WO1995010591A1 - Protease-containing cleaning compositions - Google Patents

Abstract

The present invention relates to cleaning compositions comprising protease enzyme which is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived by replacement of a plurality of amino acid residues of a precursor carbonyl hydrolase with different amino acids, wherein said plurality of amino acid residues replaced in the precursor enzyme correspond to position +76 in combination with one or more of the following residues: +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265, and/or +274, where the numbered positions correspond to naturally-occurring subtilisin from Bacillus amyloliquefaciens or to equivalent amino acid residues in other carbonyl hydrolases or subtilisins (such as Bacillus lentus subtilisin).

Description

PROTEASE-CONTAINING CLEANING COMPOSITIONS

This application is a continuation-in-part application of U.S. Application Serial No. 08/136,797, filed October 14, 1993 and U.S. Application Serial No. 08/237,938, filed May 2, 1994, both incorporated herein by reference in their entirety.

TECHNICAL FIELD The present invention relates to a variety of cleaning compositions comprising novel protease enzymes which are carbonyl hydrolase variants.

BACKGROUND Enzymes make up the largest class of naturally occurring proteins. Each class of enzyme generally catalyzes (accelerates a reaction without being consumed) a different kind of chemical reaction. One class of enzymes, known as proteases, are known for their ability to hydrolyze (break down a compound into two or more simpler compounds with the uptake of the H and OH parts of a water molecule on either side of the chemical bond cleaved) other proteins. This ability to hydrolyze proteins has been taken advantage of by incorporating naturally occurring and protein engineered proteases as an additive to laundry detergent preparations. Many stains on clothes are proteinaceous and wide- specificity proteases can substantially improve removal of such stains. Unfortunately, the efficacy level of these proteins in their natural, bacterial environment, frequently does not translate into the relatively unnatural wash environment. Specifically, protease characteristics such as thermal stability, pH stability, oxidative stability and substrate specificity are not necessarily optimized for utilization outside the natural environment of the enzyme. The amino acid sequence of the protease enzyme determines the characteristics of the protease. A change of the amino acid sequence of the protease may alter the properties of the enzyme to varying degrees, or may even inactivate the enzyme, depending upon the location, nature and/or magnitude of the change in the amino acid sequence. Several approaches have been taken to alter the amino acid sequence of proteases in an attempt to improve their properties, with the goal of increasing the efficacy of the protease for cleaning uses such as in the wash environment. These approaches include altering the amino acid sequence to enhance thermal stability and to improve oxidation stability under quite diverse conditions.

Despite the variety of approaches described in the art, there is a continuing need for new effective variants of proteases useful for cleaning a variety of surfaces. It is therefore an object of the present invention to provide cleaning compositions containing protease enzymes which are carbonyl hydrolase variants having improved proteolytic activity, substrate specificity, stability and/or enhanced performance characteristics. These and other objects will become readily apparent from the detailed description which follows.

SUMMARY OF THE INVENTION The present invention relates to cleaning compositions comprising:

(a) an effective amount of protease enzyme which is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived by replacement of a plurality of amino acid residues of a precursor carbonyl hydrolase with different amino acids, wherein said plurality of amino acid residues replaced in the precursor enzyme correspond to position +76 in combination with one or more of the following residues: +99, +101 , +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265, and/or +274, where the numbered positions corresponds to naturally-occurring subtilisin from Bacillus amyloliquefaciens or to equivalent amino acid residues in other carbonyl hydrolases or subtilisins (such as Bacillus lentus subtilisin); and

(b) one or more cleaning composition materials compatable with the protease enzyme.

The present invention also relates to methods for cleaning items in need of cleaning by contacting said item with a protease enzyme which is a carbonyl hydrolase variant as described herein. The invention therefore encompasses a method for cleaning fabrics comprising contacting, preferably with agitation, said fabrics with an aqueous liquor containing said protease enzyme. The method can be carried out at temperatures below about 60°C but, of course, is quite effective at laundry temperatures up to the boil. The present invention also relates to a method for cleaning dishes by contacting a dish in need of cleaning with a protease enzyme as described herein. The present invention methods also include methods for personal cleansing , said methods comprising contacting the part of the human or lower animal body in need of cleaning with a protease enzyme as described herein.

BRIEF DESCRIPTION OF THE DRAWINGS Figs. 1 A-C depict the DNA and amino acid sequence for Bacillus amyloliquefaciens subtilisin and a partial restriction map of this gene (Seq. ID No.6).

Fig. 2 depicts the conserved amino acid residues among subtilisins from Bacillus amyloliquefaciens (BPN)' and Bacillus lentus (wild-type). Figs. 3A and 3B depict the amino acid sequence of four subtilisins. The top line represents the amino acid sequence of subtilisin from Bacillus amyloliquefaciens subtilisin (also sometimes referred to as subtilisin BPN') (Seq. ID No.7). The second line depicts the amino acid sequence of subtilisin from Bacillus subtilis (Seq. ID No.8). The third line depicts the amino acid sequence of subtilisin from B. licheniformis (Seq. ID No.9). The fourth line depicts the amino acid sequence of subtilisin from Bacillus lentus (also referred to as subtilisin 309 in PCT WO89/06276) (Seq. ID No.10). The symbol * denotes the absence of specific amino acid residues as compared to subtilisin BPN'. Fig. 4 depicts the construction of plasmid GGA274.

Fig. 5 depicts the construction of GGT274 which is an intermediate to certain expression plasmids used in this application.

Figs. 6A and 6B depict the DNA and amino acid sequence of subtilisin from Bacillus lentus (Seq. ID No.11 ). The mature subtilisin protein is coded by the codons beginning at the codon GCG (334-336) corresponding to Ala.

Figs. 7A and 7B depict the DNA and amino acid sequence of a preferred embodiment of the invention (N76D/S103AΛ 104I) (Seq. ID No.12). The DNA in this figure has been modified by the methods described to encode aspartate at position 76, alanine at position 103 and isoleucine at position 104. The mature subtilisin variant protein is coded by the codons beginning at the codon GCG (334-336) corresponding to Ala.

Fig. 8 depicts the construction of vector pBCDAICAT. Fig. 9 depicts the construction of vector pUCCATFNA. Fig. 10 shows the stability of a preferred mutant enzyme compared to wild-type, in a liquid detergent formulation.

DETAILED DESCRIPTION OF THE INVENTION 1. Protease Enzymes:

The invention includes protease enzymes which are non-naturally- occurring carbonyl hydrolase variants having a different proteolytic activity, stability, substrate specificity, pH profile and/or performance characteristic as compared to the precursor carbonyl hydrolase from which the amino acid sequence of the variant is derived. The precursor carbonyl hydrolase may be a naturally-occurring carbonyl hydrolase or recombinant hydrolase. Specifically, such carbonyl hydrolase variants have an amino acid sequence not found in nature, which is derived by replacement of a plurality of amino acid residues of a precursor carbonyl hydrolase with different amino acids. The plurality of amino acid residues of the precursor enzyme correspond to position +76 in combination with one or more of the following residues +99, +101 , +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265, and/or +274, where the numbered position corresponds to naturally-occurring subtilisin from Bacillus amyloliquefaciens or to equivalent amino acid residues in other carbonyl hydrolases or subtilisins, such as Bacillus lentus subtilisin.

The carbonyl hydrolase variants which are protease enzyme useful in the present invention compositions comprise replacement of amino acid residue +76 in combination with one or more additional modifications. Preferably the variant protease enzymes useful for the present invention comprise the substitution, deletion or insertion of amino acid residues in the following combinations: 76/99; 76/101; 76/103; 76/104; 76/107; 76/123; 76/99/101; 76/99/103; 76/99/104; 76/101/103; 76/101/104; 76/103/104; 76/104/107; 76/104/123; 76/107/123; 76/99/101/103; 76/99/101/104; 76/99/103/104; 76/101/103/104; 76/103/104/123; 76/104/107/123; 76/99/101/103/104; 76/99/103/104/123; 76/99/101/103/104/123; 76/103/104/128; 76/103/104/260; 76/103/104/265; 76/103/104/197; 76/103/104/105; 76/103/104/135; 76/103/104/126; 76/103/104/107; 76/103/104/210; 76/103/104/126/265; and/or 76/103/104/222. Most preferably the variant enzymes useful for the present invention comprise the substitution, deletion or insertion of an amino acid residue in the following combination of residues: 76/99; 76/104; 76/99/104; 76/103/104; 76/104/107; 76/101/103/104; 76/99/101/103/104 and 76/101/104 of B. amyloliquefaciens subtilisin.

Variant DNA sequences encoding such carbonyl hydrolase or subtilisin variants are derived from a precursor DNA sequence which encodes a naturally-occurring or recombinant precursor enzyme. The variant DNA sequences are derived by modifying the precursor DNA sequence to encode the substitution of one or more specific amino acid residues encoded by the precursor DNA sequence corresponding to positions 76, 99, 101, 103, 104, 107, 123, 27, 105, 109, 126, 128, 135, 156, 166, 195, 197, 204, 206, 210, 216, 217, 218, 222, 260, 265 and/or 274, in Bacillus amyloliquefaciens or any combination thereof. Although the amino acid residues identified for modification herein are identified according to the numbering applicable to B. amyloliquefaciens (which has become the conventional method for identifying residue positions in all subtilisins), the preferred precursor DNA sequence useful for the present invention is the DNA sequence of Bacillus lentus as shown in Fig. 6 (Seq. ID No. 11).

These variant DNA sequences encode the insertion or substitution of the amino acid residue 76 in combination with one or more additional modification. Preferably the variant DNA sequences encode the substitution or insertion of amino acid residues in the following combinations: 76/99; 76/101 ; 76/103; 76/104; 76/107; 76/123; 76/99/101; 76/99/103; 76/99/104; 76/101/103; 76/101/104; 76/103/104; 76/104/107; 76/104/123; 76/107/123; 76/99/101/103; 76/99/101/104; 76/99/103/104; 76/101/103/104; 76/103/104/123; 76/104/107/123; 76/99/101/103/104; 76/99/103/104/123; 76/99/101 /103/104/123; 76/103/104/128; 76/103/104/260; 76/103/104/265; 76/103/104/197; 76/103/104/105; 76/103/104/135; 76/103/104/126; 76/103/104/107; 76/103/104/210; 76/103/104/126/265; and/or 76/103/104/222. Most preferably the variant DNA sequences encode for the modification of the following combinations of residues: 76/99; 76/104; 76/99/104; 76/103/104; 76/104/107; 76/101 /103/104; 76/99/101 /103/104 and 76/101 /104. These recombinant DNA sequences encode carbonyl hydrolase variants having a novel amino acid sequence and, in general, at least one property which is substantially different from the same property of the enzyme encoded by the precursor carbonyl hydrolase DNA sequence. Such properties include proteolytic activity, substrate specificity, stability, altered pH profile and/or enhanced performance characteristics. The protease enzymes useful herein encompass the substitution of any of the nineteen naturally occurring L-amino acids at the designated amino acid residue positions. Such substitutions can be made in any precursor subtilisin (procaryotic, eucaryotic, mammalian, etc.). Thoughout this application reference is made to various amino acids by way of common one- and three- letter codes. Such codes are identified in Dale, J.W. (1989), Molecular Genetics of Bacteria. John Wiley & Sons, Ltd., Appendix B.

Preferably, the substitution to be made at each of the identified amino acid residue positions include but are not limited to: substitutions at position 76 including D, H, E, G, F, K, P and N; substitutions at position 99 including D, T, N, Q, G and S; substitutions at position 101 including G, D, K, L, A, E, S and R; substitutions at position 103 including Q, T, D, E, Y, K, G, R, S, and A; substitutions at position 104 including all nineteen naturally-occurring amino acids; substitutions at position 107 including V, L, M, Y, G, E, F, T, S, A, N and I; substitutions at position 123 including N, T, I, G, A, C, and S; substitutions at position 27 including K, N, C, V and T; substitutions at position 105 including A, D, G, R and N; substitutions at position 107 including A, L, V, Y, G, F, T, S and A; substitutions at position 109 including S, K, R, A, N and D; substitutions at position 126 including A, F, I, V and G; substitutions at position 128 including G, L and A; substitutions at position 135 including A, F, I, S and V; substitutions at position 156 including D, E, A, G, Q and K; substitutions at position 166 including all nineteen naturally-occurring amino acids; substitutions at position 195 including E; substitutions at position 197 including E; substitutions at position 204 including A, G, C, S and D; substitutions at position 206 including L, Y, N, D and E; substitutions at position 210 including L, I, S, C and F; substitutions at position 216 including V, E, T and K; substitutions at position 217 including all nineteen naturally-occurring amino acids; substitutions at position 218 including S, A, G, T and V; substitutions at position 222 including all nineteen naturally-occurring amino acids; substitutions at position 260 including P, N, G, A, S, C, K and D; substitutions at position 265 including N, G, A, S, C, K, Y and H; and substitutions at position 274 including A and S. The specifically preferred amino acid(s) to be substituted at each such position are designated below in Table I. Although specific amino acids are shown in Table I, it should be understood that any amino acid may be substituted at the identified residues.

Table I

Amino Acid Preferred Amino Acid to Residue be Substituted/Inserted

+76 D,H

+99 D.T.N.G

+101 R,G,D,K,LAE

+103 A,Q,T,D,E,Y,K,G,R

+104 l,Y,S,L,A,T,G,F,M,W,D,V,N

+107 V,L,Y,G,F,T,S,A,N

+123 s,τ,ι

+27 K

+105 A,D

+109 S,K,R

+126 A.I.V.F

+128 G,L

+135 IAS

+156 E.D.Q

+166 D,G,E,K,N,A,F,I,V,L

+195 E

+197 E

+204 A.G.C

+206 L

+210 I.S.C

+216 V

+217 H,I,Y,C,A,G,F,S,N,E,K

+218 S

+222 A,Q,S,C,I,K

+260 PAS.N.G

+265 NAG.S

+274 A,S

These protease enzymes containing in vitro mutations in B. lentus subtilisin at an amino acid residue equivalent to +76 in Bacillus amyloliquefaciens subtilisin produces subtilisin variants exhibiting altered stability (e.g., modified autoproteolytic stability) over precursor subtilisins. (See

Tables IV and VI.)

Also, in vitro mutation at residues equivalent to +99, +101, +103, +104,

+107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197,

+204, +206, +210, +216, +217, +218 , +222, +260, +265, and/or +274 in

Bacillus amyloliquefaciens subtilisin, alone or in combination with each other and in any combination with +76 mutations, produce subtilisin variants exhibiting altered proteolytic activity, altered thermal stability, altered pH profile, altered substrate specificity and/or altered performance characteristics. Carbonyl hydrolases are protease enzymes which hydrolyze compounds containing

O

II C-X bonds in which X is oxygen or nitrogen. They include naturally-occurring carbonyl hydrolases and recombinant carbonyl hydrolases. Naturally-occurring carbonyl hydrolases principally include hydrolases, e.g., peptide hydrolases such as subtilisins or metal loproteases. Peptide hydrolases include α- aminoacylpeptide hydrolase, peptidylamino acid hydrolase, acyiamino hydrolase, serine carboxypeptidase, metallocarboxypeptidase, thiol proteinase, carboxylproteinase and metalloproteinase. Serine, metallo, thiol and acid proteases are included, as well as endo and exo-proteases.

"Recombinant carbonyl hydrolase" refers to a carbonyl hydrolase in which the DNA sequence encoding the naturally-occurring carbonyl hydrolase is modified to produce a mutant DNA sequence which encodes the substitution, insertion or deletion of one or more amino acids in the carbonyl hydrolase amino acid sequence. Suitable modification methods are disclosed herein, and in U.S. Patent 4,760,025 (RE 34,606), U.S. Patent 5,204,015 and U.S. Patent 5,185,258, the disclosure of which are incorporated herein by reference.

Subtilisins are bacterial or fungal carbonyl hydrolases which generally act to cleave peptide bonds of proteins or peptides. As used herein, "subtilisin" means a naturally-occurring subtilisin or a recombinant subtilisin. A series of naturally-occurring subtilisins is known to be produced and often secreted by various microbial species. Amino acid sequences of the members of this series are not entirely homologous. However, the subtilisins in this series exhibit the same or similar type of proteolytic activity. This class of serine proteases shares a common amino acid sequence defining a catalytic triad which distinguishes them from the chymotrypsin related class of serine proteases. The subtilisins and chymotrypsin related serine proteases both have a catalytic triad comprising aspartate, histidine and serine. in the subtilisin related proteases the relative order of these amino acids, reading from the amino to carboxy terminus, is aspartate-histidine-serine. In the chymotrypsin related proteases the relative order, however, is histidine-aspartate-serine. Thus, subtilisin herein refers to a serine protease having the catalytic triad of subtilisin related proteases. Examples include but are not limited to the subtilisins identified in Fig. 3 herein.

"Recombinant subtilisin" refers to a subtilisin in which the DNA sequence encoding the subtilisin is modified to produce a variant (or mutant) DNA sequence which encodes the substitution, deletion or insertion of one or more amino acids in the naturally-occurring subtilisin amino acid sequence. Suitable methods to produce such modification, and which may be combined with those disclosed herein, include those disclosed in U.S. Patent 4,760,025 (RE 34,606), U.S. Patent 5,204,015 and U.S. Patent 5,185,258.

