AU705715B2

AU705715B2 - Use of flea proteases and protease inhibitors to protect animals from flea infestation

Info

Publication number: AU705715B2
Application number: AU41038/96A
Authority: AU
Inventors: Ann Arfsten; Beverly Dale; Glenn R Frank; Robert B Grieve; Andrew Heath; Shirley Wu Hunter; Keith E Rushlow; Gary L Stiegler; Miles Yamanaka
Original assignee: Heska Corp
Current assignee: Heska Corp
Priority date: 1994-10-18
Filing date: 1995-10-18
Publication date: 1999-05-27
Anticipated expiration: 2015-10-18
Also published as: CA2202622A1; EP0787014A4; EP0787014A1; AU4103896A; NZ296424A; JPH10507455A; IL115671A0; WO1996011706A1; MX9702776A

Description

WO 96/11706 PCT/US95/14442 Use of Flea Proteases and Protease Inhibitors to Protect Animals from Flea Infestation Field of the Invention The present invention relates to novel flea protease proteins and their use to reduce flea infestation of animals. The present invention also relates to the use of anti-flea protease antibodies and other compounds that reduce flea protease activity to reduce flea infestation of animals.

Background of the Invention Fleas, which belong to the insect order Siphonaptera, are obligate ectoparasites for a wide variety of animals, including birds and mammals. Flea infestation of animals is of health and economic concern because fleas are known to cause and/or transmit a variety of diseases. Fleas cause and/or carry infectious agents that cause, for example, flea allergy dermatitis, anemia, murine typhus, plague and tapeworm. In addition, fleas are a problem for animals maintained as pets because the infestation becomes a source of annoyance for the pet owner who may find his or her home generally contaminated with fleas which feed on the pets. As such, fleas are a problem not only when they are on an animal but also when they are in the general environment of the animal.

The medical and veterinary importance of flea infestation has prompted the development of reagents capable of controlling flea infestation. Commonly WO 96/11706 PCTUS95/14442 2 encountered methods to control flea infestation are generally focussed on use of insecticides in formulations such as sprays, shampoos, dusts, dips, or foams, or in pet collars. While some of these products are efficacious, most, at best, offer protection of a very limited duration.

Furthermore, many of the methods are often not successful in reducing flea populations on the pet for one or more of the following reasons: failure of owner compliance (frequent administration is required); behavioral or physiological intolerance of the pet to the pesticide product or means of administration; and the emergence of flea populations resistant to the prescribed dose of pesticide. Additional anti-flea products include nontoxic reagents such as insect growth regulators (IGRs), including methoprene, which mimics flea hormones and affect flea larval development.

An alternative method for controlling flea infestation is the use of flea vaccines to be administered to animals prior to or during flea infestation. However, despite considerable interest in developing anti-flea reagents, no flea vaccine presently exists.

Summary of the Invention The present invention relates to a method to protect a host animal from flea infestation that includes the step of treating that animal with a composition that includes a compound that reduces protease activity of fleas feeding from the treated animal, thereby reducing flea burden on P:\WPDOCS\KDF\63i190.RH 30/10/98 the animal and in the environment of the animal. The compound that reduces protease activity of fleas is selected from the group consisting of: an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibody that selectively binds to a protease present in flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in flea midgut. Flea proteases to target can be aminopeptidases, carboxypeptidases and/or endopeptidases, and can include serine proteases, metalloproteases, aspartic acid proteases and cysteine proteases.

Preferred compounds to include in a composition of the present invention include one or more of the following: flea protease vaccines, anti-flea protease antibodies and/or protease inhibitors. Also included in the present invention are compositions including such compounds. Particularly preferred compounds are those that reduce the activity of the flea serine proteases, with flea serine protease vaccines being even more preferred.

Another embodiment of the present invention is a controlled release formulation that includes one or more compositions of the present invention and use of such a formulation to provide long term protection against flea infestation.

In a preferred embodiment, treatment of an animal with a composition of the present invention reduces flea viability by at least about 50 percent within at least about 21 days after fleas begin feeding from a treated animal. In another embodiment, treating an animal with a composition of the present invention reduces flea fecundity by at least about 50 per cent within at least about 30 days after fleas begin feeding from a treated animal.

S: 25 The present invention also includes a method to protect a host animal from flea infestation, which includes treating the animal with a composition comprising a first compound capable of reducing flea protease activity and a second compound that reduces flea burden by a method other than by reducing flea protease activity, wherein said step of .treating reduces flea burden on said animal and in the environment of said animal, wherein 30 said first compound is selected from the group consisting of an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule a 1111111 P:\WPDOCS\I(1D\635190pRH 30110/98 capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibody that selectively binds to a protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut. In this embodiment, the first compound, by reducing proteolytic activity in the flea midgut, can enhance the efficacy of a second compound that also enters the flea through its midgut and otherwise would be susceptible to proteolytic degradation.

Also included in the present invention are compositions including such first and second 10 compounds.

Also included in the present invention is a method to reduce flea infestation comprising treating an animal with a composition comprising a compound capable of reducing flea protease activity, said animal being selected from the group consisting of fleas and animals susceptible to flea infestation, said step of treating thereby reducing flea burden on 15 said animal and in the environment of said animal, wherein said compound is selected from a group consisting of an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions 20 with a gene encoding a flea protease present in a flea midgut; an isolated antibody that selectively binds to a protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut.

Another aspect of the present invention is a soluble flea midgut preparation having proteolytic activity, wherein at least about 70 percent of that proteolytic activity can be inhibited by 4 2 -aminoethyl-benzenesulfonylflouride-hydrochloride wherein about percent of that activity is serine protease activity). Such a preparation is preferably produced by disrupting a flea midgut to produce a mixture comprising a liquid portion and a solid portion; and purifying said protease from said liquid portion. A variety of purification techniques may be used.

The present invention also includes an isolated WO 96/11706 PCTUS9/14442 protein that includes an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut. Such a protein preferably has proteolytic activity and/or the ability to elicit an immune response against a flea midgut protease. Also included in the present invention is an isolated flea protease protein that includes an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a flea midgut protease having an amino acid sequence including SEQ ID NO:1.

The present invention also includes a nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut. Also included are recombinant molecules including one or more nucleic acid molecules of the present invention as well as recombinant cells including one or more nucleic acid molecules of the present invention. Nucleic acid molecules encoding flea protease proteins of the present invention can be used in the production of such proteins.

The present invention also includes isolated antibodies capable of selectively binding to a protease present in a flea midgut. Such antibodies have a variety of uses including in passive immunization protocols.

Another aspect of the present invention is a method to identify a compound capable of inhibiting the proteolytic activity of a flea protease. Such a method includes the WO 96/11706 PCTIUS95/14442 6 steps of contacting an isolated flea protease protein with a putative inhibitory compound under conditions in which, in the absence of the compound, the protease has proteolytic activity; and determining if the putative inhibitory compound inhibits the activity of the protease.

Also included in the present invention is a test kit to identify a compound capable of inhibiting proteolytic activity of a flea protease. Such a kit includes an isolated flea protease protein having proteolytic activity and a means for determining the extent of inhibition of that activity in the presence of a putative inhibitory compound.

The present invention also relates to flea serine protease and aminopeptidase proteins; to flea serine protease and aminopeptidase nucleic acid molecules, including those that encode such proteins; to antibodies raised against such proteins; and to compounds that inhibit flea serine protease and/or aminopeptidase activities. The present invention also includes methods to obtain such proteins, nucleic acid molecules, antibodies, and inhibitors. Also included in the present invention are therapeutic compositions comprising such proteins, nucleic acid molecules, antibodies, and/or inhibitors as well as the use of such therapeutic compositions to protect a host animal from flea infestation.

One embodiment of the present invention is an isolated flea serine protease nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea serine WO 96/11706 PCT/US95/14442 7 protease gene. Particularly preferred flea serine protease nucleic acid molecules include nucleic acid sequences

SEQ

ID NQ:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34,1 SEQ ID NO:36, SEQ ID NO:38, the nucleic acid sequences disclosed in Table 2 SEQ ID NO:52,1 SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ

ID

NO:601, SEQ ID NO:62, SEQ ID NO: 64,1 SEQ ID NO:66,1 SEQ ID NO:68, SEQ ID NO:70,1 SEQ ID NO:724, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO:78), SEQ ID NO:80, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90,1 SEQ

ID

NO:92, SEQ ID NO:94,1 SEQ ID NO:96, SEQ ID NO:98,1 SEQ

ID

NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:l08,1 SEQ ID NO:llo, and/or nucleic acid sequences encoding proteins having amino acid sequences SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 17,1 SEQ ID NO:l9, SEQ ID NO:2l, SEQ ID NO:23, SEQ ID NO:25,

SEQ

ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37,1 SEQ ID NO:39,1 SEQ ID NO:40, SEQ

ID

NO:4l, SEQ ID NO:42, SEQ ID NO:430, SEQ ID NO:44, SEQ ID SEQ ID NO:46, SEQ ID NO:47, the amino acid sequences disclosed in Table 2 SEQ ID NO:53, SEQ ID NO:55,

SEQ

ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67,1 SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:75,1 SEQ ID NO:77, SEQ ID NO:79), SEQ ID NO:8l,1 SEQ ID NO:83, SEQ ID NO:85,1 SEQ ID NO:87, SEQ

ID

NO:89, SEQ ID NO:91,1 SEQ ID NO:93,1 SEQ ID NO:95, SEQ ID WO 96/11706 PCT/US95/14442 8 NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, and/or SEQ ID NO:11l, as well as allelic variants of any of those nucleic acid sequences.

Another embodiment of the present invention is an isolated flea aminopeptidase nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea aminopeptidase gene. A particularly preferred flea aminopeptidase nucleic acid molecule includes nucleic acid sequence SEQ ID NO:50 or an allelic variant thereof.

Another particularly preferred flea aminopeptidase nucleic acid molecule includes nucleic acid sequence SEQ ID NO:112 or an allelic variant thereof.

The present invention also relates to recombinant molecules, recombinant viruses and recombinant cells that include flea serine protease and/or aminopeptidase nucleic acid molecules of the present invention. Also included are methods to produce such nucleic acid molecules, recombinant molecules, recombinant viruses and recombinant cells.

Another embodiment of the present invention includes an isolated flea serine protease protein, including a protein that includes a flea serine protease protein.

A

preferred flea serine protease protein is capable of eliciting an immune response against a natural flea protease when administered to an animal and/or of having serine protease activity. Particularly preferred flea serine protease proteins are those encoded by preferred flea serine protease nucleic acid molecules of the present WO 96/11706 PCT/US95/14442 9 invention.

Yet another embodiment of the present invention includes an isolated flea aminopeptidase protein, including a protein that includes a flea aminopeptidase protein.

A

preferred flea aminopeptidase protein is capable of eliciting an immune response against a natural flea protease when administered to an animal and/or of having aminopeptidase activity. A particularly preferred flea aminopeptidase protein is a protein that includes SEQ ID NO:51 or a protein that is encoded by a nucleic acid molecule that is an allelic variant of a nucleic acid molecule comprising SEQ ID NO:50. Another particularly preferred flea aminopeptidase protein is a protein that includes SEQ ID NO:113 or a protein that is encoded by a nucleic acid molecule that is an allelic variant of a nucleic acid molecule comprising SEQ ID NO:112.

The present invention also relates to mimetopes of flea serine protease and aminopeptidase proteins as well as to isolated antibodies that selectively bind to flea serine protease proteins or mimetopes thereof or to flea aminopeptidase proteins or mimetopes thereof. Also included are methods, including recombinant methods, to produce proteins, mimetopes and antibodies of the present invention.

Yet another embodiment of the present invention is a therapeutic composition that is capable of reducing flea infestation. Such a therapeutic composition includes one or more of the following protective compounds: an isolated WO 96/11706 PCT/US95/14442 flea serine protease protein or a mimetope thereof; an isolated flea serine protease nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea serine protease gene; an isolated antibody that selectively binds to a flea serine protease protein; an inhibitor of flea serine protease activity identified by its ability to inhibit flea serine protease activity; an isolated flea aminopeptidase protein or a mimetope thereof; an isolated flea aminopeptidase nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea aminopeptidase gene; an isolated antibody that selectively binds to a flea aminopeptidase protein; and an inhibitor of flea aminopeptidase activity identified by its ability to inhibit flea aminopeptidase activity.

A

preferred therapeutic composition of the present invention also includes an excipient, an adjuvant and/or a carrier.

Also included in the present invention is a method to reduce flea infestation. The method includes the step of administering to the animal a therapeutic composition of the present invention.

Another embodiment of the present invention is a method to identify a compound capable of inhibiting flea serine protease or flea aminopeptidase activity. The method includes the steps of: contacting an isolated flea serine protease protein or a flea aminopeptidase protein with a putative inhibitory compound under conditions in which, in the absence of the compound, the protein has, respectively, serine protease or WO 96/11706 PCTfUS95/14442 11 aminopeptidase activity; and determining if the putative inhibitory compound inhibits the respective activity. Also included in the present invention is a test kit to identify a compound capable of inhibiting flea serine protease or flea aminopeptidase activity. Such a kit includes an isolated flea serine protease protein having serine protease activity or an isolated flea aminopeptidase protein having aminopeptidase activity and a means for determining the extent of inhibition of the respective activity in the presence of a putative inhibitory compound.

Brief Description of the Fiqures Fig. 1 depicts a protease substrate gel analysis of the relative proteolytic activity in 1, 2, 5 or 10 midguts from either fed or unfed female fleas.

Fig. 2 depicts a protease substrate gel analysis of fed and unfed midgut preparations incubated in the presence or absence of a serine protease inhibitor.

Fig. 3 depicts a protease substrate gel analysis of various fractions obtained in the preparation of a soluble flea midgut preparation incubated in the presence or absence of a serine protease inhibitor.

Fig. 4 depicts a protease substrate gel showing midgut protease activity as a function of time after flea blood feeding.

Fig. 5A depicts a Coomassie stained SDS-PAGE of partially purified (1,3- 3 H)-diisopropylfluoro-phosphate WO 96/11706 PCT/US95/14442 12 (DFP)-labeled fed flea midgut serine proteases.

Fig. 5B depicts an autoradiogram of the SDS-PAGE gel of Fig. 5A of partially purified DFP-labeled fed flea midgut serine proteases.

Fig. 6 depicts the mean viability of adult (both male and female) fleas fed blood containing certain protease inhibitors.

Fig. 7 depicts the mean fecundity of adult female fleas fed blood containing certain protease inhibitors.

Fig. 8 depicts the mean viability of adult (both male and female) fleas fed blood containing certain protease inhibitors.

Fig. 9 depicts the mean fecundity of adult female fleas fed blood containing certain protease inhibitors.

Fig. 10 depicts induction over time of DFP-labeled proteases in fleas feeding on a cat.

Fig. 11 depicts SDS-PAGE of induction over time of DFP-labeled proteases in fleas feeding on a cat.

Detailed Description of the Invention The present invention includes the use of compounds that inhibit flea protease activity to protect a host animal from flea infestation. The inventors have discovered that proteases are significant components of the flea midgut and are good targets for immunotherapeutic and/or chemotherapeutic intervention to reduce flea burden both on the host animal and in the immediate surrounding) environment of the animal. The inventors have

-I

WO 96/11706 PCTIUS95/14442 13 shown, for example, that the viability and/or fecundity of fleas consuming a blood meal is reduced when the blood meal contains compounds that reduce flea protease activity, Probably because the compounds interfere with flea digestion and other functions. Compounds that reduce the amount and/or activity of flea proteases without substantially harming the host animal are included in the present invention. Such compounds include flea protease vaccines, anti-flea protease antibodies, flea protease inhibitors, and/or compounds that suppress protease synthesis; such compounds are discussed in more detail below.

One embodiment of the present invention is a method to protect a host animal from flea infestation by treating the animal with a composition that includes a compound that reduces the protease activity of fleas feeding (includes fleas in the process of feeding as well as fleas having fed) from the treated animal thereby reducing the flea burden on the animal and in the environment of the animal.

It is to be noted that the term or "an" entity refers to one or more of that entity; for example, a compound refers to one or more compounds. As such, the terms "a" (or "one or more" and "at least one" can be used interchangeably herein. Thus, a composition of the present invention can include one or more compounds that target (reduced the activity of) one or more proteases in the flea.

As used herein, the phrase "to protect an animal from WO 96/11706 PCT/US95/14442 14 flea infestation" refers to reducing the potential for flea population expansion on and around the animal reducing the flea burden). Preferably, the flea population size is decreased, optimally to an extent that the animal is no longer bothered by fleas. A host animal, as used herein, is an animal from which fleas can feed by attaching to and feeding through the skin of the animal. Fleas, and other ectoparasites, can live on a host animal for an extended period of time or can attach temporarily to an animal in order to feed. At any given time, a certain percentage of a flea population can be on a host animal whereas the remainder can be in the environment surrounding the animal in the environment of the animal). Such an environment can include not only adult fleas, but also flea eggs and/or flea larvae. The environment can be of any size such that fleas in the environment are able to jump onto and off of a host animal. As such, it is desirable not only to reduce the flea burden on an animal per se, but also to reduce the flea burden in the environment surrounding the animal.

In accordance with the present invention, a host animal is treated by administering to the animal a compound of the present invention in such a manner that the compound itself a protease inhibitor, protease synthesis suppressor or anti-flea protease antibody) or a product generated by the animal in response to administration of the compound antibodies produced in response to a flea protease vaccine, or conversion of an inactive WO 96/11706 PCTIUS95/14442 inhibitor "prodrug" to an active protease inhibitor) ultimately enters the flea midgut. An animal is preferably treated in such a way that the compound or product thereof enters the blood stream of the animal. Fleas are then exposed to the compound when they feed from the animal.

For example, flea protease inhibitors administered to an animal are administered in such a way that the inhibitors enter the blood stream of the animal, where they can be taken up by feeding fleas. In another embodiment, when a host animal is administered a flea protease vaccine, the treated animal mounts an immune response resulting in the production of antibodies against the protease (anti-flea protease antibodies) which circulate in the animal's blood stream and are taken up by fleas upon feeding. Blood taken up by fleas enters the flea midgut where compounds of the present invention, or products thereof, such as anti-flea protease antibodies, flea protease inhibitors, and/or protease synthesis suppressors, interact with, and reduce proteolytic activity in the flea midgut. The present invention also includes the ability to reduce larval flea infestation in that when fleas feed from a host animal that has been administered a therapeutic composition of the present invention, at least a portion of compounds of the present invention, or products thereof, in the blood taken up by the flea are excreted by the flea in feces, which is subsequently ingested by flea larvae. It is of note that flea larvae obtain most, if not all, of their nutrition from flea feces.

WO 96/11706 PCT/US95/14442 16 In accordance with the present invention, reducing proteolytic activity in flea midguts can lead to a number of outcomes that reduce flea burden on treated animals and their surrounding environments. Such outcomes include, but are not limited to, reducing the viability of fleas that feed from the treated animal, reducing the fecundity of female fleas that feed from the treated animal, reducing the reproductive capacity of male fleas that feed from the treated animal, reducing the viability of eggs laid by female fleas that feed from the treated animal, altering the blood feeding behavior of fleas that feed from the treated animal fleas take up less volume per feeding or feed less frequently), (f) reducing the viability of flea larvae, for example due to the feeding of larvae from feces of fleas that feed from the treated animal and/or altering the development of flea larvae by decreasing feeding behavior, inhibiting growth, inhibiting slowing or blocking) molting, and/or otherwise inhibiting maturation to adults).

One embodiment of the present invention is a composition that includes one or more compounds that reduce the activity of one or more flea proteases directly an anti-flea protease antibody or a flea protease inhibitor) and/or indirectly a flea protease vaccine). Suitable flea proteases to target include flea aminopeptidases, flea carboxypeptidases and/or flea endopeptidases. Preferred flea proteases to target include, but are not limited to, serine proteases, WO 96/11706 PCTIUS95/14442 17 metalloproteases, aspartic acid proteases and/or cysteine proteases. It is to be noted that these preferred groups of proteases include aminopeptidases, carboxypeptidases and/or endopeptidases. Preferred flea proteases to target include, but are not limited to, proteases that degrade hemoglobin, proteases involved in blood coagulation and/or lytic (anti-coagulation) pathways, proteases involved in the maturation of peptide hormones, proteases that inhibit complement or other host immune response elements antibodies) and/or proteases involved in vitellogenesis.

A number of proteases are known to those skilled in the art, including, but not limited to, aminopeptidases, such as leucine aminopeptidase and aminopeptidases B and M; astacin-like metalloproteases; calpains; carboxypeptidases, such as carboxypeptidases A, P and Y; cathepsins, such as cathepsins B, D, E, G, H, and L, chymotrypsins; cruzipains; meprins; papains; pepsins; renins; thermolysins and trypsins. A particularly preferred protease to target is a protease having a proteolytic activity that, when targeted with a composition of the present invention, reduces flea burden without substantially harming the host animal. Such a protease can be identified using, for example, methods as disclosed herein.

