WO1994017820A1 - Polypeptides pouvant etre obtenus a partir d'especes de fasciola, et vaccins, procedes de traitement, et sequences d'adn de ces polypeptides - Google Patents

Polypeptides pouvant etre obtenus a partir d'especes de fasciola, et vaccins, procedes de traitement, et sequences d'adn de ces polypeptides Download PDF

Info

Publication number
WO1994017820A1
WO1994017820A1 PCT/AU1994/000051 AU9400051W WO9417820A1 WO 1994017820 A1 WO1994017820 A1 WO 1994017820A1 AU 9400051 W AU9400051 W AU 9400051W WO 9417820 A1 WO9417820 A1 WO 9417820A1
Authority
WO
WIPO (PCT)
Prior art keywords
gly
ser
glu
fasciola
ala
Prior art date
Application number
PCT/AU1994/000051
Other languages
English (en)
Inventor
Andrew Richard Milner
Michel Panaccio
Terence William Spithill
Gene Louise Wijffels
Original Assignee
Daratech Pty. Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Daratech Pty. Ltd. filed Critical Daratech Pty. Ltd.
Priority to AU59962/94A priority Critical patent/AU5996294A/en
Priority to JP6517444A priority patent/JPH07505787A/ja
Priority to EP94906095A priority patent/EP0647138A4/fr
Priority to BR9404004A priority patent/BR9404004A/pt
Priority to NO942360A priority patent/NO942360L/no
Publication of WO1994017820A1 publication Critical patent/WO1994017820A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6402—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
    • C12N9/6405—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
    • C12N9/641—Cysteine endopeptidases (3.4.22)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/10—Anthelmintics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates generally to a vaccine and more particularly to a vaccine useful in reducing spread of the liver fluke parasite and to polypeptides useful for same.
  • the present invention also relates to a method of reducing spread of infection of liver fluke.
  • Helminths such as trematode parasites are a major cause of economic loss in domestic animals as well as causing serious disease in humans (Haroun and Hillyer, 1986).
  • the major trematodes of economic or public health importance are Fasciola hepatica, Fasciola gigantica, Fasciola magna, Schistosoma bovis, Schistosoma matthei, Schistosoma mansoni, Schistosoma haematobium, Schistosoma japonicum, Paramphistomum microbothium, Gigantocotyle explanatum, Dicrocoelium dendnticum, Eurytremapancr aticum,Paragonimuswestermani, Clonorchis sinensisand Opisthorchis viverrini (Spithill, 1992).
  • Fascioliasis is caused by infection with the trematode parasite Fasciola hepatica This infection is of particular economic importance to industries involving ruminant animals such as sheep and cattle where fascioliasis causes wasting, death and reduced wool and egg production (Haroun and Hillyer, 1986).
  • a vaccine that reduced parasite egg production would lead to reduced transmission from one infected host to other hosts and, in the case of Schistosoma spp., reduce human disease.
  • there are currently no defined vaccines for prevention of any fluke infection (Spithill, 1992; McManus et al, 1993) and, in particular, which target worm fecundity.
  • one aspect of the present invention contemplates a peptide and in particular an isolated polypeptide comprising a sequence of amino acid residues wherein said sequence includes, in a contiguous sequence, amino acid residues: Gln-Xaa-Xaa-Xaa-Xaa 1 -Xaa-Cys-Trp-Xaa-Xaa-Xaa 2 (SEQ ID NO. 23) wherein Xaa is any amino acid residue; Xaa j is Gly or Glu; and Xaa 2 is Ser, Thr, Ala or Gly; said polypeptide further characterised by its ability to induce an immune response in a host against a helminth.
  • the helminth is a trematode.
  • the trematode is a species of Fasciola such as but not limited to F. hepatica, F. gigantica or F. magna. The most preferred species is F. hepatica.
  • the Fasciola species may be in the mature state or in the newly excysted larval stage.
  • the present invention is particularly directed to a polypeptide capable of inducing an immune response in a host which results in reduced worm viability and/ or fecal egg counts.
  • the polypeptide is a cathepsin protease, cathepsin protease-like polypeptide or a polypeptide having cathepsin protease-like properties.
  • a cathepsin protease or like polypeptide is characterised inter alia by an active site defined by conserved residues at three regions in the molecule.
  • the cathepsin protease maybe in mature form or in a precursor form.
  • the cathepsins consist of a family of sequences termed cathepsin B, H, L, S and G which vary in their degree of overall sequence identity.
  • the host is a mammal.
  • the mammal is a livestock animal such as but not limited to ovine or bovine species.
  • the immune response is a protective immune response against worm fecundity.
  • another aspect of the present invention contemplates a peptide cr polypeptide derived from or comprising a cathepsin protease isolatable from a Fasciola species and capable of stimulating antibody production in a suitable host against a cathepsin protease from Fasciola hepatica.
  • the antibody response results in reduced worm viability and/or fecal egg counts.
  • the polypeptide of the present invention is conveniently a cathepsin protease isolatable from a species of Fasciola selected from F. hepatica, F. gigantica and F. magna and most preferably F. hepatica or a part, fragment or derivative thereof or is a fusion molecule comprising a said cathepsin protease or a part, fragment or derivative thereof and which polypeptide is capable of stimulating antibody production in a suitable host against a Fasciola species cathepsin protease.
  • Such fusion molecules may comprise fusions of two or more of the same or different cathepsin proteases or parts, fragments or derivatives thereof, or fusions of one or more cathepsin proteases or parts, fragments or derivatives thereof with another protective molecule, such as, but not limited to, glutathione-S-transferase (GST) of E_--h- ⁇ --J-ica,
  • GST glutathione-S-transferase
  • the polypeptide may be isolated from immature (e.g. newly excysted larval stage) or mature Fasciola species although the mature organism is the preferred source.
  • F. hepatica should be considered to include all species of Fasciola (e.g. F. gigantica, F. magn ⁇ ).
  • polypeptide is used in its broadest sense and for convenience includes peptides, polypeptides, proteins, glycoproteins and fusion molecules.
  • the polypeptide is generally in isolated form or recombinant or synthetic form. When in isolated form, the polypeptide has undergone at least one purification or isolation step.
  • the isolated molecule is in a form suitable for use in a vaccine and/or represents at least 5%, preferably at least 20%, more preferably at least 35%, still more preferably at least 55-60%, even more preferably at least 75- 80% or yet even more preferably at least 90-100% of a composition relative to other components.
  • the percentage content is conveniently measured by, for example, weight, activity, antibody reactivity or other like means.
  • the present invention extends to non-naturally occurring (i.e. synthetic) derivative of the subject polypeptides including derivatives which incorporate non-naturall occurring amino acid residues or chemical equivalent, homologues or analogues o naturally occurring amino acid residues.
  • the polypeptide has at least one proline residue modified to a 3-hydrox or 4-hydroxyproline. More preferably, the proline residue is 3-hydroxy proline.
  • the polypeptide is a mature size cathepsin protease, it has molecular weight determined following SDS-PAGE of about 25-30 kDa and mor preferably about 26-28 kDa. However, the molecular weight may vary depending o whether the polypeptide is a precursor cathepsin protease or a part, fragment o derivative thereof.
  • the peptide or polypeptide according to this aspect of the invention may be use inter alia as an active immunogen in a liver fluke vaccine.