"Non-human carbonyl hydrolases" and the DNA encoding them may be obtained from many procaryotic and eucaryotic organisms. Suitable examples of procaryotic organisms include gram negative organisms such as E. coli or Pseudomonas and gram positive bacteria such as Micrococcus or Bacillus. Examples of eucaryotic organisms from which carbonyl hydrolase and their genes may be obtained include yeast such as Saccharomyces cerevisiae, fungi such as Aspergillus sp. and non-human mammalian sources such as, for example, bovine sp. from which the gene encoding the carbonyl hydrolase chymosin can be obtained. As with subtilisins, a series of carbonyl hydrolases can be obtained from various related species which have amino acid sequences which are not entirely homologous between the members of that series but which nevertheless exhibit the same or similar type of biological activity. Thus, non-human carbonyl hydrolase as used herein has a functional definition which refers to carbonyl hydrolases which are associated, directly or indirectly, with procaryotic and eucaryotic sources.

A "carbonyl hydrolase variant" has an amino acid sequence which is derived from the amino acid sequence of a "precursor carbonyl hydrolase." The precursor carbonyl hydrolases (such as a subtilisin) include naturally- occurring carbonyl hydrolases (subtilisin) and recombinant carbonyl hydrolases (subtilisin). The amino acid sequence of the carbonyl hydrolase variant is "derived" from the precursor hydrolase amino acid sequence by the substitution, deletion or insertion of one or more amino acids of the precursor amino acid sequence. Such modification is of the "precursor DNA sequence" which encodes the amino acid sequence of the precursor carbonyl hydrolase (subtilisin) rather than manipulation of the precursor carbonyl hydrolase (subtilisin) enzyme per se. Suitable methods for such manipulation of the precursor DNA sequence include methods disclosed herein, as well as methods known to those skilled in the art (see, for example, EP 0328299,

WO89/06279 and the US patents and applications already referenced herein). Specific residues corresponding to position +76 in combination with one or more of the following positions +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210,

+216, +217, +218, +222, +260, +265 and/or +274 oi Bacillus amyloliquefaciens subtilisin are identified herein for mutation. Preferably the modified residues are selected from the following combinations: 76/99; 76/101 ; 76/103; 76/104;

76/107; 76/123; 76/99/101; 76/99/103; 76/99/104; 76/101/103; 76/101/104; 76/103/104; 76/104/107; 76/104/123; 76/107/123; 76/99/101 /103;

76/99/101/104; 76/99/103/104; 76/101/103/104; 76/103/104/123;

76/104/107/123; 76/99/101/103/104; 76/99/103/104/123;

76/99/101/103/104/123; 76/103/104/128; 76/103/104/260; 76/103/104/265;

76/103/104/197; 76/103/104/105; 76/103/104/135; 76/103/104/126; 76/103/104/107; 76/103/104/210; 76/103/104/126/265; and/or 76/103/104/222; and most preferably are 76/99; 76/104; 76/99/104; 76/103/104; 76/104/107;

76/101/103/104; 76/99/101/103/104 and 76/101/104. These amino acid position numbers refer to those assigned to the mature Bacillus amyloliquefaciens subtilisin sequence presented in Fig. 1. The protease enzymes useful in the present invention, however, are not limited to the mutation of this particular subtilisin but extends to precursor carbonyl hydrolases containing amino acid residues at positions which are "equivalent" to the particular identified residues in Bacillus amyloliquefaciens subtilisin.

Preferably, the precursor subtilisin is Bacillus lentus subtilisin and the substitutions, deletions or insertions are made at the equivalent amino acid residue in β. lentus corresponding to those listed above.

A residue (amino acid) of a precursor carbonyl hydrolase is equivalent to a residue of Bacillus amyloliquefaciens subtilisin if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analogous to a specific residue or portion of that residue in Bacillus amyloliquefaciens subtilisin (i.e., having the same or similar functional capacity to combine, react, or interact chemically).

In order to establish homology to primary structure, the amino acid sequence of a precursor carbonyl hydrolase is directly compared to the Bacillus amyloliquefaciens subtilisin primary sequence and particularly to a set of residues known to be invariant in subtilisins for which sequence is known. Fig.

2 herein shows the conserved residues as between amyloliquefaciens subtilisin and B. lentus subtilisin. After aligning the conserved residues, allowing for necessary insertions and deletions in order to maintain alignment (i.e., avoiding the elimination of conserved residues through arbitrary deletion and insertion), the residues equivalent to particular amino acids in the primary sequence of Bacillus amyloliquefaciens subtilisin are defined. Alignment of conserved ^• residues preferably should conserve 100% of such residues. However, alignment of greater than 75% or as little as 50% of conserved residues is also adequate to define equivalent residues. Conservation of the catalytic triad, Asp32/His64/Ser221 should be maintained. For example, in Fig. 3 the amino acid sequence of subtilisin from

Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus licheniformis (carisbergensis) and Bacillus lentus are aligned to provide the maximum amount of homology between amino acid sequences. A comparison of these sequences shows that there are a number of conserved residues contained in each sequence. These conserved residues (as between BPN' and B. lentus) are identified in Fig. 2.

These conserved residues, thus, may be used to define the corresponding equivalent.amino acid residues of Bacillus amyloliquefaciens subtilisin in other carbonyl hydrolases such as subtilisin from Bacillus lentus (PCT Publication No. W089/06279 published July 13, 1989), the preferred . subtilisin precursor enzyme herein, or the subtilisin referred to as PB92 (EP O 328299), which is highly homologous to the preferred Bacillus lentus subtilisin. The amino acid sequences of certain of these subtilisins are aligned in Figs. 3A and 3B with the sequence of Bacillus amyloliquefaciens subtilisin to produce the maximum homology of conserved residues. As can be seen, there are a number of deletions in the sequence of Bacillus lentus as compared to Bacillus amyloliquefaciens subtilisin. Thus, for example, the equivalent amino acid for Val 165 in Bacillus amyloliquefaciens subtilisin in the other subtilisins is isoleucine for B. lentus and B. licheniformis. Thus, for example, the amino acid at position +76 is asparagine (N) in both β. amyloliquefaciens and β. lentus subtilisins. In the preferred subtilisin variant useful in the invention, however, the amino acid equivalent to +76 in Bacillus amyloliquefaciens subtilisin is substituted with aspartate (D). A comparison of all the amino acid residues identified herein for substitution versus the preferred substitution for each such position is provided in Table II for illustrative purposes. Table II

+76 +99 +101 +103 +104 +107 +123

B. amyloliquefaciens N D s Q Y I N (wild-type)

B. lentus (wild-type) N S s S V I N

Most Preferred Substitution D D R A l/Y V S

Equivalent residues may also be defined by determining homology at the level of tertiary structure for a precursor carbonyl hydrolase whose tertiary structure has been determined by x-ray crystallography. Equivalent residues are defined as those for which the atomic coordinates of two or more of the main chain atoms of a particular amino acid residue of the precursor carbonyl hydrolase and Bacillus amyloliquefaciens subtilisin (N on N, CA on CA, C on C and O on O) are within 0.13nm and preferably 0.1 nm after alignment.

Alignment is achieved after the best model has been oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the carbonyl hydrolase in question to the Bacillus amyloliquefaciens subtilisin. The best model is the crystallographic model giving the lowest R factor for experimental diffraction data at the highest resolution available.

R factor - W f ff l ∑_h\Fo (h) \

Equivalent residues which are functionally analogous to a specific residue of Bacillus amyloliquefaciens subtilisin are defined as those amino acids of the precursor carbonyl hydrolases which may adopt a conformation such that they either alter, modify or contribute to protein structure, substrate binding or catalysis in a manner defined and attributed to a specific residue of the Bacillus amyloliquefaciens subtilisin. Further, they are those residues of the precursor carbonyl hydrolase (for which a tertiary structure has been obtained by x-ray crystallography) which occupy an analogous position to the extent that, although the main chain atoms of the given residue may not satisfy the criteria of equivalence on the basis of occupying a homologous position, the atomic coordinates of at least two of the side chain atoms of the residue lie with 0.13nm of the corresponding side chain atoms of Bacillus amyloliquefaciens subtilisin. The coordinates of the three dimensional structure of Bacillus amyloliquefaciens subtilisin are set forth in EPO Publication No. 0251 446 (equivalent to U.S. Patent Application SN 08/212,291, the disclosure of which is incorporated herein by reference) and can be used as outlined above to determine equivalent residues on the level of tertiary structure.

Some of the residues identified for substitution, insertion or deletion are conserved residues whereas others are not. In the case of residues which are not conserved, the replacement of one or more amino acids is limited to substitutions which produce a variant which has an amino acid sequence that does not correspond to one found in nature. In the case of conserved residues, such replacements should not result in a naturally-occurring sequence. The carbonyl hydrolase variants useful in the present invention include the mature forms of carbonyl hydrolase variants, as well as the pro- and prepro-forms of such hydrolase variants. The prepro-forms are the preferred construction since this facilitates the expression, secretion and maturation of the carbonyl hydrolase variants. "Prosequence" refers to a sequence of amino acids bound to the N- terminal portion of the mature form of a carbonyl hydrolase which when removed results in the appearance of the "mature" form of the carbonyl hydrolase. Many proteolytic enzymes are found in nature as translational proenzyme products and, in the absence of post-translational processing, are expressed in this fashion. A preferred prosequence for producing carbonyl hydrolase variants, specifically subtilisin variants, is the putative prosequence of Bacillus amyloliquefaciens subtilisin, although other subtilisin prosequences may be used. In the Examples, the putative prosequence from the subtilisin from Bacillus lentus (ATCC 21536) is used. A "signal sequence" or "presequence" refers to any sequence of amino acids bound to the N-terminal portion of a carbonyl hydrolase or to the N- terminal portion of a prohydrolase which may participate in the secretion of the mature or pro forms of the hydrolase. This definition of signal sequence is a functional one, meant to include all those amino acid sequences encoded by the N-terminal portion of the subtilisin gene or other secretable carbonyl hydrolases which participate in the effectuation of the secretion of subtilisin or other carbonyl hydrolases under native conditions. The protease enzymes useful for the present invention utilize such sequences to effect the secretion of the carbonyl hydrolase variants as described herein. A preferred signal sequence used in the Examples comprises the first seven amino acid residues of the signal sequence from Bacillus subtilis subtilisin fused to the remainder of the signal sequence of the subtilisin from Bacillus lentus (ATCC 21536). A "prepro" form of a carbonyl hydrolase variant consists of the mature form of the hydrolase having a prosequence operably linked to the amino terminus of the hydrolase and a "pre" or "signal" sequence operably linked to the amino terminus of the prosequence. "Expression vector" refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of said DNA in a suitable host. Such control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites and sequences which control termination of transcription and translation. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, "plasmid" and "vector" are sometimes used interchangeably as the plasmid is the most commonly used form of vector at present. However, included herein are such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.

The "host cells" used in the present invention generally are procaryotic or eucaryotic hosts which preferably have been manipulated by the methods disclosed in U.S. Patent 4,760,025 (RE 34,606) to render them incapable of secreting enzymatically active endoprotease. A preferred host cell for expressing subtilisin is the Bacillus strain BG2036 which is deficient in enzymatically active neutral protease and alkaline protease (subtilisin). The construction of strain BG2036 is described in detail in U.S. Patent 5,264,366. Other host cells for expressing subtilisin include Bacillus subtilis 1168 (also described in U.S. Patent 4,760,025 (RE 34,606) and U.S.Patent 5,264,366, the disclosure of which are incorporated herein by reference), as well as any suitable Bacillus strain such as B. licheniformis, B. lentus, etc. Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the carbonyl hydrolase variants or expressing the desired carbonyl hydrolase variant. In the case of vectors which encode the pre- or prepro-form of the carbonyl hydrolase variant, such variants, when expressed, are typically secreted from the host cell into the host cell medium. "Operably linked, " when describing the relationship between two DNA regions, simply means that they are functionally related to each other. For example, a presequence is operably linked to a peptide if it functions as a signal sequence, participating in the secretion of the mature form of the protein most probably involving cleavage of the signal sequence. A promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.

The genes encoding the naturally-occurring precursor carbonyl hydrolase may be obtained in accord with the general methods known to those skilled in the art. The methods generally comprise synthesizing labeled probes having putative sequences encoding regions of the hydrolase of interest, preparing genomic libraries from organisms expressing the hydrolase, and screening the libraries for the gene of interest by hybridization to the probes. Positively hybridizing clones are then mapped and sequenced. The B. lentus gene used in the Examples is cloned as described in Example 1 of U.S. Patent 5,185,258, the disclosure of which is incorporated herein. The BPN' gene used in the Examples is cloned as described in Example 1 in RE 34,606, the disclosure of which is incorporated herein. The cloned carbonyl hydrolase is then used to transform a host cell in order to express the hydrolase. The hydrolase gene is then ligated into a high copy number plasmid. This plasmid replicates in hosts in the sense that it contains the well-known elements necessary for plasmid replication: a promoter operably linked to the gene in question (which may be supplied as the gene's own homologous promotor if it is recognized, i.e., transcribed, by the host), a transcription termination and polyadenylation region (necessary for stability of the MRNA transcribed by the host from the hydrolase gene in certain eucaryotic host cells) which is exogenous or is supplied by the endogenous terminator region of the hydrolase gene and, desirably, a selection gene such as an antibiotic resistance gene that enables continuous cultural maintenance of plasmid-infected host cells by growth in antibiotic-containing media. High copy number plasmids also contain an origin of replication for the host, thereby enabling large numbers of plasmids to be generated in the cytoplasm without chromosomal limitations. However, it is within the scope herein to integrate multiple copies of the hydrolase gene into host genome. This is facilitated by procaryotic and eucaryotic organisms which are particularly susceptible to homologous recombination. The genes used in the present examples are a natural B. lentus gene and a natural β. amyloliquefaciens gene. Alternatively, a synthetic gene encoding a naturally-occurring or mutant precursor carbonyl hydrolase (subtilisin) may be produced. In such an approach, the DNA and/or amino acid sequence of the precursor hydrolase (subtilisin) is determined. Multiple, overlapping synthetic single-stranded DNA fragments are thereafter synthesized, which upon hybridization and ligation produce a synthetic DNA encoding the precursor hydrolase. An example of synthetic gene construction is set forth in Example 3 of U.S. Patent 5,204,015, the disclosure of which is incorporated herein by reference.

Once the naturally-occurring or synthetic precursor carbonyl hydrolase gene has been cloned, a number of modifications are undertaken to enhance the use of the gene beyond synthesis of the naturally-occurring precursor carbonyl hydrolase. Such modifications include the production of recombinant carbonyl hydrolases as disclosed in U.S. Patent 4,760,025 (RE 34,606) and EPO Publication No. 0251 446 and the production of carbonyl hydrolase variants described herein.

The following cassette mutagenesis method may be used to facilitate the construction and identification of the carbonyl hydrolase variants useful in the present invention, although other methods including site-directed mutagenesis may be used. First, the naturally-occurring gene encoding the hydrolase is obtained and sequenced in whole or in part. Then the sequence is scanned for a point at which it is desired to make a mutation (deletion, insertion or substitution) of one or more amino acids in the encoded enzyme. The sequences flanking this point are evaluated for the presence of restriction sites for replacing a short segment of the gene with an oligonucleotide pool which when expressed will encode various mutants. Such restriction sites are preferably unique sites within the hydrolase gene so as to facilitate the replacement of the gene segment. However, any convenient restriction site which is not overly redundant in the hydrolase gene may be used, provided the gene fragments generated by restriction digestion can be reassembled in proper sequence. If restriction sites are not present at locations within a convenient distance from the selected point (from 10 to 15 nucleotides), such sites are generated by substituting nucleotides in the gene in such a fashion that neither the reading frame nor the amino acids encoded are changed in the final construction. Mutation of the gene in order to change its sequence to conform to the desired sequence is accomplished by M13 primer extension in accord with generally known methods. The task of locating suitable flanking regions and evaluating the needed changes to arrive at two convenient restriction site sequences is made routine by the redundancy of the genetic code, a restriction enzyme map of the gene and the large number of different restriction enzymes. Note that if a convenient flanking restriction site is available, the above method need be used only in connection with the flanking region which does not contain a site.

Once the naturally-occurring DNA or synthetic DNA is cloned, the restriction sites flanking the positions to be mutated are digested with the cognate restriction enzymes and a plurality of end termini-complementary oligonucleotide cassettes are ligated into the gene. The mutagenesis is simplified by this method because all of the oligonucleotides can be synthesized so as to have the same restriction sites, and no synthetic linkers are necessary to create the restriction sites. As used herein, proteolytic activity is defined as the rate of hydrolysis of peptide bonds per milligram of active enzyme. Many well known procedures exist for measuring proteolytic activity (K. M. Kalisz, "Microbial Proteinases," Advances in Biochemical Enqinee nα/Biotechnoloαv. A. Fiechter ed., 1988). In addition to or as an alternative to modified proteolytic activity, the variant enzymes of the present invention may have other modified properties such as K_m, m i ratio and/or modified substrate specificity and/or modified pH activity profile. These enzymes can be tailored for the particular substrate which is anticipated to be present, for example, for hydrolytic processes such as laundry uses. One objective can be to secure a variant carbonyl hydrolase having altered proteolytic activity as compared to the precursor carbonyl hydrolase, since increasing such activity (numerically larger) enables the use of the enzyme to more efficiently act on a target substrate. Also of interest are variant enzymes having altered thermal stability and/or altered substrate specificity as compared to the precursor. Preferably the carbonyl hydrolase to be mutated is a subtilisin. Specific amino acids useful to obtain such results in subtilisin-type carbonyl hydrolases at residues equivalent to +76, +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265 and/or +274 or any combination thereof in Bacillus amyloliquefaciens subtilisin are presented in the Examples. In some instances, lower proteolytic activity may be desirable. Conversely, in some instances it may be desirable to increase the proteolytic activity of the variant enzyme versus its precursor. Additionally, increases or decreases (alteration) of the stability of the variant, whether alkaline or thermal stability, may be desirable. Increases or decreases in K,-,,, K„, or K^/l^ are specific to the substrate used to determine these kinetic parameters. Also, it has been determined that residues equivalent to +76 in combination with a number of other modifications in subtilisin are important in modulating overall stability and/or proteolytic activity of the enzyme. Thus, as set forth in the Examples, the Asparagine (N) in Bacillus lentus subtilisin at equivalent position +76 can be substituted with Aspartate (D) in the preferred protease enzymes in combination with modification of one or more of the following amino acid residues +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265 and/or +274 to produce enhanced stability and/or enhanced activity of the resulting mutant enzyme. The most preferred protease enzymes useful in this invention are set forth in the Examples. These include the following specific combinations of substituted residues: N76D/S99D; N76DA/104I; N76D/S99D/V104I; N76D/S103A/V104I; N76D/V1041/1107V; N76D/V104Y/1107V and N76D/S101R/S103A/V104I. These substitutions are preferably made in Bacillus lentus (recombinant or native-type) subtilisin, although the substitutions may be made in any Bacillus subtilisin.