One aspect of the present invention is the discovery that a substantial amount of the proteolytic activity found in flea midguts is serine protease activity. Both in vitro and in vivo studies using a number of protease inhibitors substantiate this discovery, details of which are disclosed WO 96/11706 PCT/US95/14442 18 in the Examples. As such a particularly preferred protease to target is a serine protease. Examples of serine proteases, include, but are not limited to, acrosins, bromelains, cathepsin G, chymotrypsins, collagenases, elastases, factor Xa, ficins, kallikreins, papains, plasmins, Staphylococcal V8 proteases, thrombins and trypsins. In one embodiment, a preferred flea serine protease to target includes a protease having trypsin-like or chymotrypsin-like activity. It is appreciated by those skilled in the art that an enzyme having "like" proteolytic activity has similar activity to the referenced protease, although the exact structure of the preferred substrate cleaved may differ. "Like" proteases usually have similar tertiary structures as their referenced counterparts.

Protease inhibitor studies disclosed in the Examples section also indicate that additional preferred proteases to target include aminopeptidases and/or metalloproteases.

Examples of such proteases include exo- and endometalloproteases, digestive enzymes, and enzymes involved in peptide hormone maturation. One example of an aminopeptidase that is also a metalloprotease is leucine aminopeptidase.

Suitable compounds to include in compositions of the present invention include, but are not limited to, a vaccine comprising a flea protease (a flea protease vaccine), an antibody that selectively binds to a flea protease (an anti-flea protease antibody), a flea protease inhibitor (a compound other than a vaccine or an antibody WO 96/11706 PCT/US95/14442 19 that inhibits a flea protease), and a mixture of such compounds. As used herein, a mixture thereof refers to a combination of one or more of the cited entities.

Compositions of the present invention can also include compounds to suppress protease synthesis or maturation, such as, but not limited to, protease modulating peptides.

A preferred embodiment of the present invention is a flea protease vaccine and its use to reduce the flea population on and around an animal. A flea protease vaccine can include one or more proteins capable of eliciting an immune response against a flea protease and can also include other components. Preferred flea protease vaccines include a flea serine protease, a flea metalloprotease, a flea aspartic acid protease and/or a flea cysteine protease, with flea serine protease, flea metalloprotease and/or flea aminopeptidase vaccines being more preferred. Examples of flea protease vaccines include soluble flea midgut preparations of the present invention as well as one or more isolated proteins of the present invention.

One embodiment of the present invention is a soluble flea midgut preparation. Such a preparation includes primarily components naturally present in the lumen of a flea midgut and, depending on the method of preparation, can also include one or more peripheral midgut membrane proteins. Methods to preferentially include, or exclude, membrane proteins from such a preparation are known to those skilled in the art. The present invention includes WO 96/11706 PCT/US95/14442 the discovery that such a preparation has proteolytic activity, of which a substantial portion is serine protease activity. Preferably at least about 70 percent of the proteolytic activity in a soluble flea midgut soluble preparation is serine protease activity, as can be indicated by the ability to inhibit at least about percent of the proteolytic activity with 4-2-aminoethylbenzenesulfonylfluoride-hydrochloride (AEBSF). Serine protease activity can also be identified using other known inhibitors or substrates. Other preferred inhibitors that can inhibit at least about 70 percent of the proteolytic activity of a soluble flea midgut preparation of the present invention include soybean trypsin inhibitor, 1,3diisopropylfluoro-phosphate or leupeptin.

A soluble flea midgut preparation of the present invention includes proteases that range in molecular weight from about 5 kilodaltons (kD) to about 200 kD, as determined by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis), with at least a substantial portion of the serine proteases ranging in molecular weight from about 5 kD to about 60 kD, as determined by SDS-PAGE. A substantial portion of protease activity in a soluble flea midgut preparation of the present invention has a pH activity optimum ranging from about pH 5 to about pH 10, preferably an activity optimum ranging from about pH 7 to about pH 9, and even more preferably an activity optimum of about pH 8. While not being bound by theory, such a pH optimum suggests that a WO 96/11706 PCT/US95/14442 21 large proportion of proteases in soluble flea midgut preparations of the present invention are serine proteases.

It is also interesting to note that the pH of the flea midgut is also about pH 8. The findings that proteases in soluble flea midgut preparations of the present invention exhibit a varied pattern of inhibition by protease inhibitors of a given type serine protease inhibitors), as well as variances seen in molecular weights and pH optima of the proteases, suggest that there are a number of protease isoforms in such preparations.

A soluble flea midgut preparation of the present invention is preferably prepared by a method that includes the steps of disrupting a flea midgut to produce a mixture including a liquid portion and a solid portion and recovering the liquid portion to obtain a soluble flea midgut preparation. Such a method is a simplified version of methods disclosed in U.S. Patent No. 5,356,622, ibid.

It is to be noted that in accordance with the present invention, methods disclosed in U.S. Patent No. 5,356,622, ibid. can also be used to prepare soluble flea midgut preparations having similar proteolytic activities.

Flea midguts can be obtained dissected from) from unfed fleas or from fleas that recently consumed a blood meal blood-fed fleas). Such midguts are referred to herein as, respectively, unfed flea midguts and fed flea midguts. Flea midguts can be obtained from either male or female fleas. As demonstrated in the Examples section, female flea midguts exhibit somewhat more WO 96/11706 PCTUS95/14442 22 proteolytic activity than do male flea midguts.

Furthermore, fed flea midguts have significantly more proteolytic activity than do unfed flea midguts. While not being bound by theory, it is believed that blood feeding induces in flea midguts the synthesis and/or activation of proteases as well as other factors enzymes, other proteins, co-factors, etc.) important in digesting the blood meal, as well as in neutralizing host molecules potentially damaging to the flea complement, immunoglobulins, blood coagulation factors). It is also to be appreciated that unfed flea midguts may contain significant targets not found in fed flea midguts and vice versa. Furthermore, although the present application focusses primarily on flea midgut proteases, it is to be noted that the present invention also includes other components of soluble flea midgut preparations of the present invention that provide suitable targets to reduce flea burden on an animal and in the environment of that animal; see also U.S. Patent No. 5,356,622, ibid.

Methods to disrupt flea midguts in order to obtain a soluble flea midgut preparation are known to those skilled in the art and can be selected according to, for example, the volume being processed and the buffers being used.

Such methods include any technique that promotes cell lysis, such as, but are not limited to, chemical disruption techniques exposure of midguts to a detergent) as well as mechanical disruption techniques homogenization, sonication, use of a tissue blender or WO 96/11706 PCT/US95/14442 23 glass beads, and freeze thaw techniques).

Methods to recover a soluble flea midgut preparation are also known to those skilled in the art and can include any method by which the liquid portion of disrupted flea midguts is separated from the solid portion filtration or centrifugation). In a preferred embodiment, disrupted flea midguts are subjected to centrifugation, preferably at an acceleration ranging from about i0,000 x g to about 15,000 x g for several minutes from about 1 minute to about 15 minutes). The supernatant from such a centrifugation comprises a soluble flea midgut preparation of the present invention.

The present invention also includes an isolated protein that includes an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions that hybridize under stringent hybridization conditions) with a nucleic acid molecule that encodes a protease present in can be found in) a flea midgut, such as a midgut from a blood-fed female flea, a midgut from a blood-fed male flea, a midgut from an unfed female flea or a midgut from an unfed male flea.

A

preferred midgut protease is present in the lumen of the midgut.

An isolated protein of the present invention, also referred to herein as an isolated protease protein, preferably is capable of eliciting an immune response against a flea midgut protease and/or has proteolytic activity. According to the present invention, an isolated, WO 96/11706 PCT/US95/14442 24 or biologically pure, protein, is a protein that has been removed from its natural milieu. As such, "isolated" and "biologically pure" do not necessarily reflect the extent to which the protein has been purified. An isolated protease protein can be obtained from its natural source.

Such an isolated protein can also be produced using recombinant DNA technology or chemical synthesis.

As used herein, an isolated protein of the present invention can be a full-length protein or any homologue of such a protein, such as a protein in which amino acids have been deleted a truncated version of the protein, such as a peptide), inserted, inverted, substituted and/or derivatized by glycosylation, phosphorylation, acetylation, myristylation, prenylation, palmitoylation, amidation and/or addition of glycerophosphatidyl inositol) such that the homologue comprises a protein having an amino acid sequence that is sufficiently similar to a natural flea midgut protease that a nucleic acid sequence encoding the homologue is capable of hybridizing under stringent conditions to with) a nucleic acid sequence encoding the corresponding natural flea midgut protease amino acid sequence. As used herein, stringent hybridization conditions refer to standard hybridization conditions under which nucleic acid molecules, including oligonucleotides, are used to identify similar nucleic acid molecules. Such standard conditions are disclosed, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press, 1989.

WO 96/11706 PCT/US95/14442 The minimal size of a protein homologue of the present invention is a size sufficient to be encoded by a nucleic acid molecule capable of forming a stable hybrid with the complementary sequence of a nucleic acid molecule encoding the corresponding natural protein. As such, the size of the nucleic acid molecule encoding such a protein homologue is dependent on nucleic acid composition and percent homology between the nucleic acid molecule and complementary sequence as well as upon hybridization conditions per se temperature, salt concentration, and formamide concentration). The minimal size of such nucleic acid molecules is typically at least about 12 to about 15 nucleotides in length if the nucleic acid molecules are GC-rich and at least about 15 to about 17 bases in length if they are AT-rich. As such, the minimal size of a nucleic acid molecule used to encode a protease protein homologue of the present invention is from about 12 to about 18 nucleotides in length. There is no limit, other than a practical limit, on the maximal size of such a nucleic acid molecule in that the nucleic acid molecule can include a portion of a gene, an entire gene, or multiple genes, or portions thereof. Similarly, the minimal size of a protease protein homologue of the present invention is from about 4 to about 6 amino acids in length, with preferred sizes depending on whether a full-length, multivalent fusion protein having more than one domain each of which has a function), or functional portions of such proteins are desired. Protease protein WO 96/11706 PCT/US95/14442 26 homologues of the present invention preferably have protease activity and/or are capable of eliciting an immune response against a flea midgut protease.

A protease protein homologue of the present invention can be the result of allelic variation of a natural gene encoding a flea protease. A natural gene refers to the form of the gene found most often in nature. Protease protein homologues can be produced using techniques known in the art including, but not limited to, direct modifications to a gene encoding a protein using, for example, classic or recombinant DNA techniques to effect random or targeted mutagenesis. Isolated protease proteins of the present invention, including homologues, can be identified in a straight-forward manner by the proteins' ability to effect proteolytic activity and/or to elicit an immune response against a flea midgut protease. Such techniques are known to those skilled in the art.

A preferred protease protein of the present invention is a flea serine protease, a flea metalloprotease, a flea aspartic acid protease, a flea cysteine protease, or a homologue of any of these proteases. A more preferred protease protein is a flea serine protease, a flea metalloprotease or a homologue of either. Also preferred is a flea aminopeptidase or a homologue thereof.

Particularly preferred is a flea serine protease or a homologue thereof.

Preferred protease proteins of the present invention are flea protease proteins having molecular weights ranging WO 96/11706 PCT/US95/14442 27 from about 5 kD to about 200 kD, as determined by SDS-PAGE, and homologues of such proteins. More preferred are flea protease proteins having molecular weights ranging from about 5 kD to about 60 kD, as determined by SDS-PAGE, and homologues of such proteins. Even more preferred are flea serine protease proteins and particularly those having molecular weights of about 26 kD (denoted PfSP26), about 24 kD (denoted PfSP24), about 19 kD (denoted PfSPl9) and about 6 kD (denoted PfSP6), as determined by SDS-PAGE, and homologues of such proteins.

One preferred embodiment of the present invention is an isolated flea protease protein that includes an amino acid sequence encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea serine protease gene or with a flea aminopeptidase gene. As used herein, a flea protease gene includes all nucleic acid sequences related to a natural flea protease gene such as regulatory regions that control production of a flea protease protein encoded by that gene (such as, but not limited to, transcription, translation or posttranslation control regions) as well as the coding region itself.

The inventors have discovered an extensive family of serine proteases, encoded by a family of serine protease genes. Such a gene family may be due to allelic variants genes having similar, but different, sequences at a given locus in a population of fleas) and/or to, the existence of serine protease genes at more than one locus WO 96/11706 PCTIUS95,'14442 28 in the flea genome. As such, the present invention includes f lea serine protease genes comprising not only the nucleic acid sequences disclosed herein genes including nucleic acid sequences SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24,1 SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38 and/or the nucleic acid sequences disclosed in Table 2, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60,1 SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68,1 SEQ ID SEQ ID NO:72, SEQ ID NO:74,1 SEQ ID NO:76, SEQ ID NO:78), SEQ ID NO:80, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:901 SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:l0O, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:ll0, and/or nucleic acid sequences encoding proteins having amino acid sequences as disclosed herein

SEQ

ID NO:l1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23,

SEQ

ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33,1 SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, the amino acid sequences disclosed in Table 2 SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61,

SEQ

ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:731, SEQ ID NO:751 SEQ ID NO:77, SEQ ID WO 96/11706 PCT/US95/14442 29 NO:79), SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, and/or SEQ ID NO:111), but also allelic variants of any of those nucleic acid sequences. (It should be noted that since nucleic acid sequencing technology is not entirely errorfree, all sequences represented herein are at best apparent deduced) nucleic acid or amino acid sequences.) A preferred flea aminopeptidase gene includes nucleic acid sequence SEQ ID NO:50, which encodes an aminopeptidase protein including SEQ ID NO:51. Another preferred flea aminopeptidase gene includes nucleic acid sequence SEQ ID NO:112, which encodes an aminopeptidase protein including SEQ ID NO:113. Additional preferred aminopeptidase genes include allelic variants of SEQ ID NO:50 and of SEQ ID NO:112.

A preferred flea serine protease protein of the present invention is encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions with at least one of the following nucleic acid molecules: nfSPl, nfSP2, nfSP3, nfSP4, nfSP5, nfSP6, nfSP7, nfSP8, nfSP9, nfSP10, nfSPll, nfSPl2, nfSPl3, nfSPl4, nfSP16, nfSPl7, nfSPl8, nfSPl9 and nfSP20. As used herein, each of these nucleic acid molecules represent the entire coding region of a flea serine protease gene of the present invention (at least portions of which are also referred to by flea clone numbers, as described in the Examples).

WO 96/11706 PCTIUS95/14442 Nucleic acid molecules that contain partial coding regions or other parts of the corresponding gene are denoted by names that include the size of those nucleic acid molecules nfSP4 156 Nucleic acid molecules containing apparent full length coding regions for which the size is known also are denoted by names that include the size of those nucleic acid molecules nfSP4 6 2 The production, and at least partial nucleic acid sequence, of such nucleic acid molecules is disclosed in the Examples.

Particularly preferred serine protease proteins are encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions with at least one of the following nucleic acid molecules: nfSP4 6 2 nfSP 1 56 nfSP2 168 nfSP3 1 7, nfSP4156, nfSP5 159 nfSP6 168 nfSP7 1 59 nfSP8 1 nfSP9 168 nfSP1012 0 and nfSP1162 as well as other specific nucleic acid molecules disclosed in the Examples section, such as, but not limited to, nfSPl 7 9 nfSP2 44 nfSP3,, nfSP4 2 nfSP5 157 nfSP5 218 nfSP6 932 nfSP7 894 nfSP8 299 nfSP9 266 nfSP10 3 78 nfSP11 252 nfSPl2 1 44 nfSPl2 2 25 nfSP3 850 nfSPl4 21 3 nfSPl5 252 nfSP6 1 nfSP18534, nfSP1359, and/or 1 Even more preferred serine protease proteins include the following amino acid sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID WO 96/11706 PCT/US95/14442 31 SEQ ID NO:46, SEQ ID NO:47, and/or the amino acid sequences presented in Table 2 SEQ ID NO:53, SEQ ID SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, and/or SEQ ID NO:79), as well as SEQ ID NO:81, SEQ ID NO:83, SEQ ID SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, and/or SEQ ID NO:111. Additional particularly preferred serine protease proteins are encoded by allelic variants of nucleic acid molecules encoding proteins that include the cited amino acid sequences. Also preferred are flea serine protease proteins including regions that have at least about 50%, preferably at least about 75%, and more preferably at least about 90% identity with flea serine protease proteins having amino acid sequences as cited herein.

A preferred flea aminopeptidase protein of the present invention is encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions with nucleic acid molecule nfAP 53 and/or nfAP 1580 the production of which are described in the Examples. Even more preferred is an aminopeptidase that includes amino acid sequence SEQ ID NO:51 and/or SEQ ID NO:113 or an aminopeptidase encoded by an allelic variant of a nucleic acid molecule that includes SEQ ID NO:50 and/or SEQ ID NO:112. Also preferred are flea aminopeptidase proteins WO 96/11706 PCT/US95/14442 32 including regions that have at least about 50%, preferably at least about 75%, and more preferably at least about identity with SEQ ID NO:51 and/or SEQ ID NO:113.

One embodiment of the present invention is an isolated protein having proteolytic activity that is substantially inhibited by a serine protease inhibitor. Such inhibition can be measured by techniques known to those skilled in the art. To be substantially inhibited means that at least half of the proteolytic activity of the protease protein is inhibited by a serine protease inhibitor. Preferably at least about 70 percent, and even more preferably at least about 90 percent of the proteolytic activity of the protease protein is inhibited by a serine protease inhibitor.

An isolated protein of the present invention can be produced in a variety of ways, including recovering such a protein from a flea midgut and producing such a protein recombinantly. In one embodiment, a flea midgut protease can be recovered by methods heretofore disclosed for obtaining a soluble flea midgut preparation. A flea midgut protease protein can be further purified from a disrupted flea midgut by a number of techniques known to those skilled in the art, including, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis standard, capillary and flow-through electrophoresis), hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, WO 96/11706 PCT/US95/14442 33 chromatofocusing and differential solubilization. In one embodiment, a flea midgut protease is purified using protease inhibitor affinity chromatography, an example of which is disclosed in the Examples section.

Another embodiment of the present invention is a method to produce an isolated protein of the present invention using recombinant DNA technology. Such a method includes the steps of culturing a recombinant cell comprising a nucleic acid molecule encoding a protein of the present invention to produce the protein and (b) recovering the protein therefrom. Details on producing recombinant cells and culturing thereof are presented below. The phrase "recovering the protein" refers simply to collecting the whole fermentation medium containing the protein and need not imply additional steps of separation or purification. Proteins of the present invention can be purified using a variety of standard protein purification techniques, as heretofore disclosed.

Isolated proteins of the present invention are preferably retrieved in "substantially pure" form. As used herein, "substantially pure" refers to a purity that allows for the effective use of the protein as a vaccine. A vaccine for animals, for example, should exhibit no substantial toxicity and should be capable of stimulating the production of antibodies in a vaccinated animal.

Another embodiment of the present invention is an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease WO 96/11706 PCT/US95/14442 34 present in a flea midgut. Such a nucleic acid molecule is also referred to herein as a flea protease nucleic acid molecule. Particularly preferred is an isolated nucleic acid molecule that hybridizes under stringent conditions with a flea serine protease gene or with a flea aminopeptidase gene. The characteristics of such genes are disclosed herein. In accordance with the present invention, an isolated nucleic acid molecule is a nucleic acid molecule that has been removed from its natural milieu that has been subject to human manipulation). As such, "isolated" does not reflect the extent to which the nucleic acid molecule has been purified. An isolated nucleic acid molecule can include DNA, RNA, or derivatives of either DNA or RNA.

As stated above, a flea protease gene includes all nucleic acid sequences related to a natural flea protease gene such as regulatory regions that control production of a flea protease protein encoded by that gene (such as, but not limited to, transcription, translation or posttranslation control regions) as well as the coding region itself. A nucleic acid molecule of the present invention can be an isolated natural flea protease nucleic acid molecule or a homologue thereof. A nucleic acid molecule of the present invention can include one or more regulatory regions, full-length or partial coding regions, or combinations thereof. The minimal size of a flea protease nucleic acid molecule of the present invention is the minimal size capable of forming a stable hybrid under WO 96/11706 PCT/US95/14442 stringent hybridization conditions with a corresponding natural gene. Flea protease nucleic acid molecules can also include a nucleic acid molecule encoding a hybrid protein, a fusion protein, a multivalent protein or a truncation fragment.

An isolated nucleic acid molecule of the present invention can be obtained from its natural source either as an entire complete) gene or a portion thereof capable of forming a stable hybrid with that gene. As used herein, the phrase "at least a portion of" an entity refers to an amount of the entity that is at least sufficient to have the functional aspects of that entity. For example, at least a portion of a nucleic acid sequence, as used herein, is an amount of a nucleic acid sequence capable of forming a stable hybrid with the corresponding gene under stringent hybridization conditions.

An isolated nucleic acid molecule of the present invention can also be produced using recombinant

DNA

technology polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis. Isolated flea protease nucleic acid molecules include natural nucleic acid molecules and homologues thereof, including, but not limited to, natural allelic variants and modified nucleic acid molecules in which nucleotides have been inserted, deleted, substituted, and/or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to encode a flea protease protein of the present invention or WO 96/11706 PCTIUS95/14442 36 to form stable hybrids under stringent conditions with natural nucleic acid molecule isolates.

A flea protease nucleic acid molecule homologue can be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et al., ibid.). For example, nucleic acid molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant

DNA

techniques, such as site-directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and/or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to "build" a mixture of nucleic acid molecules and combinations thereof. Nucleic acid molecule homologues can be selected from a mixture of modified nucleic acids by screening for the function of the protein encoded by the nucleic acid the ability of a homologue to elicit an immune response against a flea protease and/or to have proteolytic activity) and/or by hybridization with isolated flea protease nucleic acids under stringent conditions.