  • the cathepsin proteas useful in the vaccine may be a single molecule (including a fusion molecule) or ma comprise a mixture of cathepsin proteases. Where there is a mixture of protease isolated from Fasciola species (eg F. hepatica, F. gigantica or F. magna), or isolate from other helminths (e.g.
  • trematodes preferably at least one of said protease contains a hydroxylated proline residue but more preferably about 10-20% and eve more preferably about 20% of the cathepsin proteases carry at least on hydroxylated proline residue.
  • Reference hereinafter to "Fasciola” species include reference to helminths in general such as trematodes and which contain the nove proteases of the present invention.
  • the vaccine comprises a single cathepsi protease isolated from a Fasciola species or a fusion molecule thereof, the preferably at least one and more preferably at least 10-20% of the proline residue are hydroxylated at the 3 or 4 position, or even more preferably at the 3 positio
  • the vaccine may comprise an immunogenic fragment of a cathepsi protease separately or a fusion molecule between two or more such immunogeni fragments.
  • such an immunogenic fragment or fusion molecule may b fused to another protective moleucle, such as GST.
  • the cathepsin protease may be synthesised by recombinant means in which case there may or may not be hydroxylation of proline residues.
  • the vaccine comprises at least one recombinant cathepsin protease which may or may not carry a hydroxylated proline residue.
  • the recombinant cathepsin protease may have an amino acid sequence substantially identical to the naturally occurring sequence or may contain one or more amino acid substitutions, deletions and/or additions thereto provided that following such alterations to the sequence, the molecule is still capable of eliciting an immune response against the naturally occurring cathepsin protease from a species o Fasciola, such as F. hepatica, F. gigantica or F. magna. Such an immune response preferably results in reduced worm viability and/ or reduced egg counts.
  • a similar immunogenic requirement is necessary for any fragments or derivatives of the cathepsin protease whether made from the recombinant molecule or the naturall occurring molecule.
  • cathepsin protease is considered reference to the naturally occurring molecule, its recombinant form and any mutants, derivatives, fragments, homologues or analogues thereof provided that such molecules elicit an immune response against the naturally occurring molecule from a species of Fasciola such as F. hepatica.
  • the term "cathepsin protease” also extends to a fusion molecule between two or more cathepsin proteases or with other similar molecules related by amino acid sequences, as well as to fusion molecules with other protective molecules such as GST.
  • the polypeptide for a Fasciola vaccine has an amino acid sequence substantially as set forth in SEQ ID NO. 2 ( Figure 9A) or SEQ ID NO. 12 ( Figure 9B) or SEQ ID NO. 24 ( Figure 12) or an N-terminal sequence as set forth in SEQ ID NO. 21 or SEQ ID NO. 22 or having at least 40%, preferably at least 50%, more preferably at least 60%, still more preferably at least 70-80% and even still more preferably at least 90% similarity to the amino acid sequence or to a region or part of the amino acid sequence provided the polypeptide can stimulate antibodies to a cathepsin protease from a species of Fasciola such as F. hepatica.
  • the antibodies reduce worm viability and/or reduce fecal egg counts.
  • another aspect of the present invention provides a polypeptide which: (i) is a cathepsin protease or like molecule; (ii) is isolatable from Fasciola species; and
  • (iii) comprises an amino acid sequence having at least 40% amino acid sequence identity to all or part of the amino acid sequence set forth in SEQ ID NO. 2,
  • polypeptide which: (i) is a cathepsin protease or like molecule; (ii) is isolatable from Fasciola species; and
  • (iii) comprises an amino acid sequence having at least 40% amino acid sequence identity to all or part of an N-terminal amino acid sequence as set forth in
  • the helminth is a trematode as hereinbefore described and is most preferably a species of Fasciola such as F. hepatica or F. gigantica.
  • a "part" is at least five and more preferably at least ten contiguous, amino acid residues.
  • the Fasciola species is F. hepatica.
  • the Fasciola species is in its mature form although the present invention extends to cathepsin proteases from a newly excysted larval stage parasite.
  • the present invention extends to any related polypeptides having cathepsin protease-like properties such as those in the cathepsin family of proteases from other animal or plant cells which are capable of eliciting the appropriate immune response against a naturally occurring cathepsin protease from Fasciola.
  • the present invention also extends to cDNA encoding the polypeptide of the present invention and preferably having a nucleotide sequence as set forth in SEQ ID NO.
  • nucleic acid molecule comprising a sequence of nucleotides which: (i) encodes a cathepsin protease; (ii) is isolatable from a helminth species; and (iii) hybridises under low stringency conditions to all or part of the nucleic acid sequence set forth in SEQ ID NO. 1 or 11 or to a complementary form thereof.
  • the helminth is preferably a trematode and more preferably a species of Fasciola such as but not limited to F. hepatica, F. gigantica or F. magna.
  • the nucleic acid molecule may be RNA or DNA, single stranded or double stranded, in linear or covalently closed circular form.
  • level of stringency reference can conveniently be made to Sambrook et al (1989) at pp 387-389 which is herein incorporated by reference where the washing step at paragraph 11 is considered high stringency.
  • a low stringency is defined herein as being in 0.1-0.5 w/v SDS at 37-45 °C for 2-3 hours.
  • conditions of stringency may be employed such as medium stringent conditions which are considered herein to be 0.25-0.5% w/v SDS at ⁇ 45 °C for 2-3 hours or high stringent conditions as disclosed by Sambrook et al (1989).
  • the Fasciola species is F. hepatica.
  • the Fasciola species is a mature organism although the present invention extends to Fasciola organisms in the newly excysted larval stage.
  • the present invention further extends to a composition of matter comprising recombinant and non-recombinant forms of the cathepsin proteases of the present invention including their fragments, derivatives and the like.
  • the present invention is predicated, in part, on the discovery that vaccination o animals with a preparation of one or more cathepsin proteases leads to a reductio in fecal egg counts resulting in a significant decrease in worm fecundity. There is also a reduction in egg viability. This has the result of reducing desert contamination and thereby reducing spread of infection of the parasite since less viable eggs are shed by the animal into the environment.
  • the present invention extends to any animal capable of being infected by or carrying the parasite and is particularly directed to ruminant animals such as sheep and cattle.
  • a method for reducing spread of a helminth parasite comprising administering to an animal susceptible to infection with said parasite an effective amount of a polypeptide derived from or comprising a cathepsin protease isolatable from a helminth for a time and under conditions sufficient for the animal to develop antibodies to said cathepsin protease.
  • the helminth is a trematode and is more preferably a species of Fasciola such as F. hepatica, F. gigantica or F. magna
  • the species of Fasciola is most preferably in the mature state.
  • the polypeptide is preferably a cathepsin protease as hereinbefore described and may or may not have at least one hydroxylated proline residue.