Based on the results obtained with this and other variant subtilisins, it is apparent that residues in carbonyl hydrolases (preferably subtilisin) equivalent to positions +76, +99, +101 , +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265 and/or +274 in Bacillus amyloliquefaciens are important to the proteolytic activity, performance and/or stability of these enzymes and the cleaning or wash performance of such variant enzymes.

The following is presented by way of example for manufacturing protease enzymes useful in the present invention compositions.

Protease Manufacture Example Construction for the Expression of GG36 Gene in B. subtilis The cloning and the construction for expression of the subtilisin gene from B. lentus is performed essentially the same as that described in U.S. Patent 5,185,258. The plasmid GGA274 (described in Fig. 4 herein) is further modified in the following manner, as shown in Fig. 5. The Pstl site that is introduced during the construction of the GGA274 plasmid is removed by the oligonucleotide directed mutagenesis described below, with an oligonucleotide having the following sequence: 5' GAAGCTGCAACTCGTTAAA 3' (Seq. ID No.1 ). The underlined "A" residue eliminates the recognition sequence of restriction enzyme Pstl and changes the corresponding amino acid residue from alanine to threonine at position 274. Threonine at position 274 is the wild- type residue originally found in the cloned B. lentus subtilisin gene sequences. The DNA segment encoding subtilisin is excised from the plasmid GGA274 or its derivatives (GGT274 shown in Fig. 5) by EcoRI and BamHI digest. The DNA fragment is subcloned back into Bacteriophage M13-based vectors, such as MP19, for mutagenesis. After mutagenesis, the EcoRI and Hindlll digest, followed by cloning, are performed to move the mutated subtilisin gene back into an expression plasmid like GGA274 for the expression and the recovery of mutated subtilisin proteins.

Oliαonucleotide-Directed Mutagenesis Oligonucleotide-directed mutagenesis is performed as described in

Zoller, M. et al. (1983), Methods Enzvmol.. 100:468-500. As an example, a synthetic oligonucleotide of the sequence 5' GCTGCTCTAGACAATTCG 3' (Seq. ID No.2) is used to change the amino acid residue at position 76 from asparagine (N) to aspartic acid (D), or N76D. The underlined "G" and "C" residues denote changes from the wild-type gene sequence. The CA keeps the ieucine at position +75 and changes the amino acid sequence to introduce an Xbal recognition site of the Xbal restriction enzyme (TCTAGA), while the change at GAC changes asparagine at +76 to aspartate.

For mutagenesis at positions 99, 101, 103 and 104, different oligonucleotides can be used depending on the combination of mutations desired. For example, an oligonucleotide of the sequence 5' GTATTAGGGGCGGACGGTCGAGGCGCCATCAGCTCGATT 3'(Seq. ID No.3) is used to simultaneously make the following changes: S99D; S101 R; S103A and V104I in a single subtilisin molecule. Similarly, oligonucleotides of the sequence 5' TCAGGTTCGGTCTCGAGCGTTGCCCAAGGATTG 3' (Seq. ID No.4) and 5' CACGTTGCTAGCTTGAGTTTAG 3' (Seq. ID No.5) are utilized to generate 1107V and N123S, respectively. Again, the underlined residues denote changes from wild-type sequences which produce desired changes either in amino acid sequences or restriction enzyme recognition sequences. Proteolytic Activity of Subtilisin Variants

Following the methods of Oligonucleotide-Directed Mutagenesis hereinbefore, the variants listed in Table III are made. Proteolytic activity of each of these subtilisin variants is shown in Table III. The kinetic parameters I ,,,, Kμ, and I^K_M are measured for hydrolysis of the synthetic peptide substrate succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide using the method described in P. Bonneau et al. (1991) J. Am. Chem. Soc. Vol. 113, No. 3, p. 1030. Briefly, a small aliquot of subtilisin variant stock solution is added to a 1 cm cuvette containing substrate dissolved in 0.1M Tris-HCL buffer, pH 8.6, and thermostated at 25°C. The reaction progress is followed spectrophotometrically by monitoring the absorbance of the reaction product p- nitroaniline at 410 nm. Kinetic parameters are obtained by using a non-linear regression algorithm to fit the reaction velocity and product concentration for each reaction to the Michaelis-Menten equation.

Table III

Kinetic Parameters kς_at, KM and _ca^/KM Measured for Bacillus lentus Subtilisin and Variants

Protease # Enzvme iScat is- =ll KMI ) i cat KM Variants isJj tl)

- B. lentus Subtilisin 170 0.00078 2.18x10^s

- N76D 219 0.0008 2.74x10^s

1 N76D/S99D 88 0.00061 1.44x10^s

2 N76D/S101R 371 0.0013 2.85x10^s

3 N76D/S103A 400 0.0014 2.86x10^s

4 N76DΛ I04I 459 0.0011 4.17x10^s

5 N76D/I107V 219 0.0011 1.99x10^s

6 N76D/N123S 115 0.0018 6.40x10⁴

7 N76D/S99D/S101R 146 0.00038 3.84x10^s

8 N76D/S99D/S103A 157 0.0012 1.31x10^s

9 N76D/S99D/V104I 247 0.00097 2.55x10^s

10 N76D/S101R/S103A 405 0.00069 5.90x10^s

11 N76D/S101R/V104I 540 0.00049 1.10X10⁶

12 N76D/S103A V104I 832 0.0016 5.20x10^s

13 N76D/V1041/1107V 497 0.00045 1.10x10⁶

14 N76D/V104Y/I107V 330 0.00017 1.90x10⁶

15 N76D/V104I/N123S 251 0.0026 9.65x10⁴

16 N76D/I107V/N123S 147 0.0035 4.20x10⁴

17 N76D/S99D/S101 R/S103A 242 0.00074 3.27x10^s

18 N76D/S99D/S101 R/V104I 403 0.00072 5.60x10^s

19 N76D/S99D/S103A V104I 420 0.0016 2.62x10^s

20 N76D/S101 R S103A/V104I 731 0.00065 1.12X10⁶

21 N76D/S103AΛ 104I/N123S 321 0.0026 1.23x10^s

22 N76D/V104I/I107V N123S 231 0.003 7.70x10⁴

23 N76D/S99D/S101 R/S103A/V104I 624 0.00098 6.37x10^s

24 N76D/S99D/S103A/V104I/N123S 194 0.0043 4.51x10⁴

25 N76D/S99D/S101 R/S103A/V104I/N123S 311 0.0023 1.35x10^s

The results listed in Table III indicate that all of the subtilisin variants tested retain proteolytic activity. Further, detailed analysis of the data reveal that proteolytic activity is significantly altered for Bacillus lentus subtilisin by the various combinations of substitutions at amino acid residues equivalent to positions 76, 99, 101, 103, 104, 107 and 123 in Bacillus amyloliquefaciens.

Thermal Stability of Subtilisin Variants A comparison of thermal stability observed for Bacillus lentus subtilisin and the variants of the present invention made by the process of Oligonucleotide-Directed Mutagenesis hereinbefore is shown in Table IV. Purified enzyme, 15 ug/ml in 0.1 M glycine 0.01% Tween-80 pH 10.0, with or without 50 mM CaCl2, is aliquotted into small tubes and incubated at 10°C for 5 minutes, 10°C to 60°C over 1 minute, and 60°C for 20 minutes. Tubes are then placed on ice for 10 minutes. Aliquots from the tubes are assayed for enzyme activity by addition to 1 cm cuvettes containing 1.2 mM of the synthetic peptide substrate succinyl-L-ala-L-Ala-L-Pro-L-Phe-p-nitroanilide dissolved in 0.1 M tris-HCL buffer, pH 8.6, thermostatted at 25°C. The initial linear reaction velocity is followed spectrophotometrically by monitoring the absorbance of the reaction product p-nitroaniline at 410 nm as a function of time. Data are presented as percent activity prior to heating. The results listed in Table IV indicate that a vast majority of variants exhibit thermal stability comparable to Bacillus lentus subtilisin (24 out of 26) in the test condition with 50mM CaCI₂ added. In the test condition without 50mM CaCI₂ added, a vast majority of variants (19 out of 26) are significantly more stable than Bacillus lentus subtilisin. Further, the variants N76D/S99D, N76D/V104I, N76D/S99D/V104I, N76D/S103A/V104I, N76D/V1041/1107V, N76DΛ 104Y/1107V and N76D/S101 R/S103A/V104I are significantly more stable than the single substitution variant N76D in the test condition without 50mM CaCI, added.

Table IV

Thermal Stability Measured for Bacillus lentus Subtilisin and Variants

At pH 10, 60°C, +/- 50mM CaCI₂ Added % Initial Activity Remaining

Enzvme -CaCI? +CaCh

B. lentus Subtilisin 2 96 N76D 34 97

N76D/S99D 49 98 N76D/S101R 0 82 N76D/S103A 26 92 N76D/V104I 58 98 N76D/I107V 32 96 N76D/N123S 0 97 N76D/S99D/S101R 30 100 N76D/S99D/S103A 36 100 N76D/S99D/V104I 48 97 N76D/S101R/S103A 26 100

N76D/S101R V104I 38 100

N76D/S103A/V104I 58 100

N76DΛ/1041/1107V 60 97

N76D/V104Y/I107V 48 74

N76DΛ 104I/N123S 0 98

N76D/I107V/N123S 16 100

N76D/S99D/S101 R/S103A 38 100

N76D/S99D/S101R/V104I 33 100

N76D/S99D/S103A/V104I 38 98

N76D/S101 R/S103A/V104I 40 99

N76D/S103A/V104I/N123S 1 98

N76D/V1041/1107V/N123S 3 99

N76D/S99D/S101 R/S103A/V104I 36 99

N76D/S99D/S103A/V104I/N123S 2 95

N76D/S99D/S101 R/S103A/V104I/N123S 0 100

Oligonucleotide-Directed Mutagenesis with Sinole-Stranded DNA Template Generated from Phaoemid

A. Construction of B. lentus Variants

The mutagenesis protocol is essentially the same as described above in Oligonucleotide-Directed Mutagenesis. The single-stranded DNA template is generated by phagemid method. To construct the phagemid vector for generating the single-stranded DNA template we first construct the vector pBCDAICAT. The flow chart of vector construction is outlined in Figure 8.

First, the C1al to C1al fragment encoding the CAT gene from pC194 plasmid (Horinouchi, S. and Weisblum, B., J. Bacterio 150:8-15, 1982) is cloned into the Accl site of polylinker region of pUC19 (New England BioLabs, Beverly,

MA) to make plasmid pUCCHL and the EcoRI-Dral 0.6 KB fragment from the 5' end of the GG36DAI encoding DNA is cloned into the EcoRI and EcoRV sites of pBSKS plasmid (Stratagene, Inc., San Diego, CA) to make pBC2SK5. The single EcoRI site of the plasmid pBC2SK5 is eliminated by EcoRI digestion, followed by filling in catalyzed-by-T4 DNA polymerase, and religation to generate the plasmid ρBC2SK-5R which does not have the EcoRI site. The

EcoRI-Dral fragment which is cloned into pBCSK-5R is isolated as a Pstl-

Hindlll fragment and cloned into the Pstl-Hindlll site of the pUCCHL (part of the polylinker of pUC19) to generate plasmid pUCCHL5R. The encoding sequence of GG36DAI gene is excised as an EcoRI-BamHI fragment and cloned into the EcoRI-BamHI sites of pUCCHL5R to make pUCCAT. The large EcoRl-Hindlll fragment of pUCCAT is then cloned into the EcoRI and Hindlll sites of BS2KS+ to generate the plasmid pBCDAICAT.

To generate single-stranded DNA, £. co//-containing pBCDAICAT are infected with phage R408 (obtained from Stratagene, San Diego, CA) following ιe protocol described in Russel, M., Kidd, S. and Kelley, M.R., GENE 45:333- 338, 1986. Once the single-stranded DNA template is available, standard mutagenesis methods as described above in Oligonucleotide-Directed Mutogenesis are carried out. The construction of certain mutants is detailed below for illustrative purposes.

For the construction of B. lentus (GG36) N76D/S103A/V104I/L217H, an EcoRI-BamHI DNA fragment encoding GG36 N76D/S103A V104I is used in the construction of pUCCAT (see Fig. 8) to generate the plasmid pBCDAICAT. After the single-stranded DNA template is made following the protocol described above, a mutagenesis primer with the following sequence * *** ** x Cf a/

5' TAT GCC AGC CAC AAC GGT ACT. TCG ATG GCT 3' (Seq. ID No.13) is used to make the L217H. As before, the underlined residues denote the nucleotide changes that are made and the x C7a/ indicates that the existing C1al site is eliminated after the mutagenesis. The mutagenesis protocol is as described in Oligonucleotide-Directed Mutogenesis hereinbefore. After the mutagenesis, plasmid DNA is first screened for the elimination of the C1al site and those clones missing the C1al site are subjected to DNA sequence analysis to verify the DNA sequence which made the L to H change at the 217th amino acid residue. B. Construction of BPN' Variants and their Expression in B. subtilis

The construction of B. amyloliquefaciens (BPN') N76D/Q103A Y104I/Y217L is done in a similar fashion except in two consecutive steps. N76D is first introduced into BPN' Y217L to make BPN' N76D/Y217L and a second mutagenesis is done to convert BPN' N76D/Y217L to BPN' N76D/Q103A/Y104I/Y217L. To generate the single-stranded DNA template for the first mutagenesis, an EcoRI-BamHI fragment encoding BPN' Y217L subtilisin (derived from the Y217L plasmid described in Wells, J., et al., PNAS. 84, 5167, 1087) is used to construct a plasmid pUCCATFNA (see Fig. 9). The pUCCATFNA plasmid containing BPN' Y217L is used to construct the pBCFNACAT plasmid (Fig. 9). Single-stranded DNA is generated as described above. To generate BPN' N76D/Y217L, an oligonucleotide primer with the sequence * *** ^** Xbal

5' C ACA GTT GCG GCT CTA GAT AAC TCA ATC GGT G 3' (Seq. ID

No.14) is used to generate the change N76D. Single-stranded DNA is then prepared from the pBCFNACAT plasmid containing the BPN' N76D/Y217L (the pBCFNACAT plasmid after N76D mutagenesis) and mutagenized with another oligonucleotide with the sequence

* *** ** x Pvull

5' GCT GAC GGT TCC GGC GCJ AJT AGJ TGG ATC ATT 3' (Seq. ID No.15) to obtain BPN' N76D/Q103A/Y104I/Y217L. All steps involved in the cloning, the single-stranded DNA preparation, the mutagenesis, and the screening for mutants are carried out as described above. Expression of the BPN' gene and its variants are achieved by integrating plasmid DNA (pBCFNACAT containing the different variants' BPN' gene) directly into a protease-deficient strain of

Bacillus subtilis as described in RE 34,606.

Numerous variants are made as per the teachings of these Protease

Manufacture Examples. Kinetics data and stability data are generated for such variants. The kinetics data are generated using the methods described hereinbefore and are provided in Table V. The stability data are generated as detailed herein. Results are shown in Table VI.

Thermal Stability Assay Procedure

Purified enzyme is buffer-exchanged into 0.1 M glycine pH 10.0, 0.01%

Tween-80 by applying the enzyme to a column consisting of Sephadex G-25 equilibrated with this buffer and elufmg the enzyme from the column using the same buffer.

To a tube containing 0.1 M glycine, 0.01% Tween-80 pH 10.0 thermostatted at 60°C, the buffer-exchanged enzyme is added to give a final enzyme concentration of 15 ug/ml. Aliquots are removed from the 60°C incubation at various times and immediately assayed for enzyme activity by addition to a 1 cm cuvette containing 1.2 mM of the synthetic peptide substrate succinyl-L-Ala-L-Ala-L-

Pro-L-Phe-p-nitroanilide dissolved in 0.1 M tris-HCL buffer, pH 8.6, thermostatted at 25°C. The initial linear reaction velocity is followed spectrophotometrically by monitoring the absorbance of the reaction product p- nitroaniline at 410 nm as a function of time.

Half-life, which is the length of time required for 50% enzyme inactivation, is determined from the first-order plot of reaction velocity as a function of the time of incubation at 60°C. The data are presented in Table VI as percent of the half-life determined or Bacillus lentus subtilisin (GG36) under identical conditions.

