/kg/hr.

4. The use of claim 2 wherein the oligonucleotide is administered at a constant rate of about 40 mg/kg/hr.

5. The use of claim 2 wherein 5 to 10 mg oligonucleotide per kg primate is administered over a 10 minute period.

6. The use of claim 2 wherein about 80 mg oligonucleotide per kg primate is administered over a 120 minute period.

7. The use of claim 1 wherein the oligonucleotide is about 6 to 50 nucleotides in length.

3. The use of claim 7 wherein the oligonucleotide is about 20 to 33 nucleotides in length.

9. The use of claim 1 wherein the oligonucleotide comprises at least one deoxyribonucleotide.

10. The use of claim 1 wherein the oligonucleotide comprises at least one ribonucleotide.

11. The use of claim 9 wherein the oligonucleotide comprises at least one ribonucleotide,

12. The use of claim 1 wherein the oligonucleotide is modified.

13. The use of claim 1 wherein a decrease in complement activity of at least 50% is measured.