  • the vaccine may be a mixture of purified or partially purified cathepsin proteases including a product extracted, excreted, secreted or otherwise released from the helminth. Such a product is termed herein to "regurgitate" from the parasitic worm.
  • regurgitate from the parasitic worm.
  • the cathepsin protease(s) may be administered by any convenient route such as b oral, intravenous, subcutaneous, intradermal, intramuscular, intraperitoneal suppository or intranasal administration.
  • the present invention therefore, provides a vaccine composition comprising an immunogenic effective amount of one or more cathepsin proteases as hereinbefore described and one or more carriers and /or diluents acceptable for veterinary use.
  • the active ingredients of the vaccine composition comprising one or more cathepsin proteases or active immunogenic fragments thereof are contemplated to exhibit excellent activity in stimulating antibodies in the target animal when administered in an amount which depends on the particular case.
  • the variation depends, for example, on the animal and the cathepsin protease.
  • from about 0.5 ug to about 20 mg, preferably from about 0.5 ⁇ g to about 10 mg and even more preferably from about 1 ⁇ g to about 1 mg of cathepsin protease or combined total of cathepsin proteases per animal per dose may be administered. Dosage periods may be adjusted to provide the optimum therapeutic response.
  • the active compound may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intramuscular, subcutaneous, intranasal, intradermal or suppository routes or implanting (eg using controlled release molecules).
  • the active ingredients which comprise one or more cathepsin proteases may be required to be coated in a material to protect said ingredients from the action of enzymes, acids and other natural conditions which may inactivate said ingredients.
  • the low lipophilicity of the cathepsin protease will allow it to be destroyed in the gastrointestinal tract by enzymes capable of cleaving peptide bonds and in the stomach by acid hydrolysis.
  • the cathepsin protease will be coated by, or administered with, a material to prevent its inactivation.
  • the cathepsin protease may be administered in an adjuvant, co-administered with enzyme inhibitors or in liposomes.
  • Adjuvant is used in its broadest sense and includes any immune stimulating compound such as interferon or other cytokines.
  • Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and n-hexadecyl polyethylene ether. Conveniently, the adjuvant is Freund's Complete or Incomplete Adjuvant.
  • Enzyme inhibitors include pancreatic trypsin inhibitor diisopropylfluorophosphate (DEP) and trasylol.
  • Liposomes include water-in-oil-in water CGF emulsions as well as conventional liposomes.
  • the active compounds may also be administered in dispersions prepared in glycerol liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinar conditions of storage and use, these preparations contain a preservative to preven the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueou solutions (where water soluble) or dispersions and sterile powders for th extemporaneous preparation of sterile injectable solutions or dispersion.
  • the form must be sterile and must be fluid to the extent that easy syringability exists It must be stable under the conditions of manufacture and storage and must b preserved against the contaminating action of microorganisms such as bacteria an fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liqui polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersio and by the use of surfactants.
  • the prevention of the action of microorganisms ca be brought about by various antibacterial and antifungal agents, for example parabens, chlorobutanol, phenol, sorbic acid, thormerosal, and the like. In man cases, it will be preferable to include isotonic agents, for example, sugars or sodiu chloride. Prolonged absorption of the injectable compositions can be brought abou by the use in the compositions of agents delaying absorption, for example.
  • Sterile injectable solutions are prepared by incorporating the active compounds i the required amount in the appropriate solvent with various of the other ingredient enumerated above, as required, followed by filtered sterilization.
  • Generally dispersions are prepared by incorporating the various sterilized active ingredient(s into a sterile vehicle which contains the basic dispersion medium and the require other ingredients from, those enumerated above.
  • the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile- filtered solution thereof.
  • the vaccine may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsule, or it may be compressed into tablets, or it may be incorporated directly with the food of .the diet.
  • the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of active compound.
  • compositions and preparations may, of course, be varied and may conveniently be between about 5 to about 80% of the weight of the unit.
  • the amount of active compound in the vaccine compositions is such that a suitable dosage will be obtained.
  • Preferred compositions or preparations according to the present invention are prepared,so that an oral dosage unit form contains between about 0.5 ug and 20 mg of active compound.
  • the tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum gragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such a sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavouring.
  • a binder such as gum gragacanth, acacia, corn starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin may be added or a flavoring agent such as peppermint
  • tablets, pills, or capsules may be coated with shellac, sugar or both.
  • a syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor.
  • an material used in preparing any dosage unit form should be pharmaceutically pur and substantially non-toxic in the amounts employed.
  • the activ compound maybe incorporated into sustained-release preparations and formulations
  • the vaccine is administrable with the animal feed, such as grain. Th vaccine composition may be incorporated into a grain base or may be topicall applied to feed grain.
  • carriers and/or diluents suitable for veterinary use include any an all solvents, dispersion media, aqueous solutions, coatings, antibacterial an antifungal agents, isotonic and absorption delaying agents, and the like.
  • carriers and/or diluents suitable for veterinary use include any an all solvents, dispersion media, aqueous solutions, coatings, antibacterial an antifungal agents, isotonic and absorption delaying agents, and the like.
  • the use o such media and agents for pharmaceutical active substances is well known in the art
  • the vaccine composition of the present invention may comprise in addition to on or more cathepsin proteases, one or more other active compounds such as othe antigens obtainable from liver fluke or other parasites, immune enhancing agent and/or medicaments for veterinary use.
  • the vaccine composition may also contai more than one variety or family of protease or may contain a partially purified E hepatica regurgitate.
  • the vaccine may alternatively contain or may additionall contain a fusion molecule between two or more cathepsin proteases or immunogeni fragments thereof, or between a cathepsin protease or an immunogenic fragmen thereof and another protective molecule such as GST.
  • the cathepsin protease or antigenic fragment thereof may also be delivered by a liv delivery system such as using a bacterial expression system to express the cathepsi protease in bacteria which can be incorporated into gut flora.
  • a vira expression system can be employed.
  • the present invention extends to antibodies t the cathepsin protease or antigenic fragments thereof.
  • Antibodies may b monoclonal or polyclonal and are useful, for example, in purifying cathepsi proteases or related molecules from Fasciola species such as from F. hepatica or E_ gigantica.