Table V kcat KM kcat KM

Enzyme

(8-1 ) (mM) (s"¹M'¹ )

B. lentus subtilisin 170 0.78 2.20E+05

N76D/S103G/V104I* 380 1.4 2.70E+05

N76D/S103A/V104F 730 0.33 2.20E+06

N76D/S103A/V104N 790 2.8 2.80E+05

N76D/S103A/V104S 170 0.83 2.00E+05

N76D/S103A/V104T 370 1.9 2.00E+05

N76D/S103A/V104W 880 0.31 2.80E+06

N76D/S103A V104Y 690 0.5 1.40E+06

K27R N76D/V104Y/N123S 500 1.2 4.20E+05

N76D/S101 G/S103A/V104I* 620 1.3 4.80E+05

N76D/S103A/V104I/S105A^* 550 1.3 4.20E+05

N76D/S103AΛ 104I/S105D* 440 1.7 2.60E+05

N76D/S103A/V104T/I107A* 120 5.7 2.10E+04

N76D/S103A V104T/I107L^* 310 3.2 9.70E+04

N76D/S103A/V104I/L126A 90 2.2 4.10E+04

N76D/S103A/V104I/L126F 180 1.9 9.50E+04

N76D/S103A/V104I/L126I 100 2.4 4.20E+04

N76D/S103AΛ/104I/L126V 64 3.2 2.00E+04

N76D/S103A/V104I/S128G^* 560 1.7 3.30E+05

N76D/S103A/V104I/S128L* 430 3.8 1.10E+05

N76D/S103A/V104I/L135A 140 0.76 1.80E+05

N76D/S103A/V104I/L135F 390 0.69 5.70E+05

N76D/S103A/V104I/L135I 110 0.73 1.50E+05

N76D/S103A/V104I/L135V 140 0.86 1.60E+05

N76D/S103A/V104I/S156E* 170 2.6 6.50E+04

N76D/S103A/V104I/S166D* 160 3.5 4.60E+04

N76D/S103A/V104I/D197E 510 1.4 3.60E+05

N76D/S103A/V104I/N204A* 530 1.1 4.80E+05

N76D/S103A/V104I/N204G* 580 1.4 4.10E+05

N76D/S103A/V104I/N204C* 370 1.3 2.90E+05

N76D/S103A/V104I/P21 OI* 500 1.2 4.20E+05

N76D/S103A/V104I/L217H* 80 0.63 1.30E+05

N76D/S 103A/V104I/M222A 70 3.1 2.30E+04

N76D/S103A/V104I/M222S 80 3.1 2.60E+04

N76D/S103A/V104IH^"260P 660 1.5 4.40E+05

N76D/S103AΛ 104I/S265N 590 1.3 4.50E+05

K27R/N76D/V104Y/I107V/N 123S 220 1.4 1.60E+05

K27R/N76D/V104Y/N123S/D197E 430 1.1 3.90E+05

K27R N76D/V104Y/N123S/N204C 400 1.1 3.60E+05

K27R/N76D/V104Y/N123S/Q206L 440 1.2 3.70E+05 K27R/N76D/V104Y/N123S/S216V 440 1.2 3.70E+05 K27R/N76DΛ 104Y/N123S/N218S 760 0.98 7.80E+05 K27R/N76D/V104Y/N123S/T260P 410 1.2 3.40E+05 K27R/N76D/V104Y/N 123S T274A 390 1 3.90E+05 N76D/S103A/V104I/L126F/S265N 170 2.1 8.10E+04 N76D/S103A/V104I/S156E/S166D^* 40 6.3 6.40E+03 K27R N76D/V104Y/N123S/G195E G1 S7E 410 0.98 4.20E+05 K27R/N76D V104Y/N123S/G195E/N218S 540 0.66 8.20E+05 K27R/N76D/V104Y/N123S/D197E N218S 770 0.79 9.80E+05 K27R/N76D/V104Y/N123S/N204C/N218S 610 0.99 6.20E+05 K27R/N76D/V104Y/N123S/Q206L/N218S 580 0.78 7.40E+05 K27R N76D/V104Y/N123S/N218SH^"260P 660 1 6.60E+05 K27R/N76D/V104Y/N123S/N218S T274A 590 0.89 6.60E+05 K27R/N76D/V104Y/Q109S/N123S/N218S T 520 1 5.20E+05 274A

K27R/N76D/V104Y/N123S/G195E/D197E/N 460 0.65 7.10E+05 218S

B. amyloliquefaciens subtilisin (BPN') 50 0.14 3.60E+05 BPN'-N76D/Y217L* 380 0.46 8.30E+05

^* These mutants are made as per Oligonucleotide-Directed Mutagenesis with Single-Stranded DNA Template Generated from Phagemid, all others made as per Oligonucleotide-Directed Mutagenesis, hereinbefore.

Table VI

Enzyme Thermal Stability (% half-life of native enzyme)

B. lentus subtilisin 100

N76D 590

N76D/S99D 840

N76D/S103A 390

N76D/V104I 660

N76D/I107V 710

N76D/N123S 70

N76D/S99D/S101R 610

N76D/S99D/S103A 590

N76D/S99D/V104I 910

N76D/S101R/S103A 930

N76D/S101R V104I 500

N76D/S103A/V104I 460

N76D/S103G/V104I* 370

N76D/S103A/V104F 480

N76D/S103A/V104N 230

N76D/S103A/V104S 230

N76D/S103A/V104T 370 N76D/S103A/V104W 280

N76D/S103A/V104Y 400

N76D/V1041/1107V 940

N76D/V104Y/I107V 820

N76D/V104I/N123S 80

N76D/I107V/N123S 150

K27R/N76D/V104Y/N123S 100

N76D/S99D/S101 R/S103A 570

N76D/S99D/S101 R V104I 1000

N76D/S99D/S103A/V104I 680

N76D/S101G/S103A/V104I* 390

N76D/S101R/S103A/V104I 470

N76D/S103A/V104I/S105A* 360

N76D/S103A/V104I/S105D* 370

N76D/S 103A/V104T/1107A* 270

N76D/S103A/V104T/I107L^* 230

N76D/S103A V104I/N123S 110

N76DΛ/104I/I107V/N123S 220

N76D/S103A/V104I/L126A 270

N76D/S103A/V104I/L126F 950

N76D/S103AΛ/104I/L126I 410

N76D/S103A/V104I/L126V 320

N76D/S103A/V104I/S128G^* 640

N76D/S103AΛ/104I/S128L* 760

N76D/S103A/V104I/L135A 230

N76D/S103A/V104I/L135F 200

N76D/S103A/V104I/L135I 510

N76D/S103A/V104I/L135V 500

N76D/S103A/V104I/S156E* 120

N76D/S103A/V104I/S166D* 590

N76D/S103AΛ/104I/D197E 460

N76D/S103A/V104I/N204A* 230

N76D/S103A/V104I/N204G^* 240

N76D/S103AΛ 104I/N204C^* 500

N76D/S103A/V104I/P210I* 1370

N76D/S103A/V104I/L217H^* 60

N76D/S103A/V104I/M222A 520

N76D/S103A/V104I/M222S 490

N76D/S103A/V104I T260P 490

N76D/S103A/V104I/S265N 360

K27R N76D/V104Y/I107V/N123S 210

K27R/N76D/V104Y/N123S/D197E 120

K27R/N76D/V104Y/N123S/N204C 110

K27R/N76D/V104Y/N123S/Q206L 380

K27R/N76D/V104Y/N123S/S216V 140

K27R/N76D/V104Y/N123S/N218S 270

K27R/N76D/V104Y/N123S T260P 40

K27R/N76D/V104Y/N123S T274A 60

N76D/S99D/S101R/S103A/V104I 590

N76D/S99D/S103A V104I/N123S 110

N76D/S103A/V104I/L126F/S265N 810 N76D/S103A/V104I/S156E/S166D* 220

K27R/N76D/V104Y/N123S/G195E/G197E 90

K27R N76D/V104Y/N123S/G195E/N218S 250

K27R N76D/V104Y/N123S/D197E/N218S 270

K27R/N76D/V104Y/N123S/N204C/N218S 460

K27R N76D/V104Y/N123S/Q206L/N218S 1400

K27R/N76D/V104Y/N123S/N218S/T260P 310 K27R/N76D/V104Y/N123S/N218S/T274A 180

N76D/S99D/S101R/S103A/V104I/N123S 90

K27R/N76D/V104Y/Q109S/N123S/N218S/T274 230

K27R/N76D/V104Y/N123S/G195E D197E/N21 240

B. amyloliquefaciens subtilisin (BPN') 100

BPN'-N76D/Y217L^* 420

* These mutants are made as per Oligonucleotide-Directed Mutagenesis with Single-Stranded DNA Template Generated from Phagemid, all others made as per Oligonucleotide-Directed Mutagenesis, hereinbefore.

2. Cleaning Composition Materials: The cleaning compositions of the present invention also comprise, in addition to the protease enzyme described hereinbefore, one or more cleaning composition materials compatible with the protease enzyme. The term

"cleaning composition materials", as used herein, means any liquid, solid or gaseous material selected for the particular type of cleaning composition desired and the form of the product (e.g., liquid; granule; spray composition), which materials are also compatible with the protease enzyme used in the composition. The specific selection of cleaning composition materials are readily made by considering the surface, item or fabric to be cleaned, and the desired form of the composition for the cleaning conditions during use (e.g., through the wash detergent use). The term "compatible", as used herein, means the cleaning composition materials do not reduce the proteolytic activity of the protease enzyme to such an extent that the protease is not effective as desired during normal use situations. Specific cleaning composition materials are exemplified in detail hereinafter. An effective amount of one or more protease enzymes described above are included in compositions useful for cleaning a variety of surfaces in need of proteinaceous stain removal. Such cleaning compositions include detergent compositions for cleaning hard surfaces, unlimited in form (e.g., liquid and granular); detergent compositions for cleaning fabrics, unlimited in form (e.g., granular, liquid and bar formulations); dishwashing compositions (unlimited in form); oral cleaning compositions, unlimited in form (e.g., dentifrice, toothpaste and mouthwash formulations); and denture cleaning compositions, unlimited in form (e.g., liquid, tablet). As used herein, "effective amount of protease enzyme" refers to the quantity of protease enzyme described hereinbefore necessary to achieve the enzymatic activity necessary in the specific cleaning composition. Such effective amounts are readily ascertained by one of ordinary skill in the art and is based on many factors, such as the particular enzyme variant used, the cleaning application, the specific composition of the cleaning composition, and whether a liquid or dry (e.g., granular, bar) composition is required, and the like.

Preferably the cleaning compositions of the present invention comprise from about 0.0001 % to about 10% of one or more protease enzymes, more preferably from about 0.001% to about 1%, more preferably still from about 0.001% to about 0.1%. Several examples of various cleaning compositions wherein the protease enzymes may be employed are discussed in further detail below. All parts, percentages and ratios used herein are by weight unless otherwise specified.

As used herein, "non-fabric cleaning compositions" include hard surface cleaning compositions, dishwashing compositions, oral cleaning compositions, denture cleaning compositions and personal cleansing compositions. A. Cleaning Compositions for Hard Surfaces. Dishes and Fabrics The protease enzymes can be used in any detergent composition where high sudsing and/or good insoluble substrate removal are desired. Thus the protease enzymes can be used with various conventional ingredients to provide fully-formulated hard-surface cleaners, dishwashing compositions, fabric laundering compositions and the like. Such compositions can be in the form of liquids, granules, bars and the like. Such compositions can be formulated as modern "concentrated" detergents which contain as much as 30%-60% by weight of surfactants.

The cleaning compositions herein can optionally, and preferably, contain various anionic, nonionic, zwitterionic, etc., surfactants. Such surfactants are typically present at levels of from about 0.1 % to about 60%, preferably from about 1% to about 35%, of the compositions.

Nonlimiting examples of surfactants useful herein include the conventional Cn-Ciβ alky' benzene sulfonates and primary and random alkyl sulfates, the C10-C18 secondary (2,3) alkyl sulfates of the formulas CH₃(CH₂)x(CHOSO3)-M⁺)CH₃ and CH₃(CH₂)y(CHOS0₃-M⁺) CH₂CH₃ wherein x and (y+1 ) are integers of at least about 7, preferably at least about 9, and M is a water-solubilizing cation, especially sodium, the C10-C18 ^alky' alkoxy sulfates (especially EO 1-7 ethoxy sulfates), C10-C18 alkyl alkoxy carboxylates (especially the EO 1-7 ethoxycarboxylates), the C-jo-C β alkyl polyglycosides, and their corresponding sulfated polyglycosides, C12-C18 alpha-sulfonated fatty acid esters, C12-C18 ^a'^ky' and alkyl phenol alkoxylates (especially ethoxylates and mixed ethoxy/propoxy), C12-C18 betaines and sulfobetaines ("sultaines"), C-|o^-C18 amine oxides, C8-C24 sarcosinates (especially oleoyl sarcosinate), and the like. The alkyl alkoxy sulfates (AES) and alkyl alkoxy carboxylates (AEC) are preferred herein. (Use of such surfactants in combination with the aforesaid amine oxide and/or betaine or sultaine surfactants is also preferred, depending on the desires of the formulator.) Other conventional useful surfactants are listed in standard texts. Particularly useful surfactants include the C-JQ-CIS N-methyl glucamides disclosed in US Patent 5, 194,639, Connor et al., issued March 16, 1993, incoφorated herein by reference. Particularly useful is the class of nonionic surfactants which are condensates of ethylene oxide with a hydrophobic moiety to provide a surfactant having an average hydrophilic-lipophilic balance (HLB) in the range from 5 to 17, preferably from 6 to 14, more preferably from 7 to 12. The hydrophobic (lipophilic) moiety may be aliphatic or aromatic in nature and the length of the polyoxyethylene group which is condensed with any particular hydrophobic group can be readily adjusted to yield a water-soluble compound having the desired degree of balance between hydrophilic and hydrophobic elements. Especially preferred are the C9-C15 primary alcohol ethoxylates (or mixed ethoxy/propoxy) containing 3-8 moles of ethylene oxide per mole of alcohol, particularly the C14-C15 primary alcohols containing 6-8 moles of ethylene oxide per mole of alcohol, the C12-C15 primary alcohols containing 3- 5 moles of ethylene oxide per mole of alcohol, and mixtures thereof.

A wide variety of other ingredients useful in detergent cleaning compositions can be included in the compositions herein, including other active ingredients, carriers, hydrotropes, processing aids, dyes or pigments, solvents for liquid formulations, etc. If an additional increment of sudsing is desired, suds boosters such as the C10-C16 alkolamides can be incorporated into the compositions, typically at about 1% to about 10% levels. The C10-C1 monoethanol and diethanol amides illustrate a typical class of such suds boosters. Use of such suds boosters with high sudsing adjunct surfactants such as the amine oxides, betaines and sultaines noted above is also advantageous. If desired, soluble magnesium salts such as MgCl2, MgSO.4, and the like, can be added at levels of, typically, from about 0.1% to about 2%, to provide additional sudsing.

The liquid detergent compositions herein can contain water and other solvents as carriers. Low molecular weight primary or secondary alcohols exemplified by methanol, ethanol, propanol, and isopropanol are suitable. Monohydric alcohols are preferred for solubilizing surfactants, but polyols such as those containing from about 2 to about 6 carbon atoms and from about 2 to about 6 hydroxy groups (e.g., 1,3-propanediol, ethylene glycol, glycerine, and 1 ,2-propanediol) can also be used. The compositions may contain from about 5% to about 90%, typically from about 10% to about 50% of such carriers. The detergent compositions herein will preferably be formulated such that during use in aqueous cleaning operations, the wash water will have a pH between about 6.8 and about 11.0. Finished products thus are typically formulated at this range. Techniques for controlling pH at recommended usage levels include the use of buffers, alkalis, acids, etc., and are well known to those skilled in the art.

When formulating the hard surface cleaning compositions and fabric cleaning compositions of the present invention, the formulator may wish to employ various builders at levels from about 5% to about 50% by weight. Typical builders include the 1-10 micron zeolites, polycarboxylates such as citrate and oxydisuccinates, layered silicates, phosphates, and the like. Other conventional builders are listed in standard formularies.

Likewise, the formulator may wish to employ various additional enzymes, such as cellulases, lipases, amylases, peroxidases, and proteases in such compositions, typically at levels of from about 0.001 % to about 1 % by weight. Various detersive and fabric care enzymes are well-known in the laundry detergent art.

Various bleaching compounds, such as the percarbonates, perborates and the like, can be used in such compositions, typically at levels from about 1 % to about 15% by weight. If desired, such compositions can also contain bleach activators such as tetraacetyl ethylenediamine, nonanoyloxybenzene sulfonate, and the like, which are also known in the art. Usage levels typically range from about 1% to about 10% by weight.

Various soil release agents, especially of the anionic oligoester type, various chelating agents, especially the aminophosphonates and ethylenediaminedisuccinates, various clay soil removal agents, especially ethoxylated tetraethylene pentamine, various dispersing agents, especially polyacrylates and polyasparatates, various brighteners, especially anionic brighteners, various dye transfer inhibiting agents, such as polyvinyl pyrrolidone, various suds suppressors, especially silicones and secondary alcohols, various fabric softeners, especially smectite clays and clay floculating polymers (e.g., poly(oxy ethylene)), and the like can all be used in such compositions at levels ranging from about 1 % to about 35% by weight. Standard formularies and published patents contain multiple, detailed descriptions of such conventional materials.

Enzyme stabilizers may also be used in the cleaning compositions of the present invention. Such enzyme stabilizers include propylene glycol

(preferably from about 1% to about 10%), sodium formate (preferably from about 0.1% to about 1%) and calcium formate (preferably from about 0.1% to about 1%). 1. Hard surface cleaning compositions As used herein "hard surface cleaning composition" refers to liquid and granular detergent compositions for cleaning hard surfaces such as floors, walls, bathroom tile, and the like. Hard surface cleaning compositions of the present invention comprise an effective amount of one or more protease enzymes, preferably from about 0.0001% to about 10%, more preferably from about 0.001 % to about 5%, more preferably still from about 0.001 % to about 1 % by weight of active protease enzyme of the composition. In addition to comprising one or more protease enzymes, such hard surface cleaning compositions typically comprise a surfactant and a water-soluble sequestering builder. In certain specialized products such as spray window cleaners, however, the surfactants are sometimes not used since they may produce a filmy/streaky residue on the glass surface.

