WO1994018321A1 - GLYCAM-1 (SgP50) VARIANTS - Google Patents

Abstract

The invention concerns GlyCAM 1 variants that do not function as ligands for L selectin. Some of these variants are naturally occurring polypeptides expressed during pregnancy and lactation in milk. The mammary form of GlyCAM 1 has different carbohydrate modifications as compared to the corresponding endothelial L selectin ligand, which result in the abolishment of L selectin binding. Certain variants have antimicrobial properties.

Description

GLYCAM-1 ( SgP50 ) VARIANTS Field of the Invention

The present invention relates to variants of a native L selectin ligand, GlyCAM 1. More particularly, the invention concerns GlyCAM 1 variants that do not function as ligands for L selectin. Background of the Invention

GlyCAM 1 is an acronym coined to designate a recently described sulfated glycoprotein (GLYcosylation dependant Cell Adhesion Molecule) that appears to mediate leukocyte-endothelial cell adhesion by presenting carbohydrate ligands to the lectin domain of L selectin (Berg, E., et al. , J. Cell Biol. 114: 343-349 [1991]; Imai, Y., et al., J. Cell Biol. JJL3: 1213-1221 [1991]; Imai, Y., et ai , Nature (in press); Lasky, L.A., et al. , Cell. 56:1045-1055 [1989]; Lasky, L.A., et al.. Cell, 69: 927-938 [1992]; PCT Pub. W092/19735 published 12 November 1992.

GlyCAM 1 is a mucin-like glycoprotein, since —70% of its native molecular weight is contributed by carbohydrates that are clustered in two serine/ threonine rich O-linked domains (Lasky et al., Cell, supra: PCT W092/19735 supra). The tissue specific expression of this mucin on the lumenal surface of the high endothelial venules (HEV) of peripheral and mesenteric lymph nodes is consistent with a role for GlyCAM 1 in the regional trafficking of lymphocytes to these lymphoid organs. In addition to the expression of GlyCAM 1 in these lymphoid locations, mRNA for this glycoprotein has been demonstrated in lung, although the anatomic localization of lung GlyCAM 1 has not been described. The interaction between GlyCAM 1 and L selectin is dependent upon the O-linked carbohydrate side chains that are presented by the mucin in a clustered array to the leukocyte selectin. These carbohydrates have been shown to contain a sialic acid component that is critical for the recognition of these carbohydrate ligands by die L selectin lectin domain (Imai et al., J. Cell. Biol., 113. supra). In addition, recent data have demonstrated that the sulfate modification of the carbohydrates attached to GlyCAM 1 is also required for the adhesive recognition of this glycoprotein by L selectin (Imai et al, Nature, supra). Finally, the expression of GlyCAM 1 mRNA and protein appear to be regulated by afferent lymphatic flow, since deafferentation of peripheral lymph nodes results in a loss of expression of these components as well as in a profound decrease in the trafficking of lymphocytes to these treated sites (Hendriks, H. R., et al, Eur. J. Immunol. Y 1691-95 [1987]; Mebius, R. E., et al, J. Cell Biol. 115:85-95 [1991]; Mebius, R. E. et al. , J. Cell Biol. [1992] (submitted)). This result suggests that the tissue specific expression of GlyCAM 1 in the PLN lymphoid compartment is defined by a potentially unique regulatory mechanism. Summary of the Invention

The present invention is based on data demonstrating that a variant form of the tissue-specific L selectin ligand, GlyCAM 1, is expressed during pregnancy and lactation in milk. The data also demonstrate that the form of GlyCAM 1 that is expressed in milk appears to have different carbohydrate modifications than the endothelial form, and that this mammary form is unable to function as a ligand for L selectin.

The gene encoding the GlyCAM 1 L selectin ligand was found on chromosome 15 and contained 4 coding exons (Dowbenko et al. , J. Biol. Chem. in press). During the DNA sequence analysis of the genomic region that encodes die murine GlyCAM 1 , a search of the GenBank revealed that this region of the murine genome had been previously isolated and was shown to encode an mRNA that was expressed in mammary glands during pregnancy and lactation but not in virgin mammary glands (Kawamura, K., et al. , J. Biochem. 101: 103-110 [1987]; Satow, H., et al., J. Biochem. 99: 1639-1643 [1986]). We have surprisingly found that this mammary gland mRNA, which was earlier identified as mRNA for a 26 k casein gene, in fact encodes a mammary form of GlyCAM 1.

In one aspect, the present invention concerns an isolated GlyCAM 1 variant that a) is encoded by nucleic acid able to hybridize under low stringency conditions to the complement of nucleotide sequence encoding a native sequence GlyCAM 1, and b) is unable to function as a ligand for native L selectin. In a specific embodiment, the isolated GlyCAM 1 variant has essentially the same carbohydrate structure as a native mammary GlyCAM 1.

In a further embodiment, the isolated GlyCAM 1 is a native mammary GlyCAM 1 molecule. Certain GlyCAM 1 variants within the scope of the invention have antimicrobial properties. Therefore, the invention also concerns a composition comprising an antimicrobially effective amount of a GlyCAM 1 variant a) encoded by nucleic acid able to hybridize under low stringency conditions to the complement of nucleic acid encoding a native sequence GlyCAM 1 , b) unable to function as a ligand for native L selectin, and c) having antimicrobial activity.

In a further aspect, the invention concerns a method for treating microbial infection by administering to a patient having developed or at risk of developing microbial infection an effective amount of a GlyCAM 1 variant a) encoded by nucleic acid able to hybridize under low stringency conditions to the complement of nucleic acid encoding a native sequence GlyCAM 1 , b) unable to function as a ligand for native L selectin, and c) having antimicrobial activity.

In a still further aspect, the invention concerns infant formula comprising an effective amount of an antimicrobial GlyCAM 1 variant as hereinabove defined. In yet another aspect, the invention concerns a method for isolating an endothelial GlyCAM 1 L selectin ligand from a mammalian species by generating a monoclonal antibody cross-reacting with mammary GlyCAM 1 and endothelial cells of said mammalian species, and isolating a polypeptide specifically binding to the antibody.

These and further aspects will be apparent for those skilled in the art. Brief Description of the Drawings

Figure 1. Northern blot analysis of GlyCAM 1 mRNA from various tissues. 10 micrograms of total RNA were run per lane on denaturing gels, transferred to nitrocellulose and probed with ³²P-labeled GlyCAM 1 cDNA A. a. Lactating mammary gland, b. mesenteric lymph node, c. mammary gland prepared 10 days after weaning of pups. B . a. Spleen, b. peripheral lymph node, c. mesenteric lymph node, d. Peyer's patch, e. lung, f. virgin mammary gland, g. virgin inguinal lymph node, h. lactating mammary gland, i. inguinal lymph node from a lactating animal. C. Time course of induction of GlyCAM 1 mRNA during pregnancy. Shown are the days after conception. Figure 2. In situ hybridization analysis of mammary glands probed with GlyCAM 1 ³⁵S RNA A. Lactating mammary gland probed with antisense RNA, B. Lactating mammary gland probed with sense RNA, C. Virgin mammary gland probed with antisense RNA.

Figure 3. Immunohistochemistry of GlyCAM 1 variant expression analyzed with anti-peptide antisera. A. Lactating (4 days post-partum) mammary gland pre-immune serum B. Lactating mammary gland anti-GlyCAM 1 peptide antiserum, C. Late pregnant (17 days post conception) mammary gland pre-immune serum D. Late pregnant mammary gland anti-GlyCAM 1 peptide antiserum, E. Virgin mammary gland anti-GlyCAM 1 peptide antiserum, F. Post-weaning mammary gland anti-GlyCAM 1 antiserum, G. Peripheral lymph node anti GlyCAM 1 peptide antiserum, H. Inguinal lymph node and mammary gland anti-GlyCAM 1 peptide antiserum. The arrows illustrate the HEV of the inguinal node staining with the antiserum. All photographs at 200X except G at 400X.

Figure 4. Western blot analysis of GlyCAM 1 variant in milk (mammary GlyCAM 1). 2.5 (a), 5 (b) and 10 (c) microliters of the boiled whey fraction of milk was run with 500 ng (d), 50 ng (e) or 5 ng (f) of purified recombinant GlyCAM IgG chimera on an SDS 4-20% acrylamide gradient gel after boiling in SDS mercaptoethanol. The proteins were transferred to ProBlott, stained with anti-peptide antiserum, and visualized with protein G gold and enhancement.

Figure 5. Analysis of labelled PLN and mammary GlyCAM 1. PLN or mammary glands were labeled with either Na^SO or with ³H serine and threonine in organ culture. The samples were then immunoprecipitated with either the L selectin IgG chimera or with anti-GlyCAM 1 peptide antisera or pre immune antisera. A. Sulfate labeled total PLN proteins.B. Sulfate labeled PLN proteins precipitated with L selectin IgG chimera, C. Sulfate labeled PLN proteins precipitated with L selectin IgG chimera in the presence of EGTA.. The L selectin IgG material appears to be somewhat higher molecular weight than the anti peptide precipitated material because of band compression of the anti peptide precipitated ligand by the IgG heavy chain., D. Sulfate labeled PLN proteins precipitated with pre-immune serum, E. Sulfate labeled PLN proteins precipitated with anti-GlyCAM 1 peptide antiserum, F. Sulfate labeled mammary gland total proteins, G. Sulfate labeled mammary gland precipitated with L selectin IgG chimera, H. Sulfate labeled mammary gland proteins precipitated with L selection chimera in the presence of EGTA, I. Sulfate labeled mammary gland proteins precipitated with pre immune serum, J. Sulfate labeled mammary gland proteins precipitated with the anti-GlyCAM 1 peptide antiserum, K. Serine/Threonine labelled PLN proteins precipitated with L selectin IgG chimera, L. Serine/Threonine labeled PLN proteins precipitated with L selectin IgG chimera in the presence of EGTA, M. Serine/Threonine labeled PLN proteins precipitated with anti-GlyCAM 1 peptide antiserum. As described above, the higher apparent mobility of the anti peptide precipitated GlyCAM 1 is due to band compression. , N. Serine/Threonine labeled mammary gland proteins precipitated with L selectin IgG chimera, O. Serine/Threonine labeled mammary gland proteins precipitated with L selectin IgG chimera in the presence of EGTA, P. Serine/Threonine labeled mammary gland proteins precipitated with anti-GlyCAM 1 peptide antiserum. Figure 6. The cDNA nucleotide sequence and the derived amino acid sequence of murine GlyCAM 1 (SEQ. ID. No.: 1). The unshaded box illustrates a Kozak translational initiation site surrounding the first methionine codon.