  • the present invention extends to a method of purifying a cathepsin protease o related molecule from a helminth, preferably a trematode and more preferably Fasciola species e.g. F. hepatica or from another biological sample comprisin applying a regurgitate of the helminth or applying the biological sample to an affinit column comprising a cathepsin protease reactive antibody or other suitable ligand.
  • the column effluent can be further processed by, for example, SDS-PAGE and/ or ion exchange chromatography.
  • a regurgitate or other biological sample is concentrated by ultrafiltration and subjected to molecular sieving and the material with the desired molecular weight removed.
  • Yet another aspect of the present invention contemplates a diagnostic assay for helminth infection of an animal said method comprising screening for antibodies to the cathepsin proteases as hereinbefore described.
  • the assay may alternatively involve screening for cathepsin protease antigens using monoclonal or polyclonal antibodies.
  • the most convenient form of test is an ELISA but the present invention extends to any suitable form of assay.
  • Figure 1 is a photographic representation demonstrating cathepsin proteinase activit in adult F. hepatica.
  • a 50 fold concentrate of adult regurgitate (track a) and neat adult regurgitate (track b) were resolved by SDS-PAGE and the proteins visualised by silver staining.
  • Proteolytic activity of neat adult regurgitate was detected in gelatin SDS-PAGE gels on the addition of dithiothreitol (2mM DDT) in lane (d) but only weakly without DTT (lane c).
  • Figure 2 shows molecular sieving of the regurgitate of adult F. hepatica worms. Approximately lmg of concentrated regurgitate was passed down a gel permeation column (Example 1). Panel A: Chromatographic profile of the elution monitored at 280nm (1.0 AUFS). Peaks are numbered according to order of elution. The area of collection of one minute fractions of peaks 5 and 6 is indicated. Panel B: SDS- PAGE analysis (followed by silver staining) of the one minute fractions of peaks 5 and 6. 5% of each fraction was loaded in reducing sample buffer. Panel C: Western blot analysis (using ovine F. hepaticacat epsin proteinase antiserum) of the fractions, loading 1% of each fraction in reducing sample buffer.
  • Figure 3 shows anion exchange chromatography of the cathepsin proteinases of the regurgitate of adult F.
  • hepatica Material from peaks 5 and 6 from Figure 2 was pooled, concentrated and applied by FPLC to a Mono Q column in 20 mM ethanolamine (pH 9.0; Buffer A).
  • the column was eluted with buffer B (buffer A + 2M NaCl) delivered by a discontinuous gradient which was held at 5.5% and 13% buffer B.
  • Panel A Chromatographic profile of the elution of proteins from the Mono Q column. Elution was monitored at 280nm (1.0 AUFS) and 13 fractions were collected as indicated.
  • Panel B SDS-PAGE analysis of fractions 1-13 followed by silver staining.
  • Panel C Western blot analysis (using the ovine F. hepatica cathepsin proteinase antiserum) of fractions 1-13. Approximately 1% of each fraction was loaded in reducing sample buffer.
  • Figure 4 is a photographic representation of a gel analysis of Mono Q fractions of cathepsin proteinases under non-reducing conditions. Approximately 1 % of fractions 2-5 from Fig 3A was loaded onto the gels and separated by non reducing SDS- PAGE. Proteins in the SDS-PAGE gel were detected by silver stain and the cathepsin proteinases were detected by the ovine antiserum in the Western blot.
  • Figure 5 is a photographic representation of SDS-PAGE analysis of the purified cathepsin proteinases under non-reducing (NR) and reducing (R) conditions. An aliquot of lO ⁇ g of protein was loaded in each lane and visualised by silver stain.
  • Figure 6 is a graphical representation of ELISA analyses of antibodies to cathepsin proteinases of F. hepatica during the course of the trial.
  • Individual sera from bleeds at weeks -6 (first immunisation), -2 (boost), -1 (one week prior to challenge), and weeks 4 and 12 post-infection were measured by ELISA for anti-cathepsin proteinase activity (see Example 1).
  • Panel A follows the development of anti-cathepsin proteinase titres in the infected control sheep. A maximum titre of 10,000 was achieved by one animal at week 12.
  • Panel B monitors the development of anti- cathepsin proteinase titres in the immunised sheep over the 18 weeks of the trial. A maximum titre of 225,000 was obtained by one animal at week 12.
  • Figure 7 is a photographic representation showing two dimensional SDS-PAGE analysis of purified excretory/secretory cathepsin proteases of adult F. hepatica Isoelectric focussing in the first dimension was conducted over a pH range of 2.5-7.0 with 30 ⁇ g purified proteases. Proteins were detected in the second dimension (15% w/v SDS-PAGE) by silver stain.
  • the lane (R) is a single dimensional reducing SDS- PAGE run of the cathepsin protease preparation.
  • Figure 8 is a graphical representation showing pH optima of the excretory/secretory cathepsin proteases of adult F. hepatica Total enzyme of 15 and 30ng was added to lOOmM Tris and lOOmM phosphate buffers, respectively. The assay was performed over the pH range indicated using the fluorogenic substrate, Z-FR NMeC, as described in Example 2.
  • Figure 9A Peptide alignment with the predicted amino acid sequence and the nucleotide sequence of Fhcatl.
  • the nucleotide sequence of the Fhcatl (ICEA) cDNA is 1075 bases in length.
  • the predicted amino acid sequence begins at methionine (nucleotide 25) and ends at phenylalanine (nucleotide 1002).
  • the direct N-terminal sequence .(N-term) is also mapped to the Fhcatl primary sequence Peptides were derived from chymotryptic (CT) and endo-Glu-C (GC) digests o purified F. hepatica excreted cathepsin proteases.
  • CT chymotryptic
  • GC endo-Glu-C
  • Figure 9B Representation showing the nucleotide sequence and predicted amino aci sequence of another cathepsin protease (Fhcat2 [ICEB]) from liver fluke.
  • Figure 10 Alignment of the amino acid sequences of the Fhcatl preproprotein human preprocathepsin L (HUMCATL: P07711), bromelain (P14518), huma preprocathepsin H (HUMCATH: P09668), human preprocathepsin B (HUMCATB P07858),and a Sc ⁇ istas ⁇ m ⁇ thiol cathepsin (SchistoB: N21309). (Genbank accessio numbers are indicated within the brackets). Functionally conserved amino acids ar boxed to show the similarity among these sequences.
  • FIG 11 N-terminal sequences of the excretory/secretory cathepsin proteinases o adult F. hepatica Sequences were generated either by direct N-terminal amino aci sequencing or from peptides isolated from an endoGlu C digest of the same materia (Material and Methods). Alignments were found to the N-termini of bromelai (Ritonja et al 1989) and papain (Drenth et al. 1971), several mammalian thio cathepsins (bovine cathepsin S (Wiederanders et al.1991), mouse cathepsin B (Cha et al. 1986), human and mouse cathepsin L (Mason et al. 1988; Joseph et al, 1988 and to Trypanosoma cathepsin proteinases (Mottram et al.1989, Eakin et al.1992)
  • Figure 12 Amino acid sequence of the FhcatBl sequence and alignment with Huma Cathepsin B; Schistosoma mansoni Cathepsin B; Human Cathepsin L; Fasciol hepatica Cat 1 & 2. Gaps in the Fhcat BI sequence indicate sequences to b confirmed. Bolding indicates identical residues between the sequences. EXAMPLE 1 DEVELOPMENT OF VACCINE
  • Metacercariae were maintained by passage through the intermediate host snail Lymnaea tomentosa
  • the original isolate derived from an infected sheep in Lancashire, U.K., (designated herein as "Compton 2") was purchased from Compton Paddock Laboratories (Surrey, U.K.) and is maintained by passage through the local snail host and Merino sheep as the mammalian host.