An isolated flea protease nucleic acid molecule of the present invention can include a nucleic acid sequence that encodes at least one flea protease protein of the present invention, examples of such proteins being disclosed herein. Although the phrase "nucleic acid molecule" WO 96/11706 PCTJUS95/14442 37 primarily refers to the physical nucleic acid molecule and the phrase "nucleic acid sequence",, primarily refers to the sequence of nucleotides on the nucleic acid molecule, the two phrases can be used interchangeably, especially with respect to a nucleic acid molecule, or a nucleic acid sequence, being capable of encoding an flea protease protein.

One embodiment of the present invention is a flea protease nucleic acid molecule of the present invention that is capable of hybridizing under stringent conditions to a nucleic acid that encodes at least a portion of a flea protease or a homologue thereof. Preferred is a flea protease nucleic acid molecule that includes a nucleic acid sequence having at least about 65 percent, preferably at least about 75 'percent, more preferably at least about percent, and even more preferably at least about 95 percent homology with the corresponding region(s) of the nucleic acid sequence encoding at least a portion of a flea protease protein. Particularly preferred is a flea protease nucleic acid molecule capable of encoding at least a portion of a flea protease that naturally is present in flea midguts and preferably is included in a soluble flea midgut preparation of the present invention. Examples of nucleic acid molecules of the present invention are disclosed in the Examples section.

A preferred flea serine protease nucleic acid molecule of the present invention is a nucleic acid molecule that hybridizes under stringent hybridization conditions with at WO 96/1 1706 PCTIUS95/14442 38 least one of the following nucleic acid molecules: nfSPl, nfSP2, nfSP3, nfSP4, nfSP5, nfSP6, nfSP7,, nfSP81 nfSP9, nfSPlo, nfSPll, nfSPl2, nfSPl3, nfSPl4, nfSPl51 nfSPl6, nfSPl7, nfSPl8, nfSPl9 and/or nfSP20. More preferred is a nucleic acid molecule that hybridizes under stringent hybridization conditions with at least one of the following nucleic acid molecules: nfSP4 6 72 nfSPl 156 nfSP2 16 8 nfSP,, 7 nf SP4 156 nfSP5 159 nfSP6 1 6 8 ,J nfSP7 159 nfSP8 186'" nfSP9 1 68 nfSPlQ 120 and/or nfSPll 16 2 as well as other specific nucleic acid molecules disclosed in the Examples section. Even more preferred are nucleic acid molecules that include nfSPl, nfSP2, nfSP3, nfSP4, nfSP5, nfSP6,I nfSP7, nf SP8, nfSP9, nfSPlO, nfSPll, nfSPl2, nfSPl3, nfSPl4, nfSPl6, nfSPl7, nfSPl8, nfSPl9, and/or nfSP2O and even more particularly, nfSP4 6 72 nfSP 15 nfSP2 1 68, nfSP3 7 nfSP4 1 15 9 nfSP6 1 68, nfSP7 159 nfSP8 1 86, nfSP9 1 68 nfSP10 1 20 and/or nfSPll 162 as well as other specific nucleic acid molecules disclosed in the Examples section.

Particularly preferred flea serine protease nucleic acid molecules include at least one of the following sequences: SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30,1 SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, and/or nucleic acid sequences disclosed in Table 2 SEQ ID NO:521 SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58,F SEQ ID NO:60, SEQ ID NO: 62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID NO:74,1 SEQ ID NQ:76, SEQ ID NO:78), as well as SEQ ID WO 96/11706 PCT/US9514442 39 SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, and/or SEQ ID NO:110.

Also preferred are allelic variants of such nucleic acid molecules.

A preferred flea aminopeptidase nucleic acid molecule of the present invention is a nucleic acid molecule that hybridizes under stringent hybridization conditions with nfAP 453 and/or nfAP 1580 More preferred is an aminopeptidase nucleic acid molecule that includes nfAP 4 3 nfAP 00 nfAP72 and/or nfAP 1580 Particularly preferred is a nucleic acid molecule that includes nucleic acid sequence SEQ ID SEQ ID NO:112, or an allelic variant thereof.

Knowing a nucleic acid molecule of a flea protease protein of the present invention allows one skilled in the art to make copies of that nucleic acid molecule as well as to obtain a nucleic acid molecule including additional portions of flea protease protein-encoding genes nucleic acid molecules that include the translation start site and/or transcription and/or translation control regions), and/or flea protease nucleic acid molecule homologues. Knowing a portion of an amino acid sequence of a flea protease protein of the present invention allows one skilled in the art to clone nucleic acid sequences encoding such a flea protease protein. In addition, a desired flea protease nucleic acid molecule can be obtained in a variety of ways including screening appropriate expression WO 96/11706 PCT/US95/14442 libraries with antibodies which bind to flea protease proteins of the present invention; traditional cloning techniques using oligonucleotide probes of the present invention to screen appropriate libraries or DNA; and PCR amplification of appropriate libraries, or RNA or DNA using oligonucleotide primers of the present invention (genomic and/or cDNA libraries can be used). To isolate flea protease nucleic acid molecules, preferred cDNA libraries include cDNA libraries made from unfed whole fleas, fed whole fleas, fed flea midguts, unfed flea midguts, and flea salivary glands. Techniques to clone and amplify genes are disclosed, for example, in Sambrook et al., ibid. The Examples section includes examples of the isolation of cDNA sequences encoding flea protease proteins of the present invention.

The present invention also includes nucleic acid molecules that are oligonucleotides capable of hybridizing, under stringent conditions, with complementary regions of other, preferably longer, nucleic acid molecules of the present invention that encode at least a portion of a flea protease protein. Oligonucleotides of the present invention can be RNA, DNA, or derivatives of either. The minimal size of such oligonucleotides is the size required to form a stable hybrid between a given oligonucleotide and the complementary sequence on another nucleic acid molecule of the present invention. Minimal size characteristics are disclosed herein. The size of the oligonucleotide must also be sufficient for the use of the oligonucleotide in WO 96/11706 PCT/US95/14442 41 accordance with the present invention. Oligonucleotides of the present invention can be used in a variety of applications including, but not limited to, as probes to identify additional nucleic acid molecules, as primers to amplify or extend nucleic acid molecules or in therapeutic applications to inhibit flea protease production. Such therapeutic applications include the use of such oligonucleotides in, for example, antisense-, triplex formation-, ribozyme- and/or RNA drug-based technologies.

The present invention, therefore, includes such oligonucleotides and methods to interfere with the production of flea protease proteins by use of one or more of such technologies.

The present invention also includes a recombinant vector, which includes a flea protease nucleic acid molecule of the present invention inserted into any vector capable of delivering the nucleic acid molecule into a host cell. Such a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to flea protease nucleic acid molecules of the present invention. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid. Recombinant vectors can be used in the cloning, sequencing, and/or otherwise manipulating of flea protease nucleic acid molecules of the present invention. One type of recombinant vector, herein referred to as a recombinant molecule and described in more detail below, can be used in the expression of nucleic acid WO 96/11706 PCT/US95/14442 42 molecules of the present invention. Preferred recombinant vectors are capable of replicating in the transformed cell.

Preferred nucleic acid molecules to include in recombinant vectors of the present invention are disclosed herein.

As heretofore disclosed, one embodiment of the present invention is a method to produce a flea protease protein of the present invention by culturing a cell capable of expressing the protein under conditions effective to produce the protein, and recovering the protein.

A

preferred cell to culture is a recombinant cell that is capable of expressing the flea protease protein, the recombinant cell being produced by transforming a host cell with one or more nucleic acid molecules of the present invention. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell.

Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed recombinant) cell in such a manner that their ability to be expressed is retained. Preferred nucleic acid molecules with which to transform a host cell are disclosed herein.

Suitable host cells to transform include any cell that WO 96/11706 PCT/US95/14442 43 can be transformed and that can express the introduced flea protease protein. Such cells are, therefore, capable of producing flea protease proteins of the present invention after being transformed with at least one nucleic acid molecule of the present invention. Host cells can be either untransformed cells or cells that are already transformed with at least one nucleic acid molecule.

Suitable host cells of the present invention can include bacterial, fungal (including yeast), insect, animal and plant cells. Preferred host cells include bacterial, yeast, insect and mammalian cells, with bacterial

E.

coli) and insect Spodoptera) cells being particularly preferred.

A recombinant cell is preferably produced by transforming a host cell with one or more recombinant molecules, each comprising one or more nucleic acid molecules of the present invention operatively linked to an expression vector containing one or more transcription control sequences. The phrase operatively linked refers to insertion of a nucleic acid molecule into an expression vector in a manner such that the molecule is able to be expressed when transformed into a host cell. As used herein, an expression vector is a DNA or RNA vector that is capable of transforming a host cell and of effecting expression of a specified nucleic acid molecule.

Preferably, the expression vector is also capable of replicating within the host cell. Expression vectors can be either prokaryotic or eukaryotic, and are typically WO 96/11706 PCT/US95/14442 44 viruses or plasmids. Expression vectors of the present invention include any vectors that function direct gene expression) in recombinant cells of the present invention, including in bacterial, fungal, insect, animal, and/or plant cells. As such, nucleic acid molecules of the present invention can be operatively linked to expression vectors containing regulatory sequences such as promoters, operators, repressors, enhancers, termination sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell and that control the expression of nucleic acid molecules of the present invention. As used herein, a transcription control sequence includes a sequence which is capable of controlling the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in at least one of the recombinant cells of the present invention. A variety of such transcription control sequences are known to those skilled in the art.

Preferred transcription control sequences include those which function in bacterial, yeast, helminth, insect and mammalian cells, such as, but not limited to, tac, lac, trp, trc, oxy-pro, omp/lpp, rrnB, bacteriophage lambda (1) (such as XpL and APR and fusions that include such promoters), bacteriophage T7, T7lac, bacteriophage T3, WO 96/11706 PCTUS95/14442 bacteriophage SP6, bacteriophage SP01, metallothionein, alpha mating factor, Pichia alcohol oxidase, alphavirus subgenomic promoters (such as Sindbis virus subgenomic promoters), baculovirus, Heliothis zea insect virus, vaccinia virus, herpesvirus, poxvirus, adenovirus, simian virus 40, retrovirus actin, retroviral long terminal repeat, Rous sarcoma virus, heat shock, phosphate and nitrate transcription control sequences as well as other sequences capable of controlling gene expression in prokaryotic or eukaryotic cells. Additional suitable transcription control sequences include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters promoters inducible by interferons or interleukins). Transcription control sequences of the present invention can also include naturally occurring transcription control sequences naturally associated with a DNA sequence encoding a flea protease protein.

Expression vectors of the present invention may also contain secretory signals signal segment nucleic acid sequences) to enable an expressed flea protease protein to be secreted from the cell that produces the protein. Suitable signal segments include a flea protease protein signal segment or any heterologous signal segment capable of directing the secretion of a flea protease protein, including fusion proteins, of the present invention. Preferred signal segments include, but are not limited to, flea protease, tissue plasminogen activator (t- PA), interferon, interleukin, growth hormone, WO 96/11706 PCTIUS95/14442 46 histocompatibility and viral envelope glycoprotein signal segments.

Expression vectors of the present invention may also contain fusion sequences which lead to the expression of inserted nucleic acid molecules of the present invention as fusion proteins. Inclusion of a fusion sequence as part of a flea protease nucleic acid molecule of the present invention can enhance the stability during production, storage and/or use of the protein encoded by the nucleic acid molecule. Furthermore, a fusion segment can function as a tool to simplify purification of a flea protease protein, such as to enable purification of the resultant fusion protein using affinity chromatography. A suitable fusion segment can be a domain of any size that has the desired function increased stability and/or purification tool). It is within the scope of the present invention to use one or more fusion segments. Fusion segments can be joined to amino and/or carboxyl termini of a flea protease protein. Linkages between fusion segments and flea protease proteins can be constructed to be susceptible to cleavage to enable straight-forward recovery of the flea protease proteins. Fusion proteins are preferably produced by culturing a recombinant cell transformed with a fusion nucleic acid sequence that encodes a protein including the fusion segment attached to either the carboxyl and/or amino terminal end of a flea protease protein.

A recombinant molecule of the present invention is a WO 96/11706 PCTIUS95/14442 47 molecule that can include at least one of any nucleic acid molecule heretofore described operatively linked to at least one of any transcription control sequence capable of effectively regulating expression of the nucleic acid molecule(s) in the cell to be transformed. A preferred recombinant molecule includes one or more nucleic acid molecules of the present invention, with those that encode one or more flea protease proteins, and particularly one or more flea serine protease and/or aminopeptidase proteins, being more preferred. Similarly, a preferred recombinant cell includes one or more nucleic acid molecules of the present invention, with those that encode one or more flea protease proteins, and particularly one or more flea serine protease and/or aminopeptidase proteins, being more preferred.

It may be appreciated by one skilled in the art that use of recombinant DNA technologies can improve expression of transformed nucleic acid molecules by manipulating, for example, the number of copies of the nucleic acid molecules within a host cell, the efficiency with which those nucleic acid molecules are transcribed, the efficiency with which the resultant transcripts are translated, and the efficiency of post-translational modifications.

Recombinant techniques useful for increasing the expression of nucleic acid molecules of the present invention include, but are not limited to, operatively linking nucleic acid molecules to high-copy number plasmids, integration of the nucleic acid molecules into one or more host cell 1111 WO 96/11706 PCT/US95/14442 48 chromosomes, addition of vector stability sequences to plasmids, substitutions or modifications of transcription control signals promoters, operators, enhancers), substitutions or modifications of translational control signals ribosome binding sites, Shine-Dalgarno sequences), modification of nucleic acid molecules of the present invention to correspond to the codon usage of the host cell, deletion of sequences that destabilize transcripts, and use of control signals that temporally separate recombinant cell growth from recombinant protein production during fermentation. The activity of an expressed recombinant protein of the present invention may be improved by fragmenting, modifying, or derivatizing the resultant protein.

In accordance with the present invention, recombinant cells can be used to produce flea protease proteins of the present invention by culturing such cells under conditions effective to produce such a protein, and recovering the protein. Effective conditions to produce a protein include, but are not limited to, appropriate media, bioreactor, temperature, pH and oxygen conditions that permit protein production. An appropriate, or effective, medium refers to any medium in which a cell of the present invention, when cultured, is capable of producing a flea protease protein. Such a medium is typically an aqueous medium comprising assimilable carbohydrate, nitrogen and phosphate sources, as well as appropriate salts, minerals, metals and other nutrients, such as vitamins. The medium WO 96/11706 PCT/US95/14442 49 may comprise complex nutrients or may be a defined minimal medium.

Cells of the present invention can be cultured in conventional fermentation bioreactors, which include, but are not limited to, batch, fed-batch, cell recycle, and continuous fermentors. Culturing can also be conducted in shake flasks, test tubes, microtiter dishes, and petri plates. Culturing is carried out at a temperature, pH and oxygen content appropriate for the recombinant cell. Such culturing conditions are well within the expertise of one of ordinary skill in the art.

Depending on the vector and host system used for production, resultant flea protease proteins may either remain within the recombinant cell; be secreted into the fermentation medium; be secreted into a space between two cellular membranes, such as the periplasmic space in E.

coli; or be retained on the outer surface of a cell or viral membrane. Methods to purify such proteins are heretofore disclosed.

The present invention also includes isolated anti-flea protease antibodies and their use to reduce flea infestation on a host animal as well as in the environment of the animal. An anti-flea protease antibody is an antibody capable of selectively binding to a protease present in a flea midgut, including female and male fed midguts as well as female and male unfed midguts. An antiflea protease antibody preferably binds to the protease in such a way as to reduce the proteolytic activity of that WO 96/11706 PCT/US95/14442 protease.

Isolated antibodies are antibodies that have been removed from their natural milieu. The term "isolated" does not refer to the state of purity of such antibodies.

As such, isolated antibodies can include anti-sera containing such antibodies, or antibodies that have been purified to varying degrees. As used herein, the term "selectively binds to" refers to the ability of such antibodies to preferentially bind to the protease against which the antibody was raised to be able to distinguish that protease from unrelated components in a mixture.). Binding affinities typically range from about 103 M- 1 to about 1012 M- 1 Binding can be measured using a variety of methods known to those skilled in the art including immunoblot assays, immunoprecipitation assays, radioimmunoassays, enzyme immunoassays

ELISA),

immunofluorescent antibody assays and immunoelectron microscopy; see, for example, Sambrook et al., ibid.

Antibodies of the present invention can be either polyclonal or monoclonal antibodies. Antibodies of the present invention include functional equivalents such as antibody fragments and genetically-engineered antibodies, including single chain antibodies, that are capable of selectively binding to at least one of the epitopes of the protein used to obtain the antibodies. Antibodies of the present invention also include chimeric antibodies that can bind to more than one epitope. Preferred antibodies are raised in response to proteins that are encoded, at least WO 96/11706 PCTIUS95/14442 51 in part, by a flea protease nucleic acid molecule of the present invention.

Anti-flea antibodies of the present invention include antibodies raised in an animal administered a flea protease vaccine of the present invention that exert their effect when fleas feed from the vaccinated animal's blood containing such antibodies. Anti-flea antibodies of the present invention also include antibodies raised in an animal against one or more flea protease proteins, or soluble flea midgut preparations, of the present invention that are then recovered from the animal using techniques known to those skilled in the art. Yet additional antibodies of the present invention are produced recombinantly using techniques as heretofore disclosed for flea protease proteins of the present invention.

Antibodies produced against defined proteins can be advantageous because such antibodies are not substantially contaminated with antibodies against other substances that might otherwise cause interference in a diagnostic assay or side effects if used in a therapeutic composition.

Anti-flea protease antibodies of the present invention have a variety of uses that are within the scope of the present invention. For example, such antibodies can be used in a composition of the present invention to passively immunize an animal in order to protect the animal from flea infestation. Anti-flea antibodies can also be used as tools to screen expression libraries and/or to recover desired proteins of the present invention from a mixture of WO 96/11706 PCT/US95/14442 52 proteins and other contaminants. Furthermore, antibodies of the present invention can be used to target cytotoxic agents to fleas in order to kill fleas. Targeting can be accomplished by conjugating stably joining) such antibodies to the cytotoxic agents using techniques known to those skilled in the art.

A preferred anti-flea protease antibody of the present invention can selectively bind to, and preferentially reduce the proteolytic activity of, a flea serine protease, a flea metalloprotease, a flea aspartic acid protease and/or a flea cysteine protease. More preferred anti-flea protease antibodies include anti-flea serine protease antibodies, anti-flea metalloprotease antibodies, and antiflea aminopeptidase antibodies. Particularly preferred are anti-flea serine protease antibodies and anti-flea aminopeptidase antibodies, including those raised against flea serine protease proteins or flea aminopeptidase proteins of the present invention.

The present invention also includes the use of protease inhibitors that reduce proteolytic activity of flea proteases to reduce flea infestation of animals and the surrounding environment. As used herein, protease inhibitors are compounds that interact directly with a protease thereby inhibiting that protease's activity, usually by binding to or otherwise interacting with the protease's active site. Protease inhibitors are usually relatively small compounds and as such differ from antiprotease antibodies that interact with the active site of WO 96/11706 PCTIUS95/14442 53 a protease.

Protease inhibitors can be used directly as compounds in compositions of the present invention to treat animals as long as such compounds are not harmful to the animals being treated. Protease inhibitors can also be used to identify preferred types of flea proteases to target using compositions of the present invention. For example, the inventors have shown herein the predominance of serine proteases in flea midguts, particularly in soluble flea midgut preparations, using protease inhibitors. Such knowledge suggests that effective reduction of flea infestation of an animal can be achieved using serine protease vaccines, anti-flea serine protease antibodies and other inhibitors of serine protease synthesis and activity that can be tolerated by the animal. That other proteases are also present in flea midguts according to the present invention also suggests targeting such proteases. Methods to use protease inhibitors are known to those skilled in the art; examples of such methods are disclosed herein.

In one embodiment, a protease inhibitor that can be used in a composition of the present invention to treat an animal is identified by a method including the following steps: identifying candidate putative, possible) inhibitor compounds by testing the efficacy of one or more protease inhibitors in vitro for their ability to inhibit flea protease activity and/or (ii) in a flea feeding assay for their ability to reduce the survival and/or fecundity of fleas by adding the inhibitors to the WO 96/11706 PCT/US95/14442 54 blood meal of a flea being maintained, for example, in a feeding system, such as that described by Wade et al., 1988, J.Med Entomol. 25, 186-190; and testing the efficacy of the candidate inhibitor compounds in animals infested with fleas. Although one does not need both in vitro assay data and flea feeding assay data to determine which candidate compounds to administer to animals, evaluation of both sets of data is preferred since data from neither of the assays necessarily predicts data to be obtained from the other assay. For example, candidate compounds identified using the in vitro assay may work "in the test tube" but may not work in vivo for a number of reasons, including the presence of interfering components in the blood meal that inhibit the activity of such compounds; although aprotinin can inhibit at least some flea serine proteases in vitro, aprotinin does not work well in the presence of serum proteins, such as are found in the blood. Furthermore, candidate inhibitor compounds identified by the flea feeding assays can include not only desired compounds but also compounds that reduce the viability and/or fecundity of fleas due to general toxicity affecting the mitochondria of fleas).