Figure 7. The cDNA nucleotide sequence and derived amino acid sequence of rat GlyCAM 1 (SEQ. ID. No.: 2). Potentially O-glycosylated serines and threonines are shown in shaded boxes. "N-terminus" refers to the N-terminus of the mature, secreted glycoprotein previously determined for murine GlyCAM 1. The boxed sequence surrounding the initiator MET codon is homologous to the Kozak translational start sequence, and the boxed sequence starting 19 nucleotides before the beginning of the poly A sequence (which begins after the last G residue) is homologous to a polyadenylation signal site.

Figure 8. Structural comparison of mouse and rat GlyCAM 1. Shown is a Kyte and

Doolittle hydropathy plot (negative-hydrophilic, positive-hydrophobic) with balls on sticks referring to potential O-glycosylation sites (serines and threonines). The single open ball on a stick illustrates the asparagine of a potential N-linked glycosylation site. Shown above each hydropathy plot is a hypothetical domain structure for mouse and rat GlyCAM 1. The helical domain at the C terminus represents the potential amphipathic helix (see Figure 10).

Figure 9. Sequence alignment of rat and mouse GlyCAM 1. Amino acids that are conserved between the two species are shown boxed. The potential O-linked domains (OLR1 and OLR2) are illustrated as is the potential amphipathic helix. Dots above serine and threonine residues represent conserved positions for these amino acids. The single potential N-linked glycosylation site in mouse GlyCAM 1 is shown in a shaded box.

Figure 10. C terminal amphipathic helices from mouse and rat GlyCAM 1. Shown is the view down the barrel of potential amphipathic helices from the C termini of mouse and rat GlyCAM 1. Apolar amino acids are shown as filled balls while polar amino acids are shown as open balls. Figure 11. Precipitation analysis of sulfate labeled supernatants from mouse and rat lymph node organ cultures, peripheral and mesenteric lymph nodes from mice or rats were excised, minced and labeled with Na₂ ³⁵S0₄ in organ culture as previously described. Conditioned media were immunoprecipitated and the precipitates were run on SDS 4-20% acrylamide gradient gels. A. Sulfate labeled mouse lymph nodes precipitated with L selectin IgG chimera, B. Sulfate labeled mouse lymph nodes precipitated with L selectin IgG chimera in the presence of EGTA, C. Sulfate labeled mouse lymph nodes precipitated with pre immune serum, D. Sulfate labeled mouse lymph nodes precipitated with anti GlyCAM 1 peptide antiserum, E. Sulfate labeled rat lymph nodes precipitated with L selectin IgG chimera, F. Sulfate labeled rat lymph nodes precipitated with L selectin IgG chimera in the presence of EGTA, G. Sulfate labeled rat lymph nodes precipitated with pre immune serum, H. Sulfate labeled rat lymph nodes precipitated with anti GlyCAM 1 peptide antiserum. Detailed Description of the Invention I. Definitions

"GlyCAM 1 " stands for "Glycosylation dependant cell adhesion molecule 1 " and, along with the phrases "endothelial GlyCAM 1 ", "endothelial GlyCAM 1 L selectin ligand", "native sequence GlyCAM 1", and "native sequence GlyCAM 1 L selectin ligand", which are used interchangeably, designates the about 50 kD endothelial ligand of murine L selectin having a native amino acid sequence and its equivalents in any animal species, including humans. As organ-specific L selectin binding takes place via the oligosaccharides attached to the polypeptide backbone, by definition, the foregoing expressions designate L selectin ligands that have native carbohydrate structures instrumental in binding to L selectin receptors at any endothelial sites, such as peripheral lymph nodes (PN) and Peyer's patches (PP), and glycosylation variants (either naturally occurring or not occurring in nature) that retain the qualitative ability to function as a ligand for L selectin, i.e. are able to bind L selectin. The foregoing terms specifically encompass murine GlyCAM 1 having the amino acid sequence shown in Figure 6 (SEQ. ID. No.: 1) as disclosed in its PCT counterpart WO 92/19735 published 12 November 1992; rat GlyCAM 1 having the amino acid sequence shown in Figure 7 (SEQ. ID. No.: 2) and as disclosed in Example 3; and their human and other mammalian equivalents, possessing native glycosylation, whether isolated from native source, synthesized or produced by techniques of recombinant DNA technology. The term also covers glycosylation variants of such GlyCAM 1 molecules provided that they retain the qualitative ability to function as a ligand for L selectin, i.e. to bind L selectin.

"L selectin", also known as peripheral lymph node homing receptor (pnHR), LEC-CAM-1 , LAM-1, gp90^MEL, gpl00^MEL, gpllO^MEL, MEL-14 antigen, Leu-8 antigen, TQ-1 antigen, DREG antigen, is member of the LEC-CAM or selectin family of the cell adhesion molecules. The amino acid sequences and encoding nucleotide sequences of murine and human L selectin are, for example, disclosed in U. S. patent No. 5,098,833 issued 24 March 1992.

The term "GlyCAM 1 variants" as used herein designates polypeptide compounds that a) are encoded by nucleic acid able to hybridize under low stringency conditions to the complement of nucleotide sequence encoding a native sequence GlyCAM 1 L selectin ligand, and b) do not function as ligands for a native L selectin. It is known that only certain oligosaccharide compounds can act as L selectin ligands. Thus, sialic acid moieties are known to play an important role in L selectin binding, and it has been proposed that distinct sialyloligosaccharides constitute the organ-specific recognition determinants of L selectin ligands on both peripheral lymph nodes and Peyer's patches. It has further been shown that attachment of a sulfate moiety to such oligosaccharide compounds has a significant effect on their ability to bind L selectin. Accordingly, the abolishment of L selectin ligand function preferably is due to a qualitative or quantitative change in the carbohydrate structure of a GlyCAM 1 variant herein as compared to the carbohydrate structure of the native GlyCAM 1 endothelial L selectin ligand of the same (human or non-human) mammalian species, including any change in the sulfation of the oligosaccharide structure. The polypeptide backbone of the GlyCAM 1 variants herein is preferably greater than about 60% homologous, more preferably greater than about 70% homologous, still more preferably greater than about 80% homologous, even more preferably at least about 90% homologous with the amino acid sequence of a native endothelial GlyCAM 1 L selectin ligand. Most preferably, the GlyCAM 1 variants have the same polypeptide backbone as the GlyCAM 1 L selectin ligand of the same animal species, and possess glycosylation that abolishes L selectin binding, as it has been demonstrated for the endothelial and mammary forms of L selectin in the mouse and in the rat. The phrase "GlyCAM 1 variant" specifically covers the mammary form of GlyCAM 1 ("mammary GlyCAM 1 variant") as synthesized in the mammaiy gland or as isolated from milk of any human or non-human mammalian species. The phrase also encompasses variants with amino acid sequence, glycosylation and/or covalent alterations as compared to a native mammaiy GlyCAM 1 variant, provided that they do not function as L selectin ligands. The GlyCAM 1 variants herein preferably retain a C terminal amphipathic helix tertiary structure characteristic of GlyCAM 1 L selectin ligands, and preferably comprise the signal sequence of a native endothelial GlyCAM 1 L selectin ligand. Even more preferably, the GlyCAM 1 variants herein comprise at least two serine and threonine rich domains indicative of O-linked glycosylation. The GlyCAM 1 variants preferably have antimicrobial properties. "Homologous" is defined as the percentage of residues in the candidate amino acid sequence that are identical with the residues in the amino acid sequence of a native GlyCAM 1 L selectin ligand, such as the sequence shown in Figure 4 after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology.

The phrases "antimicrobial activity", "antimicrobial agent" and their grammatical variants are used to refer to the ability to control (prevent and/or treat) any microbial, such as viral, bacterial,. fungal, protozoa, etc. infections.

The terms "nucleic acid (molecule) encoding", "DNA sequence encoding", and "DNA encoding" refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide chain. The DNA sequence thus codes for the amino acid sequence.

The term "isolated" when used in relation to a nucleic acid or a protein refers to a nucleic acid or protein that is identified and separated from at least one containment nucleic acid or protein with which it is ordinarily associated in its natural source. Isolated nucleic acid or protein is such present in a form or setting that is different from that in which it is found in nature. However, isolated nucleic acid encoding GlyCAM 1 or a variant thereof includes such nucleic acid in cells ordinarily expressing

GlyCAM 1 or a naturally occurring variant thereof where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different DNA sequence than that found in nature.

"Low stringency conditions" are overnight incubation at 42°C in a solution comprising: 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 50°C. "Stringent conditions" differ in that 50% formamide is used, and washing is performed with 0.1 x SSC AT 65°C.

The terms "amino acid" and "amino acids" refer to all naturally occurring L-α-amino acids. This definition is meant to include norleucine, ornithine, and homocysteine. The amino acids are identified by either the single-letter or three-letter designations: Asp D aspartic acid He I isoleucine

Thr T threonine Leu L leucine Ser S serine Tyr Y tyrosine

Glu E glutamic acid Phe F phenylalanine

Pro P proline His H histidine

Gly G glycine Lys K lysine Ala A alanine Arg R arginine

Cys C cysteine Tip W tryptophan

Val V valine Gin Q glutamine

Met M methionine Asn N asparagine

These amino acids may be classified according to the chemical composition and properties of their side chains. They are broadly classified into two groups, charged and uncharged. Each of these groups is divided into subgroups to classify the amino acids more accurately: I. Charged Amino Acids

Acidic Residues: aspartic acid, glutamic acid

Basic Residues: lysine, arginine, histidine II. Uncharged Amino Acids

Hvdrophilic Residues: serine, threonine, asparagine, glutamine

Aliphatic Residues: glycine, alanine, valine, leucine, isoleucine

Non-polar Residues: cysteine, methionine, proline

Aromatic Residues: phenylalanine, tyrosine, tryptophan The terms "amino acid sequence alteration", and "amino acid sequence variant" refer to molecules with some differences in their amino acid sequences as compared to a corresponding native (e.g. endothelial GlyCAM 1 or mammary GlyCAM 1 variant) amino acid sequence. Ordinarily, the amino acid sequence variants will possess at least 70% homology with a native GlyCAM 1 or mammary GlyCAM 1 variant, and preferably, they will be at least about 80%, more preferably at least about 90% homologous with a native GlyCAM 1 or mammary GlyCAM 1 variant. The amino acid sequence variants falling within this invention possess substitutions, deletions, and/or insertions at certain locations within the amino acid sequence of a native GlyCAM 1 L selectin ligand or a native GlyCAM 1 variant synthesized in the mammary gland.