  • Proteinase activity in adult regurgitate was visualised by gelatin gels (Dalton & Heffernan, 1989). Briefly, gels were prepared as for normal SDS-PAGE (Laemmli, 1970) except for the co-polymerisation of gelatin (0.1% w/v) in the resolving gel. Prior to electrophoresis, the gels and running buffer were cooled to 4 °C to reduce enzymatic activity during the run. Samples were mixed 1:1 with non-reducing SDS- PAGE sample buffer and loaded onto gels without denaturation.
  • the gels were incubated in two 30 minute changes of 0.1 M sodium citrate (pH 4.5) containing 2.5% v/v Triton X-100, followed by a final incubation in 0.1M sodium citrate (pH 4.5) (containing 2mM dithiothreitol (DTT) when appropriate.) for 1 hour at 37 °C.
  • Gels were stained with 0.1% w/v Coomassie Blue (in 50% v/v methanol, 40% v/v acetic acid, 10% v/v distilled water) for 15 minutes and then destained in 7% v/v acetic acid.
  • Fasciola hepatica cathepsin proteinases were purified from the regurgitate of mature worms.
  • Adult fluke harvested from the livers of sheep infected with the Compton 2 strain were washed three times in warm (37 °C) PBS and were incubated for 2-4 hours in Basal Eagles medium (Flow Laboratories, Melbourne) supplemented with lOmM glutamine (Flow Laboratories) and buffered with 0.06% w/v NaHC ⁇ 3 (pH 7.5) at 37 °C in 5% v/v C0 2 . The medium was then decanted and frozen (-20 °C) till required.
  • the regurgitate was clarified by centrifugation (10,000g, 30 minutes, 4 °C), vacuum filtered on a 0.45 ⁇ filter, and then Ultrafiltered to a 40-50 fold concentrate (Minitan Ultrafiltration System, Waters-Millipore, Bedford, MA) using a pre-equilibrated 10 kDa cut-off membrane (Minitan Plates: NMWL, Millipore, Bedford, MA) for 8 hours at 8psi. During ultrafiltration reservoirs were kept on ice. Typically, 2 1 batches were concentrated to 40-50ml retentate.
  • the gels were dissembled, wrapped in plastic, fluorogenic markers added, and exposed to X-ray film (XAR-5, Eastman-Kodak, Rochester, NY) for 30-60min at RT.
  • X-ray film XAR-5, Eastman-Kodak, Rochester, NY
  • the 26 kD radioactive band was excised, fragmented and boiled in 1% w/v SDS in lOmM Tris (pH 8.0) for 30 min.
  • the suspension was diluted to 0.1% w/v SDS and then rotated overnight at RT. After allowing the contents to settle, the supernatant was removed, and the gel pieces washed in 0.1% w/v SDS in 10 mM Tris (pH 8.0).
  • Antisera to the cathepsin proteinase was produced by immunising 5 Merino wethers with approximately 70 ⁇ g of apparently pure proteinase generated from adult regurgitate.
  • the purification procedure was based on that of Coles and Rubano (1988).
  • Regurgitate from 8-48 hour cultures of adult fluke
  • Cold ethanol was added dropwise (2.2 ml/min) into mixing chilled regurgitate (300-400ml at 0-2 °C), until a final ethanol concentration of 60%v/v was achieved.
  • the solution was equilibrated at - 20 °C for 18 hours and then pelleted at 6,300g (30min, 4 °C).
  • FCA Freund's Complete Adjuvant
  • CSL Commonwealth Serum Laboratories, (CSL) Melbourne, Australia
  • FCA Freund's Complete Adjuvant
  • Titres were determine as the highest serum dilution with 0.1 absorbance unit above the same dilution of th prebleed.
  • Concentrated and ultrafiltered regurgitate was used as the antigen in preference to untreated regurgitate due to the detectable presence of host (sheep) immunoglobulin fragments in this latter material. Presumably, ultrafiltered regurgitate contained reduced levels of these fragments.
  • the use of purified cathepsin proteinase as antigen revealed no advantage in sensitivity or specificity over the regurgitate concentrate in this assay.
  • Egg Viability The contents of the gall bladder were collected and stored at 4 °C in Alfoil-covered glass containers until samples could be further processed. Eggs were separated from the bile contents by several washes in tap water. A final suspension in water was incubated (in the dark) at 27-29 °C for 14 days. The suspensions were then exposed to an incandescent light source for 20 minutes. To assess viability, 10 drops of 1% w/v Lugol's iodine solution was added to a 25ml sample of the suspension, and the contents assessed under microscope for hatched miracidia and for viable eggs (i.e. those with eye spots); eggs with no sign of differentiation were considered as not viable.
  • Cathepsin proteinases identified in the regurgitate of mature F. hepatica worms.
  • a fifty-fold ultrafiltration concentrate was applied to a gel permeation column in a high salt Tris buffer (pH 6.0) and partially resolved into 5 major peaks (peaks 1-5) and a minor late eluting peak (peak 6, Fig. 2A).
  • Use of the high salt buffer and slightly acidic pH allowed best separation of peaks 5 and 6 from the earlier eluting peaks.
  • Reducing SDS-PAGE analysis of one minute fractions of peaks 5 and 6 revealed the presence of a 28kD component in all fractions (Fig. 2B).
  • Lower molecular weight species ( - 10-14 kD) were also detected in the early fractions (1-5), some of which may represent contaminating proteins from peak 4.
  • the major eluting peak from the ion exchange runs was dialysed, concentrated and separated by preparative SDS- PAGE in non-reducing conditions using a trace label.
  • Table 1 summarises the worm burdens and final FEC of the trial animals.
  • the control group returned worm burdens over the disperse range of 34-99 adult worms, causing an arithmetic mean of 69.6 and a large coefficient of variation (c.v.) of 33%.
  • immunisation with the fluke cathepsin proteinases under the regime used does not reduce burdens after 14 weeks of infection with F. hepatica metacercariae. However, FEC were markedly affected in the vaccinated group.
  • Average fecal eggs /gram faeces excreted in this group (206 ⁇ 86) were 70% reduced as compared to controls (700 ⁇ 377) and this difference was statistically significant (p ⁇ 0.05) using Tukey's multiple range test.
  • coefficients of variation were large, 54% and 42% for the control group and the vaccinates respectively, but there was littie overlap in the spread of the two groups.
  • SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis (Laemmli, 1970) analyses were carried out on 15% w/v gels which were silver stained (Morrissey 1981).
  • 30 ⁇ g of the purified cathepsin proteases was applied to an isoelectric focusing gel (OTarrell, 1975) in the first dimension (incorporating Pharmacia ampholytes pH 2.5-5 and pH 5-7 mixed at a ratio of 1:2).
  • SDS-PAGE was conducted in the second dimension using 15% reducing conditions and the gel silver stained (Morrissey, 1981).
  • Western blot analysis using an ovine cathepsin protease antiserum was conducted as previously described in Example 1.
  • Whole fluke lysates were prepared as described Wijffels et al. (1992).
  • the cathepsin proteases were essentially purified from adult liver fluke regurgitate by the procedure described in Example 1.
  • Peptides were generated from several digests of purified F. hepatica cathepsin proteases. Several peptides were produced from a digest using endoproteinase-Glu-
  • 21.2 were products of a digest of the cathepsin proteases purified as described above. Approximately 20 ⁇ g of the cathepsin protease preparation was S-pyridylethylated and coprecipitated (in acetone) with 2% w/v endo-Glu-C. Digestion was performed at 37 °C for 9 hours in lOO ⁇ l of 0.1M NH4CO3 (pH 8.0, C0 2 ).
  • a chymotryptic digest was performed on lOO ⁇ g of purified protein that had not been reduced and alkylated. Digestion was performed over 4 hours but otherwise was conducted as described Wijffels et al. (1992). Ensuing peptides were purified and refractionated on a C8 Nova-Pak (Millipore-Waters) reverse phase column using 5-60% AcN (in 0.1% TFA) gradient delivered by HPLC at 0.5 ml/min. This digest yielded the chymotryptic peptides CT13.2 and CT11.3.
  • CT21.2 and CT13.3 Two other chymotryptic peptides, CT21.2 and CT13.3 were obtained from a digest of the same preparation of cathepsin proteases described in Example 1.
  • the chymotryptic digest was performed as previously described (Wijffels et al. 1992). Peptides were purified as for the endo-Glu-C digest.