The surfactant component, when present, may comprise as little as 0.1% of the compositions herein, but typically the compositions will contain from about 0.25% to about 10%, more preferably from about 1% to about 5% of surfactant.

Typically the compositions will contain from about 0.5% to about 50% of a detergency builder, preferably from about 1 % to about 10%. Preferably the pH should be in the range of about 8 to 12. Conventional pH adjustment agents such as sodium hydroxide, sodium carbonate or hydrochloric acid can be used if adjustment is necessary.

Solvents may be included in the compositions. Useful solvents include, but are not limited to, glycol ethers such as diethyleneglycol monohexyl ether, diethyleneglycol monobutyl ether, ethyleneglycol monobutyl ether, ethyleneglycol monohexyl ether, propyleneglycol monobutyl ether, dipropyleneglycol monobutyl ether, and diols such as 2,2,4-trimethyl-1,3- pentanediol and 2-ethyl-1 ,3-hexanediol. When used, such solvents are typically present at levels of from about 0.5% to about 15%, preferably from about 3% to about 11 %.

Additionally, highly volatile solvents such as isopropanol or ethanol can be used in the present compositions to facilitate faster evaporation of the composition from surfaces when the surface is not rinsed after "full strength" application of the composition to the surface. When used, volatile solvents are typically present at levels of from about 2% to about 12% in the compositions.

The hard surface cleaning composition embodiment of the present invention is illustrated by the following nonlimiting examples. (In the following examples, reference to "Protease #" in the examples is to the variant useful in the present invention compositions having the given number in Table III hereinbefore.)

Examples 1-6 Liouid Hard Surface Cleaning Compositions

Example No.

Component 1 2 3 4 5 6

Protease * 12 0.05 0.20 0.02 0.03 0.10 0.03

Protease # 4 — — - - 0.20 0.02

EDTA** — — 2.90 2.90 — —

Na Citrate — — — — 2.90 2.90

NaCi2 Alkyl-benzene 1.95 — 1.95 — 1.95 — sulfonate

NaC-12 Alkylsulfate — 2.20 — 2.20 — 2.20

NaC-|2(ethoxy)^*** — 2.20 — 2.20 — 2.20 sulfate

Ci2 Dimethylamine — 0.50 — 0.50 — 0.50 oxide

Na Cumene sulfonate 1.30 — 1.30 — 1.30 —

Hexyl Carbitol**^* 6.30 6.30 6.30 6.30 6.30 6.30

Water**** balance to 100%

Na4 ethylenediamine diacetic acid *Diethyleneglycol monohexyl ether All formulas adjusted to pH 7 In Examples 1-4 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention described in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 5 and 6, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4, with substantially similar . results.

Examples 7-12

Spray Compositions for Cleaning Hard Surfaces and Removing Household Mildew

Example No.

Component 7 8 9 10 11 12

Protease # 12 0.20 0.05 0.10 0.30 0.20 0.30

Protease # 4 - - - - 0.30 0.10

Sodium octyl sulfate 2.00 2.00 2.00 2.00 2.00 2.00

Sodium dodecyl sulfate 4.00 4.00 4.00 4.00 4.00 4.00

Sodium hydroxide 0.80 0.80 0.80 0.80 0.80 0.80

Silicate (Na) 0.04 0.04 0.04 0.04 0.04 0.04

Perfume 0.35 0.35 0.35 0.35 0.35 0.35

Water balance to 100%

Product pH is about 7.

In Examples 7-10 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention described in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 11 and 12, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4, with substantially similar results. 2. Dishwashing Compositions

In another embodiment of the present invention, dishwashing compositions comprise one or more protease enzymes. As used herein, "dishwashing composition" refers to all forms for compositions for cleaning dishes, including but not limited to, granular and liquid forms. The dishwashing composition embodiment of the present invention is illustrated by the following examples. Examples 13-18

Dishwashing Composition

Example No.

Component 13 14 15 16 17 18

Protease # 12 0.05 0.50 0.02 0.40 0.10 0.03

Protease # 4 - - - - 0.40 0.02

C12-C14 N-methyl- glucamide 0.90 0.90 0.90 0.90 0.90 0.90

C-|2 ethoxy (1) sulfate 12.00 12.00 12.00 12.00 12.00 12.00

2-methyl undecanoic acid 4.50 4.50 — 4.50 4.50 —

C-|2 ethoxy (2) carboxylate 4.50 4.50 4.50 4.50 4.50 4.50

C-|2 alcohol ethoxylate (4) 3.00 3.00 3.00 3.00 3.00 3.00

C-|2 amine oxide 3.00 3.00 3.00 3.00 3.00 3.00

Sodium cumene sulfonate 2.00 2.00 2.00 2.00 2.00 2.00

Ethanol 4.00 4.00 4.00 4.00 4.00 4.00

Mg⁺⁺ (as MgCl2) 0.20 0.20 0.20 0.20 0.20 0.20

Ca⁺⁺ (as CaCI₂) 0.40 0.40 0.40 0.40 0.40 0.40

Water balance to 100°/c >

Product pH is adjusted to 7.

In Examples 13-16 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention described in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 17 and 18, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4 with substantially similar results.

Example 19 Granular Automatic Dishwashing Composition Component A B C Citric Acid 15.0 - - Citrate 4.0 29.0 15.0

Acrylate/methacrylate copolymer 6.0 - 6.0 Acrylic acid maleic acid copolymer - 3.7 - Dry add carbonate 9.0 - 20.0 Alkali metal silicate 8.5 17.0 9.0 Paraffin - 0.5 - Benzotriazole - 0.3 - Termamyl 60T 1.5 1.5 1.0 Protease # 12 (4.6% prill) 1.6 1.6 1.6 Percarbonate (AvO) 1.5 - - Perborate monohydrate - 0.3 1.5 Perborate tetrahydrate - 0.9 - Tetraacetylethylene diamine 3.8 4.4 - Diethylene triamine penta methyl 0.13 0.13 0.13 phosphonic acid (Mg salt) Alkyl ethoxy sulphate - 3 times ethoxylated 3.0 Alkyl ethoxy propoxy nonionic surfactant 1.5 Suds suppressor 2.0 Olin SLF18 nonionic surfactant 2.0 Sulphate Balance to 100%

In Examples 19 A-C the Protease #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention described in Tables V and VI, are substituted for Protease #12, with substantially similar results. Also in Examples 19 A-C, any combination of the proteases useful in the present invention recited in Tables III, V and VI among others, are substituted for Protease # 12 with substantially similar results. 3. Fabric cleaning compositions

In another embodiment of the present invention, fabric cleaning compositions comprise one or more protease enzymes. As used herein, "fabric cleaning composition" refers to all forms for detergent compositions for cleaning fabrics, including but not limited to, granular, liquid and bar forms. a. Granular fabric cleaning compositions

The granular fabric cleaning compositions of the present invention contain an effective amount of one or more protease enzymes, preferably from about 0.001% to about 10%, more preferably from about 0.005% to about 5%, more preferably from about 0.01% to about 1% by weight of active protease enzyme of the composition. In addition to one or more protease enzymes, the granular fabric cleaning compositions typically comprise at least one surfactant, one or more builders, and, in some cases, a bleaching agent.

The granular fabric cleaning composition embodiment of the present invention is illustrated by the following examples.

Examples 20-23 Granular Fabric Cleaning Composition

Example No.

Component 20 21 22 23

Protease # 12 (4% Prill) 0.10 0.20 0.03 0.05

Protease # 4 (4% Prill) - - 0.02 0.05

C<i3 linear alkyl benzene sulfonate 22.00 22.00 22.00 22.00

Phosphate (as sodium 23.00 23.00 23.00 23.00 tripolyphosphates)

Sodium carbonate 23.00 23.00 23.00 23.00

Sodium silicate 14.00 14.00 14.00 14.00

Zeolite 8.20 8.20 8.20 8.20

Chelant (diethylaenetriamine- 0.40 0.40 0.40 0.40 pentaacetic acid)

Sodium sulfate 5.50 5.50 5.50 5.50

Water balance to 100%

In Examples 20-21 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention described in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 22 and 23, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4, with substantially similar results. Examples 24-27 Granular Fabric Cleaning Composition

Example No.

Component 24 25 26 27

Protease # 12 (4% Prill) 0.10 0.20 0.03 0.05

Protease # 4 (4% Prill) - - 0.02 0.05

C*i2 alkyl benzene sulfonate 12.00 12.00 12.00 12.00

Zeolite A (1-10 miαometer) 26.00 26.00 26.00 26.00

2-butyl octanoic acid 4.00 4.00 4.00 4.00

C12-C14 secondary (2,3) alkyl sulfate, 5.00 5.00 5.00 5.00

Na salt Sodium citrate 5.00 5.00 5.00 5.00 Optical brightener 0.10 0.10 0.10 0.10 Sodium sulfate 17.00 17.00 17.00 17.00 Fillers, water, minors balanceto 100%

In Examples 24 and 25 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 26 and 27, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4, with substantially similar results.

Examples 28 and 29

Granular Fabric Cleaning Compositions

Components Example No

28 29

Linear alkyl benzene sulphonate 11.4 10.70

Tallow alkyl sulphate 1.80 2.40

^14-15 alkyl sulphate 3.00 3.10

C14-15 alcohol 7 times ethoxylated 4.00 4.00

Tallow alcohol 11 times ethoxylated 1.80 1.80

Dispersant 0.07 0.1

Silicone fluid 0.80 0.80

Trisodium citrate 14.00 15.00

Citric acid 3.00 2.50

Zeolite 32.50 32.10

Maleic acid acrylic acid copolymer 5.00 5.00

Diethylene triamine penta methylene 1.00 0.20 phosphonic acid

Protease # 12 (4% Prill) 0.30 0.30

Lipase 0.36 0.40

Amylase 0.30 0.30

Sodium silicate 2.00 2.50

Sodium sulphate 3.50 5.20

Polyvinyl pyrrolidone 0.30 0.50

Perborate 0.5 1

Phenol sulphonate 0.1 0.2

Peroxidase 0.1 0.1

Minors Up to 100 Up to 100

Examples 30 and 31

Granular Fabric Cleaning Compositions

Example No.

Components 30 31

Sodium linear C-J2 alkyl benzene-sulfonate 6.5 8.0

Sodium sulfate 15.0 18.0

Zeolite A 26.0 22.0

Sodium nitrilotriacetate 5.0 5.0

Polyvinyl pyrrolidone 0.5 0.7

Tetraacetylethylene diamine 3.0 3.0 Boric acid 4.0 -

Perborate 0.5 1

Phenol sulphonate 0.1 0.2

Protease * 12 (4% Prill) 0.4 0.4

Fillers (e.g., silicates; carbonates; perfumes; Up to 100 Up to 100 water)

Example 32

ComDact Granular Fabric Cleaning Composition

Components Weight %

Alkyl Sulphate 8.0

Alkyl Ethoxy Sulphate 2.0

Mixture of C25 and C45 alcohol 3 and 7 times ethoxylated 6.0

Polyhydroxy fatty acid amide 2.5

Zeolite 17.0

Layered silicate/citrate 16.0

Carbonate 7.0

Maleic acid acrylic acid copolymer 5.0

Soil release polymer 0.4

Carboxymethyl cellulose 0.4

Poly (4-vinylpyridine) -N-oxide 0.1

Copolymer of vinylimidazole and vinylpyrrolidone 0.1

PEG2000 0.2

Protease # 12 (4% Prill) 0.5

Lipase 0.2

Cellulase 0.2

Tetracetylethylene diamine 6.0

Percarbonate 22.0

Ethylene diamine disuccinic acid 0.3

Suds suppressor 3.5

Disodium-4,4'-bis (2-morpholino -4-anilino-s-triazin-6- 0,25 ylamino) stilbene-2,2'-disulphonate

Disodium-4,4'-bis (2-sulfostyril) biphenyl 0.05

Water, Perfume and Minors Up to 100

Example 33

Granular Fabric Cleaning Composition

Component Weight %

Linear alkyl benzene sulphonate 7.6 C16-C 8 alkyl sulfate 1.3

C 14-15 alcohol 7 times ethoxylated 4.0

Coco-alkyl-dimethyl hydroxyethyl ammonium chloride 1.4

Dispersant 0.07

Silicone fluid 0.8

€ Trisodium citrate 5.0

Zeolite 4A 15.0

Maleic acid acrylic acid copolymer 4.0

Diethylene triamine penta methylene phosphonic acid 0.4

Perborate 15.0

Tetraacetylethylene diamine 5.0

Smectite clay 10.0

Poly (oxy ethylene) (MW 300,000) 0.3

Protease * 12 (4% Prill) 0.4

Lipase 0.2

Amylase 0.3

Cellulase 0.2

Sodium silicate 3.0

Sodium carbonate 10.0

Carboxymethyl cellulose 0.2

Brighteners 0.2

Water, perfume and minors Up to 100

Example 34

Granular Fabric Cleaning Composition

Component Weight %

Linear alkyl benzene sulfonate 6.92

Tallow alkyl sulfate 2.05

C 14-15 alcohol 7 times ethoxylated 4.4

C 12-15 ^a"^<y' eth xy sulfate - 3 times ethoxylated 0.16

Zeolite 20.2

Citrate 5.5

Carbonate 15.4

Silicate 3.0

Maleic acid acrylic acid copolymer 4.0

Carboxymethyl cellulase 0.31

Soil release polymer 0.30

Protease # 12 (4% Prill) 0.2 Lipase 0.36

Cellulase 0.13

Perborate tetrahydrate 11.64

Perborate monohydrate 8.7

Tetraacetylethylene diamine 5.0

Diethylene tramine penta methyl phosphonic acid 0.38

Magnesium sulfate 0.40

Brightener 0.19

Perfume, silicone, suds suppressors 0.85

Minors Up to 100

In each of Examples 28-34 herein the Protease #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention described in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 28-34, any combination of the proteases useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 with substantially similar results, b. Liouid fabric cleaning compositions

Liquid fabric cleaning compositions of the present invention comprise an effective amount of one or more protease enzymes, preferably from about 0.0001% to about 10%, more preferably from about 0.001% to about 1%, and most preferably from about 0.001% to about 0.1%, by weight of active protease enzyme of the composition. Such liquid fabric cleaning compositions typically additionally comprise an anionic surfactant, a fatty acid, a water-soluble detergency builder and water.

The liquid fabric cleaning composition embodiment of the present invention is illustrated by the following examples.

Examples 35-39

Liαuid Fabric Cleaninα Compositions

Example No.

Component 35 36 37 38 39

Protease # 12 0.05 0.03 0.30 0.03 0.10

Protease # 4 — — 0.01 0.20

Ci2- C14 alkyl sulfate, Na 20.00 20.00 20.00 20.00 20.00

2-Butyl octanoic acid 5.00 5.00 5.00 5.00 5.00

Sodium citrate 1.00 1.00 1.00 1.00 1.00

C10 alcohol ethoxylate (3) 13.00 13.00 13.00 13.00 13.00

Monethanolamine 2.50 2.50 2.50 2.50 2.50

Water/oroovlene olvcol/ethanol (100:1:1 balance to 100%

In Examples 35-37 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 38 and 39, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4, with substantially similar results.

Examples 40-41 Liouid Fabric Cleaning Compositions

Example No.

Component 40 41

C 12-14 alkenyl succinic acid 3.0 8.0

Citric acid monohydrate 10.0 15.0

Sodium C 12-15 alkyl sulphate 8.0 8.0

Sodium sulfate of C-|2-15 alcohol 2 times ethoxylated - 3.0

Ci2-15 alcohol 7 times ethoxylated - 8.0

C 12-15 alcohol 5 times ethoxylated 8.0 -

Diethylene triamine penta (methylene phosphonic acid) 0.2 -

Oleic acid 1.8 -

Ethanol 4.0 4.0

Propanediol 2.0 2.0

Protease # 12 0.2 0.2

Polyvinyl pyrrolidone 1.0 2.0

Suds suppressor 0.15 0.15

NaOH up tc i pH 7.5

Perborate 0.5 1

Phenol sulphonate 0.1 0.2

Peroxidase 0.4 0.1

Waters and minors up to 100 parts

In each of Examples 40 and 41 herein the Protease #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for

Protease # 12, with substantially similar results. Also in Examples 40 and 41 , any combination of the proteases useful in the present invention recited in Tables III, V and VI, among others, are substituted from Protease # 12 with substantially similar results. c. Bar fabric cleaning compositions

Bar fabric cleaning compositions of the present invention suitable for hand-washing soiled fabrics contain an effective amount of one or more protease enzymes, preferably from about 0.001% to about 10%, more preferably from about 0.01 % to about 1 % by weight of the composition. The bar fabric cleaning composition embodiment of the present invention is illustrated by the following examples. Examples 42-45

Bar Fabric Cleani ino Compositions

Example No.