Substitutional variants are those that have at least one amino acid residue in a native sequence removed and a different amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.

Substantial changes in the properties of the variant may be obtained by substituting an amino acid with a side chain that is significantly different in charge and/or structure from that of the native amino acid. This type of substitution would be expected to affect the structure of the polypeptide backbone and/or the charge or hydrophobicity of the molecule in the area of the substitution.

Moderate changes in the properties of the variant molecule would be expected by substituting an amino acid with a side chain that is similar in charge and/or structure to that of the native molecule. This type of substitution, referred to as a conservative substitution, would not be expected to substantially alter either the structure of the polypeptide backbone or the charge or hydrophobicity of the molecule in the area of the substitution.

Insertional variants are those with one or more amino acids inserted immediately adjacent to an amino acid at a particular position in a native GlyCAM 1 or mammary GlyCAM 1 variant amino acid sequence. Immediately adjacent to an amino acid means connected to either the α-carboxy or α-amino functional group of the amino acid. The insertion may be one or more amino acids. Ordinarily, the insertion will consist of one or two conservative amino acids. Amino acids similar in charge and/or structure to the amino acids adjacent to the site of insertion are defined as conservative. Alternatively, this invention includes insertion of an amino acid with a charge and/or structure that is substantially different from the amino acids adjacent to the site of insertion.

Deletional variants are those with one or more amino acids in the native GlyCAM 1 or mammary GlyCAM 1 variant amino acid sequence removed. Ordinarily, deletional variants will have one or two amino acids deleted in a particular region of the molecule.

An essential role of the protein core of the endothelial GlyCAM 1 L selectin ligands is to serve as a scaffold for a specific carbohydrate structure recognized by the corresponding L selectin. The GlyCAM 1 amino acid sequence variants of the present invention may have alterations within the two highly O-glycosylated, serine- and threonine-rich regions (amino acids 42-63 and amino acids 93-122 in Figure 6) of the GlyCAM 1 L-selectin ligand amino acid sequence that result in the elimination or addition of glycosylation sites and thereby result in an altered carbohydrate structure so that the variants are no longer capable of binding and activating the native L-selectin receptor. Alternatively (in combination with other changes resulting in the abolishment of L selectin binding and in antimicrobial properties), or in addition, the GlyCAM 1 variants herein may have amino acid alterations, such as conservative amino acid substitutions within other regions of the GlyCAM 1 molecule.

"Oligonucleotides" are short-length, single- or double-stranded polydeoxynucleotides that are chemically synthesized by known methods [such as phosphotriester, phosphite, or phosphoramidite chemistry, using solid phase techniques such as those described in EP 266,032, published 4 May 1988, or via deoxynucleoside H-phosphanate intermediates as described by Froehler et al., Nucl. Acids Res. .14, 5399 (1986)]. They are then purified on polyacrylamide gels.

"Stable plasma proteins" are proteins typically having about 30 to about 2000 residues, which exhibit in their native environment an extended half-life in the circulation, i.e. a half-life greater than about 20 hours. Examples of suitable stable plasma proteins are immunoglobulins, albumin, lipoproteins, apolipoproteins and transferrin.

The term "immunoglobulin" generally refers to polypeptides comprising a light or heavy chain usually both disulfide bonded or non-covalently associated in the native "Y" configuration, although other linkage between them, including tetramers or aggregates thereof, is within the scope hereof.

Immunoglobulins (Ig) and certain variants thereof are known and many have been prepared in recombinant cell culture. For example, see U.S. Patent 4,745,055; EP 256,654; Faulkner et al.. Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison. J. Immun. 123:793 (1979); Kohler et al, Proc. Nat'l. Acad. Sci. USA 77:2197 (1980); Raso et al, Cancer Res. 41:2073 (1981); Morrison et al, Ann. Rev. Immunol. 2:239 (1984); Morrison. Science 229:1202 (1985); Morrison et al., Proc. Nat'l. Acad. Sci. USA 81:6851 (1984); EP 255,694; EP 266,663; and WO 88/03559. Reassorted immunoglobulin chains also are known. See for example U.S. patent 4,444,878; WO 88/03565; and EP 68,763 and references cited therein. L-selectin-immunoglobulin chimeras are, for example, disclosed in WO 91/08298 published 13 June 1991. GlyCAM 1 -immunoglobulin chimeras are described in WO 92/19735 published 12 November 1992. The immunoglobulin moiety in the chimeras of the present invention may be obtained from IgG , IgG,, IgG₃, or IgG. subtypes, IgA, IgE, IgD or IgM, but preferably IgG_! or IgG., including any cross-class and cross-species combinations such as, for example, described in EP 125,023 published 14 November 1984. The technique of "polymerase chain reaction" or "PCR", as used herein, generally refers to a procedure wherein minute amounts of a specific piece of nucleic acid, RNA and/or DNA, are amplified as described in U.S. Patent No. 4,683,195, issued 28 July 1987 and in Current Protocols in Molecular Biology. Ausubel et al. eds., Greene Publishing Associates and Wiley-Interscience 1991 , Volume 2, Chapter 15. "Northern blot analysis" is a method used to identify RNA sequences that hybridize to a known probe such as an oligonucleotides, DNA fragment, cDNA or fragment thereof, or RNA fragment. The probe is labeled with a radioisotope such as ³²P, or by biotinylation, or with an enzyme. The RNA to be analyzed is usually electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe, using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sa brook et al. , Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, 1989. II. General Methods

A. Obtaining GlyCAM 1 Variants

The GlyCAM 1 variants of the present invention are native mammary GlyCAM 1 molecules or may be conveniently prepared from native mammary GlyCAM 1 or from native endothelial GlyCAM 1 L selectin ligands.

The cloning and expression of murine GlyCAM 1 L selectin ligand is disclosed in PCT publication No. WO 92/19735 published 12 November 1992, and its nucleotide and amino acid sequences are shown in Figure 6 (SEQ. ID. No. : 1). The cloning of the rat homologue is disclosed in Example 3 herein, and the rat GlyCAM 1 nucleotide and amino acid sequences are shown in Figure 7 (SEQ. ID. No.: 2).

The mammary form of GlyCAM 1 has been detected in the soluble whey fraction of the milk of secreting mammary gland, and can be isolated and purified from this source. The detection and isolation of murine mammary GlyCAM 1 variant from the soluble whey fraction of murine milk is described in Example 1. The rat mammary GlyCAM 1 analogue and analogues from higher mammalian species can be purified in an analogous manner. The first step of purification takes advantage of the known resistance of GlyCAM 1 L selectin ligand to boiling and to denaturation by organic solvents. Accordingly, the whey fraction of milk from a mammalian species is separated, e.g. by centrifugation and is subsequently boiled and/or treated with organic solvents, e.g. chloroform, methanol. to eliminate contaminating proteins. Methods available for purification of mammary GlyCAM 1 from this crude preparate include anion and cation exchange chromatography, hydroxyapatite chromatography, immunoaffmity chromatography and lectin chromatography, and gel electrophoresis. Other known purification methods within the scope of this invention utilize anti-GlyCAM 1 antibodies, for example in reverse-phase HPLC chromatography.

A difficulty faced during the purification of native mammary GlyCAM 1 variants is the limited availability of milk, especially in the case of higher primates, such as humans. This difficulty can be overcome by using techniques of recombinant DNA technology. DNA encoding a mammary GlyCAM 1 variant may be obtained from a cDNA library prepared from mammary gland epithelial cells of pregnant or lactating mammals. Libraries are generally screened with probes designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes usually include mono- and polyclonal antibodies; oligonucleotides or pools of oligonucleotides of about 20-80 bases in length; and/or complementary or homologous cDNAs or their fragments that encode the same or similar gene. Suitable hybridization probes for the isolation of mammary GlyCAM 1 are based on the sequence encoding a known endothelial GlyCAM 1 L selectin ligand (see Figure 6). In addition, hybridization probes based on the sequence of DNA encoding a known mammary GlyCAM 1 variant can be used to isolate DNA encoding mammary GlyCAM 1 in an evolutionary closely related mammalian species. Mouse, rat, guinea pig, hamster, rabbit, higher primates and humans represent different stages of this "evolutionary ladder". Hybridization protocols are well known in the art, and are disclosed in basic textbooks such as, for example, Sambrook et al. , supra, and Current Protocols in Molecular Biology supra.

An alternative means to isolate the gene encoding a mammary GlyCAM 1 variant is to use polymerase chain reaction (PCR) methodology as described in section 14 of Sambrook et al., Supra or in Chapter 15 of Current Protocols in Molecular Biology. Supra. Once its sequence has been determined, the gene encoding a mammary GlyCAM 1 can also be prepared by chemical synthesis, using one of the methods described in Engels et al. , Agnew. Chem. Int. Ed. Engl. 28, 716 (1989). These methods include triester, phosphite, phosphoramidite and H- Phosphonate methods, PCR and other autoprimer methods, and oligonucleotide syntheses on solid supports. The DNA is then introduced into an eukaryotic or prokaryotic host cell, preferably with the aid of an expression vector, and expressed to produce the desired mammary GlyCAM 1 polypeptide, which is men isolated from the recombinant cell culture. General techniques of recombinant production of polypeptides, along with suitable host cells and expression systems, are disclosed in Sambrook et al., supra, and in Current Protocols in Molecular Biology, supra: and are detailed in US patent No. 5,098,833 issued 24 March 1992, and in PCT W092/19735. B. Glycosylation Variants of Mammary GlyCAM 1

Glycosylation variants of mammary GlyCAM 1 can be made by techniques known in the art. Glycosylation of polypeptides is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side-chain of an asparagine residue. The tripeptide sequences, asparagine-X-serine and asparagine-X -threonine, wherein X is any amino acid except proline, are recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagine side chain. O-linked glycosylation refers to the attachment of one of the sugars N-acetylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5- hydroxyproline or 5-hydroxylysine may also be involved in O-linked glycosylation.

The mammary GlyCAM 1 variants of the present invention are characterized by the prevalence of O-linked glycosylation sites. These may, for example, be modified by the addition of, or substitution by, one or more serine or threonine residue to the amino acid sequence of a native mammary GlyCAM 1 variant. For ease, changes are usually made at the DNA level, essentially using techniques known for the preparation of amino acid sequence variants of polypeptides, such as those disclosed in the above-cited textbooks and patent literature. Alternatively, starting material for making glycosylation variants within the scope of this invention may be a known endoύ elial GlyCAM 1 L selectin ligand, such as GlyCAM 1 having the amino acid sequence shown in Figure 6.