In another embodiment, protease inhibitors are used in the purification of corresponding proteases by, for example, affinity chromatography, in which, a protease inhibitor is incubated with a mixture containing a desired protease under conditions that the inhibitor forms a complex with the protease. The protease can then be WO 96/11706 PCT/US95/14442 recovered from the complex. The protease inhibitor can be attached to a solid support and/or be labelled with, for example, a radioactive, fluorescent, or enzymatic tag that can be used to detect and/or recover the complex.

Suitable protease inhibitors to use in accordance with the present invention include serine protease inhibitors, metalloprotease inhibitors, aspartic acid protease inhibitors, cysteine protease inhibitors, and/or aminopeptidase inhibitors. Preferred protease inhibitors include serine protease inhibitors, metalloprotease inhibitors and aminopeptidase inhibitors, particularly those that are broad spectrum inhibitors. More preferred are broad spectrum serine protease inhibitors.

There is a wide variety of protease inhibitors, as is known to one skilled in the art. Examples include, but are not limited to, AEBSF, aprotinin, bestatin, chloromethyl ketones TLCK (Na-p-tosyl-L-lysine chloromethyl ketone) and TPCK (N-tosyl-L-phenylalanine chloromethyl ketone), chymostatin, cystatin, 3' 4 -dichloroisocoumarin, E-64 (trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane), EDTA (ethylenediaminetetraacetic acid), leupeptin, methyl ketones having a variety of leaving groups, oxidized Lleucinethiol, pepstatin, 1,10-orthophenanthroline, phosphoramidon, soybean trypsin/chymotrypsin inhibitor and soybean trypsin inhibitor. Preferred protease inhibitors for use in the present invention include AEBSF, bestatin, E-64 leupeptin, pepstatin, 1,10-orthophenanthroline, phosphoramidon, TLCK and TPCK, with AEBSF (a broad spectrum WO 96/11706 PCT/US95/14442 56 serine protease inhibitor), bestatin (an inhibitor of leucine aminopeptidase) and 1,10-orthophenanthroline (a broad spectrum metalloprotease inhibitor) being particularly preferred.

Protease inhibitors can be produced using methods known to those skilled in the art. Protein- or peptidebased protease inhibitors, such as cystatin or small peptides comprising a protease substrate, can be produced recombinantly and modified as necessary.

The present invention also includes the use of proteolytically active flea protease proteins of the present invention to identify additional protease inhibitors, and preferably protease inhibitor compounds that can be included in a composition of the present invention to be administered to animals. A method to identify a flea protease inhibitor includes the steps of contacting combining, mixing) an isolated flea protease protein with a putative candidate) inhibitory compound under conditions in which, in the absence of the compound, the protein has proteolytic activity, and determining if the putative inhibitory compound inhibits the proteolytic activity of the protein.

Putative inhibitory compounds to screen include organic molecules, antibodies (including functional equivalents thereof) and substrate analogs. Methods to determine protease activity are known to those skilled in the art, as heretofore disclosed. Particularly preferred for use in identifying inhibitors are flea serine protease proteins WO 96/11706 PCT/US95/14442 57 and flea aminopeptidase proteins of the present invention.

The present invention also includes a test kit to identify a compound capable of inhibiting flea protease activity. Such a test kit includes an isolated flea protease protein having proteolytic activity and a means for determining the extent of inhibition of proteolytic activity in the presence of effected by) a putative inhibitory compound.

The present invention also includes inhibitors isolated by such a method, and/or test kit, and their use to inhibit any flea protease that is susceptible to such an inhibitor.

It is to be appreciated that the present invention also includes mimetopes of compounds of the present invention that can be used in accordance with methods as disclosed for compounds of the present invention. As used herein, a mimetope of a proteinaceous compound of the present invention a flea protease protein, an antiflea protease antibody, a proteinaceous inhibitor of protease activity or synthesis) refers to any compound that is able to mimic the activity of that proteinaceous compound, often because the mimetope has a structure that mimics the proteinaceous compound. For example, a mimetope of a flea protease protein is a compound that has an activity similar to that of an isolated flea protease protein of the present invention. Mimetopes can be, but are not limited to: peptides that have been modified to decrease their susceptibility to degradation; anti- WO 96/11706 PCT/US95/14442 58 idiotypic and/or catalytic antibodies, or fragments thereof; non-proteinaceous immunogenic portions of an isolated protein carbohydrate structures); and synthetic or natural organic molecules, including nucleic acids. Such mimetopes can be designed using computergenerated structures of proteins of the present invention.

Mimetopes can also be obtained by generating random samples of molecules, such as oligonucleotides, peptides or other organic molecules, and screening such samples by affinity chromatography techniques using the corresponding binding partner.

The present invention includes therapeutic compositions, also referred to herein as compositions, that include a at least one) compound of the present invention. Preferred compounds to include in a composition of the present invention include flea protease vaccines, anti-flea protease antibodies and/or protease inhibitors as disclosed herein. Such a therapeutic composition can protect an animal from flea infestation by reducing flea protease activity, thereby reducing flea burden on the animal and in the environment of the animal.

Particularly preferred therapeutic compositions of the present invention include at least one of the following compounds: an isolated flea serine protease protein or a mimetope thereof; an isolated flea serine protease nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea serine protease gene; an isolated antibody that selectively binds to a flea serine protease WO 96/11706 PCT/US95/14442 59 protein; an inhibitor of flea serine protease activity identified by its ability to inhibit flea serine protease activity; an isolated flea aminopeptidase protein or a mimetope thereof; an isolated flea aminopeptidase nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea aminopeptidase gene; an isolated antibody that selectively binds to a flea aminopeptidase protein; and an inhibitor of flea aminopeptidase activity identified by its ability to inhibit flea aminopeptidase activity.

Another embodiment of the present invention is a therapeutic composition that includes a first compound that reduces flea protease activity and a second compound that reduces flea burden by a method other than by reducing flea protease activity. The present invention also includes a method to protect an animal from flea infestation by administering to the animal such a composition. The first compound of such a composition by effectively reducing flea protease activity in the midgut, enhances the activity of the second compound. While not being bound by theory, it is believed that a number of anti-flea treatments, particularly those that are proteinaceous, are not very effective because they are degraded in the flea midgut.

The present invention permits the effective use of such anti-flea treatments by reducing proteolytic degradation of such treatments by the flea midgut.

Preferred first compounds to include in such a composition include flea protease vaccines, anti-flea WO 96/11706 PCT/US95/14442 protease antibodies and/or protease inhibitors as disclosed herein.

Suitable second compounds include any anti-flea agent(s), including, but not limited to, proteinaceous compounds, insecticides and flea collars. Preferred second compounds are proteinaceous compounds that effect active immunization antigen vaccines), passive immunization antibodies), or that otherwise inhibit a flea activity that when inhibited can reduce flea burden on and around an animal. Examples of second compounds include a compound that inhibits binding between a flea membrane protein and its ligand a compound that inhibits flea ATPase activity or a compound that inhibits binding of a peptide or steroid hormone to its receptor), a compound that inhibits hormone (including peptide or steroid hormones) synthesis, a compound that inhibits vitellogenesis (including production of vitellin and transport and maturation thereof into a major egg yolk protein), a compound that inhibits fat body function, a compound that inhibits flea muscle action, a compound that inhibits the flea nervous system, a compound that inhibits the flea immune system and/or a compound that inhibits flea feeding.

Compositions of the present invention can also include other components such as a pharmaceutically acceptable excipient, an adjuvant, and/or a carrier. For example, compositions of the present invention can be formulated in an excipient that the animal to be treated can tolerate.

I

WO 96/11706 PCT/US95/14442 61 Examples of such excipients include water, saline, Ringer's solution, dextrose solution, Hank's solution, and other aqueous physiologically balanced salt solutions.

Nonaqueous vehicles, such as fixed oils, sesame oil, ethyl oleate, or triglycerides may also be used. Other useful formulations include suspensions containing viscosity enhancing agents, such as sodium carboxymethylcellulose, sorbitol, or dextran. Excipients can also contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability. Examples of buffers include phosphate buffer, bicarbonate buffer and Tris buffer, while examples of preservatives include thimerosal, m- or o-cresol, formalin and benzyl alcohol. Standard formulations can either be liquid injectables or solids which can be taken up in a suitable liquid as a suspension or solution for injection. Thus, in a non-liquid formulation, the excipient can comprise dextrose, human serum albumin, preservatives, etc., to which sterile water or saline can be added prior to administration.

In one embodiment of the present invention, the composition can also include an immunopotentiator, such as an adjuvant or a carrier. Adjuvants are typically substances that generally enhance the immune response of an animal to a specific antigen. Suitable adjuvants include, but are not limited to, Freund's adjuvant; other bacterial cell wall components; aluminum-based salts; calcium-based salts; silica; polynucleotides; toxoids; serum proteins; viral coat proteins; other bacterial-derived preparations; WO 96/11706 PCT/US95/14442 62 gamma interferon; block copolymer adjuvants, such as Hunter's Titermax adjuvant (Vaxcelm, Inc. Norcross,

GA);

Ribi adjuvants (available from Ribi ImmunoChem Research, Inc., Hamilton, MT); and saponins and their derivatives, such as Quil A (available from Superfos Biosector

A/S,

Denmark). Carriers are typically compounds that increase the half-life of a therapeutic composition in the treated animal. Suitable carriers include, but are not limited to, polymeric controlled release formulations, biodegradable implants, liposomes, bacteria, viruses, oils, esters, and glycols.

One embodiment of the present invention is a controlled release formulation that is capable of slowly releasing a composition of the present invention into an animal. As used herein a controlled release formulation comprises a composition of the present invention in a controlled release vehicle. Suitable controlled release vehicles include, but are not limited to, biocompatible polymers, other polymeric matrices, capsules, microcapsules, microparticles, bolus preparations, osmotic pumps, diffusion devices, liposomes, lipospheres, and transdermal delivery systems. Other controlled release formulations of the present invention include liquids that, upon administration to an animal, form a solid or a gel in situ. Preferred controlled release formulations are biodegradable bioerodible).

A preferred controlled release formulation of the present invention is capable of releasing a composition of WO 96/11706 PCT/US95/14442 63 the present invention into the blood of the treated animal at a constant rate sufficient to attain therapeutic dose levels of the composition to reduce protease activity in fleas feeding from the animal over a period of time ranging from about 1 to about 12 months. A controlled release formulation of the present invention is capable of effecting a treatment for preferably at least about 1 month, more preferably at least about 3 months and even more preferably for at least about 6 months, even more preferably for at least about 9 months, and even more preferably for at least about 12 months.

In order to protect an animal from flea infestation, a therapeutic composition of the present invention is administered to the animal in an effective manner such that the protease activity of fleas feeding from the blood stream of animals treated with the composition is reduced.

As such, a treated animal is an animal that is competent to reduce the flea burden by reducing flea protease activity, or by reducing flea protease activity and at least one other flea activity. Preferably, the protease activity is reduced by at least about 50 percent, more preferably by at least about 70 percent and even more preferably by at least about 90 percent. Methods to administer compositions to the animal in order to render the animal competent depend on the nature of the composition and administration regime.

Animals administered a protease vaccine with at least one booster shot usually become competent at about the same time as would be expected for any vaccine treatment. For WO 96/11706 PCT/US95/14442 64 example, animals administered a booster dose about 4 to 6 weeks after a primary dose usually become competent within another about 3 to 4 weeks. Animals administered a composition including an anti-flea protease antibody or protease inhibitor become competent as soon as appropriate serum levels of the compound are achieved, usually with one to three days.

In a preferred embodiment, a composition of the present invention when administered to a host animal is able to reduce flea viability by at least about 50 percent within at least about 21 days after the fleas begin feeding from the treated animal. (Note that fleas usually live about 40 days to about 50 days on one or more animals.)

A

more preferred composition when administered to a host animal is able to reduce flea viability by at least about percent within at least about 14 days after the fleas begin feeding from the treated aniil. An even more preferred composition when administered to an animal is able to reduce flea viability by at least about 90 percent within at least about 7 days after the fleas begin feeding from the treated animal.

In another preferred embodiment, a composition of the present invention when administered to a host animal is able to reduce flea fecundity egg laying ability) by at least about 50 percent, more preferably by at least about 70 percent, and even more preferably by at least about 90 percent, within at least about 30 days after the fleas begin feeding from the treated animal. (Note that WO 96/11706 PCT/US95/14442 fleas usually do not begin laying eggs until about 7 days after taking a blood meal.) In accordance with the present invention, compositions are administered to an animal in a manner such that the animal becomes competent to reduce flea protease activity in a flea that feeds from the competent; the animal becomes a treated animal. For example, a flea protease vaccine of the present invention, when administered to an animal in an effective manner, is able to elicit stimulate) an immune response that produces an antibody titer in the blood stream of the animal sufficient to reduce flea protease activity. Similarly, an anti-flea protease antibody of the present invention, when administered to an animal in an effective manner, is administered in an amount so as to be present in the animal's blood stream at a titer that is sufficient to reduce flea protease activity. A protease inhibitor compound of the present invention, when administered to an animal in an effective manner, is administered in a manner so as to be present in the animal's blood stream at a concentration that is sufficient to reduce flea protease activity. Oligonucleotide nucleic acid molecules of the present invention can also be administered in an effective manner, thereby reducing expression of flea proteases.

Compositions of the present invention can be administered to animals prior to or during flea infestation. It is to be noted that when vaccines of the present invention are administered to an animal, a time WO 96/11706 PCT/US95/14442 66 period is required for the animal to elicit an immune response before the animal is competent to inhibit protease activity of fleas feeding from that animal. Methods to obtain an immune response in an animal are known to those skilled in the art.

Acceptable protocols to administer compositions in an effective manner include individual dose size, number of doses, frequency of dose administration, and mode of administration. Determination of such protocols can be accomplished by those skilled in the art. A suitable single dose is a dose that is capable of protecting an animal from flea infestation when administered one or more times over a suitable time period. For example, a preferred single dose of a protease vaccine or a mimetope thereof ranges from about 1 microgram (gg, also denoted ug) to about 10 milligrams (mg) of the composition per kilogram body weight of the animal. Booster vaccinations can be administered from about 2 weeks to several years after the original administration. Booster vaccinations preferably are administered when the immune response of the animal becomes insufficient to protect the animal from flea infestation. A preferred administration schedule is one in which from about 10 gg to about 1 mg of the vaccine per kg body weight of the animal is administered from about one to about two times over a time period of from about 2 weeks to about 12 months. In one embodiment, a booster dose of a composition of the present invention is administered about 4 to 6 weeks after the primary dose, and additional WO 96/11706 PCTJUS95/14442 67 boosters are administered about once or twice a year.

Modes of administration can include, but are not limited to, oral, nasal, topical, transdermal, rectal, and parenteral routes. Parenteral routes can include, but are not limited to subcutaneous, intradermal, intravenous, and intramuscular routes.

In another embodiment, a preferred single dose of an anti-flea protease antibody composition or a mimetope thereof ranges from about 1 Ag to about 10 mg of the composition per kilogram body weight of the animal. Antiflea antibodies can be re-administered from about 1 hour to about biweekly for several weeks following the original administration. Booster treatments preferably are administered when the titer of antibodies of the animal becomes insufficient to protect the animal from flea infestation. A preferred administration schedule is one in which from about 10 gg to about 1 mg of an anti-flea protease antibody composition per kg body weight of the animal is administered about every 2 to every 4 weeks.

Suitable modes of administration are as disclosed herein and are known to those skilled in the art.

According to one embodiment, a nucleic acid molecule of the present invention can be administered to an animal in a fashion to enable expression of that nucleic acid molecule into a protective protein flea protease vaccine, anti-flea protease antibody, or proteinaceous protease inhibitor) or protective RNA antisense

RNA,

ribozyme or RNA drug) in the animal to be protected from WO 96/11706 PCT/US95/14442 68 disease. Nucleic acid molecules can be delivered to an animal in a variety of methods including, but not limited to, direct injection as "naked" DNA or RNA molecules, such as is taught, for example in Wolff et al., 1990, Science 247, 1465-1468) or packaged as a recombinant virus particle vaccine or as a recombinant cell vaccine delivered to a cell by a vehicle selected from the group consisting of a recombinant virus particle vaccine and a recombinant cell vaccine).

A recombinant virus particle vaccine of the present invention includes a recombinant molecule of the present invention that is packaged in a viral coat and that can be expressed in an animal after administration. Preferably, the recombinant molecule is packaging-deficient. A number of recombinant virus particles can be used, including, but not limited to, those based on alphaviruses, poxviruses, adenoviruses, herpesviruses, and retroviruses.

When administered to an animal, a recombinant virus particle vaccine of the present invention infects cells within the immunized animal and directs the production of a protective protein or RNA nucleic acid molecule that is capable of protecting the animal from disease caused by a parasite of the present invention. A preferred single dose of a recombinant virus particle vaccine of the present invention is from about 1 x 104 to about 1 x 107 virus plaque forming units (pfu) per kilogram body weight of the animal. Administration protocols are similar to those described herein for protein-based vaccines.

WO 96/11706 PCT/US95/14442 69 A recombinant cell vaccine of the present invention includes recombinant cells of the present invention that express at least one protein of the present invention.

Preferred recombinant cells include Salmonella, E. coli, Mycobacterium, S. frugiperda, baby hamster kidney, myoblast G8, COS, MDCK and CRFK recombinant cells, with Salmonella recombinant cells being more preferred. Such recombinant cells can be administered in a variety of ways but have the advantage that they can be administered orally, preferably at doses ranging from about 108 to about 1012 bacteria per kilogram body weight. Administration protocols are similar to those described herein for protein-based vaccines.

Recombinant cell vaccines can comprise whole cells or cell lysates.

Compositions of the present invention can be administered to any animal susceptible to flea infestation, including warm-blooded animals. Preferred animals to treat include mammals and birds, with cats, dogs, humans, cattle, chinchillas, ferrets, goats, mice, minks, rabbits, raccoons, rats, sheep, squirrels, swine, chickens, ostriches, quail and turkeys as well as other furry animals, pets and/or economic food animals, being more preferred. Particularly preferred animals to protect are cats and dogs.

The present invention includes compositions to treat flea infestation by any flea. As such, compositions of the present invention can be derived from any flea species.

Preferred fleas to target include fleas of the following WO 96/11706 PCT/US95/14442 genera: Ctenocephalides, Cyopsyllus, Diamanus (Oropsylla), Echidnophaga, Nosopsyllus, Pulex, Tunga, and Xenopsylla, with those of the species Ctenocephalides canis, Ctenocephalides felis, Diamanus montanus, Echidnophaga gallinacea, Nosopsyllus faciatus, Pulex irritans, Pulex simulans, Tunga penetrans and Xenopsylla cheopis being more preferred. Particularly preferred fleas from which to protect animals include fleas of the species Ctenocephalides felis, Ctenocephalides canis, and Pulex species Pulex irritans and Pulex simulans). It is also within the scope of the present invention to administer compositions of the present invention directly to fleas.

The present invention also includes the use of compositions of the present invention to reduce infestation by other ectoparasites as well as the use of compositions including protease vaccines, anti-protease antibodies and compounds that inhibit protease synthesis and/or activity derived from any ectoparasite to reduce ectoparasite infestation, particularly controlled release formulations containing such compositions. Preferred ectoparasites to target include arachnids, insects and leeches. More preferred ectoparasites to target include fleas; ticks, including both hard ticks of the family Ixodidae Ixodes and Amblyomma) and soft ticks of the family Argasidae Ornithodoros, such as O. parkeri and 0.

turicata); flies, such as midges Culicoides), mosquitos, sand flies, black flies, horse flies, horn WO 96/11706 PCT/US95/14442 71 flies, deer flies, tsetse flies, stable flies, myiasiscausing flies and biting gnats; ants; spiders, lice; mites; and true bugs, such as bed bugs and kissing bugs, including those carrying Chagas disease. Even more preferred ectoparasites to target include fleas, mosquitos, midges, sandflies, blackflies, ticks and Rhodnius.

The following examples are provided for the purposes of illustration and are not intended to limit the scope of the present invention.

Examples Example 1 This Example demonstrates that soluble flea midgut preparations contain serine protease activity as well as leucine aminopeptidase activity.

Using a homogenization sonication protocol as described in U.S. Patent No. 5,356,622, ibid., followed by an about 2 minute centrifugation step at about 10,000 x g, soluble flea midgut preparations were obtained from fed and unfed fleas. Pellets from the centrifugation step were also collected and resuspended for analysis. Also prepared were whole flea lysates. Peptide substrate screening studies using the synthetic chromogenic trypsin substrate BAPNA (Na-benzoyl-DL-arginine-p-nitroanilide; available from Sigma Chemical Co., St. Louis MO) demonstrated significant proteolytic activity in both soluble flea midgut preparations as well as some proteolytic activity in WO 96/11706 PCT/US95/14442 72 resuspended midgut pellets. Soluble unfed flea midgut preparations exhibited about 10 times as much activity as did controls (samples to which no flea midgut fractions were added), whereas soluble fed flea midgut preparations exhibited about 20 times as much activity as did controls.

Whole flea preparations exhibited about 2 to 3 times as much activity as did controls.