Component 42 43 44 45

Protease * 12 0.3 - 0.1 0.02

Protease # 4 - - 0.4 0.03

C12-C16 alkyl sulfate, Na 20.0 20.0 20.0 20.00

C 2-C14 N-methyl glucamide 5.0 5.0 5.0 5.00

C-11-C-13 alkyl benzene sulfonate, Na 10.0 10.0 10.0 10.00

Sodium carbonate 25.0 25.0 25.0 25.00

Sodium pyrophosphate 7.0 7.0 7.0 7.00

Sodium tripolyphosphate 7.0 7.0 7.0 7.00

Zeolite A (0.1 -.10μ) 5.0 5.0 5.0 5.00

Carboxymethylcellulose 0.2 0.2 0.2 0.20

Polyaαylate (MW 1400) 0.2 0.2 0.2 0.20

Coconut monethanolamide 5.0 5.0 5.0 5.00

Brightener, perfume 0.2 0.2 0.2 0.20

CaSθ4 1.0 1.0 1.0 1.00

MgS0 1.0 1.0 1.0 1.00

Water 4.0 4.0 4.0 4.00

Filler* balance to 100%

^*Can be selected from convenient materials such as CaCO₃, talc, clay, silicates, and the like.

In Examples 42 and 43 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results.

In Examples 44 and 45, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 and Protease # 4, with substantially similar results. B. Additional Cleaning Compositions

In addition to the hard surface cleaning, dishwashing and fabric cleaning compositions discussed above, one or more protease enzymes may be incoφorated into a variety of other cleaning compositions where hydrolysis of an insoluble substrate is desired. Such additional cleaning compositions include but are not limited to, oral cleaning compositions, denture cleaning compositions, and contact lens cleaning compositions. 1. Oral cleaning compositions

In another embodiment of the present invention, a pharmaceutically- acceptable amount of one or more protease enzymes are included in compositions useful for removing proteinaceous stains from teeth or dentures. As used herein, "oral cleaning compositions" refers to dentifrices, toothpastes, toothgels, toothpowders, mouthwashes, mouth sprays, mouth gels, chewing gums, lozenges, sachets, tablets, biogels, prophylaxis pastes, dental treatment solutions, and the like. Preferably, oral cleaning compositions of the present invention comprise from about 0.0001% to about 20% of one or more protease enzymes, more preferably from about 0.001% to about 10%, more preferably still from about 0.01% to about 5%, by weight of the composition, and a pharmaceutical ly-acceptable carrier. As used herein, "pharmaceutical ly- acceptable" means that drugs, medicaments or inert ingredients which the term describes are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, incompatibility, instability, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio. Typically, the pharmaceutically-acceptable oral cleaning carrier components of the oral cleaning components of the oral cleaning compositions will generally comprise from about 50% to about 99.99%, preferably from about 65% to about 99.99%, more preferably from about 65% to about 99%, by weight of the composition.

The pharmaceutically-acceptable carrier components and optional components which may be included in the oral cleaning compositions of the present invention are well known to those skilled in the art. A wide variety of composition types, carrier components and optional components useful in the oral cleaning compositions are disclosed in U.S. Patent 5,096,700, Seibel, issued March 17, 1992; U.S. Patent 5,028,414, Sampathkumar, issued July 2, 1991; and U.S. Patent 5,028,415, Benedict, Bush and Sunberg, issued July 2, 1991; all of which are incoφorated herein by reference.

The oral cleaning composition embodiment of the present invention is illustrated by the following examples. Examples 46-49 Dentifrice Composition

Example No.

Component 46 47 48 49

Protease # 12 2.000 3.500 1.500 2.000

Sorbitol (70% aqueous solution) 35.000 35.000 35.000 35.000

PEG-6* 1.000 1.000 1.000 1.000

Silica dental abrasive** 20.000 20.000 20.000 20.000

Sodium fluoride 0.243 0.243 0.243 0.243

Titanium dioxide 0.500 0.500 0.500 0.500

Sodium saccharin 0.286 0.286 0.286 0.286

Sodium alkyl sulfate (27.9% 4.000 4.000 4.000 4.000 aqueous solution) Flavor 1.040 1.040 1.040 1.040

Carboxyvinyl Polymer*** 0.300 0.300 0.300 0.300 Carrageenan* 0.800 0.800 0.800 0.800 Water balance to 100%

*PEG-6 = Polyethylene glycol having a molecular weight of 600. *^*Precipitated silica identified as Zeodent 119 offered by J.M. Huber. ***Carbopol offered by B.F. Goodrich Chemical Company. *^***lota Carrageenan offered by Hercules Chemical Company.

In Examples 46-49 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 46-49, any combination of the protease enzymes useful in the present invention recited in Tables III, V, VI, among others, are substituted for Protease # 12 with substantially similar results. Examples 50-53

Mouthwash Composition

Example No.

Component 50 51 52 53

Protease # 12 3.00 7.50 1.00 5.00

SDA 40 Alcohol 8.00 8.00 8.00 8.00

Flavor 0.08 0.08 0.08 0.08

Emulsifier 0.08 0.08 0.08 0.08

Sodium Fluoride 0.05 0.05 0.05 0.05

Glycerin 10.00 10.00 10.00 10.00

Sweetener 0.02 0.02 0.02 0.02

Benzoic acid 0.05 0.05 0.05 0.05

Sodium hydroxide 0.20 0.20 0.20 0.20

Dye 0.04 0.04 0.04 0.04

Water balance to 100%

In Examples 50-53 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 50-53, any combination of the protease enzymes useful in the present invention recited in Tables III, V, and VI, among others, are substituted for Protease # 12 with substantially similar results.

Examples 54-57 Lozenge Composition

Example No.

Component 54 55 56 57

Protease # 12 0.01 0.03 0.10 0.02

Sorbitol 17.50 17.50 17.50 17.50

Mannitol 17.50 17.50 17.50 17.50

Starch 13.60 13.60 13.60 13.60

Sweetener 1.20 1.20 1.20 1.20

Flavor 11.70 11.70 11.70 11.70

Color 0.10 0.10 0.10 0.10

Corn Syrup balance to 100%

In Examples 54-57 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 54-57, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 with substantially similar results.

Examples 58-61 Chewing Gum Composition

Example No.

Component 58 59 60 61

Protease # 12 0.03 0.02 0.10 0.05

Sorbitol crystals 38.44 38.40 38.40 38.40

Paloja-T gum base* 20.00 20.00 20.00 20.00

Sorbitol (70% aqueous solution) 22.00 22.00 22.00 22.00

Mannitol 10.00 10.00 10.00 10.00

Glycerine 7.56 7.56 7.56 7.56

Flavor 1.00 1.00 1.00 1.00

^•Supplied by L.A. Dreyfus Company.

In Examples 58-61 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 58-61 , any combination of the protease enzymes useful in the present invention recited in Tables III, V, and VI, among others, are substituted for Protease # 12 with substantially similar results. 2. Denture cleaning compositions

In another embodiment of the present invention, denture cleaning compositions for cleaning dentures outside of the oral cavity comprise one or more protease enzymes. Such denture cleaning compositions comprise an effective amount of one or more protease enzymes, preferably from about 0.0001 % to about 50% of one or more protease enzymes, more preferably from about 0.001% to about 35%, more preferably still from about 0.01% to about 20%, by weight of the composition, and a denture cleansing carrier. Various denture cleansing composition formats such as effervescent tablets and the like are well known in the art (see for example U.S. Patent 5,055,305, Young, incoφorated herein by reference), and are generally appropriate for incoφoration of one or more protease enzymes for removing proteinaceous stains from dentures. The denture cleaning composition embodiment of the present invention is illustrated by the following examples.

Examples 62-65 Two-laver Effervescent Denture Cleansing Tablet

Example No.

Component 62 63 64 65

Acidic Laver

Protease # 12 1.0 1.5 0.01 0.05

Tartaric acid 24.0 24.0 24.00 24.00

Sodium carbonate 4.0 4.0 4.00 4.00

Sulphamic acid 10.0 10.0 10.00 10.00

PEG 20,000 4.0 4.0 4.00 4.00

Sodium bicarbonate 24.5 24.5 24.50 24.50

Potassium persulfate 15.0 15.0 15.00 15.00

Sodium acid pyrophosphate 7.0 7.0 7.00 7.00

Pyrogenic silica 2.0 2.0 2.00 2.00

Tetracetylethylene diamine 7.0 7.0 7.00 7.00

Ricinoleylsulfosuccinate 0.5 0.5 0.50 0.50

Flavor 1.0 1.0 1.00 1.00

Alkaline Laver

Sodium perborate monohydrate 32.0 32.0 32.00 32.00

Sodium bicarbonate 19.0 19.0 19.00 19.00

EDTA 3.0 3.0 3.00 3.00

Sodium tripolyphosphate 12.0 12.0 12.00 12.00

PEG 20,000 2.0 2.0 2.00 2.00

Potassium persulfate 26.0 26.0 26.00 26.00

Sodium carbonate 2.0 2.0 2.00 2.00

Pyrogenic silica 2.0 2.0 2.00 2.00

Dve/flavor 2.0 2.0 2.00 2.00

In Examples 62-65 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 62-65, any combination of the protease enzymes useful in the present invention recited in Tables III, V and VI, among others, are substituted for Protease # 12 with substantially similar results. 3. Personal Cleansing Compositions In another embodiment of the present invention, personal cleaning compositions for cleaning the skin (in liquid and bar form) comprise one or more of the protease enzymes. Such compositions typically comprise from about 0.001% to about 5% protease enzyme, preferably from about 0.005% to about 2%, and most preferably from about 0.01 % to about 0.8% by weight of * the composition. Preferred personal cleansing compositions into which can be included protease enzymes as described herein are taught in U.S. Patent Applications SN 08/121,623 and SN 08/121,624, both by Visscher et al., filed September 14, 1993, the disclosures of which are incorporated herein by reference in their entirety. Such compositions are illustrated by the following examples.

Example 66

Liouid Personal Cleansing Compositions Containing Soao

Component Weight %

Soap (K or Na) 15.00

30% Laurate

30% Myristate

25% Palmitate

15% Stearate

Fatty acids (above ratios) 4.50

Na Lauryl Sarcosinate 6.00

Sodium Laureth-3 Sulfate 0.66

Cocamidopropylbetaine 1.33

Glycerine 15.00

Propylene glycol 9.00

Polyquaternium 10 0.80

Ethylene glycol distearate (EDTA) 1.50

Propylparaben 0.10

Methyiparaben 0.20

Protease # 12 0.10

KOH or NaOH If necessary to adjust pH

Calcium sulfate 3

Acetic acid 3

Water Balance to 100

I Example 67

Personal Cleansinα Bar Composition

Component Weight % Sodium Cocoyl Isethionate 47.20

Sodium Cetearyl Sulfate 9.14

Paraffin 9.05

Sodium Soap (in situ) 3.67 Sodium Isethionate 5.51

Sodium Chloride 0.45

Titanium Dioxide 0.4

Trisodium EDTA 0.1

Trisodium Etidronate 0.1 Perfume 1.20

Na₂SO4 0.87

Protease # 12 0.10

Water/Minors Balance to 100

In Examples 66-67 the Proteases #'s 1-11 and 13-25 recited in Table III, among others including the additional proteases useful in the present invention desαibed in Tables V and VI, are substituted for Protease # 12, with substantially similar results. Also in Examples 66-67, any combination of the protease enzymes useful in the present invention recited in Tables III, V, and VI, among others, are substituted for Protease # 12 with substantially similar results.

Example 68 Wash Performance Test The wash performance of the variants useful in the present invention compositions is evaluated by measuring the removal of stain from EMPA 116 (blood/milk/carbon black on cotton) cloth swatches (Testfabrics, Inc., Middlesex, NJ 07030).

Six EMPA 116 swatches, cut to 3 X 4-1/2 inches with pinked edges, are placed in each pot of a Model 7243S Terg-O-Tometer (United States Testing Co., Inc., Hoboken, NJ) containing 1000 ml of water, 15 gpg hardness (Ca⁺⁺:Mg⁺⁺::3:1::w:w), 7 g of detergent, and enzyme as appropriate. The detergent base is WFK1 detergent from wfc - Testgewebe GmbH, Adierstrasse 42, Postfach 130762, D-47759 Krefeld, Germany:

Component % of Final Formulation

Zeolite A 25%

Sodium sulfate 25%

Soda Ash 10%

Linear alkylbenzenesulfonate 8.8% Alcohol ethoxylate (7-8 EO) 4.5%

Sodium soap 3%

Sodium silicate (Siθ2:Na2θ::3.3:1) 3%

To this base detergent, the following additions are made:

Component % of Final Formulation

Sodium perborate monohydrate 13%

Copolymer (Sokalan CP5) 4%

TAED (Mykon ATC Green) 3%

Enzyme 0.5%

Brightener (Tinopal AMS-GX) 0.2%

Sodium perborate monohydrate is obtained from Degussa Corporation,

Ridgefield-Park, NJ 07660. Sokalan CP5 is obtained from BASF Corporation, Parsippany, NJ 07054. Mykon ATC Green (TAED, tetraacetylethylenediamine) is obtained from Warwick International, Limited, Mostyn, Holywell, Clwyd CH8 9HE, England. Tinopal AMS GX is obtained from Ciba-Geigy Corporation, Greensboro, NC 27419.

Six EMPA 116 swatches are washed in detergent with enzyme for 30 min at 60°C and are subsequently rinsed twice for 5 minutes each time in 1000 ml water. Enzymes are added at final concentrations of 0.05 to 1 ppm for standard curves, and 0.25 ppm for routine analyses. Swatches are dried and pressed, and the reflectance from the swatches is measured using the L value on the L*a*b* scale of a Minolta Chroma Meter, Model CR-200 (Minolta Coφoration, Ramsey, NJ 07446). Performance is reported as a percentage of the performance of B. lentus (GG36) protease and is calculated by dividing the amount of B. lentus (GG36) protease by the amount of variant protease that is needed to provide the same stain removal performance X 100. The data are shown in Table VII.

Table VII Enzyme Wash Performance

B. lentus subtilisin 100

N76D 310

N76D/S103A 230

N76D V104I 130

N76D/V107V 160

N76D/S99D/S101R 370

N76D/S99D/S103A 290

N76D/S101R S103A 130

N76D/S101R/V104I 300

N76D/S103A/V104I 320

N76D/S103G/V104I 160

N76D/S103A/V104F 210

N76D/S103A/V104N 110 N76D/S103A/V104T 170

N76DΛ/1041/1107V 210

N76D/S99D/S101 R/S103A 220

N76D/S99D/S101R V104I 140

N76D/S101G/S103AΛ 104I 170

N76D/S101R/S103A/V104I 150

N76D/S103A/V104I/S105A 170

N76D/S103A/V104T/I107A 120

N76D/S103A/V104T/I107L 110

N76D/S103A/V104I/L126F 110

N76D/S103A/V104I/S128G 280

N76D/S103A/V104I/L135I 160

N76D/S103A/V104I/L135V 160

N76D/S103A/V104I/D197E 170

N76D/S103A/V104I/N204A 160

N76D/S103A/V104I/N204G 150

N76D/S103A/V104I/P210I 470

N76D/S103A/V104I/M222A 100

N76D/S103A/V104I/T260P 280

N76D/S103A/V104I/S265N 190

Example 69 Protease Stability in a Liouid Detergent Formulation A comparison of protease stability toward inactivation in a liquid detergent formulation is made for Bacillus lentus subtilisin and it's variant enzyme N76D/S103A/V104I according to the procedure outlined herein. The detergent formulation for the study is a commercially purchased bottle of Tide Ultra liquid lanudry detergent made in the USA by The Procter & Gamble Company. Heat treatment of the detergent formulation is necessary to inactivate in-situ protease. This is accomplished by incubating the detergent at 96°C for a period of 4.5 hours. Concentrated preparations of the B. lentus subtilisin and N76D/S103A/V104I variant, in the range of 20 grams/liter enzyme, are then added to the heat-treated Tide Ultra at room-temperature to a final concentratrion of 0.3 grams/liter enzyme in the detergent formulation. The heat-treated detergent with protease added is then incubated in a water bath thermostatted at 50°C. Aliquots are removed from the incubation tubes at 0, 24, 46, 76, and 112 hour time intervals and assayed for enzyme activity by addition to a 1 cm cuvette containing 1.2 mM of the synthetic peptide substrate suc-Ala-Ala-Pro-phe-p-nitroanilide dissolved in 0.1 M tris-HCL buffer, pH 8.6, and thermostatted at 25°C. The initial linear reaction velocity is followed spectrophotometrically by monitoring the absorbance of the reaction product p- nitroaniline at 410nm as a function of time. As shown in Fig. 10, the N76D/S103A/V104I variant is observed to have significantly greater stability towards inactivation than the native B. lentus enzyme. Estimated half-lives for inactivation in the Tide Ultra detergent formulation for the two enzymes, under the specified test conditions, are 45 hours for B. lentus subtilisin and 125 hours for the N76D/S103A/V104I variant.

While particular embodiments of the subject invention have been desαibed, it will be obvious to those skilled in the art that various changes and modifications of the subject invention can be made without departing from the spirit and scope of the invention. It is intended to cover, in the appended claims, all such modifications that are within the scope of the invention.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Baeck, Andre (NMN)

Ghosh, Chanchal K.

Graycar, Thomas P.

Bott, Richard R.

Wilson, Lori J.

Brode, Philip F., Ill

Barnett, Bobby L. rξ Rubingh, Donn N.'