Chemical or enzymatic coupling of glycosydes to the polypeptide backbone of the GlyCAM 1 variants of the present invention may also be used to modify or increase the number of carbohydrate substituents. These procedures are advantageous in that they do not require production of the polypeptide Uiat is capable of O-linked (or N-linked) glycosylation. Depending on the coupling mode used, the sugar(s) may be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free hydroxyl groups such as those of cysteine, (d) free sulfhydryl groups such as those of serine, threonine, or hydroxyproline, (e) aromatic residues such as those of phenylalanine, tyrosine, or tryptophan or (f) the amide group of glutamine. These methods are described in WO 87/05330 (published 11 September 1987), and in Aplin and Wriston, CRC Crit. Rev. Biochem.. pp. 259-306 (1981).

Carbohydrate moieties present on a known GlyCAM 1 or GlyCAM 1 variant molecule may also be removed chemically or enzymatically. Chemical deglycosylation requires exposure to trifluoromethanesulfonic acid or an equivalent compound. This treatment results in the cleavage of most or all sugars, except the linking sugar, while leaving the polypeptide intact. Chemical deglycosylation is described by Hakimuddin et al. , Arch. Biochem. Biophvs. 259. 52 (1987) and by Edge et al. , Anal. Biochem. 118, 131 (1981). Carbohydrate moieties can be removed by a variety of endo- and exoglycosidases as described by Thotakura et al. , Meth. Enzvmol. 138, 350 (1987). Glycosylation is suppressed by tunicamycin as described by Duskin et al. , J. Biol. Chem. 257. 3105 (1982). Tunicamycin blocks the formation of protein-N-glycosyde linkages.

Glycosylation variants can also be produced by selecting appropriate host cells. Yeast, for example, introduce glycosylation which varies significantly from that of mammalian systems. Similarly. mammalian cells having a different species (e.g. hamster, murine, insect, porcine, bovine or ovine) or tissue (e.g. lung, liver, lymphoid, mesenchymal or epidermal) origin than the source of the endothelial GlyCAM 1 L selectin ligand or mammary GlyCAM 1 variant molecule, are routinely screened for the ability to introduce variant glycosylation as characterized for example, by altered levels of mannose or variant ratios of mannose, fucose, sialic acid, and other sugars essential for selectin binding. In order to achieve glycosylation essentially identical with the glycosylation pattern of a native GlyCAM 1 variant, the DNA encoding the polypeptide backbone of a desired GlyCAM 1 variant may be expressed in host cells in which the native GlyCAM 1 variant occurs in nature, such as, in mammary epithelial cells. C. Amino Acid Sequence Variants and Covalent Modifications

In addition, or alternatively, the GlyCAM 1 variants of the present invention may contain amino acid alterations as compared to the amino acid sequence of any naturally occurring GlyCAM 1 L selectin ligand or mammary GlyCAM 1 variant. These alterations (substitutions, deletions and/or insertions) are preferably achieved by site-directed mutagenesis of DNA that encodes a naturally occurring GlyCAM 1 or GlyCAM 1 variant. Whereas any technique known in the art can be used to perform site-directed mutagenesis, e.g. as disclosed in Sambrook et al. supra, oligonucleotide-directed mutagenesis is the preferred method for the purpose of this invention. This method, which is well known in the art

(Adelman et al. DNA, 2:183 [1983]), is particularly suitable for making substitution variants, it may also be used to conveniently prepare deletion and insertion variants. The oligonucleotides are readily synthesized using techniques well known in the art such as that described by Crea et al. (Proc. Nat'l. Acad. Sci. USA. 75:5765 [1978]). The cDNA to be mutated must be inserted into a suitable vector, such as the vectors that contain a single-stranded phage origin of replication as described by Veira et al,

(Meth. Enzvmol.. 153:3 [1987]), in order to generate single-stranded template. Production of the single- stranded template is described in sections 4.21-4.41 of Sambrook et al., supra.

To mutagenize a native sequence, the oligonucleotide is annealed to the single-stranded DNA template molecule under suitable hybridization conditions. A DNA polymerizing enzyme, usually the Klenow fragment of E. coli DNA polymerase I, is then added. This enzyme uses the oligonucleotide as a primer to complete the synthesis of the mutation-bearing strand of DNA. Thus, a heteroduplex molecule is formed such that one strand of DNA encodes die wild-type GlyCAM 1 inserted in the vector, and the second strand of DNA encodes the mutated form of GlyCAM 1 inserted into the same vector. This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JM101. After growing the cells, they are plated on to agarose plates and screened using the oligonucleotide primer radiolabeled with 32-P to identify the colonies that contain the mutated t-PA. These colonies are selected, and the DNA is sequenced to confirm the presence of mutations in the GlyCAM 1 molecule.

Mutants with more than one amino acid substituted may be generated in one of several ways. If the amino acids are located close together in the polypeptide chain, they may be mutated simultaneously using one oligonucleotide that codes for all of the desired amino acid substitutions. If however, the amino acids are located some distance from each other (separated by more than ten amino acids, for example) it is more difficult to generate a single oligonucleotide that encodes all of the desired changes. Instead, one of two alternative methods may be employed. In Λe first method, a separate oligonucleotide is generated for each amino acid to be substituted. The oligonucleotides are then annealed to the single- stranded template DNA simultaneously, and the second strand of DNA that is synthesized from the template will encode all of the desired amino acid substitutions. The alternative method involves two or more rounds of mutagenesis to produce die desired mutant. The first round is as described for the single mutants: native GlyCAM 1 DNA is used for the template, an oligonucleotide encoding the first desired amino acid substitution(s) is annealed to this template, and the heteroduplex DNA molecule is then generated. The second round of mutagenesis utilizes the mutated DNA produced in the first round of mutagenesis as the template. Thus, this template already contains one or more mutations. The oligonucleotide encoding the additional desired amino acid substitution(s) is then annealed to this template, and the resulting strand of DNA now encodes mutations from both the first and second rounds of mutagenesis. This resultant DNA can be used as a template in a third round of mutagenesis, and so on.

While site-directed mutagenesis is preferred, others techniques, such as cleavage-ligation techniques, PCR mutagenesis may also be used for producing amino acid sequence alterations within the polypeptide backbone of GlyCAM 1 or mammary GlyCAM 1 variant.

Covalent modifications of the GlyCAM 1 variants of the present invention are included within the scope herein. Such modifications are traditionally introduced by reacting targeted amino acid residues of the GlyCAM 1 protein with an organic derivatizing agent that is capable of reacting with selected side- chains or terminal residues, or by harnessing mechanisms of post-translational modifications that function in selected recombinant host cells. The resultant covalent derivatives are useful in programs directed at identifying residues important for biological (antimicrobial) activity, for immunoassays, or for the preparation of anti-GlyCAM 1 variant antibodies for immunoaffinity purification of the recombinant glycoprotein. For example, complete inactivation of the biological activity of the protein after reaction with ninhydrin would suggest that at least one arginyl or lysyl residue is critical for its activity, whereafter the individual residues which were modified under the conditions selected are identified by isolation of a peptide fragment containing the modified amino acid residue. Such modifications are within the ordinary skill in the art and are performed without undue experimentation.

Derivatization with bifunctional agents is useful for preparing intramolecular aggregates of the GlyCAM 1 variants with polypeptides as well as for cross-linking the GlyCAM 1 variant glycoprotein to a water insoluble support matrix or surface for use in assays or affinity purification. In addition, a study of interchain cross-links will provide direct information on conformational structure. Commonly used cross-linking agents include l, l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, homobifunctional imidoesters, and bifunctional maleimides. Derivatizing agents such as methyl-3- [(p-azidophenyl)dithio]propioimidate yield photoactivatable intermediates which are capable of forming cross-links in the presence of light. Alternatively, reactive water insoluble matrices such as cyanogen bromide activated carbohydrates and the systems reactive substrates described in U.S. patent Nos. 3,959,642; 3,969,287; 3,691 ,016; 4, 195, 128; 4,247,642; 4,229,537; 4,055,635; and 4,330,440 are employed for protein immobilization and cross-linking.

Certain post-translational modifications are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and aspariginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains [T.E. Creighton, Proteins: Structure and Molecular Properties. W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)]. Other derivatives comprise the GlyCAM 1 variants of this invention covalently bonded to a nonproteinaceous polymer. The nonproteinaceous polymer ordinarily is a hydrophilic synthetic polymer, i.e. a polymer not otherwise found in nature. However, polymers which exist in nature and are produced by recombinant or in vitro methods are useful, as are polymers which are isolated from nature. Hydrophilic polyvinyl polymers fall within the scope of this invention, e.g. polyvinylalcohol and polyvinylpyrrolidone. Particularly useful are polyvinylalkylene ethers such a polyethylene glycol, polypropylene glycol.

The GlyCAM 1 variants may be linked to various nonproteinaceous polymers, such as polyethylene glycol, polypropylene glycol or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337. The GlyCAM 1 variants may be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, in colloidal drug delivery systems (e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules), or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences. 16th Edition, Osol, A., Ed. (1980). A GlyCAM 1 variant sequence can be linked to a stable plasma protein sequence as hereinbefore defined. The stable plasma protein sequence may, for example, be an immunoglobulin sequence, e.g. an immunoglobulin constant domain sequence. The resultant molecules are commonly referred to as GlyCAM 1 variant-immunoglobulin chimeras.

In a preferred embodiment, the C-terminus of a GlyCAM 1 variant amino acid sequence, which preferably contains the region(s) required for antimicrobial activity, is fused to the N-terminus of the C- terminal portion of an antibody (in particular the Fc domain), containing the effector functions of an immunoglobulin, e.g. immunoglobulin G . It is possible to fuse the entire heavy chain constant region to the sequence containing the selectin binding site(s). However, more preferably, a sequence beginning in the hinge region just upstream of the papain cleavage site (which defines IgG Fc chemically; residue 216, taking the first residue of heavy chain constant region to be 114 [Kobet et al. , Supra! . or analogous sites of other immunoglobulins) is used in the fusion. In a particularly preferred embodiment, the GlyCAM 1 variant amino acid sequence is fused to the hinge region and C H 2 and C H 3 or C H 1, hinge, C H 2 and C H 3 domains of an IgG^ IgG₂ or IgG heavy chain. The precise site at which the fusion is made is not critical, and the optimal site can be determined by routine experimentation. As hereinabove mentioned, GlyCAM 1 (L selectin ligand) - stable plasma protein chimeras are disclosed in WO 92/19735 published 12 November 1992. ( Assays for Testing L Selectin Binding and Antimicrobial Activity

L selectin binding can, for example, be assayed by determining die binding of radiolabeled (e.g. ³⁵S-labeled) GlyCAM 1 variants to immobilized receptor-immunoglobulin chimera, in the presence or absence of soluble inhibitors, essentially as described by Imai et al., J. Cell Biol. 113. 1213 (1991). Alternatively or in addition, adherence to cells expressing the respective receptor can be used to assay ligand binding. For example, EL-4 cells (ATCC TIB39) are known to express high levels of L selectin on their surfaces, and can therefore be used in cell adhesion assays for L selectin binding. Adherent cells can be quantitated by lactate dehydrogenase activity [Bradley et al. , J. Cell. Biol. 105. 991 (1987)]. GlyCAM 1 that do not bind L selectin in these assays are within the scope of the present invention provided diat they exhibit antimicrobial activity.