The ability of soluble fed and unfed flea midgut preparations to cleave BAPNA was almost completely inhibited nearly 100%) by aprotinin (available from Sigma), whereas PMSF (phenylmethane-7-sulfonyl fluoride; available from Sigma) inhibited such proteolytic activity by about 50%. EDTA inhibited proteolytic activity of the preparations by about 10%, whereas addition of calcium ions stimulated proteolytic activity by about 25%. These results indicate the presence of serine protease activity, and more particularly of trypsin-like activity, in these soluble flea midgut preparations. These results also suggest the presence of serine protease isoforms in the preparations. It is also of interest to note that flea trypsin-like activity appears to be distinctive from that of mosquitos in that mosquito trypsins are not affected by EDTA or calcium ions.

Using a methyl-hemoglobin substrate, the pH optimum of the proteolytic activity in the soluble flea midgut preparations was found to be between pH 7 and pH 9, with a pH of about pH 8 giving the best activity. Such pH optima suggest the presence of serine proteases in soluble flea WO 96/11706 PCTIUS95/14442 73 midgut preparations.

Soluble preparations of both unfed and fed flea midgut soluble preparations also were able to cleave the leucine aminopeptidase specific substrate LPNA (L-leucine-pnitroanilide; available from Sigma) using standard conditions, indicating the presence of leucine aminopeptidase (LAP) activity in such preparations.

Example 2 The following example evaluated the number of proteases in flea midguts that could be assessed by protease substrate gel analysis.

Protease substrate gels (available from Novex, San Diego, CA, as Novex Zymogels) were 10% polyacrylamide-SDS gels with 0.1% gelatin. Samples and gels were processed according to Novex instructions. Briefly, samples were diluted in SDS-PAGE sample buffer without reducing agents.

Tris-glycine SDS-PAGE was carried out by standard procedures. After electrophoresis, gels were incubated in 0.25% Triton X-100 at room temperature for 30 minutes (min), then in developing buffer (50 mM (millimolar) Tris- HC1 pH 7.0, 5 mM CaC1 2 0.02% Brij 35, 0.2 M (molar) NaCl) at room temperature for 30 min, and then incubated with fresh developing buffer at 37°C, usually overnight. Gels were then stained 30 min in 0.5% coomassie R-250, methanol, 10% acetic acid and destained in 40% methanol, acetic acid.

The following flea midguts were dissected directly WO 96/11706 PCT/US95/14442 74 into sample buffer: 100 midguts from unfed males; 100 midguts from unfed females; 100 midguts from fed males; and 100 midguts from fed females. Samples containing 10 or midguts each were evaluated using protease substrate gel analysis and numerous negative staining bands were observed. The general pattern was the same for female and male midguts, although there appeared to be more activity in gel lanes containing female midguts. There were distinct differences noted between gel lanes containing fed and unfed midguts. There was a definite increase in overall activity in the fed midgut lanes, and, in addition, there were differences in the band patterns.

Fed and unfed female midguts were further evaluated using protease substrate gel analysis and the results are shown in Fig. 1. The protease substrate gel shown in Fig.

1 demonstrates the relative proteolytic activity in 1, 2, or 10 midguts from either fed or unfed female fleas.

Specifically, lane 1 contains a set of molecular weight markers. Lanes 2 through 5 contain, respectively, 10, 2 and 1 unfed midguts. Lanes 6 through 9 contain, respectively, 1, 2, 5 and 10 fed midguts. Lane 10 contains 100 gg of dried bovine blood.

Proteolytic activity could easily be detected in one fed or one unfed female midgut, although there was considerably more activity in the fed midgut. Lane evaluated 100 Ag of dried bovine blood to assess if the increase in activity seen in the fed midgut lane was due to proteases in the blood meal. No activity was seen in the WO 96/11706 PCT/US95/14442 blood lane.

Example 3 This example evaluated the protease classes present in flea midguts.

Three unfed female midguts and 0.75 fed female midguts were evaluated in duplicate in several protease substrate gels. Each gel was cut in half. Half was processed as described in Example 2, while the other half contained protease inhibitors in all incubation buffers. The following inhibitors were evaluated: the serine protease inhibitor AEBSF (available from Boehringer Mannheim, Indianapolis, IN) was used at a final concentration of 1 mM; the serine protease inhibitor soybean trypsin inhibitor (available from Sigma) was used at a final concentration of 100 jg/ml (milliliter); the cysteine and serine protease inhibitor leupeptin (available from Sigma) was used at a final concentration of Ag/ml; the aminopeptidase inhibitor bestatin (available from Sigma) was used at a final concentration of 0.25 mM; the metalloprotease inhibitor EDTA (available from Sigma) was used at a final concentration of 2 mM; and the cysteine protease E-64 (available from Sigma) was used at a final concentration of 10 Ag/ml.

AEBSF, soybean trypsin inhibitor and leupeptin were the only inhibitors to have any effect at the sensitivity ww WO 96/11706 PCT/US95/14442 76 of this assay. It was determined that serine proteases were the predominant, if not only, proteases present in the midgut preparations evaluated. Fig. 2 shows a protease substrate gel with fed (lanes 2 and 4) and unfed (lanes 1 and 3) midgut preparations with (lanes 3 and 4) and without (lanes 1 and 2) AEBSF. Residual activity in the inhibitor lanes could have been due to proteolysis that occurred during electrophoresis and prior to saturation of the gel with inhibitor in the incubation buffers.

Example 4 This Example evaluates protease activity contained in a soluble fed midgut preparation of the present invention.

Mixed-sex fed flea midguts were processed as described in U.S. Patent No. 5,356,622, ibid. Aliquots of several steps of the procedure were evaluated by loading an equivalent of 0.4 midguts per lane of a protease substrate gel as described in Example 2. The results are shown in Fig. 3. Samples were from the low speed supernatant (lanes 2 and sonicated midguts (lanes 3 and 10), high speed supernatant (lanes 4 and 11), combined low and high speed supernatants (FGS) (lanes 5 and 12) and the high speed pellet (lanes 6 and 13). Lanes 7 and 8 contained nanograms (ng) of trypsin as a control. Duplicate lanes were evaluated. The gel was cut in half, and lanes 1-7 were processed as described in Example 2, and lanes 8-14 were processed with 100 Ag/ml soybean trypsin inhibitor in all the incubation buffers.

WO 96/11706 PCTIUS95/14442 77 Protease activity was seen in all preparations, the most being observed in the FGS lane (lane It was also evident that the majority of the activity was inhibited by soybean trypsin inhibitor, a serine protease inhibitor.

Example This Example demonstrates the increase in flea midgut protease activity after blood feeding by fleas.

Fleas were fed on a dog for 15 minutes. At timed intervals after feeding, two midguts were dissected directly into sample buffer and proteases evaluated by protease substrate gel analysis as described in Example 2.

Fig. 4 depicts a gel showing midgut protease activity at min (lane 1 hr (lane 2 hr (lane 4 hr (lane 4), 6 hr (lane 8 hr (lane 24 hr (lane 7) and 56 hr (lane 8) after blood feeding ended.

Increases in proteolytic activity were first observed 2 hr (lane 3) after feeding, although at 4 hr (lane 4) there was a much greater increase in activity noted. This increase in activity was still noticed 56 hr after feeding (lane 8).

Example 6 This Example evaluates the effect of a number of protease inhibitors on flea viability and fecundity in a flea feeding system as described by Wade et al. ibid.

The following protease inhibitors were tested at the indicated final concentrations in blood meals: WO 96/11706 PCTIUS95/14442 78 Aminopeptidase inhibitor bestatin at 1.3 mM and 13 mM; Aspartic acid protease inhibitor pepstatin A at 1 4g/ml and 10 jg/ml; Cysteine protease inhibitor E-64 at 1 jg/ml and jg/ml.

Metalloprotease inhibitor phosphoramidon at 10 jg/ml and 100 jg/ml; and the following serine protease inhibitors: AEBSF at 0.3 mM, 0.5 mM, 5.0 mM and 6.0 mM; Aprotinin at 2 jg/ml and 20 jg/ml; Leupeptin at 5 jg/ml and 50 jg/ml; Soybean trypsin inhibitor at 10 jg/ml and 100 Aig/ml; Soybean trypsin/chymotrypsin inhibitor at jg/ml and 100 ig/ml; AEBSF is available from Boehringer Mannheim; all other listed inhibitors are available from Sigma.

Protease inhibitor compounds were tested in groups of 3 to 6 including appropriate control groups. Inhibitors were not tested in groups of common inhibition types.

Rather, they were tested in groups based on the diluent needed to dissolve them. (AEBSF, aprotinin, bestatin, leupeptin, phosphoramidon, soybean trypsin inhibitor and soybean trypsin/chymotrypsin inhibitor were dissolved in water; E-64 and pepstatin were dissolved in ethanol). This reduced the number of control (diluent only) groups needed within a particular assay. Inhibitor concentrations were chosen such that the lower concentration used was within WO 96/11706 PCT/US95/14442 79 the range recommended by the supplier for that inhibitor.

The higher concentration was typically 10 times above the lower concentration and was used to look for dose response.

The general protocol for all of the assays was as follows: Approximately 2000 newly emerged adult fleas were placed in feeding chambers to feed on normal blood for about 24 to 48 hr. The fleas were prefed for two reasons: The first was to be certain that only fleas that would feed in the feeding system were used in the comparative study.

The second was to prime female fleas for egg laying, since female fleas typically do not begin laying maximal numbers of eggs per day until the third day of feeding.

The prefed fleas were placed in "minifeeder" feeding chambers at a ratio of about 80 female fleas to about male fleas for a total of about 100 fleas per chamber.

Actual total number of fleas per chamber varied from about to 125 fleas. Previous experiments have not demonstrated any differences in adult survival or fecundity based on such variance in numbers of fleas in a chamber.

Three chambers were prepared for each experimental and control group. A fresh blood meal containing the appropriate inhibitor in 3 ml total volume was placed on each chamber daily through the 7 day extent of an assay.

On days 3, 5, and 7 of the assay, surviving adult fleas were transferred to clean chambers. The contents of the original chambers were dissolved in about 40 ml of PBS (phosphate-buffered saline) in a 50 ml Falcon tube. The contents of a given tube were then filtered through a pre- WO 96/11706 PCTfUS95/14442 weighed #1 Whatman filter disk inserted into a vacuum filter. The 50 ml tube and the filter funnel were rinsed with distilled water which was then passed through the filter. Once the chamber contents had been filtered, dead adult fleas were removed from the filter paper and placed in a labelled tube so that they could be counted and sexed.

The filter paper was then placed into a preweighed 12 x polypropylene tube and dried in the SpeedVac for 2.5 hr with the heater on. After drying the filter paper was weighed. The weight of the filter paper and tube was subtracted to obtain the dry weight of the eggs and this value was converted to an estimated number of eggs using the formula y 4 1384.361x 162.37, where x dry weight of eggs.

On day 7, adult fleas that had survived the study were frozen, counted and sexed. The numbers were added to the number of male and female fleas that had died during the assay to verify the number of male and female fleas in each chamber at the start of the study.

Female, male and total adult flea survival were calculated for all experimental and control groups on days 3, 5, and 7 of each assay. Additionally, the number of eggs per surviving female was calculated on days 3, 5 and 7. Female fleas found dead on a given collection date were included in the total number of egg-laying females for the days between that date and the previous collection date, providing a conservative estimate of fecundity. Fecundity values were averaged for the three collection dates to WO 96/11706 PCT/US95/14442 81 obtain an average for each group over 7 days.

Results of these studies are presented below in Table 1 and Fig. 6 through Fig. 9. All survival and fecundity values are presented below as a percent of control value.

TABLE 1 Effect of Protease Inhibitors on Flea Viability and Fecundity Compound Conc. Fecundity 1 Adult Survival' Days 1-7 Female Male Total

AEBSF

mM 17.2% 4.1% 0.0 3.4% mM 1.4% 6.8% 0.0% 5.6% mM 95.0% 103.9% 104.2% 103.6% 0.3 mM 82.4% 116.2% 103.0% 111.9% Aprotinin ug/ml 84.2% 100.0% 101.7% 99.9% 2 ug/ml 83.2% 103.2% 104.9% 103.3% Leupeptin 50 ug/ml 77.6% 101.5% 111.7% 104.6% 5 ug/ml 85.0% 71.0% 61.4% 68.4% Soybean Trypsin Inhibitor 100 ug/ml 79.1% 76.5% 76.0% 76.3% ug/ml 96.1% 80.1% 101.7% 83.9% Trypsin/Chymotrypsin Inhibitor 100 ug/ml 81.1% 88.0% 95.4% 89.9% ug/ml 100.7% 115.1% 143.5% 120.7% E-64 ug/ml 177.4% 110.2% 139.0% 114.2% 1 ug/ml 109.4% 99.9% 102.9% 100.1% 10 ug/ml 84.1% 90.2% 91.1% 90.6% 1 ug/ml 95.2% 77.3% 80.0% 77.5% Phosphoramidon 100 ug/ml 84.9% 70.2% 64.6% 69.7% ug/ml 89.0% 98.8% 95.2% 97.8% Pepstatin

A

ug/ml 83.9% 113.6% 133.4% 116.2% 1 ug/ml 67.7% 77.6% 96.6% 80.5% Bestatin 13.0 mM 23.3% 121.0% 103.4% 117.0% 1.3 mM 60.4% 119.5% 116.3% 116.8% SAll experimental values are expressed as a percent of the corresponding control group.

WO 96/11706 PCT/US95/14442 82 The aminopeptidase inhibitor bestatin caused a significant (p 0.05) reduction in fecundity at 13 mM (77% reduction) and at 1.3 mM (40% reduction) indicating the presence of an aminopeptidase or other exopeptidase in flea midguts. Bestatin at the concentrations tested, however, had no significant effect on adult viability at either concentration. These results suggest that aminopeptidases may play a role in ovarian function, or a related process, such as vitellogenesis.

The aspartic acid protease inhibitor pepstatin

A

caused a significant reduction (p 0.05) in fecundity at 1 gg/ml (32% reduction), but not at 10 gg/ml. Pepstatin A had no significant effect on adult viability at either concentration.

The cysteine protease inhibitor E-64 showed no statistically significant reduction in fecundity in this assay. There was a small, but significant (p 0.05), reduction in total adult flea survival when E-64 was dissolved in grain alcohol and added to blood at 1 Ag/ml.

However, this reduction was not evident in the group that was fed blood containing 10 gg/ml E-64 in grain alcohol.

The metalloprotease inhibitor phosphoramidon caused a reduction in adult viability of about 30%, which, however was not statistically significant. There was no significant reduction in fecundity.

Results using serine protease inhibitors were particularly interesting and suggest the significance of serine proteases in flea midguts. AEBSF administered at WO 96/11706 PCT/US95/14442 83 concentrations ranging from about 5 mM to about 6 mM reduced flea fecundity by more than 80%. In addition, adult survival was reduced to near zero (p 0.05).

Aprotinin, however, had no significant effect on either fecundity or viability, likely due to the ability of serum proteins, such as albumin, to interfere with aprotinin's inhibitory activity.

Leupeptin had no effect on fecundity at both concentrations, but reduced adult viability by 30% at gg/ml. However, adult viability was not affected by gg/ml leupeptin and none of the observed reductions were statistically significant.

Soybean trypsin inhibitor caused a small statistically insignificant reduction in fecundity at 100 gg/ml. The lower concentration had no effect. Soybean trypsin inhibitor, on the other hand, is very effective in in vitro studies as disclosed in several of the examples and was used to purify serine proteases as disclosed in Example 7. Soybean trypsin/chymotrypsin inhibitor had no effect on adult viability or fecundity.

Example 7 This Example describes the production of a preferred soluble flea midgut preparation of the present invention and purification of flea serine proteases therefrom. Also included is amino acid sequence analysis of a flea serine protease of the present invention.

The soluble flea midgut preparation was prepared as WO 96/11706 PCTfUS95/14442 84 follows. Flea midguts (3,735) from a mix of female and male fed fleas were homogenized in a homogenization buffer comprising 1.5 ml 50 mM Tris-HCl, 0.5 M NaCl, pH 8.5. The homogenate was centrifuged at 14,000 x g for 10 min. The resultant pellet was processed again in another 1.5 ml of the homogenization. The two supernatant solutions were combined to form the soluble flea midgut preparation.

The preparation was added to 3 ml of paminobenzamidine-sepharose 6 B (affinity matrix for trypsin-like proteases, available from Sigma) and incubated at 5°C overnight on a rocker. The sepharose beads were drained and washed with 7.5 ml of the homogenization buffer. The adsorbed proteins were eluted with 5 ml 0.1 M p-aminobenzamidine in the same buffer. This eluate was concentrated and the buffer exchanged to 50 mM Tris-HCl pH 0.1 mM CaC1 2 by ultrafiltration through a membrane with a 3 kD cutoff, the final volume being 140 pl (microliters).

Labeling of proteins was performed by adding 10 pl of (1,3- 3 H)-diisopropylfluorophosphate (available from New England Nuclear, Beverly, MA, at 6.0 Ci (Curies) mmole, mCi/ml) to 90 Al of the affinity purified proteins and incubating at 5°C for 18 hours. The reaction was divided in half, each half then being separated by C4 reverse phase chromatography according to the following protocol: WO 96/11706 PCTIUS95/14442 Buffer A: 0.1% TFA in water Buffer B: 0.085% TFA, 90% Acetonitrile 0.8 ml/min, 220 nm, 1 min fractions 5.6% B 15 min 5.6% to 100% B over 60 min Ten microliters of each fraction was added to scintillation fluid and counted. Most protein-associated counts were found in fractions 44-47. Fig. 5A shows electrophoresis of fractions 40 (lane 44 (lane 46 (lane 4) and 47 (lane 5) from one chromatography run through a 14% Trisglycine polyacrylamide-SDS gel, followed by coomassie staining. This gel was then processed with Entensigy

(NEN)

and exposed to film for 18 hours, as shown in Fig. Each fraction contained several proteins as shown in Fig.

5A, but only 4 bands were labeled, the most prominent being 26 kd (seen in lanes 3, 4 and and denoted herein as PfSP26. A faint band of 24 kd, denoted herein as PfSP24, was also noticed in lane 5. A band of 19 kD, denoted herein as PfSP19, was labeled in lane 4 that was associated with a very faintly staining protein band. Some labeled proteins were seen at the dye front of lanes 4 and indicating a molecular weight less than 6 kd, denoted herein as PfSP6, and could be degradation products.

Fraction 44 (analogous to lane 3) from a second C4 chromatography separation experiment was electrophoresed, blotted onto PVDF, stained with Coomassie R-250 and destained via standard procedures. The 26 kd band, corresponding to PfSP26 (also referred to herein as PfSP44- WO 96/11706 PCT/US95/14442 86 E, indicating the fraction in which the protein eluted and the gel/filter band from which the protein was excised), was excised and subjected to N-terminal amino acid sequencing using techniques known to those skilled in the art. A partial N-terminal amino acid sequence of about 32 amino acids was deduced and is represented herein as SEQ ID NO:1: I IGGEVAGEGSAPYQVSLRTKEGNHF

S

G G S I L, It should be noted that since amino acid sequencing technology is not entirely error-free, SEQ ID NO:1 represents, at best, an apparent partial N-terminal amino acid sequence of PfSP26. This caution is particularly relevant in light of the sequencing of this protein having been done at a low picomolar concentration.

A homology search of the non-redundant protein sequence database was performed through the National Center for Biotechnology Information using the BLAST network.

This database includes +SwissProt PIR SPUpdate GenPept GPUpdate.ole level. Results of the search indicate that the N-terminus of PfSP26 shares significant amino sequence homology with a number of serine proteases, including a variety of trypsins, chymotrypsins and plasmins. The 32-amino acid N-terminal amino acid sequence of PfSP26 shared the highest degree of homology with a hornet chymotrypsin

II.

WO 96/11706 PCT/US95/14442 87 Example 8 This example describes the cloning of certain flea protease nucleic acid molecules of the present invention.

This example also describes the production of certain recombinant molecules, recombinant cells and flea protease proteins of the present invention.

Several flea serine protease nucleic acid molecules, ranging in size from about 250 to about 500 nucleotides, and representing one or more partial flea serine protease genes, were PCR amplified from a fed flea midgut cDNA library that was prepared from RNA isolated from fed flea midguts using standard protocols as described in Sambrook et al., ibid. Several pairs of primers were used in PCR amplification reactions that represented degenerate oligonucleotides designed from published sequences of serine protease genes isolated from biting insects mosquitos and black flies). Each primer pair was designed so that a properly amplified fragment of a flea serine protease gene would include a domain corresponding to the most conserved domain of trypsin protease genes (thought to be the active site) given that such a domain is contained in flea serine protease gene(s).

The amplified PCR fragments were of predicted size, ranging from about 250 nucleotides to about 500 nucleotides, depending on which primer pairs were used.

PCR fragments that hybridized to a probe designed from the domain most conserved among all known trypsin genes were gel purified and cloned, for example, into the pCRII WO 96/11706 PCT/US95/14442 88 cloning vector (available from InVitrogen, Corp., San Diego, CA), following manufacturer's instructions. Nucleic acid sequences of the fragments are being determined using standard techniques.

The amplified PCR fragments are also being used as probes to identify full-length flea protease genes in unfed and fed flea midgut cDNA libraries and in flea salivary gland cDNA libraries, as well as in flea genomic

DNA

libraries, using standard procedures.