  • Substrates N-CBZ Phe- Arg 7-amino-4-methyl coumarin (Z-FR NMeC) and N-CBZ arginine 7-amido-4-methyl coumarin (Z-R NMeC)
  • inhibitory reagents phenyl methyl sulphonyl fluoride (PMSF), iodoacetamide (IAA), leupeptin, antipain, aprotinin, and E-64 (trans-epoxysuccinyl-L-leucylamido (4-guanidino) butane)
  • Phagemid DNA containing cDNA inserts from positive ⁇ ZAP phage clones was isolated by excision in vivo of the pBluescript phagemid under the conditions recommended by Stratagene (La Jolla, USA). Phagemid DNA was extracted by the method of Birnboim and Doly (1979). DNA sequencing of cDNA inserts was performed by the chain termination method (Sanger et al. 1977) after the plasmid DNA was denatured by treatment with NaOH.
  • a pH maximum of 7.2 was achieved in 100 mM phosphate, and activity was detected over a broad pH range (pH 6.5-9.0; Fig. 4).
  • An average 1 ⁇ of 46 ⁇ M was derived by a Michaelis- Menten plot for this group of cathepsin proteases (lOOmM phosphate, pH 7.45).
  • a pH maximum was not determined, with activity increasing in alkaline conditions (Fig. 8).
  • the putative Fhcatl preproprotein has 44% homology to human preprocathepsin L and 39% homology with preprocathepsin H. There was limited homology to human preprocathepsin B (23%) and cathepsin proteases from Schistosoma (20%, Fig. 10) and Haemonchus (20%).
  • Fhcat2 The nucleotide and predicted amino acid sequences of another cDNA sequence located in the screen of the cDNA library, Fhcat2, is shown in Figure 9B. It is noted that Fhcat2 has 87% homology to Fhcatl.
  • amino acids 1-17 of the putative Fhcatl preproprotein encode the Pre region and amino acids 18-107 encode the Pro region.
  • the Pre and Pro regions are cleaved off to form a mature protease of 219 amino acids in length.
  • Residues 126-136 of die predicted Fhcatl mature protein contains the thiol cathepsin consensus pattern Q-x(3)-[GE]-x-C-W-x(2)-[STAG] and subsequently the best homologies to the thiol cathepsins are found on comparison to the mature polypeptides, with 54% and 44% identity to cathepsins L and H (Fig. 10).
  • good homologies were obtained with various plant thiol cathepsins (bromelain: 39% (Fig. 10), barley aleurain: 47%, actinidin: 42%, papain: 35%).
  • CT13.2 and CT11.3 were also contiguous when mapped to positions 277-291 of the predicted amino acid sequence of the Fhcatl cDNA (Fig. 9A).
  • CT11.3 in particular has a highly conserved region containing the Asn residue which makes up part of the catalytic triad of the thiol cathepsins (Fig. 9A and Musil et al. 1991).
  • the endo-Glu-C peptide (GC20.2), in agreement with the N-terminus of bromelain, has two residues prior to the conserved proline. This peptide terminated with a Glu at position 9 but it is likely to be contiguous with the peptide GC3.1 which aligns at this exact region with chicken cathepsin L (Fig. 11).
  • This GC20.2 sequence has 78% identity with the bromelain N-terminus but also has similar levels of homology with cathepsins L and H N-termini.
  • the direct N-terminal sequence has only the one residue (valine) prior to the proline in position two, a feature shared with most tiiiol cathepsins. This sequence then deviates from most of the thiol cathepsin N-terminal sequences after the DWR region resulting in a lower level of homology to bromelain (61%) and the cadiepsin L subfamily.
  • proline would be predicted at these sites, the possibility of a modified proline within these peptides was investigated.
  • the most simple modification of proline occurs in the collagen chains where proline is hydroxylated at either C3 or C4 generating 3-hydroxyproline (3-Hyp) or 4- hydroxyproline (4-Hyp) respectively.
  • 3-Hyp-PTH and 4-Hyp-PTH derived from the CB6 peptides of die ⁇ j and ⁇ chains of human type III collagen were chromatographically compared.
  • Average 69.6 700 11.1 Average 79.3 206 3.10 S.D. 23.0 377 7.6 S.D. 42.1 86 1.73 c.v. 33.0 53.9 68.5 c.v. 53.0 41.9 55.8
  • the recombinant vaccine trial was performed as described on page 26 except tha 120 ⁇ g of protein was given per dose.
  • Groups of ten sheep received either nativ denatured cathepsins (Group A), native active cathepsins (Group B), Fhcat2 (Grou C), Fhcatl (Group D) and Fhcatl +2 (Group E).
  • Group G received PBS alone whilst Group E were the uninfected controls.
  • This solution was further concentrated and simultaneously dialysed against 50 mM Tris pH 7.5, IM NaCl (Buffer 1), to 1 ml using a microprodicon concentrator using a 10,000 Dalton molecular weight cutoff membrane.
  • Gel filtration chromatography was carried out using Buffer 1 and a Pharmacia FPLC with a Superose 12 column at a flow rate o 0.25 ml/minute and 1 ml fractions collected. These fractions were analysed usin SDS-PAGE and Western blotting on reducing and non-reducing gels, as well zymogram analysis. Fractions that showed homogeneity by these criteria were use for preparing the antigen for vaccination.
  • DNA encoding the mature cathepsin was amplified from Fhcatl and Fhcat2 containing plasmids using the following primers: ICEF 5 ' ACAGCTCGAGGATCCGGCTGTACCCGACA 3' (SEQ ID NO. 19); ICER 5' CTCGAGGATCCTATCACGGAAATCGTGC 3' (SEQ ID NO. 20).
  • the PCR products were cut with BamHI and then ligated into the BamHI site of pET15b (Novagen, USA).
  • the ligated plasmid DNA was transformed into the E. coli strain BL21 (DE3)pLysS.
  • Clones encoding the mature form of Fhcatl or 2 were grown overnight in 10 mis of L-broth containing ampicillin (20 ⁇ g/ml) and chloramphenicol (25 ⁇ g/ml). They were then inoculated into 200 mis of L-Broth containing ampicillin (20 ⁇ g/ml), ,chloramphenicol (25 ⁇ g/ml) and 1 mM IPTG and grown at 37 °C for 3 hours. The cells were collected by centrifugation (10,000g for ten minutes) and then the cell pellets were resuspended in 50 mis of PBS, 0.1% v/v Triton X-100.
  • the cells were lysed and the insoluble material collected by centrifugation (10,000g for ten minutes).
  • the insoluble material was then resuspended in 10 mis of 8 M urea in lx binding buffer and heated to 65 °C for ten minutes.
  • the insoluble material was removed by centrifugation and the supernatant was kept.
  • Recombinant protein was purified from the supernatant by chromatography using His. Bind. Resin as described by the manufacturer (Novagen, USA) using denaturing conditions containing 8M urea.
  • the eluted material (approximately 10 mis) was dialysed against 2 changes of one litre of PBS at 4 °C. During dialysis the recombinant proteins precipitate out of solution. The dialysed solutions were then sonicated to form a fine suspension and the protein concentration was determined.
  • GROUP VACCINE A Native denatured adult cathepsin protease (ACP)
  • Larval proteases were isolated and the N-terminal sequence determined and compared to cathepsin B of bovine, rat, mouse and human origin; cathepsin sequences of mouse and human origin; Fhcatl and cathepsin L sequences in a peptide GC20.2 from F. hepatica; schistosome cathepsin B sequences; and the plant proteases bromelain and papain. The results are set forth below:
  • the amplified Cathepsin B cDNA was cloned using the pCR- Script SK( + ) Cloning Kit (Stratagene, La Jolla, USA). One clone (FhcatBl) was obtained. Plasmid DNA was isolated and DNA sequence determined as described on page 30 above. DNA translation and alignments of the predicted amino acid sequence were carried out using Staden software and sequences from Genbank.
  • the FhcatBl sequence predicts a polypeptide showing high similarity to the cathepsin B family of proteases.
  • cathepsin B sequences from human and S. mansoni are, similar to Fhcat BI.
  • FhcatBl shows a lower degree of similarity to cathepsin L sequences from human and F. hepatica.
  • MUSIL D., ZUCIC, D., TURK, D., ENGH, R.A., MAYR, I., HUBER, R., POPOVIC, T.,
  • WIEDERANDERS B., BROEMME, D., KIRSCHKE, H., KALKKINEN, N., RINNE, A., PAQUETTE, T. & TOOTHMAN, P. 1991.