In an appropriate in vitro assay of antimicrobial activity the ability of a candidate GlyCAM 1 variant molecule to inhibit rotavirus replication in tissue culture is tested as described in Example 2. In vivo activity may, for example, be tested in a mouse model of rotavirus gastroenteritis, as described in Example 3. D. Therapeutic Compositions

Certain GlyCAM 1 variants of the present invention can be used as antimicrobial agents, particularly useful in the prevention or treatment of infections from gut and respiratory pathogens, such as various bacterial and viral infections, and can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby they are combined in admixture with a pharmaceutically acceptable carrier. Suitable carriers and their formulations are described in Remington's Pharmaceutical Sciences. 16th ed., 1980, Mack Publishing Co., edited by Oslo et al. These compositions will typically contain the GlyCAM 1 variant in an amount effective to prevent or treat a microbial infection. Effective amounts range from on the order of about 0.01 μg/ml to about 10 mg/ml, more preferably from about 0.1 μg/ml to about 1 mg/ml, together with a suitable amount of carrier to prepare pharmaceutically acceptable compositions suitable for effective administration to me patient. The GlyCAM 1 variant may be administered parenterally or by other methods that ensure its delivery to the bloodstream in an effective form. Compositions particularly well suited for the clinical administration of the GlyCAM 1 variants used to practice this invention include sterile aqueous solutions or sterile hydratable powders such as lyophilized protein. Typically, an appropriate amount of a pharmaceutically acceptable salt is also used in the formulation to render the formulation isotonic.

The native mammary GlyCAM 1 variants are believed to function as naturally occurring antibiotics that prevent respiratory and/or gastrointestinal pathogenesis in immunologically native offspring. The mammary GlyCAM 1 variants are particularly useful against rotaviruses, which are gut pathogens that elicit diarrhea in infants. Accordingly, they can be conveniently incorporated in infant formulas. Further typical viral infections that can be prevented or treated in accordance with the present invention are active or latent infections by DNA viruses, single stranded RNA or double stranded RNA viruses, including, without limitation, rotaviruses and respiratory syncytial viruses.

The effective dose will, of course, vary depending on various factors such as, the nature of the padiogen, the general condition of the patient, the time of intervention, etc. The determination of the effective dose for a specific situation is well within the skill of an ordinary physician. In general, the effective dose is between about 0.0001 and 10 mg/kg, more preferably between about 0.001 and 1 mg/kg, even more preferably between about 0.01 and 1 mg/kg, most preferably between about 0.01 and

0.01 mg/kg.

E. Isolation of GlyCAM 1 L selectin Ligands

The mammary GlyCAM 1 variants of the present invention are useful for the isolation of GlyCAM 1 L selectin ligands from various mammalian species. The high degree of sequence conservation between human and murine L selectins, together with in vitro and in vivo data that suggest conservation in the adhesion of human and murine lymphocytes to PLN HEV (Stoolman. L.M. et al.. Blood 70:1842-1850 [1987]), suggest that similar types of carbohydrate recognition mechanisms are utilized in a wide diversity of species. However, failed attempts to obtain homologous cDNA clones from bovine and human PLN libraries, and failure to demonstrate cross-hybridization to die genomic DNA from a number of species using both rat and murine GlyCAM 1 clones, suggest that other organisms do not have highly conserved homologues of GlyCAM 1. As it is believed that the endothelial and mammary forms of GlyCAM 1 in a given animal species have essentially the same amino acid sequence, mammary GlyCAM 1 variants provide a convenient tool for isolating endothelial GlyCAM 1 L selectin ligands. In particular, monoclonal antibodies cross-reacting with a native mammary GlyCAM 1 variant and witii endoύielial cells of the same species can be used for the purification of a desired endothelial L selectin ligand. Methods for generating such antibodies are well known in the art (see the references cited hereinbefore), as are methods for isolation and purification of polypeptides taking advantage of specific binding to such antibodies. Further details of die invention are illustrated in the following non-limiting Examples.

Example 1

Expression of a Differentially Glvcosylated Form of GlyCAM 1 by Lactating Mammary Gland Epithelial Cells and its Detection in Milk Materials and Methods RNA Analysis. Total RNA from either mammary tissues at various times during pregnancy and lactation or other organs was purified as previously described (Lasky, L.A., et al. Cell, 69: 927-938 [1992]). Northern blot analysis using equivalent amounts of total RNA from each tissue was performed using a GlyCAM 1 cDNA that was ³²P-labeled using me random priming method. Filters were washed and exposed to X-ray film as previously described (Lasky et al., Cell, supra; Lehrach,H., et al , Biochemistry. 16:4743-4751 [1977]).

In Situ Hybridization Analysis. Mammary tissues from lactating or virgin female mice were sectioned and prepared for in situ hybridization as previously described for PLN tissue. Anti-sense and sense probes were produced using the previously described GlyCAM 1 subclone in pSKII (Stratagene). Sections were processed and exposed as previously described (Lasky et al. , Cell, supra: Melton, D., et al., Nucleic Acids Res. 12: 7035-7056 [1984]).

Immunohistochemistry. Mammary tissues from lactating and virgin mice were dissected out and immersed in buffered 4% parafoπnaldehyde. The tissues were hydrated with a series of ascending ethanol and substituted widi xylol and embedded in paraffin. 3 micron thick paraffin sections were cut and mounted on albumin-coated slides. Deparaffinized sections were rinsed with PBS and dien incubated with PBS/5% normal goat serum. The sections were then stained with die previously described anti- GlyCAM 1 peptide antisera for 1 hr. Sections were washed and then incubated with biotin anti-rabbit- IgG for 30 minutes. The sections were washed and then incubated wiϋi horse radish peroxidase conjugated streptavidin and DAB substrate. The sections were finally counterstained with hematoxylin or methyl green and photographed.

Western Blot Analysis. The whey fraction of murine milk was isolated by centrifugation of either frozen or fresh murine milk (Yolken, R., et al. , J. Clin. Inv. [1992] (in press), and ϋiis fraction was boiled for 5 minutes and centrifuged to remove denatured proteins. Various amounts of the boiled whey fraction were run on 4-20% acrylamide gradient gels after boiling in SDS-mercaptoethanol and transferred to ProBlot membrane electrophoretically (Sambrook, et al. Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press [1989]). The blots were incubated widi a 2% solution of bovine skim milk, and then they were reacted with a 1 : 1000 dilution of anti-peptide antiserum overnight. The blots were washed and then incubated with protein G gold reagent until a signal could be visualized, after which the blots were enhanced widi silver. A GlyCAM 1 IgG fusion protein was produced in transfected 293 cells as previously described for L selectin (Watson, S., et al , J. Cell Biol. 110:2221-2229 [1990]), and purified by protein A sepharose chromatography. Crude quantitation of the amount of GlyCAM 1 in milk was performed by including a known quantity of the recombinant GlyCAM 1 IgG fusion protein on the same blots. In Vitro Labeling in Organ Culture. Mesenteric or peripheral lymph nodes and mammary glands were dissected out of pregnant and virgin animals and labeled in organ culture with Na³⁵SO or ³H serine/threonine as previously described (Imai, Y., et al , J. Cell Biol. 113: 1213-1221 (1991); Imai, Y., et al. , Nature [1992] (in press)). Solubilized proteins were precipitated with either an L selectin IgG (Yolken, R., et al. , supra) chimera or with anti-peptide antisera as previously described (Imai, Y., et al. , J. Cell Biol. , supra: Imai, Y., et al. , Nature, (in press), supra: Lasky, L.A., et al , Cell, supra). The precipitated proteins were run on 4-20% acrylamide gradient gels, treated with Enhance and autoradiographed . Results Expression of GlyCAM 1 mRNA During Pregnancy

During the DNA sequence analysis of the genomic region that encodes murine GlyCAM 1 (Dowbenko, D., et al , J. Biol. Chem. [1993] (in press) Kawamura, K., et al. , J. Biochem. KM : 103-110 [1987]; Satow, H., et al , J. Biochem. 99: 1639-1643 [1986]), a search of the GenBank revealed that this region of the murine genome had been previously isolated and was shown to encode an mRNA that was expressed in mammary glands during pregnancy and lactation but not in virgin mammary glands (Kawamura et al , supra: Satow et al , supra). In order to determine if this mammary gland mRNA encoded GlyCAM 1 , we analyzed die expression of mRNA encoding diis mucin during pregnancy and lactation using the isolated GlyCAM 1 cDNA. As can be seen in Figure 1, the mRNA for GlyCAM 1 does indeed appear to be expressed in a regulated fashion in mammary glands during pregnancy. Panel A illustrates that an extremely high level of GlyCAM 1 mRNA is found in mammary glands from lactating females (day 19 of pregnancy), and that the level of this mRNA is much higher than that found in mesenteric lymph nodes. In addition, this panel shows that the mRNA in mammary glands falls dramatically when pups are removed from the mother ( — 10 days after weaning of pups), suggesting that the regulation of GlyCAM 1 mRNA in mammary glands is similar to other milk proteins in that it requires exogenous stimulation by feeding pups for continued expression (Cowie, A., et al. Hormonal control of lactation, in Monographs on Endocrinology, volume 15, [1980] Springer- Verlag, Berlin, Heidelberg, New York; Hobbs, A., et α/. Richards, D., Kessler, D and Rosen, J. (1977). Complex hormonal regulation of rat casein gene expression. J. Biol. Chem. 257(7): 3596-3605 [1977]; Vonderhaar, B and Ziska, S. Ann. Rev. Physiol., . 51:641-652 [1989]; Whitworth, N. Psychoneuroendocrinology, 13: 171-188 [1988]). Panel B illustrates that the level of GlyCAM 1 mRNA is dramatically increased when compared with the level in virgin mammary glands. In addition, this panel also illustrates that the level of this mRNA in the inguinal lymph nodes adjacent to me lactating mammary glands also increases, although the relative degree of enhanced expression is only a few-fold and is, therefore, far less than that seen for lactating versus virgin mammary glands ( > 100 fold). Panel C illustrates the time course of induction of the expression of GlyCAM 1 mRNA during pregnancy. As has been found for a number of other milk proteins that are regulated by levels of progesterone, prolactin and insulin, the expression of GlyCAM 1 mRNA begins on day 10 of pregnancy, reaches a peak on day 15, and begins to fall slightly until the completion of gestation. These data clearly demonstrate that GlyCAM 1 mRNA is expressed in murine mammary glands in a manner that appears identical to that previously described for milk proteins that are hormonally regulated during pregnancy and lactation. In Situ Hybridization Analysis