Recombinant molecules and recombinant cells including the amplified PCR fragments as well as full-length flea protease genes are being produced using standard procedures. Culturing of such recombinant cells leads to the production of flea protease proteins of the present invention.

Example 9 This Example describes the testing of a flea protease protein as a flea protease vaccine of the present invention, that is for the ability of such a protein, upon administration to an animal, to elicit the production of antibodies that reduce flea protease activity and, as such, reduce flea viability and/or fecundity. This Example also demonstrates the use of such a flea protease protein as a vaccine on a dog subsequently infested with fleas.

A flea protease protein produced as described in Example 7 is administered to rabbits according to a standard immunization protocol known to those skilled in WO 96/11706 PCT/US95/14442 89 the art, including appropriate booster shots. Such a protein is also administered to guinea pigs and to dogs following a similar protocol.

Sera is collected from the treated rabbits and is verified to contain anti-flea protease antibodies. Such sera is then fed to fleas in a feeding system as reported by Wade et al. ibid. Fleas feeding on such a sera show reduced viability compared to fleas feeding on sera collected from rabbits not administered the flea protease protein. Sera from treated guinea pigs and dogs are verified in a similar manner.

Dogs treated with a flea protease protein are then infested with fleas as are dogs not treated with a flea protease protein. Dogs treated with a flea protease protein show a significant reduction in flea burden compared to untreated dogs.

Example This Example describes the determination of the partial N-terminal amino acid sequence of additional flea serine protease proteins of the present invention.

An additional eight flea serine proteases were purified and consensus partial N-terminal amino acid sequences were determined as described in Example 7. The results are as follows, the proteins being named by the fraction in which they were eluted and the SDS-PAGE gel band from which they were excised. Each of the proteases bore at least some sequence homology to known proteases, WO 96/11706 PCT/US95/14442 the highest percent identity estimated to be no more than about 30-40%.

Flea protease PfSP45-C had a partial N-terminal amino acid sequence of XV G G H D T S I D X H P H Q V T, also represented herein as SEQ ID NO:2. PfSP45-C was most similar in amino acid sequence to a fruit fly trypsin epsilon.

Flea protease PfSP46-C had a partial N-terminal amino acid sequence of I V G G A D A A P G N A P F Q V S L R D K G, also represented herein as SEQ ID NO:3. PfSP46-C was most similar in amino acid sequence to a collagenolytic 36 kD protease from a Kamchatda crab.

Flea protease PfSP46-A had a partial N-terminal amino acid sequence of IV G G Q DAD I A K Y G Y Q A S L Q V F N E H F X G A X I L N N Y, also represented herein as SEQ ID NO:4. PfSP46-A was most similar in amino acid sequence to a hornet chymotrypsin

II.

Flea protease PfSP46-B had a partial N-terminal amino acid sequence of I V G G T D V N I E N F G W Q V S L F D R N G H F, also represented herein as SEQ ID NO:5. PfSP46-B was most similar in amino acid sequence to a fruit fly trypsin beta.

Flea protease PfSP48-A had a partial N-terminal amino acid sequence of I V G G H D T S I D K H P F Q V S L I D K N, also represented herein as SEQ ID NO:6. PfSP48-A was most similar in amino acid sequence to a fruit fly trypsin epsilon.

Flea protease PfSP48-B had a partial N-terminal amino WO 96/11706 PCT/US95/14442 91 acid sequence of V V G G L E A A E GS AP Y Q V X L Q W G N F, also represented herein as SEQ ID NO:7. PfSP48-B was most similar in amino acid sequence to a human Factor 12.

Flea protease PfSP48-D had a partial N-terminal amino acid sequence of I V G G E D A E L G E X P T Q, also represented herein as SEQ ID NO:8. PfSP48-D was most similar in amino acid sequence to a bovine Factor 9.

Flea protease PfSP40-B had a partial N-terminal amino acid sequence of D E D G K D D S A P G E I, also represented herein as SEQ ID NO:9. PfSP40-B was most similar in amino acid sequence to a fruit fly furin-like protease I.

Example 11 This Example describes the isolation of nucleic acid molecules encoding flea serine protease proteins of the present invention.

Several midgut proteinase cDNA genes have been isolated in a manner similar to that described in Example 8, using two degenerate primers, the design of which was based on a highly conserved serine proteinase amino acid sequence (C Q/N G D S G G P L, denoted SEQ ID located about 195 amino acid residues (based on an average protease size of about 240 residues) from the mature amino terminus in a number of known serine proteases.

Complementing primers for use in the PCR amplification reaction were primers corresponding to the vectors in which nucleic acid molecules of the present invention had been WO 96/11706 PCT/US95/14442 92 ligated. The actual primers used in PCR amplification of serine protease nucleic acid molecules from whole fed flea cDNA expression libraries (produced as described in Example 8) included the following serine protease specific primers: cat-try #1 having nucleic acid sequence 5' TAA WGG WCC WCC YGA ATC TCC CTG GCA 3' (Y indicating C or T; W indicating A or represented herein as SEQ ID NO:11; and cat-try #2 having nucleic acid sequence 5' TAA WGG WCC AGA RTC TCC TTG ACA 3' (R indicating A or represented herein as SEQ ID NO:12. Vector specific primers included: M13 Reverse having nucleic acid sequence GGAAACAGCTATGACCATG represented herein as SEQ ID NO:13; and T3 Primer having nucleic acid sequence ATTAACCCTCACTAAAG 3' represented herein as SEQ ID NO:14.

The resultant PCR products, obtained using standard

PCR

conditions Sambrook et al., ibid.), were about 600 to about 700 nucleotides in length.

The PCR products were hybridized under standard hybridization conditions Sambrook et al., ibid.) with to) an internal synthetic oligonucleotide probe named H57, the sequence of which corresponds to a region including a conserved histidine residue in known serine proteases. The nucleic acid sequence of H57 is 5' TGG GTW GTW ACW GCW GCW CAT TG 3' represented herein as SEQ ID NO:15. PCR products which hybridized strongly to the probe were gel purified and cloned into the TA Vector" (available from InVitrogen, Corp.). Approximately 80 recombinant

TA

vector clones were isolated. To prevent repetitive WO 96/11706 PCT/US95/14442 93 sequencing of the same serine proteinase clones, a number of the clones were characterized to identify those having unique restriction endonuclease patterns using the enzymes HaeII and HaeIII. About 11 plasmids apparently containing unique flea serine proteinase nucleic acid molecules of about 600 to about 700 nucleotides in length were isolated using this procedure. These nucleic acid molecules were subjected to nucleic acid sequencing using the Sanger dideoxy chain termination method, as described in Sambrook et al., ibid.

The complete nucleic acid sequence of one of the flea serine protease nucleic molecules, namely nfSP4 672 is represented herein as SEQ ID NO:16. Translation of SEQ ID NO:16 yields a protein of about 223 amino acids, denoted PfSP4 223 having amino acid sequence SEQ ID NO:17. Although the entire amino acid sequence of PfSP4 223 is not highly conserved to that of known serine proteases, there are several conserved regions of note (as numbered for SEQ ID NO:17), including: the sequence IVGG spanning from about amino acid 5 through about amino acid 9; the active-site histidine at about amino acid 46 and surrounding sequences spanning from about amino acid 41 through about amino acid 47; the conserved aspartic acid residue at about amino acid 90; the GWG sequence spanning from about amino acid 124 through about amino acid 126; the conserved cysteines at about amino acid 152 and about amino acid 165; and the conserved sequence around the active site serine, spanning from about amino acid 174 WO 96/11706 PCT/US95/14442 94 through about amino acid 182.

Nucleic acid and amino acid sequences of all 11 flea serine protease nucleic acid molecules were determined for the regions corresponding to the region in known serine proteases to span from the conserved GWG sequence to the conserved CXGDSGGP sequence (denoted SEQ ID NO:10). Flea nucleic acid molecule nfSP1 156 has the nucleic acid sequence represented herein as SEQ ID NO:18, which encodes a protein PfSP1 52 having an amino acid sequence represented herein as SEQ ID NO:19. Flea nucleic acid molecule nfSP2 168 has the nucleic acid sequence represented herein as SEQ ID which encodes a protein PfSP2 56 having an amino acid sequence represented herein as SEQ ID NO:21. Flea nucleic acid molecule nfSP3 177 has the nucleic acid sequence represented herein as SEQ ID NO:22, which encodes a protein PfSP3 59 having an amino acid sequence represented herein as SEQ ID NO:23. Flea nucleic acid molecule nfSP4 156 has the nucleic acid sequence represented herein as SEQ ID NO:24, which encodes a protein PfSP4 52 having an amino acid sequence represented herein as SEQ ID NO:25. Flea nucleic acid molecule nfSP5 159 has the nucleic acid sequence represented herein as SEQ ID NO:26, which encodes a protein 53 having an amino acid sequence represented herein as SEQ ID NO:27. Flea nucleic acid molecule nfSP6 168 has the nucleic acid sequence represented herein as SEQ ID NO:28, which encodes a protein PfSP6 56 having an amino acid sequence represented herein as SEQ ID NO:29. Flea nucleic acid molecule nfSP7 159 has the nucleic acid sequence WO 96/11706 PCT/US95/14442 represented herein as SEQ ID NO:30, which encodes a protein PfSP7 53 having an amino acid sequence represented herein as SEQ ID NO:31. Flea nucleic acid molecule nfSP818 has the nucleic acid sequence represented herein as SEQ ID NO:32, which encodes a protein PfSP8 62 having an amino acid sequence represented herein as SEQ ID NO:33. Flea nucleic acid molecule nfSP916 has the nucleic acid sequence represented herein as SEQ ID NO:34, which encodes a protein PfSP9 56 having an amino acid sequence represented herein as SEQ ID NO:35. Flea nucleic acid molecule nfSP101 20 has the nucleic acid sequence represented herein as SEQ ID NO:36, which encodes a protein PfSP10 40 having an amino acid sequence represented herein as SEQ ID NO:37. Flea nucleic acid molecule nfSPll16 has the nucleic acid sequence represented herein as SEQ ID NO:38, which encodes a protein PfSP11 54 having an amino acid sequence represented herein as SEQ ID NO:39.

Comparison of the nucleic acid sequences of the flea serine proteases with that of a mosquito aegypti) trypsin indicates that SEQ ID NO:18 is about 33% identical, SEQ ID NO:20 is about 33% identical, SEQ ID NO:22 is about 24% identical, SEQ ID NO:24 is about 25% identical, SEQ ID NO:26 is about 32% identical, SEQ ID NO:28 is about 38% identical, SEQ ID NO:30 is about 33% identical, SEQ ID NO:32 is about 33% identical, SEQ ID NO:34 is about identical, SEQ ID NO:36 is about 33% identical, and SEQ ID NO:38 is about 29% identical, to the corresponding region of the mosquito trypsin. Comparison of the nucleic acid WO 96/11706 PCTfUS9514442 96 sequences of the flea serine proteases with that of a black fly vittatum) trypsin indicates that SEQ ID NO:18 is about 34% identical, SEQ ID NO:20 is about 34% identical, SEQ ID NO:22 is about 25% identical, SEQ ID NO:24 is about 28% identical, SEQ ID NO:26 is about 36% identical, SEQ ID NO:28 is about 45% identical, SEQ ID NO:30 is about 29% identical, SEQ ID NO:32 is about 36% identical, SEQ ID NO:34 is about 42% identical, SEQ ID NO:36 is about 34% identical, and SEQ ID NO:38 is about 30% identical, to the corresponding region of the black fly trypsin. It is to be noted that the mosquito and black fly trypsins are about identical in the same regions.

Comparison of the amino acid sequences of the flea serine proteases with that of a mosquito aegypti) trypsin indicates that SEQ ID NO:19 is about 11% identical, SEQ ID NO:21 is about 30% identical, SEQ ID NO:23 is about 19% identical, SEQ ID NO:25 is about 19% identical, SEQ ID NO:27 is about 28% identical, SEQ ID NO:29 is about 21% identical, SEQ ID NO:31 is about 14% identical, SEQ ID NO:33 is about 22% identical, SEQ ID NO:35 is about identical, SEQ ID NO:37 is about 22% identical, and SEQ ID NO:39 is about 29% identical, to the corresponding region of the mosquito trypsin. Comparison of the amino acid sequences of the flea serine proteases with that of a black fly vittatum) trypsin indicates that SEQ ID NO:19 is about 14% identical, SEQ ID NO:21 is about 28% identical, SEQ ID NO:23 is about 16% identical, SEQ ID NO:25 is about 17% identical, SEQ ID NO:27 is about 35% identical, SEQ ID WO 96/11706 PCT/US95/14442 97 NO:29 is about 33% identical, SEQ ID NO:31 is about 11% identical, SEQ ID NO:33 is about 22% identical, SEQ ID is about 33% identical, SEQ ID NO:37 is about 21% identical, and SEQ ID NO:39 is about 25% identical, to the corresponding region of the black fly trypsin. It is to be noted that the mosquito and black fly trypsins are about identical in the same regions.

Partial N-terminal amino acid sequences were deduced for each of the cloned flea serine protease nucleic acid molecules, four of which were identical to the following amino acid sequences derived from N-terminal sequencing of serine proteases as described in Example 10: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:7. The remaining nucleic acid molecules had the following deduced N-terminal amino acid sequences: SEQ ID NO:40, namely I V G G E N A KEKS DVPYQVS LRNAENKHFCGGAII

DDY

W V L T, which was most similar in amino acid sequence to mite fecal allergen Der pIII; SEQ ID NO:41, namely I V G G L E A K N G S A P F M V S L Q A E D Y F H, which was most similar in amino acid sequence to a chymotrypsin-like protein; SEQ ID NO:42, namely I I G G E V A G E G S A P Y Q V S L R T K E G N H F, which was most similar in amino acid sequence to a chymotrypsin-like protein; SEQ ID NO:43, namely IV G G T A V D I R G F P G R Y Q F K P K P S F L W W F Y, which did not substantially match any protein in the data base; SEQ ID NO:44, namely I V N G L E A G V G Q F P IQ V F L D L T N I R D E K S R C G G A L F, which was most similar in amino acid sequence to a trypsin precursor; SEQ WO 96/11706 PCT/US95/14442 98 ID NO:45, namely IV GG L E A K N G I T P F I G F F A S G R L F, which was most similar in amino acid sequence to a chymotrypsin-like protease; SEQ ID NO:46, namely I V G G N D V S X K I F W Q V S I Q S N X Q H F C G, which was most similar in amino acid sequence to a trypsin; and SEQ ID NO:47, namely I I G G E D A P E G S A P Y Q V S L R N Q N L E H F C G G S I, which was most similar in amino acid sequence to a chymotrypsin-like protein.

Additional amino terminal and carboxyl terminal sequences of flea serine protease nucleic acid molecules comprising sequences listed above as well as additional nucleic acid molecules identified using the techniques described herein are presented in Table 2.

TABLE 2 Additional Flea Serine Protease Sequences A. The apparent N-terminal nucleic acid sequence (SEQ ID NO:52), as well as deduced amino acid sequence (SEQ ID NO:53) of nfSPl is: TCA GCA CTC GTT GCC TTG TCT GCA GCT ATT CCT CAC TCC AAC AGA GTC S A L V A L S A A I P H S N R V GTT GGA GGA CTG GAA GCT GCA GAG GGT TCT GCA CCT TAT CAA GTA TCC V G G L E A A E G S A P Y Q V S TTG CAA GTT GGC AAC TTC CAC TTC TGT GGT GGT TCA ATT CTG AAC GAA L Q V G N F H F C G G S I L N E TAT TGG GTT TTG ACT GCT GCT CAC TGT TTG GGT TAT GAC TTC GAC GTG Y W V L T A A H C L G Y D F D V GTA GTT GGA ACA AAC AAA CTT GAT CAA CCA GGT GAA AGA TAC CTC GTA V V G T N K L D Q P G E R Y L V GAA CAA ACT TTT GTT CAC E Q T F V H B. The apparent N-terminal nucleic acid sequence (SEQ ID NO:54), as well as deduced amino acid sequence (SEQ ID NO:55) of nfSP2 is: TTA GAT GGG CGC ATT GTT GGA GGA CAA GAT GCT GAT ATT GCC AAA TAT L D G R I V G G Q D A D I A K Y GGC TAT CAA GCT TCA CTC CAA GTA TTT AAC GAA CAT TTC TGT GGA GCT G Y Q A S L Q V F N E H F C G A WO 96/11706 PCTIUS95/14442 99 TCA ATA TTG AAT AAT TAT TGG ATT GTC ACA GCA GCT CAT TGC ATA TAT S I L N N Y W I V T A A H C I Y GAT GAA TTC ACG TAT TCA GTT CGA GTC GGC ACC AGT TTC CAA GGA AGA D E F T Y S V R V G T S F Q G R CGT GGT TCC GTT CAT CCT GTG GCA CAA ATT ATC AAG CAT CCT GCA TAC R G S V H P V A Q I I K H P A Y C. The apparent N-terminal nucleic acid sequence (SEQ ID NO:56), as well as deduced amino acid sequence (SEQ ID NO:57) of nfSP4 is: AGG GAA CAA AAG CTG GAG CTC CAC CGC GGT GCG CCG GCT CTA GAA CTA R E Q K L E L H R G A P A L E L GTG GAT CCC CCG GGT CTG CAG GAA TTG GCA CGA GGA TGT TCT TGG CTG V D P P G L Q E L A R G C S W L TGT TTA GTA GCT ATT CTT TGT GCA GTG GCT GCT GGG CCT ACT AAT CGC C L V A I L C A V A A G P T N R ATT GTT GGA GGA TTG GAG GCG AAA AAT GGA ATC ACC CCA TTC ATC GGT I V G G L E A K N G I T P F I G TTC TTT GCA AGC GGA AGA CTA TTT CA F F A S G R L F D. The apparent N-terminal nucleic acid sequence (SEQ ID NO:58), as well as deduced amino acid sequence (SEQ ID NO:59) of nfSP5 is: ACG AGG TTT CGC TTA GCA ATT GTA TGT GCT CTC GCT GTC TGC ACA TTC T R F R L A I V C A L A V C T F> GGT GCC AGT GTT CCA GAA CCA TGG AAA AGA TTA GAT GGT AGA ATC GTA G A S V P E P W K R L D G R I V> GGA GGA CAC GAT ACC AGC ATC GAT AAA CAC CCT CAT CAA GTA TCT TTA G G H D T S I D K H P H Q V S L> TTG TAC TCC AGC CAC AAT TGT GGT GGT TCC TTG ATT GCC AAA AAC TGG L Y S S H N C G G S L I A K N W> GTT TTG ACT GCA GCT CAT TGC ATT GGA GTT AAC AAA TAC AAT GTC CGT V L T A A H C I G V N K Y N V R> E. The apparent N-terminal nucleic acid sequence (SEQ ID NO:60), as well as deduced amino acid sequence (SEQ ID NO:61) of nfSP6 is: CCC TCA CTA AAG GGA ACA AAA GOT GGA GOCT CCA CCG CGG TGC GCC GCT P S L K G T K A G A P P R C A A CTA GAA CTA GTG GAT CCC CCG GGC TGC AGG AAT TCG GCA CGA GCG TTT L E L V D P P G C R N S A R A F GGT TGG ATT GAG CGC GTC TCA TCT TAC AAG ATA AAG GAT AGA TTA GAT G W I E R V S S Y K I K D R L D GGG CGC ATT GTT GGA GGA CAA GAT GCT GAT ATT GCC AAA TAT GGC TAT G R I V G G Q D A D I A K Y G Y CAA GCT TCA CTC CAA GTA CTT AAC GAA CAT TTC TGT GGA GCT Q A S L Q V L N E H F C G A WO 96/11706 PCTIUS95/14442 100 F. The apparent N-terminal nucleic acid sequence (SEQ ID NO:62), as well as deduced amino acid sequence (SEQ ID NO:63) of nfSP7 is: GCG GTG ATT GTG TCA TTT GTT CTG GCT TGT GCA TTT TCT GTA CAG GCT A V I V S F V L A C A F S V Q A CTT CCA TCA AGC AGA ATT GTC AAT GGA CTT GAA GCA GGA GTT GGA CAA L P S S R I V N G L E A G V G Q TTT CCA ATT CAG GTT TTC TTA GAC TTG ACA AAT ATC AGA GAC GAA AAA F P I Q V F L D L T N I R D E K TCC AGA TGT GGT GGT GCT TTG TTA TCA GAT TCA TGG GTT TTG ACT GCT S R C G G A L L S D S W V L T A GCT CAT TGT TTT GAT GAT TTG AAG TCT ATG GTA GTG TCC GTT GGT GCT A H C F D D L K S M V V S V G A CAT GAT GTC AGC AAA TCT GAA GAA CCT CAC AGG CAA ACC AGG AAA CCT H D V S K S E E P H R Q T R K P