(ii) TITLE OF INVENTION: Protease-Containing Cleaning Compositions

(iii) NUMBER OF SEQUENCES: 15

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: The Procter & Gamble Company

(B) STREET: 11810 East River Road

(C) CITY: Cincinnati

(D) STATE: OH

(E) COUNTRY: USA

(F) ZIP: 45253-8707

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE: 13-OCT-1994

(C) CLASSIFICATION:

(Viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Zerby, Kim William

(B) REGISTRATION NUMBER: 32,323

(C) REFERENCE/DOCKET NUMBER: 5040R

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (513) 627-2885

(B) TELEFAX: (513) 627-0318

(2) INFORMATION FOR SEQ ID Nθ:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:l: GAAGCTGCAA CTCGTTAAA 19

(2) INFORMATION FOR SEQ ID Nθ:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GCTGCTCTAG ACAATTCG 18

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 39 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:3: GTATTAGGGG CGGACGGTCG AGGCGCCATC AGCTCGATT 39

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: TCAGGTTCGG TCTCGAGCGT TGCCCAAGGA TTG 33

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: CACGTTGCTA GCTTGAGTTT AG 22

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1497 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GGTCTACTAA AATATTATTC CATACTATAC AATTAATACA CAGAATAATC TGTCTATTGG 60 TTATTCTGCA AATGAAAAAA AGGAGAGGAT AAAGAGTGAG AGGCAAAAAA GTATGGATCA 120 GTTTGCTGTT TGCTTTAGCG TTAATCTTTA CGATGGCGTT CGGCAGCACA TCCTCTGCCC 180

AGGCGGCAGG GAAATCAAAC GGGGAAAAGA AATATATTGT CGGGTTTAAA CAGACAATGA 240

GCACGATGAG CGCCGCTAAG AAGAAAGATG TCATTTCTGA AAAAGGCGGG AAAGTGCAAA 300

AGCAATTCAA ATATGTAGAC GCAGCTTCAG TCACATTAAA CGAAAAAGCT GTAAAAGAAT 360

TGAAAAAAGA CCCGAGCGTC GCTTACGTTG AAGAAGATCA CGTAGCACAT GCGTACGCGC 420

AGTCCGTGCC TTACGGCGTA TCACAAATTA AAGCCCCTGC TCTGCACTCT CAAGGCTACA 480

CTGGATCAAA TGTTAAAGTA GCGGTTATCG ACAGCGGTAT CGATTCTTCT CATCCTGATT 540

TAAAGGTAGC AAGCGGAGCC AGCATGGTTC CTTCTGA AAC AAATCCTTTC CAAGACAACA 600

ACTCTCACGG AACTCACGTT GCCGGCACAG TTGCGGCTCT TAATAACTCA ATCGGTGTAT 660

TAGGCGTTGC GCCAAGCGCA TCACTTTACG CTGTAAAAGT TCTCGGTGCT GACGGTTCCG 720

GCCAATACAG CTGGATCATT AACGGAATCG AGTGGGCGAT CGCAAACAAT ATGGACGTTA 780

TTAACATGAG CCTCGGCGGA CCTTCTGGTT CTGCTGCTTT AAAAGCGGCA GTTGATAAAG 840

CCGTTGCATC CGGCGTCGTA GTCGTTGCGG CAGCCGGTAA CGAAGGCACT TCCGGCAGCT 900

CAAGCACAGT GGGCTACCCT GGTAAATACC CTTCTGTCAT TGCAGTAGGC GCTGTTGACA 960

GCAGCAACCA AAGAGCATCT TTCTCAAGCG TAGGACCTGA GCTTGATGTC ATGGCACCTG 1020

GCGTATCTAT CCAAAGCACG CTTCCTGGAA ACAAATACGG GGCGTACAAC GGTACGTCAA 1080

TGGCATCTCC GCACGTTGCC GGAGCGGCTG CTTTGATTCT TTCTAAGCAC CCGAACTGGA 1140

CAAACACTCA AGTCCGCAGC AGTTTAGAAA ACACCACTAC AAAACTTGGT GATTCTTTGT 1200

ACTATGGAAA AGGGCTGATC AACGTACAAG CGGCAGCTCA GTAAAACATA AAAAACCGGC 1260

CTTGGCCCCG CCGGTTTTTT ATTATTTTTC TTCCTCCGCA TGTTCAATCC GCTCCATAAT 1320

CGACGGATGG CTCCCTCTGA AAATTTTAAC GAGAAACGGC GGGTTGACCC GGCTCAGTCC 1380

CGTAACGGCC AACTCCTGAA ACGTCTCAAT CGCCGCTTCC CGGTTTCCGG TCAGCTCAAT 1440

GCCATAACGG TCGGCGGCGT TTTCCTGATA CCGGGAGACG GCATTCGTAA TCGGATC 1497

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 275 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:7:

Ala Gin Ser Val Pro Tyr Gly Val Ser Gin He Lys Ala Pro Ala Leu 1 5 10 15

His Ser Gin Gly Tyr Thr Gly Ser Asn Val Lys Val Ala Val He Asp 20 25 30

Ser Gly He Asp Ser Ser His Pro Asp Leu Lys Val Ala Gly Gly Ala 35 40 45 Ser Met Val Pro Ser Glu Thr Asn Pro Phe Gin Asp Asn Asn Ser His 50 55 60

Gly Thr His Val Ala Gly Thr Val Ala Ala Leu Asn Asn Ser He Gly 65 70 75 80

Val Leu Gly Val Ala Pro Ser Ala Ser Leu Tyr Ala Val Lys Val Leu 85 90 95

Gly Ala Asp Gly Ser Gly Gin Tyr Ser Trp He He Asn Gly He Glu 100 105 110

Trp Ala He Ala Asn Asn Met Asp Val He Asn Met Ser Leu Gly Gly 115 120 125

Pro Ser Gly Ser Ala Ala Leu Lys Ala Ala Val Asp Lys Ala Val Ala 130 135 140

Ser Gly Val Val Val Val Ala Ala Ala Gly Asn Glu Gly Thr Ser Gly 145 150 155 160

Ser Ser Ser Thr Val Gly Tyr Pro Gly Lys Tyr Pro Ser Val He Ala 165 170 175

Val Gly Ala Val Asp Ser Ser Asn Gin Arg Ala Ser Phe Ser Ser Val 180 185 190

Gly Pro Glu Leu Asp Val Met Ala Pro Gly Val Ser He Gin Ser Thr 195 200 205

Leu Pro Gly Asn Lys Tyr Gly Ala Tyr Asn Gly Thr Ser Met Ala Ser 210 215 220

Pro His Val Ala Gly Ala Ala Ala Leu He Leu Ser Lys His Pro Asn 225 230 235 240

Trp Thr Asn Thr Gin Val Arg Ser Ser Leu Glu Asn Thr Thr Thr Lys 245 250 255

Leu Gly Asp Ser Phe Tyr Tyr Gly Lys Gly Leu He Asn Val Gin Ala 260 265 270

Ala Ala Gin 275

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 275 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Ala Gin Ser Val Pro Tyr Gly He Ser Gin He Lys Ala Pro Ala Leu 1 5 10 15

His Ser Gin Gly Tyr Thr Gly Ser Asn Val Lys Val Ala Val He Asp 20 25 30

Ser Gly He Asp Ser Ser His Pro Asp Leu Asn Val Arg Gly Gly Ala 35 40 45

Ser Phe Val Pro Ser Glu Thr Asn Pro Tyr Gin Asp.Gly Ser Ser His 50 55 60

Gly Thr His Val Ala Gly Thr He Ala Ala Leu Asn Asn Ser He Gly 65 70 75 80 Val Leu Gly Val Ser Pro Ser Ala Ser Leu Tyr Ala Val Lys Val Leu 85 90 95

Asp Ser Thr Gly Ser Gly Gin Tyr Ser Trp He He Asn Gly He Glu 100 105 110

Trp Ala He Ser Asn Asn Met Asp Val He Asn Met Ser Leu Gly Gly 115 120 125

Pro Thr Gly Ser Thr Ala Leu Lys Thr Val Val Asp Lys Ala Val Ser 130 135 140

Ser Gly He Val Val Ala Ala Ala Ala Gly Asn Glu Gly Ser Ser Gly 145 150 155 160

Ser Thr Ser Thr Val Gly Tyr Pro Ala Lys Tyr Pro Ser Thr He Ala 165 170 175

Val Gly Ala Val Asn Ser Ser Asn Gin Arg Ala Ser Phe Ser Ser Ala 180 185 190

Gly Ser Glu Leu Asp Val Met Ala Pro Gly Val Ser He Gin Ser Thr 195 200 205

Leu Pro Gly Gly Thr Tyr Gly Ala Tyr Asn Gly Thr Ser Met Ala Thr 210 215 220

Pro His Val Ala Gly Ala Ala Ala Leu He Leu Ser Lys His Pro Thr 225 230 235 240

Trp Thr Asn Ala Gin Val Arg Asp Arg Leu Glu Ser Thr Ala Thr Tyr 245 250 255

Leu Gly Asn Ser Phe Tyr Tyr Gly Lys Gly Leu He Asn Val Gin Ala 260 265 270

Ala Ala Gin 275

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 274 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Ala Gin Thr Val Pro Tyr Gly He Pro Leu He Lys Ala Asp Lys Val 1 5 10 15

Gin Ala Gin Gly Phe Lys Gly Ala Asn Val Lys Val Ala Val Leu Asp 20 25 30

Thr Gly He Gin Ala Ser His Pro Asp Leu Asn Val Val Gly Gly Ala 35 40 45

Ser Phe Val Ala Gly Glu Ala Tyr Asn Thr Asp Gly Asn Gly His Gly 50 55 60

Thr His Val Ala Gly Thr Val Ala Ala Leu Asp Asn Thr Thr Gly Val 65 70 75 80

Leu Gly Val Ala Pro Ser Val Ser Leu Tyr Ala Val Lys Val Leu Asn 85 90 95 Ser Ser Gly Ser Gly Ser Tyr Ser Gly He Val Ser Gly He Glu Trp 100 105 no

Ala Thr Thr Asn Gly Met Asp Val He Asn Met Ser Leu Gly Gly Ala 115 120 125

Ser Gly Ser Thr Ala Met Lys Gin Ala Val Asp Asn Ala Tyr Ala Arg 130 135 140

Gly Val Val Val Val Ala Ala Ala Gly Asn Ser Gly Asn Ser Gly Ser 145 150 155 160

Thr Asn Thr He Gly Tyr Pro Ala Lys Tyr Asp Ser Val He Ala Val 165 170 175

Gly Ala Val Asp Ser Asn Ser Asn Arg Ala Ser Phe Ser Ser Val Gly 180 185 190

Ala Glu Leu Glu Val Met Ala Pro Gly Ala Gly Val Tyr Ser Thr Tyr 195 200 205

Pro Thr Asn Thr Tyr Ala Thr Leu Asn Gly Thr Ser Met Ala Ser Pro 210 215 220

His Val Ala Gly Ala Ala Ala Leu He Leu Ser Lys His Pro Asn Leu 225 230 235 240

Ser Ala Ser Gin Val Arg Asn Arg Leu Ser Ser Thr Ala Thr Tyr Leu 245 250 255

Gly Ser Ser Phe Tyr Tyr Gly Lys Gly Leu He Asn Val Glu Ala Ala 260 265 270

Ala Gin

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 269 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Ala Gin Ser Val Pro Trp Gly He Ser Arg Val Gin Ala Pro Ala Ala 1 5 10 15

His Asn Arg Gly Leu Thr Gly Ser Gly Val Lys Val Ala Val Leu Asp 20 25 30

Thr Gly He Ser Thr His Pro Asp Leu Asn He Arg Gly Gly Ala Ser 35 40 45

Phe Val Pro Gly Glu Pro Ser Thr Gin Asp Gly Asn Gly His Gly Thr 50 55 60

His Val Ala Gly Thr He Ala Ala Leu Asn Asn Ser He Gly Val Leu 65 70 75 80

Gly Val Ala Pro Ser Ala Glu Leu Tyr Ala Val Lys Val Leu Gly Ala 85 90 95

Ser Gly Ser Gly Ser Val Ser Ser He Ala Gin Gly Leu Glu Trp Ala 100 105 110 Gly Asn Asn Gly Met His Val Ala Asn Leu Ser Leu Gly Ser Pro Ser 115 120 125

Pro Ser Ala Thr Leu Glu Gin Ala Val Asn Ser Ala Thr Ser Arg Gly 130 135 140

Val Leu Val Val Ala Ala Ser Gly Asn Ser Gly Ala Gly Ser He Ser 145 150 155 160

Tyr Pro Ala Arg Tyr Ala Asn Ala Met Ala Val Gly Ala Thr Asp Gin 165 170 175

Asn Asn Asn Arg Ala Ser Phe Ser Gin Tyr Gly Ala Gly Leu Asp He 180 185 190

Val Ala Pro Gly Val Asn Val Gin Ser Thr Tyr Pro Gly Ser Thr Tyr 195 200 205

Ala Ser Leu Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala 210 215 220

Ala Ala Leu Val Lys Gin Lys Asn Pro Ser Trp Ser Asn Val Gin He 225 230 235 240

Arg Asn His Leu Lys Asn Thr Ala Thr Ser Leu Gly Ser Thr Asn Leu 245 250 255

Tyr Gly Ser Gly Leu Val Asn Ala Glu Ala Ala Thr Arg 260 265

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1140 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:ll:

ATGAAGAAAC CGTTGGGGAA AATTGTCGCA AGCACCGCAC TACTCATTTC TGTTGCTTTT 60

AGTTCATCGA TCGCATCGGC TGCTGAAGAA GCAAAAGAAA AATATTTAAT TGGCTTTAAT 120

GAGCAGGAAG CTGTCAGTGA GTTTGTAGAA CAAGTAGAGG CAAATGACGA GGTCGCCATT 180

CTCTCTGAGG AAGAGGAAGT CGAAATTGAA TTGCTTCATG AATTTGAAAC GATTCCTGTT 240

TTATCCGTTG AGTTAAGCCC AGAAGATGTG GACGCGCTTG AACTCGATCC AGCGATTTCT 300

TATATTGAAG AGGATGCAGA AGTAACGACA ATGGCGCAAT CAGTGCCATG GGGAATTAGC 360

CGTGTGCAAG CCCCAGCTGC CCATAACCGT GGATTGACAG GTTCTGGTGT AAAAGTTGCT 420

GTCCTCGATA CAGGTATTTC CACTCATCCA GACTTAAATA TTCGTGGTGG CGCTAGCTTT 480

GTACCAGGGG AACCATCCAC TCAAGATGGG AATGGGCATG GCACGCATGT GGCCGGGACG 540

ATTGCTGCTT TAAACAATTC GATTGGCGTT CTTGGCGTAG CGCCGAGCGC GGAACTATAC 600

GCTGTTAAAG TATTAGGGGC GAGCGGTTCA GGTTCGGTCA GCTCGATTGC CCAAGGATTG 660

GAATGGGCAG GGAACAATGG CATGCACGTT GCTAATTTGA GTTTAGGAAG CCCTTCGCCA 720

AGTGCCACAC TTGAGCAAGC TGTTAATAGC GCGACTTCTA GAGGCGTTCT TGTTGTAGCG 780

GCATCTGGGA ATTCAGGTGC AGGCTCAATC AGCTATCCGG CCCGTTATGC GAACGCAATG 840 GCAGTCGGAG CTACTGACCA AAACAACAAC CGCGCCAGCT TTTCACAGTA TGGCGCAGGG 900

'CTTGACATTG TCGCACCAGG TGTAAACGTG CAGAGCACAT ACCCAGGTTC AACGTATGCC 960

AGCTTAAACG GTACATCGAT GGCTACTCCT CATGTTGCAG GTGCAGCAGC CCTTGTTAAA 1020

CAAAAGAACC CATCTTGGTC CAATGTACAA ATCCGCAATC ATCTAAAGAA TACGGCAACG 1080

AGCTTAGGAA GCACGAACTT GTATGGAAGC GGACTTGTCA ATGCAGAAGC GGCAACACGC 1140

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1140 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

( i) SEQUENCE DESCRIPTION: SEQ ID NO:12:

ATGAAGAAAC CGTTGGGGAA AATTGTCGCA AGCACCGCAC TACTCATTTC TGTTGCTTTT 60

AGTTCATCGA TCGCATCGGC TGCTGAAGAA GCAAAAGAAA AATATTTAAT TGGCTTTAAT 120

GAGCAGGAAG CTGTCAGTGA GTTTGTAGAA CAAGTAGAGG CAAATGACGA GGTCGCCATT 180

CTCTCTGAGG AAGAGGAAGT CGAAATTGAA TTGCTTCATG AATTTGAAAC GATTCCTGTT 240

TTATCCGTTG AGTTAAGCCC AGAAGATGTG GACGCGCTTG AACTCGATCC AGCGATTTCT 300

TATATTGAAG AGGATGCAGA AGTAACGACA ATGGCGCAAT CAGTGCCATG GGGAATTAGC 360

CGTGTGCAAG CCCCAGCTGC CCATAACCGT GGATTGACAG GTTCTGGTGT AAAAGTTGCT 420

GTCCTCGATA CAGGTATTTC CACTCATCCA GACTTAAATA TTCGTGGTGG CGCTAGCTTT 480

GTACCAGGGG AACCATCCAC TCAAGATGGG AATGGGCATG GCACGCATGT GGCCGGGACG 540

ATTGCTGCTT TAGACAACTC GATTGGCGTT CTTGGCGTAG CGCCGAGCGC GGAACTATAC 600

GCTGTTAAAG TATTAGGGGC GAGCGGTTCA GGCGCCATCA GCTCGATTGC CCAAGGATTG 660

GAATGGGCAG GGAACAATGG CATGCACGTT GCTAATTTGA GTTTAGGAAG CCCTTCGCCA 720

AGTGCCACAC TTGAGCAAGC TGTTAATAGC GCGACTTCTA GAGGCGTTCT TGTTGTAGCG 780

GCATCTGGGA ATTCAGGTGC AGGCTCAATC AGCTATCCGG CCCGTTATGC GAACGCAATG 840

GCAGTCGGAG CTACTGACCA AAACAACAAC CGCGCCAGCT TTTCACAGTA TGGCGCAGGG 900

CTTGACATTG TCGCACCAGG TGTAAACGTG CAGAGCACAT ACCCAGGTTC AACGTATGCC 960

AGCTTAAACG GTACATCGAT GGCTACTCCT CATGTTGCAG GTGCAGCAGC CCTTGTTAAA 1020

CAAAAGAACC CATCTTGGTC CAATGTACAA ATCCGCAATC ATCTAAAGAA TACGGCAACG 1080

AGCTTAGGAA GCACGAACTT GTATGGAAGC GGACTTGTCA ATGCAGAAGC GGCAACACGC 1140

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: TATGCCAGCC ACAACGGTAC TTCGATGGCT 30

(2) INFORMATION FOR SEQ ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: CACAGTTGCG GCTCTAGATA ACTCAATCGG T 31

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 33 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: GCTGACGGTT CCGGCGCTAT TAGTTGGATC ATT 33

Claims

What ia claimed is :

1. A cleaning composition comprising:

(a) an effective amount of protease enzyme which is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a precursor carbonyl hydrolase comprising a substitution of a different amino acid for a plurality of amino acid residues at a position in said precursor carbonyl hydrolase equivalent to position +76 in Bacillus amyloliquefaciens subtilisin, in combination with one or more amino acid residue positions equivalent to those selected from the group consisting of +99, +101 , +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265, and/or +274 in Bacillus amyloliquefaciens subtilisin; and

(b) one or more cleaning composition materials compatable with the protease enzyme.