Although the expression of GlyCAM 1 during pregnancy and lactation appeared to mimic that seen for the milk proteins that are produced by the mammary secretory epithelial cells, it was possible that the elevated expression of this mucin was in a mammary vascular site analogous to the HEV. Such vascular expression of GlyCAM 1 during lactation might be expected if this L selectin ligand was involved in the trafficking of, for example, IgA-secreting B cells to the mammary glands (Roux, M., et al, J. Exp. Med. 146: 1311-1322 [1977]). In order to examine the anatomical location of GlyCAM 1 mRNA synthesis, in situ hybridization was performed. Previously, we demonstrated that this technique revealed the expression of GlyCAM 1 mRNA in the HEV of peripheral lymph nodes (Lasky, L.A., et al. Cell, supra) Figure 2, however, clearly illustrates that GlyCAM 1 mRNA was expressed in the epithelial cells of the mammary gland during lactation. As can be seen from panel A, strong hybridization of the antisense probe was seen directly over the mammary epithelial cells that produce die milk. In agreement with the Northern blot analysis described above, the virgin mammary glands showed little, if any, specific hybridization over these epithelial cells. Analysis of the sections revealed no obvious hybridization over any of the vascular sites. While these data do not totally rule out the possibility that GlyCAM 1 is expressed in mammary gland vascular sites, they are consistent with the hypothesis that GlyCAM 1 is expressed in a hormonally-dependent manner in the epithelial cells that produce milk proteins. Immunohistochemical Analysis of GlyCAM 1 Expression

The in situ hybridization analysis suggested d at GlyCAM 1 protein may be expressed by the epithelial cells during pregnancy and lactation. A further possibility raised by these findings was that GlyCAM 1 may be found in milk. In order to examine these possibilities, immunohistochemistry was performed using antipeptide antisera specific for GlyCAM 1 (Lasky et al. , Cell, supra) and various mammary gland tissues. As can be seen in Figure 3, immunohistochemical analysis of 17 day pregnant mammary glands and 4 day lactating mammary glands widi these antisera demonstrated that immunoreactive material could be observed in the mammary epithelial cells and in die lumen containing the secreted milk. The 4 day lactating glands revealed a high level of staining directly over the cells and in the lumen, consistent widi the expression of GlyCAM 1 mRNA at this time. The 17 day pregnant sample revealed a high level of staining of the non-milk fat globule (whey) fraction of the lumenal milk, but a somewhat lower level of staining over the cells. In agreement with the Northern blot and in situ analyses, this figure also illustrates that virgin and post weaning mammary glands show no immunoreactive material. Finally, panel H of this figure clearly shows the simultaneous expression of GlyCAM 1 in the epithelial cells and associated lumens of the lactating mammary glands as well as in the HEV cells of the associated inguinal lymph nodes.

In summary, these data demonstrate that GlyCAM 1 protein is expressed by the mammary epithelium during pregnancy and lactation and diat this glycoprotein is secreted into the lumenal milk. Western Blot Analysis of GlyCAM 1 in Milk

Because it demonstrated that most of the lumenal milk GlyCAM 1 was soluble and not associated with the prominent milk fat globules, the immunohistochemical analysis of pregnant and lactating mammary glands widi GlyCAM 1 antisera suggested that the glycoprotein would be found in die soluble whey fraction of milk. Previously, we demonstrated that GlyCAM 1 was resistant to denaturation by organic solvents, such as chloroform methanol, and to boiling (M. Singer-unpublished). We therefore isolated the whey fraction of murine milk by centrifugation and boiled Uiis fraction to eliminate many of the contaminating proteins. The boiled whey fraction was run on SDS acrylamide gels and analyzed by Western blot using the anti-peptide antisera described above. As can be seen from Figure 4, immunoreactive material migrating at —45 kD and -35 kilodaltons could be detected in mis fraction of milk. The 45 kD band is apparently artifactual, since it is not seen with some of the anti-peptide antisera and is occasionally seen with non-immune sera. In addition, the 35 kD band, which is only observed with immune sera, appears to migrate with the same mobility as the GlyCAM 1 band produced in radioactively-labeled mammary gland organ cultures (see below). These data also suggest that, since the native molecular weight of GlyCAM 1 derived from the cDNA sequence is — 14 kD, iere must be a large amount of O-linked carbohydrate on the milk form of the glycoprotein. These data are entirely consistent with the immunohistochemistry data and suggest that a highly glycosylated form of GlyCAM 1 is found in the soluble whey fraction of murine milk. Analysis of Labeled Milk GlyCAM 1 In order to analyze the potential functional differences between the mammary form of GlyCAM 1 and the endothelial form of the mucin, radioactive labeling and immunoprecipitation experiments were performed. Previously, we demonstrated that the HEV form of GlyCAM 1 could be readily labeled with inorganic sulfate in organ culture (Imai et al. , J. Cell Biol. , supra: Nature, supra). We therefore determined if the mammary form of GlyCAM 1 contained this sulfate modification. Figure 5 shows that, while the PLN HEV form of GlyCAM 1 could be readily labeled with sulfate, die peptide antisera directed against GlyCAM 1 could not immunoprecipitate any sulfate labeled material from late pregnancy mammary glands, in spite of the fact that total mammary gland sulfate labeled protein contained a heterogeneous species that appeared to migrate at approximately the same molecular weight as lymph node GlyCAM 1. These results suggest that the sulfate type of sugar modification that the GlyCAM 1 polypeptide backbone undergoes during synthesis in HEV does not occur when the mucin is produced in mammary epithelial cells. This differential glycosylation is supported by other data shown in Figure 5. The sulfate modification of GlyCAM 1 has been previously shown to be an absolute requirement for ligand recognition by L selectin (Imai et al. , Nature, supra; Watson, et al. , J. Cell Biol. , supra) and the prediction was, therefore, that the mammary form of GlyCAM 1 should not react with the previously described L selectin IgG chimera. Figure 5 shows that, while the HEV form of the mucin, when labeled with ³H serine and direonine, reacted in a calcium dependent (ie. carbohydrate directed) manner with the L selectin IgG chimera, the ³H labeled mammary form of GlyCAM 1 could not react with this IgG chimera. These results support the previous data implicating the requirement for sulfate-modified carbohydrates in L selectin ligand recognition of GlyCAM 1 (Imai et al, Nature, supra), and suggest that the mammary form of the mucin is glycosylated differently than the HEV form. Discussion

The foregoing experimental data demonstrate that GlyCAM 1 , a mucin like glycoprotein that was previously demonstrated to be a tissue-specific adhesion ligand for L selectin, is also expressed during pregnancy and lactation in milk. The data also demonstrate that the form of GlyCAM 1 that is expressed in milk appears to have different carbohydrate modifications man the endoύielial form, and diat this mammary form is unable function as a ligand for L selectin. These results are consistent with the possibility that the mammary form of GlyCAM 1 has a function other than cell adhesion, and further support the earlier view that the GlyCAM 1 polypeptide may be a scaffold mat presents diverse carbohydrates for different tissue-specific functions.

Previous work with a genomic DNA clone for a polypeptide, which was erroneously identified as a mouse 26K casein gene, suggested that the regulation of the expression of this protein was under hormonal control during pregnancy (Kawamura et al. , supra; Satow et al. , supra). We have found that backbone of the polypeptide encoded by this "casein gene" was identical widi that of an L selectin ligand, designated Glycam 1, accordingly, we have identified this polypeptide as the mammary form of GlyCAM 1. Previous data have indicated a requirement for continued suckling by pups for the expression of milk proteins regulated by prolactin, insulin and steroids, and we found here that removal of pups from lactating mothers resulted in the down regulation of the expression of the mRNA for GlyCAM 1. In addition, we found that the mRNA for GlyCAM 1 is induced during pregnancy with kinetics that mimic those seen with other milk proteins. These data suggest that the mammary expression of GlyCAM 1 is under hormonal control, and they are supported by the sequence analysis of the GlyCAM 1 genomic fragment. This analysis revealed several potential glucocorticoid receptor binding elements and a number of sequences potentially capable of binding the mammary gland transcription factor, MGF. MGF has been shown to be regulated by hormones during pregnancy, and its expression mirrors the expression of GlyCAM 1 illustrated here. The expression and sequence data are, therefore, consistent with the regulation of GlyCAM 1 by elevated levels of prolactin, insulin and steroids during pregnancy, and with the regulation of the levels of these hormones by neuroendocrine stimulation of the mammary gland by the sucking pups. These data therefore provide an interesting example of differential gene regulation in two different tissues: the HEV of PLN and mammary glands. It will, dierefore, be of great interest to examine the mechanisms by which the GlyCAM 1 gene is regulated in diese two divergent sites.

A second interesting aspect of the work described here is the question of the function of milk GlyCAM 1. The data reported here are consistent with a non-adhesive function for mammary GlyCAM 1, since this form of the mucin lacks the sulfate modification required for L selectin binding and has been shown to not interact with L selectin IgG. A number of possible functions may be performed by milk GlyCAM 1. For example, the protein may function in the gastrointestinal tract of the pup as a lubricant or to protect the lining of these organs (Carraway, K.L. et al. , Glycobiology , 131-138 [1991]; Gum.J.R. Jr. et al, J. Biol. CΛem. , 266:22733-22738 [1991]; Larocca, D. et al , Cancer Res., 50: 5925-5930 [1990]; Larocca, D. et al, Cancer Res. 5J_.: 4994-4998 [1991]; Porchet, N. et al, Am. Rev. Resp.Dis. , 144: S15-S18 [1991]; Sherbloom, A.P. et al , J. Biol. Chem. 255: 12051-12059 [1980]). An argument against this hypothesis is that it might be expected mat large quantities of a mucin might be required for this protective/lubrication function, but low levels of GlyCAM 1 glycoprotein appear to be present in milk, in spite of the very high apparent mRNA levels. Mucins have also been shown to function as adhesive ligands for sperm binding to mammalian eggs (Florman, H. and Wasserman, P., Cell 41: 313- 324 (1985); Wasserman, P., Develop. 108: 1-17 [1990]), but it is unlikely that milk GlyCAM 1 plays any such adhesive function. Instead, it is proposed that the role of GlyCAM 1 is to inhibit the replication of pathogenic organisms in the respiratory and gastrointestinal tracts. Previously published data suggest that the mucins in the high molecular weight mucin complex associated widi the milk fat globules have anti- rotaviral activity at extremely low concentrations ( —0.1 microgram per ml) (Yolken, R. et al, J. Clin. Inv., supra). This inhibition appears to be mediated by carbohydrate side chains, particularly sialic acids, that are attached to these mucins and die mechanism of inhibition appears to be due to competitive blocking of viral binding to me cell surface. The mucin-like structure of GlyCAM 1 is consistent with its function as a naturally occurring anti-infections agent.