GAA

E

G. The apparent N-terminal nucleic acid sequence (SEQ ID NO:64), as well as deduced amino acid sequence (SEQ ID NO:65) of nfSPl2 is: GTA CTG ATC GTT TTA GCA GTC V L I V L A V ATT GAA TTC GCA TCA GCG TCT TCA ATC I E F A S A S S I GGC TGG AGA ATC GTG GGT GGT GAA AAT GCT AAA GAA AAA TCG GTG CCC G W R I V G G E N A K E K S V P TAT CAA GTT TCM CTT CGA AAT GCT GAA AAC AAA CAT TTY TGT GGR GGR Y Q V S L R N A E N K H F C G G H. The apparent N-terminal nucleic acid sequence (SEQ ID NO:66), as well as deduced amino acid sequence (SEQ ID NO:67) of nfSPl3 is: TTC GGC TTC AAG CTA AGT CAT TTG GTA AGT AAG TAC TGT GCT TGT GCA F G F K L S H L V S K Y C A C A TTA GCA TCG GCA CTG AAG TAC TCC ATC GAT CAT GGT CCT CGT ATC ATC L A S A L K Y S I D H G P R I I GGA GGT GAA GTT GCA GGT GAA GGA TCA GCA CCT TAC CAG GTG TCC TTA G G E V A G E G S A P Y Q V S L AGA ACC AAG GAA GGA AAT CAT TTT TGC GGT GGA TCA ATA CTA AAT AAG R T K E G N H F C G G S I L N K cGA TGG GTT GTA ACT GCA GCA CAT TGT CTT GAA CCG GAA ATA TTA GAT R W V V T A A H C L E P E I L D TCG GTA TAC GTC GGA TCC AAT CAC TTA GAC CGA AAA GGC AGA TAT TAC S V Y V G S N H L D R K G R Y Y GAC GTA GAA CGG TAT ATA ATT CAT D V E R Y I I H GAA AAA TAT ATA GGA GAA CTA AAT E K Y I G E L N

AAT

N

ATT

I

TTT

F

CAA

Q

TAT GCT GAC ATC GGT CTA ATA AAA CTT GAT GGA AGA CTT AGA Y A D I G L I K L D G R L R WO 96/11706 PCTIUS95/14442 101 I. The apparent N-terminal nucleic acid sequence (SEQ ID NO:68), as well as deduced amino acid sequence (SEQ ID NO:69) of nfSPl4 is: CGG GCT GCA GGA ATT CGG CAC GAG AAG AAA CTG CCA ATA TTA ATC GCC R A A G I R H E K K L P I L I A TTG ATC GGA TGC GTT CTT TCT GAA GAA ATA GAG GAT CGC ATT GTC GGC L I G C V L S E E I E D R I V G GGA ACG GCA GTT GAT ATA AGA GGT TTT CCC TGG CAG GTA TCA ATT CAA G T A V D I R G F P W Q V S I Q ACC GAA AAC CGT CAT TTT TGT GGT GGT TCT ATT ATC GAT AAA AGC TGG T E N R H F C G G S I I D K S W ATA TTA ACT GCC GCA CAT TGT GTA CMC GAT ATG AAG ATG TCG AAC TGG I L T A A H C V X D M K M S N W J. The apparent N-terminal nucleic acid sequence (SEQ ID NO:70), as well as deduced amino acid sequence (SEQ ID NO:71) of nfSPlS is: CAC GAG ATT TTA TTA AGC GCA TTA TTT GCA AGT GTA ATT TGC TCC TTT H E I L L S A L F A S V I C S F AAC GCG GAA GTA CAA AAT CGA ATC GTT GGT GGC AAT GAT GTA AGT ATT N A E V Q N R I V G G N D V S I TCA AAA ATT GGG TGG CAA GTA TCT ATT CAA AGT AAT AAA CAA CAT TTC S K I G W Q V S I Q S N K Q H F TGT GGT GGT TCA ATC ATT GCT AAA GAT GGG TCC C G G S I I A K D G S K. The apparent N-terminal nucleic acid sequence (SEQ ID NO:72), as well as deduced amino acid sequence (SEQ ID NO:73) of nfSPl6 is: ATC ATG GCA AAT TTT AGG CTA TTC ACC TTA CTA GCC TTG GTT TCA GTA I M A N F R L F T L L A L V S V GCA ACT TCC AAA TAT ATT GAT CCA AGA ATA ATT GGA GGC GAA GAT GCT A T S K Y I D P R I I G G E D A CCT GAA GGC TCG GCT CCG TAC CAA GTT TCA TTG AGA AAT CAG AAT CTG P E G S A P Y Q V S L R N Q N L GAG CAT TTC TGT GGT GGT TCC ATT E H F C G G S I L. The apparent N-terminal nucleic acid sequence (SEQ ID NO:74), as well as deduced amino acid sequence (SEQ ID NO:75) of nfSPl7 is: GCA CGA GAT CGC ATT GTT GGA GGA TTG GAG GCG AAA AAT GGA TCA GCC A R D R I V G G L E A K N G S A CCA TTC ATG GTT TCT TTG CAA GCG GAA GAC TAT TTT CAT TTT TGT GGA P F M V S L Q A E D Y F H F C GC TCC TCT ATT CTG AAT GAG AGA TGG GTT CTT ACT GCT GCT CAC TGT ATC S S I L N E R W V L T A A H C I CAA CCA AAT GTA CAC AAG TAC GTT TAC GTC GGT TCG AAC AAC GTA GAA Q P N V H K Y V Y V G S N N V E WO 96/11706 PCTIUS95/14442 102 M. The apparent C-terminal nucleic acid sequence (SEQ ID NO:76), as well as deduced amino acid sequence (SEQ ID NO:77) of nfSPl2 is: CCA ATC CAC GAT AGC CAA TAT GCA CTT TTG CAG ATA TGG GTC AAG GGT P I H D S Q Y A L L Q I W V K G> GCA TGT AAG GGT GAT TCC GGT GGC CCC TTA GTC ATC AAT GGA CAA CTT A C K G D S G G P L V I N G Q L> CAT GGA ATT GTT TCC TGG GGC ATT CCT TGC GCT GTC GCA AGC CTG ATG H G I V S W G I P C A V A S L M> TAT TCA CAA GAG TTT CTC ATT ATG TCG ATT GGA TTA AAT CCA AAA TTG Y S Q E F L I M S I G L N P K L> AAT AAA ATT GTT TAG N K I V N. The apparent C-terminal nucleic acid sequence (SEQ ID NO:78), as well as deduced amino acid sequence (SEQ ID NO:79) of nfSP13 is (the initial GGPL is next to the conserved active-site serine): GGA GGT CCT TTG GCA ATC AAT GGT GAA CTT GTT GGT GTT ACT TCA TTC G G P L A I N G E L V G V T S F ATT ATG GGG ACA TGT GGA GGA GGA CAT CCT GAT GTC TTC GGT CGA GTC I M G T C G G G H P D V F G R V CTT GAC TTC AAA CCA TGG ATT GAT TCT CAT ATG GCA AAT GAC GGC GCT L D F K P W I D S H M A N D G A AAT TCT TTT ATT TAA N S F I Example 12 This Example describes the purification of a flea aminopeptidase of the present invention.

The starting material for the isolation of a flea aminopeptidase was a flea midgut lysate preparation that had been depleted of serine proteases by passage over a benzamidine-Sepharose affinity column. To assay for aminopeptidase activity, the synthetic substrate L-Leucine-AMC (Leu-AMC), which releases a fluorescent

AMC

leaving group upon proteolytic cleavage, was incubated with the serine protease-depleted flea midgut preparation.

Aminopeptidase activity was easily detectable with as little as 1.2 gg of lysate, both confirming the presence of WO 96/11706 PCT/US95/14442 103 an aminopeptidase (as indicated in other Examples herein) and allowing for the detection of aminopeptidase activity in fractions collected throughout subsequent fractionation and purification procedures.

Serine protease-depleted flea midgut lysates (samples of about 1.2 Mg and about 12 Mg) were incubated with Leu- AMC in the presence of the following inhibitors: 1 mM pefabloc, 1 mg/ml trypsin/chymotrypsin inhibitor, 1 mg/ml trypsin inhibitor, 1 mM TPCK, 1 gg/ml pepstatin, 10 Mg/ml E-64, 10 Mg/ml of leupeptin, 10 mM EDTA, and 86 gg/ml of bestatin. Only bestatin inhibited the flea protease that cleaved Leu-AMC, whereas both EDTA and bestatin inhibited the control protease, a leucine aminopeptidase. These results indicated that the flea protease being characterized was an aminopeptidase, but apparently was not a metallo-aminopeptidase like the "classic" leucine aminopeptidases.

A flea aminopeptidase was purified using the following protocol. Flea midgut lysates cleared of serine protease activity were fractionated by anion-exchange chromatography. Those fractions containing aminopeptidase activity were pooled and subjected to cation-exchange chromatography, and the resulting fractions were again assayed for activity with L-Leu-AMC in 96-well plates.

Fractions containing aminopeptidase activity were subjected to SDS-PAGE and silver-stained to identify the protein(s) exhibiting that activity. Aminopeptidase activity was found to be associated with proteins that WO 96/11706 PCT/US95/14442 104 migrated at a molecular weight of about 95 kD and about 56 kD when subjected to SDS-PAGE. The 95 kD and 56 kD proteins may each be aminopeptidases or they may be subunits of a larger enzyme. A number of known aminopeptidases are multi-subunit enzymes comprised of subunits ranging from about 45 kD to about 55 kD and from about 90 kD to about 95 kD.

Additional purification studies have indicated that the majority of aminopeptidase activity was found to be associated with the membrane pellet preparation and could be solubilized with detergent. Aminopeptidase activity in such preparations was also monitored during purification using L-Leu-AMC, and appeared to be associated with the kD and 56 kD proteins when active fractions were analyzed by SDS-PAGE and silver staining. The 95 kD and 56 kD protein were co-purified to greater than 90% purity by cation exchange chromatography, affinity chromatography using w-aminohexyl agarose, and C-4 reverse phase chromatography. N-terminal amino acid sequence analysis indicated that both isolated aminopeptidases appeared to be blocked at the amino terminus.

Example 13 This Example describes the isolation of a flea aminopeptidase nucleic acid molecule of the present invention A nucleic acid molecule encoding a flea aminopeptidase was isolated in the following manner. A DNA fragment was WO 96/11706 PCT/US95/14442 105 PCR amplified from a whole fed flea cDNA expression library (prepared as described in Example 8 using degenerate primers, the design of which was based on conserved regions of bovine lens leucine aminopeptidase (LAP). The specific LAP-based primers used included: degenerate LAP sense primer A, corresponding to bovine lens LAP amino acid sequence from about amino acid 247 through 257 and having nucleic acid sequence 5' GTW GGW AAA GGW WTW ACW TTY GAT TCW GGW GG represented herein as SEQ ID NO:48; and degenerate LAP antisense primer C, corresponding to bovine lens LAP amino acid sequence from about amino acid 335 through 329 and having nucleic acid sequence 5' CG WCC TTC WGC ATC WGT ATT 3' represented herein as SEQ ID NO:49.

Also used were vector primers having SEQ ID NO:13 and SEQ ID NO:14, described in Example 11.

In a first experiment, the LAP primer C having SEQ ID NO:49 and the M13 reverse vector primer having SEQ ID NO:13 were used to PCR amplify DNA fragments from the expression library. The resultant PCR products were screened by hybridization under standard hybridization conditions with LAP primer A having SEQ ID NO:48. A PCR product that hybridized with SEQ ID NO:48 was subjected to nested (actually semi-nested) PCR amplification using LAP primer C and the T3 vector primer having SEQ ID NO:14. The resulting PCR product, which was about 900 nucleotides in length (denoted nfAP 900 and hybridized under standard stringent) hybridization conditions with LAP primer A, was cloned into the TAT

M

vector and analyzed by DNA sequence WO 96/11706 PCT/US95/14442 106 analysis as described in Example 11.

The nucleic acid sequence of a portion of nfAP 900 namely of nfAP 53 is represented herein as SEQ ID Translation of SEQ ID NO:50 yields a protein of about 151 amino acids, denoted herein as PfAP 51 the amino acid sequence of which is represented herein as SEQ ID NO:51.

Analysis of SEQ ID NO:51 suggests that the sequence includes a leader segment of about 15 amino acids followed by a mature protein that has about 32% identity with the bovine lens LAP. The corresponding bovine and flea nucleotide sequences are about 29% identical.

Example 14 This Example describes the production of an anti-flea midgut protease antiserum and its use to inhibit flea protease activity thereby supporting the utility of protease-based vaccines as anti-flea agents.

Anti-flea protease antiserum was produced in the following manner. A rabbit was immunized 3 times with approximately 40-50 gg of a flea midgut protease preparation that had been affinity-purified using benzamidine sepharose as described in Example 7 and then combined with Freund's complete adjuvant for the first immunization and with incomplete adjuvant for the second and third immunizations according to standard procedures.

After the second immunization, endpoint titers of around 1:3200 were obtained, while the third immunization boosted the anti-protease titers to about 1:6400. Western blot

I

WO 96/11706 PCTIUS95/14442 107 analysis of the immunoreactivity of the resultant anti-flea protease antiserum against the affinity-purified midgut protease preparation demonstrated the presence of at least 7-8 reactive protease bands. This was an important observation since there are numerous reports in the literature of difficulties associated with generating high-titered antisera against certain classes of proteases.

To assess the inhibitory activity of the rabbit antiflea protease antiserum against flea midgut proteases, an in vitro assay which measures trypsin activity as a function of absorbance at OD 450 using a defined protein substrate succinylated casein) was established using a commercially available kit (available from Pierce, Rockford, IL). In preliminary assays, the proteolytic activity of the affinity-purified flea midgut protease preparation was about 25-30% of the activity observed with the trypsin control. This lower activity is not unexpected since the flea proteases may require different reaction conditions than the trypsin control for optimal activity.

Also, the primary amino acid sequences determined for the flea proteases as described in Examples 7, 10 and 11 are suggestive of highly specialized functions that may require specific substrates for determining optimal activity.

Incubation of the affinity purified midgut protease preparation with the succinylated casein substrate in the presence of about 500 ng of the rabbit anti-flea protease antibody-containing serum collected after the second immunization reduced the proteolytic activity of the WO 96/11706 PCT/US95/14442 108 protease preparation by about 20%. This result, using a suboptimal assay, supports the feasibility of using immunological methods to inhibit flea midgut protease activity.

Using a similar immunization protocol, anti-flea protease antiserum has also been generated in cats that has exhibited immunoreactivity, as identified by Western blot analysis, against several proteases in the affinitypurified midgut protease preparation. The cat anti-flea protease antiserum also reduced proteolytic activity of an affinity purified midgut protease preparation by about using the same assay as described for analyzing the rabbit antiserum.

Example This Example demonstrates that flea larvae have predominantly serine-type proteases.

Newly hatched flea larvae were raised in colony rearing dishes and fed on larval rearing media containing dried bovine blood using standard techniques. About 300 to 500 larvae were collected at different developmental stages, homogenized by sonication in flea gut dissection buffer (50 mM Tris, 100 mM CaCI 2 pH 8.0) and centrifuged to pellet cell debris. About 25 larval equivalents were incubated with about 2 5 Ci [l,3- 3 H]-diisopropylfluorophosphate (DFP) overnight at 4'C.

After incubation, about 10 larval equivalents were spotted onto filter paper, precipitated with 10% trichloroacetic WO 96/11706 PCT/US95/14442 109 acid, and counted in a liquid scintillation counter.

Reducing SDS-PAGE was performed on samples comprising about larval equivalents, and autoradiography was performed using standard techniques. In addition, adult flea midgut proteases were extracted and 3 H-labeled in the same manner and examined by SDS-PAGE and autoradiography. Analysis of the gel indicated that, based on their ability to be labeled with DFP, larval proteases appear to be predominantly serine-type proteases, the production of which appears to be induced by blood feeding as occurs in adults. Blood-fed 3rd instars appeared to have the highest amount of proteolytic activity.

Example 16 The Example demonstrates that flea feces has proteolytic activity, that is predominantly due to serine proteases.

Flea feces were collected from fleas fed in flea cages placed on a live cat or in a flea feeding system as described in Example 6 in which the fleas were fed bovine blood. Fresh feces were collected every 9-17 hours, resuspended in water at 150 mg feces/ml, and centrifuged to pellet insoluble material. The soluble fractions were then assayed using two techniques. Western blot analysis was performed on samples subjected to reducing SDS-PAGE, each lane having about 40 gg of protein. Blotted proteins were incubated overnight at 4'C with 1:500 rabbit anti-flea protease antiserum produced as described in Example 14.

WO 96/11706 PCT/US95/14442 110 Goat anti-rabbit secondary antibody was used at 1:2000 to develop the Western blot. Analysis of the Western blot indicated the presence of serine-type proteases in flea feces. Appearance of such proteases migrating at about to about 30 kD in such a system suggests the presence of full-length serine proteases.

Zymogram analysis was performed by loading approximately 50 jg protein into each lane of the electrophoresis gel in non-reducing sample buffer. After electrophoresis, the zymogram gel was soaked in Triton-X-100 to renature the samples and developed at 37'C in 50 mM Tris, pH 7.6, 200 mM NaCl, 5 mM CaC1 2 0.02% Brij Coomassie staining the gel revealed clear plaques where active proteases digested the gelatin in the gel matrix.

Both of these techniques indicated the presence of serinetype proteases in flea feces.

Example 17 This Example demonstrates that fleas that have fed on antibody-containing blood have antibodies in their feces, suggesting an immunological method to eradicate flea larvae, which feed from flea feces.

The ability of antibodies in a blood meal to be taken up by fleas, pass through the midgut and be excreted in the feces was demonstrated in the following manner. A commercially available rabbit antibody against ovalbumin was added at near physiological concentration at about 2 mg/ml) to the blood meal of adult fleas in a flea

I

WO 96/11706 PCT/US95/14442 111 feeding system as described in Example 6. Feces were collected at 24 hr and 48 hr after feeding and rehydrated in phosphate saline buffer. The rehydrated fecal samples were subjected to Western blot analysis and shown to contain rabbit anti-ovalbumin antibodies that were apparently full-length, using a rabbit-specific secondary antibody screen against the Fc region of rabbit antibodies.

Supernatants of flea midguts collected at the same time periods showed residual amounts of rabbit anti-ovalbumin antibodies.

In a second experiment, fleas were fed in a similar manner a blood meal containing cat-specific antiserum generated against keyhole limpet hemocyanin (KLH) and feces were collected at 24, 48 and 72 hours post-feeding. The sample collected at 24 hours was divided into halves, with one half rehydrated immediately in PBS while the second half was rehydrated 7 days later. Fecal samples collected at 48 and 72 hours were held for 6 and 5 days, respectively, after collection in desiccated form prior to rehydration. Aliquots of the bloodmeal containing the KLH antiserum fed to the fleas were also sampled at 1 and 2 days. All of the recovered antibodies were reactive against KLH by Western blot analysis, with a pattern or reactivity indistinguishable from the cat anti-KLH serum alone.

These studies demonstrate that antibodies are able to pass through the flea midgut in intact form and are able to maintain their antigen-binding characteristics, thereby WO 96/11706 PCTIUS95/14442 112 supporting the feasibility of an immunological method to target larval development, since flea larvae in their normal habitat feed from flea feces.

Example 18 This Example provides additional nucleic acid and deduced amino acid sequences of nucleic acid molecules encoding flea serine protease proteins of the present invention, examples of the isolation of which were described in Example 11.

A. Flea serine protease clone 1 was determined to comprise flea serine protease nucleic acid molecule nfSPl9 9 the nucleic acid sequence of which is denoted herein as SEQ ID NO:80. Translation of SEQ ID NO:80 yielded a predicted serine protease protein referred to herein as PfSP 232 the amino acid sequence of which is denoted herein as SEQ ID NO:81, SEQ ID NO:80 including an apparent stop codon spanning about nucleotides 699 through 701. The N-terminus of the mature form of PfSP1 232 apparently occurs at about amino acid 17 of SEQ ID NO:81, and a conserved GWG sequence spans about amino acids 132 through 134 of SEQ ID NO:81.

PfSP1 232 apparently also includes SEQ ID NO:7 (a partial amino terminal sequence of a purified serine protease protein, the production of which is described in Example nfSP 779 also apparently includes SEQ ID NO:52 and SEQ ID NO:18 and, as such, PfSP1 232 apparently includes SEQ ID NO:53 and SEQ ID NO:19. A BLAST homology search indicated that SEQ ID NO:81 was most similar in amino acid sequence WO 96/11706 PCT/US95/14442 113 to an Anopheles gambiae chymotrypsin II and to a kallikrein. As is the case for any of these molecules, variations between sequences may be due to a number of factors, such as but not limited to, sequencing errors or allelic variation.

B. Flea serine protease clone 2 was determined to comprise flea serine protease nucleic acid molecule nfSP2 944 the nucleic acid sequence of which is denoted herein as SEQ ID NO:82. Translation of SEQ ID NO:82 yielded a predicted serine protease protein referred to herein as PfSP2 255 the amino acid sequence of which is denoted herein as SEQ ID NO:83, SEQ ID NO:82 including an apparent stop codon spanning about nucleotides 768 through 770. The N-terminus of the mature form of PfsP2 255 apparently occurs at about amino acid 23 of SEQ ID NO:81, and a conserved GWG sequence spans about amino acids 148 through 150 of SEQ ID NO:83.

PfSP2 255 apparently also includes SEQ ID NO:5 (a partial amino terminal sequence of a purified serine protease protein, the production of which is described in Example 10). nfSP2 44 also apparently includes SEQ ID NO:20, and, as such, PfSP2 255 apparently includes SEQ ID NO:21. A BLAST homology search indicated that SEQ ID NO:83 was most similar in amino acid sequence to a Bombix mori vitellindegrading protease precursor.