Abstract

Peptides pouvant être obtenus à partir d'une espèce de Fasciola et comprenant la séquence suivante: Gln-Xaa-Xaa-Xaa-Xaa1-Xaa-Cys-Trp-Xaa-Xaa-Xaa2, Xaa représentant n'importe quel aminoacide, Xaa1 représentant Gly ou Glu et Xaa2 représentant Ser, Thr, Ala, ou Gly. L'invention se rapporte également à des vaccins et à des procédés de traitement permettant de réduire la propagation d'une infection par la douve du foie, ainsi qu'à des séquences d'ADN de ces polypeptides.
PCT/AU1994/000051 1993-02-05 1994-02-04 Polypeptides pouvant etre obtenus a partir d'especes de fasciola, et vaccins, procedes de traitement, et sequences d'adn de ces polypeptides WO1994017820A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU59962/94A AU5996294A (en) 1993-02-05 1994-02-04 Polypeptides obtainable from species of fasciola, and vaccines, methods of treatment and DNA sequences of the same
JP6517444A JPH07505787A (ja) 1993-02-05 1994-02-04 ファスキオラ種から取得可能なポリペプチド類，およびワクチン，処置法およびそのｄｎａ配列
EP94906095A EP0647138A4 (fr) 1993-02-05 1994-02-04 Polypeptides pouvant etre obtenus a partir d'especes de fasciola, et vaccins, procedes de traitement, et sequences d'adn de ces polypeptides.
BR9404004A BR9404004A (pt) 1993-02-05 1994-02-04 Poliptídeo isolado fragmento antigênico parte derivado ou análogo molécula de ácido nucléico método para reduzir o alastramento de um parasita helmíntico e composição de vacina
NO942360A NO942360L (no) 1993-02-05 1994-06-21 Vaksine og polypeptider som er nyttige for denne

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AUPL7109 1993-02-05
AUPL710993 1993-02-05

Publications (1)

Publication Number Publication Date
WO1994017820A1 true WO1994017820A1 (fr) 1994-08-18

Family

ID=3776688

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU1994/000051 WO1994017820A1 (fr) 1993-02-05 1994-02-04 Polypeptides pouvant etre obtenus a partir d'especes de fasciola, et vaccins, procedes de traitement, et sequences d'adn de ces polypeptides

Country Status (8)

Country Link
EP (1) EP0647138A4 (fr)
JP (1) JPH07505787A (fr)
AU (1) AU5996294A (fr)
BR (1) BR9404004A (fr)
CA (1) CA2126455A1 (fr)
NO (1) NO942360L (fr)
NZ (1) NZ261279A (fr)
WO (1) WO1994017820A1 (fr)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995009182A1 (fr) * 1993-09-28 1995-04-06 The University Of Melbourne Antigenes de protection contre les parasites
WO1998040497A2 (fr) * 1997-03-11 1998-09-17 Stichting Dienst Landbouwkundig Onderzoek Modele animal ex vivo ou modele de provocation utilise comme methode pour mesurer l'immunite protectrice dirigee contre les parasites, et vaccins s'etant averes protecteurs dans ladite methode
WO2002038744A2 (fr) * 2000-10-18 2002-05-16 Incyte Genomics, Inc. Protéases
WO2004050883A2 (fr) * 2002-12-04 2004-06-17 Institute Of Bioorganic Chemistry Proteine chimerique, sequence, construction, cellule vegetale, plante transgenique, utilisation des plantes transgeniques, vaccin et procede d'induction
WO2004058816A2 (fr) * 2002-12-31 2004-07-15 Instytut Biotechnologii Antybiotykow Corps d'inclusion pour la vaccination orale d'animaux
EP1543038A2 (fr) * 2002-09-11 2005-06-22 Genentech, Inc. Purification de proteines
US20110091559A1 (en) * 2009-10-07 2011-04-21 Wyeth Llc Compositions comprising adjuvant, macrolide and proteinaceous antigen and methods of use thereof
ES2525106A1 (es) * 2013-06-17 2014-12-17 Universidad De Salamanca Péptido sintético derivado de Fasciola hepatica y su uso como vacuna
WO2019043232A1 (fr) * 2017-09-01 2019-03-07 The Queen's University Of Belfast Antigène et vaccin de fasciola hepatica

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU5310286A (en) * 1984-12-21 1986-07-22 National Research Development Corp. Liver fluke antigens
AU7871987A (en) * 1986-08-18 1988-03-08 Australian National University, The Helminth parasite vaccine
AU5028390A (en) * 1989-01-31 1990-08-24 Daratech Pty Ltd Vaccine for the preventative treatment of infection of liver fluke in ruminants
EP0524834A2 (fr) * 1991-07-25 1993-01-27 Fusanori Hamajima Médicaments immunosuppressifs contenant une cysteine protéase

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2199947T3 (es) * 1992-10-21 2004-03-01 John Pius Dalton Vacuna que contiene una tiolproteasa.

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU5310286A (en) * 1984-12-21 1986-07-22 National Research Development Corp. Liver fluke antigens
AU7871987A (en) * 1986-08-18 1988-03-08 Australian National University, The Helminth parasite vaccine
AU5028390A (en) * 1989-01-31 1990-08-24 Daratech Pty Ltd Vaccine for the preventative treatment of infection of liver fluke in ruminants
EP0524834A2 (fr) * 1991-07-25 1993-01-27 Fusanori Hamajima Médicaments immunosuppressifs contenant une cysteine protéase

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Biochemistry and Molecular Biology International, Vol. 31, No. 3, YAMASAKI, H. and AOKI, T., "Cloning and Sequence Analysis of the Major Cysteine Protease Expressed in the Trematode Parasite Fasciola sp.", pages 537-542, Figs. 1 and 2. *
Molecular and Biochemical Parasitology, Vol. 33 (1989), KLINKERT, MO-QUEN et al., "Primary Structures of Sm 31/32 Diagnostic Proteins of Schistosoma Mansoni and their Identification as Proteases", pages 113-122, whole document, especially Figure 1. *
Molecular and Biochemical Parasitology, Vol. 55 (1992), MARIN, M.S. et al., "Identification and Expression of a Fasciola Hepatica Gene Encoding a Gut Antigen Protein Bearing Repetitive Sequences", pages 155-160, whole document. *
Molecular and Biochemical Parasitology, Vol. 62 (1993), CARMONA, C. et al., "Cathepsin L Proteinase Secreted by Fasciola Heptaca in Vitro Prevents Antibody-Mediated Eosinophil Attachment to Newly Excysted Juveniles", pages 9-18, whole document. *
Molecular and Biochemical Parasitology, Vol. 62 (1993), SMITH, A.M. et al., "Purification of a Cathepsin L-Like Proteinase Secreted by Adult Fasciola Hepatica", pages 1-8, whole document. *
See also references of EP0647138A4 *