In addition to differences in glycosylation, another apparent major difference between HEV GlyCAM 1 and mammary GlyCAM 1 is in their relative degrees of cell association. HEV GlyCAM 1 appears to be associated lumenally with HEVs, a result that is expected in view of its presumed role as an adhesion molecule. The immunohistochemical data described here suggest that mammary GlyCAM 1 is readily secreted into the lumenal milk, and die direct demonstration of this mucin in milk supports this result. Interestingly, low levels of sulfated, active GlyCAM 1 can also be demonstrated to be shed into the circulation in vivo (Brustein, M. et al . J. Exp. Med. 176: 1415-1419 [1992]). The physiological reasons for this vascular shedding are not clear, but one possibility is that GlyCAM 1 must be weakly associated widi the HEV surface to allow for ready extravasation of the recirculating lymphocyte into the lymph node. Because GlyCAM 1 does not have a transmembrane domain or phosphotidyl inositol type linkage, the mechanism by which HEV GlyCAM 1 is bound to the cell surface can only be speculated upon. Various possibilities include association with a transmembrane protein or peripheral insertion into the membrane through the C-terminal amphipathic helix (Finer-Moore, J. and Stroud, R., Proc. Natl. Acad. Sci. USA 8L 155-159 [1984]; Segrest, J.P. et al, Proteins: Struc. Func. Gen. 8: 103-117 [1990]). The results reported here may be interpreted to suggest that, since GlyCAM 1 was forced to evolve for dual functions in the vasculature and in milk, a creative mechanism for HEV surface association was derived to allow the mammary form of the protein to be easily secreted. Of course, this conundrum might have been solved by alternative splicing, but, since the sequence of mammary GlyCAM 1 is identical to HEV GlyCAM 1, diis mechanism is clearly not utilized.

In summary, the data reported here imply that GlyCAM 1 can perform at least two functions: a known function as an adhesive ligand for L selectin in PLN HEV and a not entirely understood function in milk. These data provide the first example to our knowledge of a mucin-like molecule that appears to be utilized as a scaffold for the presentation of tissue-specific carbohydrate residues for functionally different reasons. However, a thro mbospondin-binding non-mucin adhesion molecule, CD36 or PAS IV, is also expressed in a hormonally regulated manner in mammary glands as well as constitutively in a number of endothelial sites as well as in platelets (Greenwalt, D. and Mather, I. J. Cell. Biol. 100: 397- 408 [1985]; Greenwalt, D., et al, Biochem. 29: 7054-7059 [1990]; Greenwalt, D., et al, Blood. 80(5): 1105-1115 [1990]). Example 2

Assay of antimicrobial activity

A. In vitro assay

The GlyCAM 1 variant to be tested is diluted in EMEM containing 0.5-1 μg/ml porcine trypsin and mixed with approximately 100 pfu of the indicated strain of rotavirus. Following adsorption of the virus-GlyCAM 1 variant mixture for one hour at 37 °C, the cell monolayers are washed and covered with an agarose overlay containing 0.5 μg/ml trypsin plus the same concentration of GlyCAM 1 variant as used in the adsorption. After approximately 5 days of incubation at 37°C, a second agarose overlay containing neutral red is added, and plaques are enumerated following visual inspection.

For each concentration of test compound, a percentage inhibition is calculated as 100 x (1-(P /P )) where P is the number of plaques generated in cells infected with virus incubated with the test compound and P is die number of plaques generated in cells infected with virus in the absence of added test compound. The minimum inhibitory concentration (MIC ) is calculated by interpolating the minimum concentration required for the 50% inhibition of plaque generation.

B. In vivo assay A previously developed mouse model of rotavirus gastroenteritis (Yolken, R. et al, J. Clin. Inv.,

79:148-154 [1987]; Yolken, R. et al. , J. Clin. Inv. , [1993] (in press)) can be used to study the effect of GlyCAM 1 variants on the development of experimental rotavirus gastroenteritis. The epizootic diarrhea of infant mice (EDIM) strain of murine rotavirus is purified by ultracentrifugation through CsCl and incubated at a concentration of 10 ID_)op ml with antiviral GlyCAM 1 candidates admixed in milk (test compounds), at a suitable concentration such as 100 μg/ml, or with control preparations. Following incubation for 30 minutes at 37 °C, 100 μl of the test compound/milk-virus mixture is fed to each mouse in individual litters of suckling mice. The animals are observed for the development of diarrhea for 3-5 days following infection. The suckling mice continue to receive milk from their mothers during the course of the study. Control preparations consist of a bovine milk-based infant's formula (Similac, Ross Laboratories) as well as minimum essential media. In order to minimize variations among litters, the suckling mice are pooled and then randomly divided among the dams immediately prior to inoculation. The suckling mice remain with these dams throughout the course of the study. Example 3 Cloning of Rat GlyCAM 1 Experimental Procedures cDNA cloning and sequencing. Poly A mRNA was isolated from rat peripheral and mesenteric lymph nodes as previously described (Lasky et al, Cell 69: 927-938 (1992)) and used to produce a cDNA library in lambda gtlO using the InvitroGen librarian kit. Approximately 50,000 plaques per plate were transferred to nitrocellulose filters and 20 sets of duplicate filters were hybridized with a ³²P labeled cDNA clone encoding murine GlyCAM 1 (Lasky et al , Supra) using 20% formamide, 42°C hybridization conditions (Sambrook et al. Molecular cloning: a laboratory manual, 2nd Ed. Cold Spring Harbor Press [1989]). Filters were washed in 0.5 X SSC, 0.1 % SDS at 55°C for 2x 30 minutes, dried and autoradiographed. Duplicate positives were plaque purified, and the cDNA was isolated by EcoRl digestion and was subcloned into EcoRl digested pSKII vector (Stratagene). The entire nucleotide sequence of both strands of the largest cDNA insert was determined using dideoxynucleotide supercoil sequencing.

Immunoprecipitation of sulfate labeled rat lymph node proteins. Mesenteric and/or peripheral lymph nodes were dissected from rats and labeled in organ culture with Na³⁵SO as previously described (Imai. Y. et al, J. Cell Biol 113: 1213-1221 [1991]). Conditioned media were immunoprecipitated with ei er the previously described murine L selectin IgG chimera (Watson, S. et al, J. Cell Biol. 110: 2221-2229 [1990]) or with the previously described anti GlyCAM 1 peptide antiserum (Lasky et al , Supra). The peptide antiserum used was directed against residues 60-73 of murine GlyCAM 1. Immunoprecipitates were run on 4-20% acrylamide gradient SDS gels and visualized by autoradiography. Results

A southern blot analysis of genomic DNA from various species revealed tiiat only rat DNA appeared to contain a sequence that hybridized specifically with the murine GlyCAM 1 cDNA under reduced stringency. In order to characterize this rat homologue, a cDNA library was constructed from rat lymph node poly A RNA and was screened with the murine GlyCAM 1 cDNA (Lasky et al. , Supra) using reduced stringency of hybridization conditions (see experimental procedures). A number of duplicate positive clones were plaque purified, and die nucleotide sequence of the longest cDNA clone was determined and is shown in Figure 6. This cDNA encoded a 146 amino acid protein that was 5 amino acids shorter than murine GlyCAM 1. The N terminus of the protein appeared to encode a signal sequence that was rich in hydrophobic amino acids. Assuming the N terminus of this protein was identical to diat previously described for murine GlyCAM 1 (Lasky et al, Supra), the mature rat protein contained —26 percent serine and threonine residues, in agreement with the enriched level of these residues previously found for murine GlyCAM 1. In addition to the high overall level of serine and direonine, many of these residues were found to occur in clusters of 2,3 or 4. As with the murine cDNA, the initiator methionine codon was surrounded by a consensus Kozak translational start site (Kozak, M. J. Cell Biol. 1_15: 887-903 (1991)), and a polyadenylation signal was found upstream of the poly A (both boxed in Figure 7).

Hydropathy analysis (Figure 8) revealed diat the overall hydrophobicity profile was conserved between the murine and rat forms of GlyCAM 1. Thus, both rat and murine GlyCAM 1 demonstrated a highly hydrophobic N terminal signal sequence that was followed by a predominantly hydrophilic protein. In addition, this analysis of rat GlyCAM 1 revealed that many of the potentially O-glycosylated serines and direonines were clustered into two domains, as was previously found for murine GlyCAM 1. Domain 1 (residues 40-59) contained -50% serine and threonine residues and corresponded to O-linked region 1 of murine GlyCAM 1, while domain 2 (residues 77-115) contained -37% serine and threonine residues and corresponded to O-linked region II of the murine mucin. As was previously found for murine GlyCAM 1 , the rat homologue did not contain a highly hydrophobic transmembrane domain at its C terminus, but did contain a moderately hydrophobic region at this site.

The direct sequence comparisons of murine and rat GlyCAM 1 (Figure 9) revealed a number of interesting findings. The proteins show a high degree of sequence conservation with -70 percent of the residues being identical. Many domains of the protein are more highly conserved than others. For example, the N-terminal signal sequence was almost completely conserved between d ese two species, consistent with a potential function for this domain in addition to its role in protein secretion (see below). The serine/threonine rich domain corresponding to O-linked region 1 is also conserved ( - 68 % identity) and is more highly conserved dian the region corresponding to the second O-linked domain ( - 53 % identity). Interestingly, the 5 amino acids mat are absent from rat GlyCAM 1 are found clustered in the second O-linked domain of murine GlyCAM 1 and contain 3 potential O-glycosylation sites. These data suggest iat the first O-linked domain may be of greater functional significance than the second. Another important aspect of this comparative analysis is seen when the relative positions of the various potentially O-glycosylated serines and direonines are examined. As can be seen in Figure 9, the spacing of most of these potential carbohydrate acceptor sites is conserved in O-linked domain 1 , while diis conservation is only partially observed in the second serine/threonine rich domain, in great part due to die 5 amino acid deletion. Finally, the potential N linked site (N at position 115) in murine GlyCAM 1 is not conserved in the rat homologue, suggesting that this potential glycosylation site may not be functionally important. A potential amphipathic helix at the C terminus of murine GlyCAM 1 was previously hypothesized to be involved in me association of this glycoprotein with the cell surface (Lasky et al, Supra, Eisenberg, D. et al, J. Mol. Biol. 179: 125-142 [1984]). An analysis of the amphipathic potential of this domain (Figure 10) demonstrated that this region of rat GlyCAM 1 could also form an amphipathic helix. The conservation of this potential amphipathic helix is explained by a combination of identical amino acids in diis region together with a number of conservative substitutions.