2. The cleaning compositions according to Claim 1 wherein the cleaning composition materials are selected from the group consisting of surfactants, solvents, buffers, enzymes, soil release agents, clay soil removal agents, dispersing agents, brighteners, suds suppressors, fabric softeners, suds boosters, enzyme stabilizers, builders, bleaching agents, dyes, perfumes, and mixtures thereof.

3. The cleaning compositions according to Claim 1 wherein the cleaning composition materials comprise at least about 1 % surfactant by weight of the composition, said surfactant comprising materials selected from the group consisting of alkyl benzene sulfonates, primary alkyl sulfates, secondary alkyl sulfates, alkyl alkoxy sulfates, alkyl alkoxy carboxylates, alkyl polyglycosides and their corresponding sulfated polyglycosides, alpha-sulfonated fatty acid esters, alkyl and alkyl phenol alkoxylates, betaines and sulfobetaines, amine oxides, N-methyl glucamides, nonionic primary alcohol ethoxylates, nonionic primary alcohol mixed ethoxy/propoxy, and mixtures thereof.

4. The cleaning composition according to Claim 3 further comprising at least about 5% builder selected from the group consisting of zeolites, polycarboxylates, layered silicates, phosphates, and mixtures thereof.

5. The cleaning compositions according to Claim 1 wherein the cleaning composition materials comprise at least one bleaching agent.

6. The cleaning compositions according to Claim 5 wherein the bleaching agent is selected from the group consisting of percarbonates, perborates, and

<^" mixtures thereof, and optionally further comprising at least one bleach activator.

7. The cleaning compositions according to Claim 1 wherein the cleaning composition materials comprise at least one enzyme selected from the group consisting of cellulases, lipases, amylases, proteases, peroxidases and mixtures thereof.

8. The cleaning compositions according to Claim 1 wherein the cleaning composition materials comprise at least one fabric softener.

9. The cleaning compositions according to Claim 1 wherein the precursor carbonyl hydrolase for the protease enzyme is a subtilisin, and the protease enzyme is a subtilisin variant wherein a combination of substitutions is made at the positions equivalent to 76/99, 76/101, 76/103, 76/104, 76/107, 76/123, 76/99/101 , 76/99/103, 76/99/104, 76/101 /103, 76/101 /104, 76/103/104,

76/104/107, 76/104/123, 76/107/123, 76/99/101/103, 76/99/101/104, 76/99/103/104, 76/101/103/104, 76/103/104/123, 76/104/107/123. 76/99/101/103/104, 76/99/103/104/123, 76/99/101/103/104/123, 76/103/104/126, 76/103/104/135, 76/103/104/197, 76/103/104/222, 76/103/104/260, 76/103/104/265, 76/103/104/126/265, 27/76/104/123/274,

27/76/104/109/123/274, 27/76/104/123/218/274, 27/76/104/123, 27/76/104/107/123, 27/76/104/109/123, 27/76/104/109/123/218/274, 27/76/104/123/197, 27/76/104/123/204, 27/76/104/123/206, 27/76/104/123/216, 27/76/104/123/218, 27/76/104/123/260, 27/76/104/123/195/197, 27/76/104/123/195/218, 27/76/104/123/197/218,

27/76/104/123/204/218, 27/76/104/123/206/218, 27/76/104/123/218/260, 27/76/104/123/195/197/218, 76/103/104/217, 76/103/104/156, 76/103/104/166, 76/103/104/105, 76/101/103/104, 76/103/104/128, 76/103/104/210, 76/103/104/107, 76/103/104/204, 76/217, 76/103/104/156/166 and 76/103/104/128.

10. The cleaning composition according to Claim 9 wherein the protease enzyme is a subtilisin variant selected from the group consisting of 76/99, 76/101, 76/103, 76/104, 76/107, 76/123, 76/99/101, 76/99/103, 76/99/104, 76/101/103, 76/101/104, 76/103/104, 76/104/107, 76/104/123, 76/107/123, 76/99/101 /103, 76/99/101 /104, 76/99/103/104, 76/101/103/104,

76/103/104/123, 76/104/107/123, 76/99/101/103/104, 76/99/103/104/123, 76/99/101/103/104/123, 76/103/104/128; 76/103/104/260; 76/103/104/265; 76/103/104/197; 76/103/104/105; 76/103/104/135; 76/103/104/126; 76/103/104/107; 76/103/104/210; 76/103/104/126/265; and/or 76/103/104/222.

11. A fabric cleaning composition comprising:

(a) an effective amount of protease enzyme which is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a subtilisin precursor carbonyl hydrolase, and wherein the protease enzyme is a subtilisin variant selected from N76D/S99D;

N76D/S101 R; N76D/S103A; N76DΛ 104I; N76D/I107V; N76D/N123S;

N76D/S99D/S101R; N76D/S99D/S103A; N76D/S99DA 104I;

N76D/S101R/S103A; N76D/S101 RΛ 104I; N76D/S103AA 104I;

N76D/V1041/1107V; N76D/V104Y/I107V; N76D/V104I/N123S; N76D/I107V/N123S; N76D/S99D/S101R S103A; N76D/S99D/S101 RΛ/104I;

N76D/S99D/S103AΛ 104I; N76D/S101 R/S103A/V104I;

N76D/S103A/V104I/N123S; N76D/V1041/1107V/N123S;

N76D/S99D/S101 R/S103AΛ/104I; N76D/S99D/S103A/V104I/N123S;

N76D/S99D/S101R/S103AΛ 104I/N123S; N76D/S103AΛ 104I/S128G; N76D/S103A/V104iπ^"260P; N76D/S103AΛ/104I/S265N;

N76D/S103A/V104I/D197E; N76D/S103AΛ 104I/S105A;

N76D/S103A/V104I/L135I; N76D/S103AΛ 104I/L126F;

N76D/S103AΛ 104T/L107T; N76D/S103A/V104I/L126F/S265N and

N76D/S103AΛ/104I/M222A and mixtures thereof; and (b) one or more cleaning composition materials compatible with the protease enzyme comprising at least about 5% surfactant and at least about

5% builder, by weight of the composition.

12. The fabric cleaning composition according to Claim 11 further comprising cleaning composition materials selected from the group consisting of solvents, buffers, enzymes, soil release agents, clay soil removal agents, dispersing agents, brighteners, suds suppressors, fabric softeners, suds boosters, enzyme stabilizers, bleaching agents, dyes, perfumes, and mixtures thereof.

13. The fabric cleaning composition according to Claim 11 further comprising at least one bleaching agent.

14. The fabric cleaning composition according to Claim 11 further comprising at least one enzyme selected from the group consisting of cellulases, lipases, amylases, proteases, peroxidases, and mixtures thereof.

15. The fabric cleaning composition according to Claim 11 in the form of a liquid, granule or bar.

16. The fabric cleaning composition according to Claim 11 wherein the protease enzyme is a subtilisin variant selected from N76D/S99D, N76D/V104I, N76D/S99DΛ 104I, N76D/S103A/V104I, N76D/V1041/1107V,

N76D/V104Y/I107V, N76D/S101 R/S103A/V104I, N76D/S99D/S101R/S103AΛ/104I, N76D/S101RΛ/104I, and mixtures thereof.

17. The fabric cleaning composition according to Claim 11 wherein the protease enzyme is a Bacillus subtilisin variant selected from N76D/V104I, N76D/S103A/V104I, and mixtures thereof.

18. A fabric cleaning composition comprising:

(a) from about 0.0001 % to about 10% protease enzyme which is an N76D/S103A/V104I subtilisin variant derived from Bacillus lentus subtilisin;

(b) at least about 5% surfactant; (c) at least about 5% builder; and

(d) optionally, one or more cleaning composition materials compatible with the protease enzyme selected from the group consisting of solvents, buffers, enzymes, soil release agents, clay soil removal agents, dispersing agents, brighteners, suds suppressors, fabric softeners, suds boosters, enzyme stabilizers, bleaching agents, dyes, perfumes, and mixtures thereof.

19. The fabric cleaning composition according to Claim 18 wherein the surfactant is selected from the group consisting of alkyl benzene sulfonates, primary alkyl sulfates, secondary alkyl sulfates, alkyl alkoxy sulfates, alkyl alkoxy carboxylates, alkyl polyglycosides and their corresponding sulfated polyglycosides, alpha-sulfonated farry acid esters, alkyl and alkyl phenol alkoxylates, betaines and sulfobetaines, amine oxides, N-methyl glucamides, nonionic primary alcohol ethoxylates, nonionic primary alcohol mixed

* ethoxy/propoxy, and mixtures thereof; and wherein further the builder is selected from the group consisting of zeolites, polycarboxylates, layered silicates, phosphates, and mixtures thereof.

20. The fabric cleaning composition according to Claim 19 further comprising one or more cleaning composition materials selected from the group consisting of bleaching agents, fabric softeners, and enzymes.

21. The fabric cleaning composition according to Claim 18 in the form of a concentrated granular fabric cleaning composition comprising at least about 30% surfactant.

22. A dishwashing composition comprising:

(a) from about 0.0001 % to about 10% protease enzyme which is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a subtilisin precursor carbonyl hydrolase, and wherein the protease enzyme is a subtilisin variant selected from N76D/S99D;

N76D/S101R; N76D/S103A; N76D/V104I; N76D/I107V; N76D/N123S;

N76D/S99D/S101R; N76D/S99D/S103A; N76D/S99D/V104I;

N76D/S101R/S103A; N76D/S101R/V104I; N76D/S103A/V104I;

N76D/V1041/1107V; N76D/V104Y/I107V; N76D/V104I/N123S; ' N76D/I107V/N123S; N76D/S99D/S101R/S103A; N76D/S99D/S101R V104I;

N76D/S99D/S103A/V104I; N76D/S101 R S103AΛ/104I;

N76D/S103A/V104I/N123S; N76D/V1041/1107V/N123S;

N76D/S99D/S101 R S103A/V104I; N76D/S99D/S103A/V104I/N123S;

N76D/S99D/S101R/S103A/V104I/N123S; N76D/S103A/V104I/S128G; N76D/S103A V104I/T260P; N76D/S103A/V104I/S265N;

N76D/S103A/V104I/D197E; N76D/S103AΛ/104I/S105A;

N76D/S103A/V104I/L135I; N76D/S103A/V104I/L126F;

N76D/S103A/V104T/L107T; N76D/S103A/V104I/L126F/S265N, and

N76D/S103A/V104I/M222A and mixtures thereof; (b) from about 0.1 % to about 10% surfactant; and (c) optionally, one or more cleaning composition materials compatible with the protease enzyme selected from the group consisting of solvents, buffers, enzymes, dispersing agents, suds suppressors, enzyme stabilizers, bleaching agents, dyes, perfumes, and mixtures thereof.

23. The dishwashing composition according to Claim 22 wherein the protease enzyme is an N76D/S103A/V104I subtilisin variant derived from Bacillus lentus subtilisin.

24. A personal cleansing composition comprising:

(a) from about 0.001 % to about 5% by weight of protease enzyme which is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a precursor carbonyl hydrolase comprising a substitution of a different amino acid for a plurality of amino acid residues at a position in said precursor carbonyl hydrolase equivalent to position +76 in Bacillus amyloliquefaciens subtilisin, in combination with one or more amino acid residue positions equivalent to those selected from the group consisting of +99, +101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166, +195, +197, +204, +206, +210, +216, +217, +218, +222, +260, +265, and/or +274 in Bacillus amyloliquefaciens subtilisin;

(b) from about 0.01 % to about 95% by weight of a surfactant system; and

(c) optionally, from about 0.05% to about 50% of an enzyme stabilizer.

25. The composition of Claim 24 wherein the protease enzyme is at a level of from about 0.001 % to about 2% by weight.

26. The composition of Claim 25 wherein the protease enzyme is at a level of from about 0.01 % to about 0.8% by weight.

27. The composition of Claim 24 wherein the surfactant system comprises a surfactant selected from the group consisting of anionic carboxylates, amine oxides, alkyl giucosides, glucose amides, alkyl sulfates, alkyl ether sulfates, acyl isethionates, alkyl sulfosuccinates, alkyl phosphate esters, ethoxylated phosphate esters, alkyl glyceryl ether sulfonates, or mixtures thereof.

28. The composition of Claim 24 wherein the surfactant system comprises a surfactant selected from the group consisting of soaps, acylglutamates, alkyl sarcosinates, lauramine oxides, cocamine oxides, cocamidopropylamine oxides, decylglucosides, lauryl sulfates, laureth sulfates, C12-C18 ^acvl isethionates, or mixtures thereof.

29. The composition of Claim 28 wherein the surfactant is soap at a level of at least about 2% by weight of the composition.

30. The composition of Claim 29 wherein the soap is at a level of at least about 10% by weight of the composition.

31. The composition of Claim 30 wherein the soap is at a level of at least about 25% by weight of the composition.

32. The composition of Claim 28 wherein the ratio of soap to protease enzyme is from about 2,000:1 to about 8:1.

33. The composition of Claim 32 wherein the ratio of soap to protease enzyme is from about 400:1 to about 40:1.

34. The composition of Claim 28 wherein the protease enzyme is a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a subtilisin precursor carbonyl hydrolase, and wherein the protease enzyme is a subtilisin variant selected from N76D/S99D; N76D/S101 R; N76D/S103A; N76DΛ/104I; N76D/I107V; N76D/N123S;

N76D/S99D/S101R; N76D/S99D/S103A; N76D/S99D/V104I;

N76D/S101R/S103A; N76D/S101R/V104I; N76D/S103A/V104I;

N76D/V1041/1107V; N76D/V104Y/I107V; N76DΛ/104I/N123S;

N76D/I107V/N123S; N76D/S99D/S101R/S103A; N76D/S99D/S101R V104I; N76D/S99D/S103A/V104I; N76D/S101R/S103A/V104I;

N76D/S103A/V104I/N123S; N76D/V104 l/l 107V/N123S;

N76D/S99D/S101 R/S103A/V104I; N76D/S99D/S103A/V104I/N123S;

N76D/S99D/S101 R/S103A/V104I/N123S; N76D/S103A/V104I/S128G;

N76D/S103A/V104I/T260P; N76D/S103A/V104I/S265N;

N76D/S103A/V104I/D197E; N76D/S103A/V104I/S105A;

N76D/S103A/V104I/L135I; N76D/S103AΛ/1041/L126F;

N76D/S103A/V104T/L107T; N76D/S103A/V104I/L126F/S265N, and

N76D/S103A/V104I/M222A; and mixtures thereof.

35. A method for cleaning fabric, said method comprising contacting a fabric in need of cleaning with a protease enzyme which is an N76D/S103A/V104I subtilisin variant derived from Bacillus lentus subtilisin.

36. A method for cleaning dishes, said method comprising contacting a dish in need of cleaning with a protease enzyme which is an N76D/S103A/V104I subtilisin variant derived from Bacillus lentus subtilisin.

37. A method for personal cleansing, said method comprising contacting the part of the human or lower animal body in need of cleaning with a carbonyl hydrolase variant having an amino acid sequence not found in nature, which is derived from a subtilisin precursor carbonyl hydrolase, and wherein the protease enzyme is a subtilisin variant selected from N76D/S99D; N76D/S101R; N76D/S103A; N76DΛ/104I; N76D/I107V; N76D/N123S; N76D/S99D/S101R; N76D/S99D/S103A; N76D/S99D/V1041; N76D/S101R/S103A; N76D/S101R/V104I; N76D/S103A/V104I; N76D V1041/1107V; N76D/V104Y/I107V; N76D/V104I/N123S; N76D/I107V/N123S; N76D/S99D/S101R/S103A; N76D/S99D/S101RΛ 104I; N76D/S99D/S103A/V104I; N76D/S101 R/S103A/V104I; N76D/S103A/V104I/N123S; N76D/V1041/1107V/N123S;

N76D/S99D/S101 R S103A/V1041; N76D/S99D/S103A/V104I/N123S; N76D/S99D/S101 R/S103A/V104I/N123S; N76D/S103A/V104I/S128G; N76D/S103A/V104I/T260P; N76D/S103A/V104I/S265N;

N76D/S103A V104I/D197E; N76D/S103A/V104I/S105A; N76D/S103A V104I/L135I; N76D/S103A/V104I/L126F; N76D/S103A/V104T/L107T; N76D/S103A/V104I/L126F/S265N and N76D/S103A/V104I/ 222A; and mixtures thereof.