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995009182A1 (fr) * 1993-09-28 1995-04-06 The University Of Melbourne Antigenes de protection contre les parasites
US7744907B2 (en) 1997-03-11 2010-06-29 Stichting Dienst Landbouwkundig Onderzoek Ex vivo animal or challenge model as method to measure protective immunity directed against parasites and vaccines shown to be protective in the method
WO1998040497A2 (fr) * 1997-03-11 1998-09-17 Stichting Dienst Landbouwkundig Onderzoek Modele animal ex vivo ou modele de provocation utilise comme methode pour mesurer l'immunite protectrice dirigee contre les parasites, et vaccins s'etant averes protecteurs dans ladite methode
WO1998040497A3 (fr) * 1997-03-11 1998-12-10 Stichting Inst Dierhouderij Modele animal ex vivo ou modele de provocation utilise comme methode pour mesurer l'immunite protectrice dirigee contre les parasites, et vaccins s'etant averes protecteurs dans ladite methode
US8507658B2 (en) 1997-03-11 2013-08-13 Stichting Dienst Landbouwkundig Onderzoek Ex vivo animal or challenge model as method to measure protective immunity directed against parasites and vaccines shown to be protective in the method
US6551594B1 (en) * 1997-03-11 2003-04-22 Stichting Dienst Landbouwkundig Onderzoek Ex vivo animal or challenge model as method to measure protective immunity directed against parasites and vaccines shown to be protective in said method
US8088909B2 (en) 1997-03-11 2012-01-03 Stichting Dienst Landbouwkundig Onderzoek Ex vivo animal or challenge model as method to measure protective immunity directed against parasites and vaccines shown to be protective in the method
WO2002038744A3 (fr) * 2000-10-18 2003-11-20 Incyte Genomics Inc Protéases
WO2002038744A2 (fr) * 2000-10-18 2002-05-16 Incyte Genomics, Inc. Protéases
EP1543038B1 (fr) * 2002-09-11 2017-05-31 Genentech, Inc. Purification de proteines
EP1543038A2 (fr) * 2002-09-11 2005-06-22 Genentech, Inc. Purification de proteines
US10501491B2 (en) 2002-09-11 2019-12-10 Genentech, Inc. Protein purification
EP3388452A3 (fr) * 2002-09-11 2019-02-20 Genentech, Inc. Purification de protéines
US9868760B2 (en) 2002-09-11 2018-01-16 Genentech, Inc. Protein purification
EP2332996A1 (fr) * 2002-09-11 2011-06-15 Genentech, Inc. Purification de protéines
WO2004050883A3 (fr) * 2002-12-04 2004-11-04 Inst Of Bioorg Chemistry Proteine chimerique, sequence, construction, cellule vegetale, plante transgenique, utilisation des plantes transgeniques, vaccin et procede d'induction
WO2004050883A2 (fr) * 2002-12-04 2004-06-17 Institute Of Bioorganic Chemistry Proteine chimerique, sequence, construction, cellule vegetale, plante transgenique, utilisation des plantes transgeniques, vaccin et procede d'induction
WO2004058816A2 (fr) * 2002-12-31 2004-07-15 Instytut Biotechnologii Antybiotykow Corps d'inclusion pour la vaccination orale d'animaux
AU2003294191B2 (en) * 2002-12-31 2010-11-25 Instytut Biotechnologii Antybiotykow Inclusion bodies for the oral vaccination of animals
WO2004058816A3 (fr) * 2002-12-31 2004-10-14 Inst Biotechnologii Antybiotyk Corps d'inclusion pour la vaccination orale d'animaux
US20110091559A1 (en) * 2009-10-07 2011-04-21 Wyeth Llc Compositions comprising adjuvant, macrolide and proteinaceous antigen and methods of use thereof
ES2525106A1 (es) * 2013-06-17 2014-12-17 Universidad De Salamanca Péptido sintético derivado de Fasciola hepatica y su uso como vacuna
WO2019043232A1 (fr) * 2017-09-01 2019-03-07 The Queen's University Of Belfast Antigène et vaccin de fasciola hepatica

Also Published As

Publication number Publication date
EP0647138A1 (fr) 1995-04-12
JPH07505787A (ja) 1995-06-29
CA2126455A1 (fr) 1994-08-06
EP0647138A4 (fr) 1996-03-06
BR9404004A (pt) 1999-05-25
NO942360L (no) 1994-10-05
AU5996294A (en) 1994-08-29
NO942360D0 (fr) 1994-06-21
NZ261279A (en) 1996-03-26

Similar Documents

Publication Publication Date Title
Cho et al. Cathepsin D produces antimicrobial peptide parasin I from histone H2A in the skin mucosa of fish
Redmond et al. Protection studies in sheep using affinity-purified and recombinant cysteine proteinases of adult Haemonchus contortus
WO1994017820A1 (fr) Polypeptides pouvant etre obtenus a partir d'especes de fasciola, et vaccins, procedes de traitement, et sequences d'adn de ces polypeptides
AU675214B2 (en) Protease vaccine against heartworm
AU705715B2 (en) Use of flea proteases and protease inhibitors to protect animals from flea infestation
US5712143A (en) Flea protease proteins, nucleic acid molecules, and uses thereof
US6623735B1 (en) Vaccine containing a thiol protease
US6180383B1 (en) Flea leucine aminopeptidase proteins and uses thereof
AU2005280742B2 (en) Immunogen and antivenom against violin spider venom
US6413521B1 (en) Helminth parasite antigen with aminopeptidase-like activity
AU2651695A (en) Novel parasite protease genes and proteins
TOSA et al. Puritication and Identification of a Serum Protein Increased by Anthelmintic Drugs for Dirofilaria immitis in Dogs
CA2252581A1 (fr) Proteines de protease de puces, molecules d'acides nucleiques et leurs utilisations
EP0362274A1 (fr) Traitement et diagnostic du fourchet utilisant la protease basique de bacteroides nodosus.
US6406900B1 (en) Flea protease proteins, nucleic acid molecules and uses thereof
AU701642B2 (en) Vaccines against helminthic parasites
AU2018201329B2 (en) Sheep nematode vaccine
WO1995012679A1 (fr) Vaccins anti-helminthiques
US6214579B1 (en) Flea leucine aminopeptidase nucleic acid molecules and uses thereof
EP1287025A1 (fr) Pou du mouton, bovicola ovis, traitement par allergene
AU731026B2 (en) Vaccine containing a thiol protease
Cho et al. Cathepsin D produces antimicrobial peptide parasinⅠfrom histone H2A in the skin mucosa of fish.
AU2390499A (en) Novel parasite protease genes and proteins

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 261279

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2126455

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 1994 244796

Country of ref document: US

Date of ref document: 19940815

Kind code of ref document: A

AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR BY CA CH CN CZ DE DK ES FI GB HU JP KP KR KZ LK LU LV MG MN MW NL NO NZ PL PT RO RU SD SE SK UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 1994906095

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWP Wipo information: published in national office

Ref document number: 1994906095

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1994906095

Country of ref document: EP