The sequencing data described above suggested diat rat lymph nodes contained a homologue of murine GlyCAM 1. In order to examine the potential functional aspects of this homologue, the synthesis of this protein in organ culture was analyzed. The labeling of cell associated and shed murine GlyCAM 1 in organ culture using Na ³⁵S0₄ was previously described (Imai, Y. et al, Supra. Lasky et al, Supra). Rat peripheral and mesenteric lymph nodes were excised and labeled with inorganic sulfate in organ culture, and the conditioned media from these cells was analyzed with the previously described L selectin IgG chimera and widi anti murine GlyCAM 1 peptide antisera that was directed against residues 60-73. As can be seen from Figure 11, total sulfate labeled conditioned medium from rat lymph nodes contained a predominant, heterogeneously migrating band of —45 kD molecular weight. Immunoprecipitation of conditioned medium widi the anti murine GlyCAM 1 anti peptide antiserum revealed diat this sulfate- labeled rat material contained an epitope that was similar to that found in murine GlyCAM 1. In addition, this figure also illustrates that the murine L selectin IgG chimera could precipitate this sulfate labeled material, and iat this interaction was dependent upon calcium, consistent with the recognition of the sulfate labeled rat glycoprotein by the calcium dependent (type C) lectin domain of L selectin (Imai, Y. et al, Supra). These data demonstrate that the — 45 kD sulfate labeled glycoprotein produced by rat lymph nodes appears to correspond to the homologue of murine GlyCAM 1 , and diat diis homologue can function as an apparently carbohydrate dependent ligand for L selectin.

SEQUENCE LISTING

(1) GENERAL INFORMATION: (i) APPLICANT: GENENTECH, INC.

(ii) TITLE OF INVENTION: GLYCAM- 1 VARIANTS

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Genentech, Inc.

(B) STREET: 460 Point San Bruno Blvd

(C) CITY: South San Francisco (D) STATE: California

(E) COUNTRY: USA

(F) ZIP: 94080

(v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: 5.25 inch, 360 Kb floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: patin (Genentech) (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Dreger, Ginger R.

(B) REGISTRATION NUMBER: 33,055

(C) REFERENCE/DOCKET NUMBER: 813PCT

(ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 415/225-3216

(B) TELEFAX: 415/952-9881

(C) TELEX: 910/371-7168

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 609 bases

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single (D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

CTGACCTTGT TCCAGTGCCA CCATGAAATT CTTCACTGTC CTGCTATTTG 50

TCAGTCTTGC TGCCACCTCT CTTGCTCTCC TGCCTGGGTC CAAAGATGAA 100 CTTCAAATGA AGACTCAGCC CACAGATGCC ATTCCAGCTG CCCAGTCCAC 150

TCCCACCAGC TACACCAGTG AGGAGAGTAC TTCCAGTAAG GACCTTTCCA 200

AGGAGCCTTC CATCTTCAGA GAAGAGCTGA TTTCCAAAGA TAATGTGGTG 250

ATAGAATCTACCAAGCCAGAGAATCAAGAGGCCCAGGATGGGCTCAGGAG300

CGGGTCATCTCAGCTGGAAGAGACCACAAGACCCACCACCTCAGCTGCAA350

CCACCTCAGA GGAAAATCTG ACCAAGTCAA GCCAGACAGT GGAGGAAGAA 400

CTGGGTAAAA TAATTGAAGG ATTTGTAACT GGTGCAGAAG ACATAATCTC 450

TGGTGCCAGT CGTATCACGA AGTCATGAAG ACAAAAACAC CTAACCACTA 500

AGTCCCATGC TAGGTGGTGC CTTCATCAGC CACATTCTGC TCATCTGACC 550

ACCACCTCTC AGTCTGCCCT TTGATGTCTT ACATTAAAGT ATTGCAACCT 600

AAAAAAAAA 609

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 585 bases (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

CTGACCTGTT CCAGTGCCAC CATGAAATTC TTCACTGTCC TGCTATTTGC 50

CAGCCTTGCT GCCACCTCTC TTGCTGCCGT GCCTGGGTCC AAAGATGAAC 100

TCCACCTGAG GACTCAGCCC ACAGATGCCA TTCCAGCTTC CCAGTTCACT 150

CCTTCCAGCC ACATCAGCAA GGAGAGCACT TCCAGTAAGG ACCTTTCCAA 200 GGAGTCTTTC ATCTTCAACG AAGAGCTGGT GTCCGAAGAT AATGTGGGGA 250

CAGAATCTAC CAAACCACAG AGTCAAGAGG CCCAGGACGG GCTCAGGAGT 300

GGGTCATCTC AGCAGGAAGA GACCACCTCA GCTGCAACCT CAGAGGGAAA 350

ACTGACCATG CTGAGCCAGG CAGTGCAGAA AGAACTGGGT AAAGTAATTG 400

AAGGATTTAT AAGTGGTGTG GAAGACATAA TCTCTGGTGC CAGTGGTACC 450

GTGAGGCCCT GAAGACAAAA ACGCCTAACC GCTAAGTCCC ACGCTAGGTG 500

GCGCCTTCAT CACCCACATT CTGCTCATCT GACCACCACC TCTTGGTCTG 550

CCCTTTGATG TCTTACATTA AAGTAGCTGC AACCG 585

Claims

Claims:

1. An isolated glycosylation dependent cell adhesion molecule (GlyCAM 1) variant which a) is a native mammary GlyCAM 1 ; or b) is greater than about 60% homologous with a native mammary GlyCAM 1; or c) is able to hybridize under low stringency conditions to a native mammary GlyCAM 1 ; said variant being unable to function as a ligand for native L selectin, and having antimicrobial activity.

2. The GlyCAM 1 variant of claim 1 wherein the homology is greater than about 70% .

3. The GlyCAM 1 variant of claim 2 wherein the homology is greater than about 80 % .

4. The GlyCAM 1 variant of claim 3 wherein the homology is greater than about 90% .

5. The GlyCAM 1 variant of claim 4 having the amino acid sequence of a native mammary

GlyCAM 1 variant.

6. The GlyCAM 1 variant of claim 7 having a polypeptide backbone that has the same amino acid sequence as die polypeptide backbone of an endothelial GlyCAM 1 L selectin ligand of the same animal species.

7. The GlyCAM 1 variant of claim 6 having essentially the same carbohydrate structure as a native mammary GlyCAM 1.

8. The GlyCAM 1 variant of claim 1 encoded by nucleic acid able to hybridize under low stringency conditions to the complement of nucleic acid having the sequence between nucleotide positions

23 and 475, inclusive of the nucleotide sequence shown in Figure 6 (SEQ. ID. No.: 1).

9. The GlyCAM 1 variant of claim 1 encoded by nucleic acid able to hybridize under low stringency conditions to die complement of nucleic acid having the sequence between nucleotide positions

22 and 459, inclusive of the nucleotide sequence shown in Figure 7 (SEQ. ID. No.: 1).

10. The GlyCAM 1 variant of claim 1 comprising a C terminal amphipathic helix tertiary structure.

11. The GlyCAM 1 variant of claim 10 comprising a signal sequence rich in hydrophobic amino acids.

12. The GlyCAM 1 variant of claim 11 comprising the signal sequence of a native endothelial GlyCAM 1 L selectin ligand.

13. The GlyCAM 1 variant of claim 12 comprising at least two serine and tiireonine rich domains.

14. The GlyCAM 1 variant of claim 1 devoid of sulfation required for L-selectin binding.

15. The GlyCAM 1 variant of claim 1 having a carbohydrate structure different from that of a naturally occurring ligand of L-selectin.

16. The GlyCAM 1 variant of claim 1 effective against respiratory or gastrointestinal pathogens.

17. The GlyCAM 1 variant of claim 16 having antiviral activity.

18. The GlyCAM 1 variant of claim 17 having antirotaviral activity.

19. The GlyCAM 1 variant of claim 1 as synthesized in die mammary gland of a mammalian species.

20. The GlyCAM 1 variant of claim 1 as isolated from milk of a mammalian species.

21. The GlyCAM 1 variant of claim 20 wherein said milk is murine.

22. The GlyCAM 1 variant of claim 20 encoded by nucleic acid having the sequence between nucleotide positions 23 and 475, inclusive shown in Figure 6 (SEQ. ID. No.: 1).

23. The GlyCAM 1 variant of claim 20 wherein said milk is that of the rat.

24. The GlyCAM 1 variant of claim 23 encoded by nucleic acid having the sequence between nucleotide positions 22 and 459, inclusive shown in Figure 7 (SEQ. ID. No.: 2).

25. A composition comprising an antimicrobially effective amount of a GlyCAM 1 variant which a) is a native mammary GlyCAM 1; or b) is greater than about 60% homologous wi i a native mammary GlyCAM 1; or c) is able to hybridize under low stringency conditions to a native mammary GlyCAM 1 ; said variant being unable to function as a ligand for native L selectin, and having antimicrobial activity .

26. The composition of claim 25 further comprising a pharmaceutically acceptable carrier.

27. The composition of claim 26 which is an infant formula.

28. A method of treating a microbial infection which comprises administering to a patient having developed or at risk of developing microbial infection an effective amount of a GlyCAM 1 variant which a) is a native mammary GlyCAM 1 ; or b) is greater than about 60% homologous with a native mammary GlyCAM 1 ; or c) is able to hybridize under low stringency conditions to a native mammary GlyCAM 1 ; said variant being unable to function as a ligand for native L selectin, and having antimicrobial activity.

29. The method of claim 28 wherein said microbial infection is viral infection.

30. The method of claim 28 wherein said patient is an infant.

31. The method of claim 20 wherein said patient is human.

32. The method of claim 30 wherein said GlyCAM 1 variant is administered prior to infection.

33. The method of claim 32 wherein said GlyCAM 1 variant is administered in an infant formula.