C. Flea serine protease clone 3 was determined to comprise flea serine protease nucleic acid molecule nfSP317, the nucleic acid sequence of which is denoted herein as SEQ ID NO:22. Translation of SEQ ID NO:22 yielded a predicted WO 96/11706 PCT/US95/14442 114 serine protease protein referred to herein as PfSP3 59 the amino acid sequence of which is denoted herein as SEQ ID NO:23. Flea serine protease protein PfSP3 59 includes a conserved GWG sequence that spans about amino acids 1 through 3 of SEQ ID NO:23. A BLAST homology search indicated that SEQ ID NO:23 was most similar in amino acid sequence to a rat trypsinogen.

D. Flea serine protease clone 4 was determined to comprise flea serine protease nucleic acid molecule nfSP4 6 72 described in Example 11. Nucleic acid molecule nfSP4 67 has nucleic acid sequence SEQ ID NO:16, translation of which yielded a predicted serine protease protein referred to herein as PfSP4 223 the amino acid sequence of which is denoted herein as SEQ ID NO:17, SEQ ID NO:16 including an apparent stop codon spanning about nucleotides 670 through 672. As stated above, the N-terminus of the mature form of PfSP4 223 apparently occurs at about amino acid 5 of SEQ ID NO:17, and a conserved GWG sequence spans about amino acids 124 through 126 of SEQ ID NO:17. PfSP4 223 apparently includes SEQ ID NO:41 and a sequence that is very similar to SEQ ID NO:45. nfSP4 6 72 also apparently includes SEQ ID NO:24, SEQ ID NO:56 (following nucleotide 141 of SEQ ID NO:56) and SEQ ID NO:74. As such, PfSP4 223 apparently contains SEQ ID NO:25 and SEQ ID NO:75 as well as a sequence that is very similar to SEQ ID NO:57 (following amino acid 47 of SEQ ID NO:57). A BLAST homology search indicated that SEQ ID NO:17 was most similar in amino acid sequence to an A. gambiae chymotrypsin I precursor.

I

WO 96/11706 PCTIUS95/14442 115 E. Flea serine protease clone 5 was determined to comprise flea serine protease nucleic acid molecules: 157 the nucleic acid sequence of which is denoted herein as SEQ ID NO:84; and nfSP5 218 the nucleic acid sequence of which is denoted herein as SEQ ID NO:86.

Translation of SEQ ID NO:84 yielded a predicted serine protease protein referred to herein as PfSP5 52 the amino acid sequence of which is denoted herein as SEQ ID The N-terminus of the mature form of the serine protease protein encoded by flea clone 5 apparently occurs at about amino acid 29 of SEQ ID NO:85. SEQ ID NO:85 apparently includes the first 10 amino acids of SEQ ID NO:2 as well as the first 10 amino acids of SEQ ID NO:6. SEQ ID NO:2 and SEQ ID NO:6 are partial N-terminal sequences of purified serine protease proteins, the production of which are described in Example 10. Translation of SEQ ID NO:86 yielded a predicted serine protease protein referred to herein as PfSP5 72 the amino acid sequence of which is denoted herein as SEQ ID NO:87. PfSP5 72 includes a conserved GWG sequence spanning about amino acids 14 through 16 of SEQ ID NO:87. nfSP5 218 apparently includes SEQ ID NO:26, and, as such, PfSP5 72 apparently includes SEQ ID NO:27. A BLAST homology search indicated that the protein encoded by flea clone 5 was most similar in amino acid sequence to a Drosophila trypsin eta precursor.

F. Flea serine protease clone 6 was determined to comprise flea serine protease nucleic acid molecule nfSP6 932 the nucleic acid sequence of which is denoted herein as SEQ WO 96/11706 PCT/US95/14442 116 ID NO:88. Translation of SEQ ID NO:88 yielded a predicted serine protease protein referred to herein as PfSP6 256 the amino acid sequence of which is denoted herein as SEQ ID NO:89, SEQ ID NO:88 including an apparent stop codon spanning nucleotides 770 through 772. The N-terminus of the mature form of PfSP6 256 apparently occurs at about amino acid 26 of SEQ ID NO:89, and a conserved GWG sequence spans about amino acids 149 through 151 of SEQ ID NO:89. PfSP6 2 56 apparently also includes SEQ ID NO:4 (a partial amino terminal sequence of a purified serine protease protein, the production of which is described in Example nfSP6 932 also apparently includes SEQ ID NO:28, SEQ ID NO:54 and SEQ ID NO:60 (following about nucleotide 111 of SEQ ID As such, PfSP6 256 apparently includes SEQ ID NO:29, SEQ ID NO:55 and SEQ ID NO:61 (following about amino acid 37 of SEQ ID NO:61). A BLAST homology search indicated that SEQ ID NO:89 was most similar in amino acid sequence to a B. mori vitellin-degrading protease.

G. Flea serine protease clone 7 was determined to comprise flea serine protease nucleic acid molecule nfSP7 894 the nucleic acid sequence of which is denoted herein as SEQ ID NO:90. Translation of SEQ ID NO:90 yielded a predicted serine protease protein referred to herein as PfSP7 2 55 the amino acid sequence of which is denoted herein as SEQ ID NO:91, SEQ ID NO:90 including an apparent stop codon spanning about nucleotides 766 through 768. The N-terminus of the mature form of PfSP7 255 apparently occurs at about amino acid 23 of SEQ ID NO:91, and a conserved GWG (in this WO 96/11706 PCT/US95/14442 117 case GWA) sequence spans about amino acids 152 through 154 of SEQ ID NO:91. PfSP7 255 apparently also includes SEQ ID NO:44. nfSP7 894 also apparently includes SEQ ID NO:30 and SEQ ID NO:62. As such, PfSP7 255 apparently includes SEQ ID NO:31 and SEQ ID NO:63. A BLAST homology search indicated that SEQ ID NO:91 was most similar in amino acid sequence to a hornet chymotrypsin II and to collagenase.

H. Flea serine protease clone 8 was determined to comprise flea serine protease nucleic acid molecule nfSP8 2 99 the nucleic acid sequence of which is denoted herein as SEQ ID NO:92. Translation of SEQ ID NO:92 yielded a predicted serine protease protein referred to herein as PfSP8 99 the amino acid sequence of which is denoted herein as SEQ ID NO:93. PfSP8, includes a conserved GWG sequence that spans about amino acids 31 through 33 of SEQ ID NO:93. nfSP8 2 9 also apparently includes SEQ ID NO:32, and, as such, PfSP8 apparently includes SEQ ID NO:33. A BLAST homology search indicated that SEQ ID NO:93 was most similar in amino acid sequence to a Tachypleus tridentatus coagulation factor B.

I. Flea serine protease clone 9 was determined to comprise flea serine protease nucleic acid molecule nfSP9 266 the nucleic acid sequence of which is denoted herein as SEQ ID NO:94. Translation of SEQ ID NO:94 yielded a predicted serine protease protein referred to herein as PfSP9,, the amino acid sequence of which is denoted herein as SEQ ID PfSP9 8 g includes a conserved GWG sequence that spans amino acids about 33 through 35 of SEQ ID NO:95. nfSP926 also apparently includes SEQ ID NO:34, and, as such, PfSP9 88 WO 96/11706 PCT/US95/14442 118 apparently includes SEQ ID NO:35. A BLAST homology search indicated that SEQ ID NO:95 was most similar in amino acid sequence to an A. gambiae trypsin 2 precursor.

J. Flea serine protease clone 10 was determined to comprise flea serine protease nucleic acid molecule nfSPl0 3 78 the nucleic acid sequence of which is denoted herein as SEQ ID NO:96. Translation of SEQ ID NO:96 yielded a predicted serine protease protein referred to herein as PfSP10 126 the amino acid sequence of which is denoted herein as SEQ ID NO:97. PfSP10 126 includes a conserved GWG sequence that spans about amino acids 63 through 65 of SEQ ID NO:97. nfSP10 378 also apparently includes SEQ ID NO:36, and, as such, PfSP10 126 apparently includes SEQ ID NO:37. A BLAST homology search indicated that SEQ ID NO:97 was most similar in amino acid sequence to an A. gambiae trypsin 1 precursor.

K. Flea serine protease clone 11 was determined to comprise flea serine protease nucleic acid molecule nfSP11 252 the nucleic acid sequence of which is denoted herein as SEQ ID NO:98. Translation of SEQ ID NO:98 yielded a predicted serine protease protein referred to herein as PfSPll, the amino acid sequence of which is denoted herein as SEQ ID NO:99. PfSPll includes a conserved GWG sequence that spans about amino acids 23 through 25 of SEQ ID NO:99. nfSP11 252 also apparently includes SEQ ID NO:38, and, as such, PfSPll apparently includes SEQ ID NO:39. A BLAST homology search indicated that SEQ ID NO:99 was most similar in amino acid sequence WO 96/11706 PCTfUS95/14442 119 to a Mus musculus plasminogen precursor.

L. Flea serine protease clone 12 was determined to comprise flea serine protease nucleic acid molecules: nfSP12 1 44 the nucleic acid sequence of which is denoted herein as SEQ ID NO:64; and nfSPl2 225 the nucleic acid sequence of which is denoted herein as SEQ ID NO:100.

Translation of SEQ ID NO:64 yielded a predicted serine protease protein referred to herein as PfSP12 52 the amino acid sequence of which is denoted herein as SEQ ID The N-terminus of the mature form of the serine protease protein encoded by flea clone 12 apparently occurs at about amino acid 20 of SEQ ID NO:65. SEQ ID NO:65 apparently includes the first 30 amino acids of SEQ ID Translation of SEQ ID NO:100 yielded a predicted serine protease protein referred to herein as PfSP12 69 the amino acid sequence of which is denoted herein as SEQ ID NO:101, SEQ ID NO:100 apparently containing a stop codon spanning from about nucleotides 208 through 210. nfSPl2 225 apparently includes SEQ ID NO:76, and, as such, PfSP12 69 apparently includes SEQ ID NO:77. A BLAST homology search indicated that the protein encoded by flea clone 12 was most similar in amino acid sequence to an A. gambiae trypsin.

M. Flea serine protease clone 13 was determined to comprise flea serine protease nucleic acid molecule nfSP13 850 the nucleic acid sequence of which is denoted herein as SEQ ID NO:102. Translation of SEQ ID NO:102 yielded a predicted serine protease protein referred to herein as PfSP13 252 the amino acid sequence of which is WO 96/11706 PCT/US95/14442 120 denoted herein as SEQ ID NO:103, SEQ ID NO:102 including an apparent stop codon spanning about nucleotides 758 through 760. The N-terminus of the mature form of PfSP13 252 apparently occurs at about amino acid 28 of SEQ ID NO:103, and a conserved GWG sequence spans about amino acids 137 through 139 of SEQ ID NO:103. PfSP13 252 apparently also includes SEQ ID NO:1 (a partial amino terminal sequence of a purified serine protease protein, the production of which is described in Example 10) and SEQ ID NO:42. nfSP13 850 also apparently includes SEQ ID NO:66 and SEQ ID NO:78 and, as such, PfSP13 252 apparently includes SEQ ID NO:67 and SEQ ID NO:79. A BLAST homology search indicated that SEQ ID NO:103 was most similar in amino acid sequence to an A.

gambiae chymotrypsin.

N. Flea serine protease clone 14 was determined to comprise flea serine protease nucleic acid molecule nfSP14 213 the nucleic acid sequence of which is denoted herein as SEQ ID NO:68. Translation of SEQ ID NO:68 yielded a predicted serine protease protein referred to herein as PfSPl41, the amino acid sequence of which is denoted herein as SEQ ID NO:69. The N-terminus of the mature form of the serine protease protein encoded by flea clone 12 apparently occurs at about amino acid 29 of SEQ ID NO:69. SEQ ID NO:69 apparently includes the first 13 amino acids of SEQ ID NO:43. A BLAST homology search indicated that the protein encoded by SEQ ID NO:69 was most similar in amino acid sequence to an A. gambiae trypsin.

O. Flea serine protease clone 15 was determined to WO 96/11706 PCT/US95/14442 121 comprise flea serine protease nucleic acid molecule 252 the nucleic acid sequence of which is denoted herein as SEQ ID NO:104. Translation of SEQ ID NO:104 yielded a predicted serine protease protein referred to herein as PfSP154, the amino acid sequence of which is denoted herein as SEQ ID NO:105. The N-terminus of the mature form of the serine protease protein encoded by flea clone 15 apparently occurs at about amino acid 28 of SEQ ID NO:105. SEQ ID NO:105 apparently includes SEQ ID NO:46.

nfSP15 2 52 also apparently includes SEQ ID NO:70, and, as such, PfSP15g apparently includes SEQ ID NO:71. A BLAST homology search indicated that the protein encoded by SEQ ID NO:105 was most similar in amino acid sequence to an A.

gambiae trypsin.

P. Flea serine protease clone 16 was determined to comprise flea serine protease nucleic acid molecule nfSP6 16 8 g, the nucleic acid sequence of which is denoted herein as SEQ ID NO:72. Translation of SEQ ID NO:72 yielded a predicted serine protease protein referred to herein as PfSP16 56 the amino acid sequence of which is denoted herein as SEQ ID NO:73. The N-terminus of the mature form of the serine protease protein encoded by flea clone 16 apparently occurs at about amino acid 26 of SEQ ID NO:73. SEQ ID NO:73 apparently includes SEQ ID NO:47. A BLAST homology search indicated that the protein encoded by SEQ ID NO:73 was most similar in amino acid sequence to an acrosin.

I WO 96/11706 PCT/US95/14442 122 Q. Flea serine protease clone 18 was determined to comprise flea serine protease nucleic acid molecule nfSP18 534 the nucleic acid sequence of which is denoted herein as SEQ ID NO:106. Translation of SEQ ID NO:106 yielded a predicted serine protease protein referred to herein as PfSP18 1 7 the amino acid sequence of which is denoted herein as SEQ ID NO:107. The N-terminus of the mature form of PfSP18 1 7 apparently occurs at about amino acid 284 of SEQ ID NO:107, and a conserved GWG sequence spans about amino acids 126 through 128 of SEQ ID NO:107.

A BLAST homology search indicated that SEQ ID NO:107 was most similar in amino acid sequence to a chymotrypsin.

R. Flea serine protease clone 19 was determined to comprise flea serine protease nucleic acid molecule nfSP19 359 the nucleic acid sequence of which is denoted herein as SEQ ID NO:108. Translation of SEQ ID NO:108 yielded a predicted serine protease protein referred to herein as PfSP19 1 19 the amino acid sequence of which is denoted herein as SEQ ID NO:109. A conserved GWG sequence spans about amino acids 69 through 71 of SEQ ID NO:109.

A

BLAST homology search indicated that SEQ ID NO:109 was most similar in amino acid sequence to bovine duodenase

I.

S. Flea serine protease clone 20 was determined to comprise flea serine protease nucleic acid molecule nfSP208 1 the nucleic acid sequence of which is denoted herein as SEQ ID NO:110. Translation of SEQ ID NO:110 yielded a predicted serine protease protein referred to herein as PfSP20 248 the amino acid sequence of which is WO 96/11706 PCT/US95/14442 123 denoted herein as SEQ ID NO:111, SEQ ID NO:110 including an apparent stop codon spanning about nucleotides 746 through 748. The N-terminus of the mature form of PfSP20 248 apparently occurs at about amino acid 27 of SEQ ID NO:111, and a conserved GWG sequence spans about amino acids 147 through 149 of SEQ ID NO:11l. PfSP20 248 apparently also includes SEQ ID NO:2 and SEQ ID NO:6 (partial amino terminal sequences of purified serine protease proteins, the production of which is described in Example nfSP20 841 also apparently includes SEQ ID NO:58, and, as such, PfSP20 248 apparently includes SEQ ID NO:59. A BLAST homology search indicated that SEQ ID NO:1ll was most similar in amino acid sequence to a trypsin.

Example 19 This Example provides additional nucleic acid and deduced amino acid sequences of nucleic acid molecules encoding flea aminopeptidase proteins of the present invention.

The nucleic acid sequence of the remainder of flea aminopeptidase nucleic acid molecule nfAP 900 was determined and used to design primers to use in combination with a vector primer M13 universal primer) to PCR amplify the 3' terminal fragment of the flea aminopeptidase coding region from a whole fed flea cDNA expression library using methods as described in Example 13. The PCR product was subjected to DNA sequencing analysis, and a composite sequence representing a close to full-length flea WO 96/11706 PCT/US95/14442 124 aminopeptidase coding region was deduced. The nucleic acid sequence of the composite nucleic acid molecule, referred to herein as nfAP1 580 is denoted herein as SEQ ID NO:112.

The primer used to obtain the 3' terminal fragment spans from about nucleotide 849 through 877 of SEQ ID NO:112. A probe spanning from about nucleotide 918 through 938 of SEQ ID NO:112 was used to verify that the 3' terminal fragment was a flea aminopeptidase nucleic acid molecule. The flea aminopeptidase gene-containing sequence of the 3' terminal fragment, referred to herein as nfAP 2 spans from about nucleotide 849 through 1580 of SEQ ID NO:112.

Translation of SEQ ID NO:112 yielded a deduced flea aminopeptidase protein of about 496 amino acids, denoted herein as PfAP 496 having amino acid sequence SEQ ID NO:113.

The deduced mature flea aminopeptidase is about 48% identical to mature bovine leucine aminopeptidase. The corresponding bovine and flea nucleic acid sequences are about 33% identical.

Example This Example demonstrates the production of certain flea serine protease proteins of the present invention.

A. Flea serine protease protein PfSPl 216 was produced in the following manner. An about 670-bp DNA fragment, referred to herein as nfSPl 670 and designed to encode an apparently mature serine protease protein, was PCR amplified from flea serine protease clone 1 using the XhoIsite containing primers Fl sense WO 96/11706 PCT/US95/14442 125 GAGCTCTCGAGAGTTGTTGGAGGACTGGAAGC 3' (SEQ ID NO:114) and F1 antisense 5' GGACCTCGAGAATTAGTTATTTTCCATGGTC 3' (SEQ ID NO:115). The PCR product nfSPl 6 was digested with XhoI restriction endonuclease, gel purified and subcloned into expression vector pTrcHisB (available from InVitrogen) that had been digested with XhoI and dephosphorylated. The resultant recombinant molecule, referred to herein as pHisnfSPl 6 70 was transformed into E. coli HB101 competent cells (available from Gibco BRL, Gaithersburg, MD) to form recombinant cell E. coli :pHis-nfSPl 670 The recombinant cell was cultured in enriched bacterial growth medium containing 0.1 mg/ml ampicillin and 0.1% glucose at about 32"C. When the cells reached an OD600 of about 0.4-0.5, expression of nfSP 670 was induced by the addition of 0.5 mM isopropyl-B-D-thiogalactoside (IPTG), and the cells were cultured for about 2 hours at about 32*C. Immunoblot analysis of recombinant cell E. coli:pHis-nfSP1 67 lysates using a T7 tag monoclonal antibody (available from Novagen, Inc., Madison, WI) directed against the fusion portion of the recombinant PHIS-PfSP1 216 fusion protein identified a protein of the appropriate size, namely an about 29 kD protein.

B. Flea serine protease protein PfSP2 233 was produced in the following manner. An about 715-bp DNA fragment, referred to herein as nfSP2 715 and designed to encode an apparently mature serine protease protein, was PCR amplified from flea serine protease clone 2 using the XhoIsite containing primers F2 sense WO 96/11706 PCT/US95/14442 126 GAGCTCTCGAGCATCGTCGGCGGCACCAGTG 3' (SEQ ID NO:116) and F2 antisense 5' GGACGAATTCTTAAAGACCAGTTTTTTTGCG 3' (SEQ ID NO:117). The PCR product nfSP2 715 was digested with XhoI restriction endonuclease, gel purified and subcloned into expression vector pTrcHisB (available from InVitrogen) that had been digested with XhoI and dephosphorylated. The resultant recombinant molecule, referred to herein as pHisnfSP2 715 was transformed into E. coli HB101 competent cells (available from Gibco BRL) to form recombinant cell E. coli :pHis-nfSP2 7 15. The recombinant cell was cultured as described in Example 20A. Immunoblot analysis of recombinant cell E. coli:pHis-nfSP2 715 lysates using a T7 tag monoclonal antibody (available from Novagen, Inc.) directed against the fusion portion of the recombinant PHIS-PfSP2 233 fusion protein identified a protein of the appropriate size, namely an about 35-kD protein.

C. Flea serine protease protein PfSP13 225 was produced in the following manner. An about 700-bp DNA fragment, referred to herein as nfSPl3 700 and designed to encode an apparently mature serine protease protein, was PCR amplified from flea serine protease clone 13 using the Xhol-site containing primers F13 sense GAGCTCTCGAGTATCATCGGAGGTGAAGTTGC 3' (SEQ ID NO:118) and F13 antisense 5' GGACCTCGAGAATTATGCGCCGTCATTTGC 3' (SEQ ID NO:119). The PCR product nfSPl3 700 was digested with XhoI restriction endonuclease, gel purified and subcloned into expression vector pTrcHisB (available from InVitrogen) that had been digested with XhoI and dephosphorylated. The WO 96/11706 PCT/US95/14442 127 resultant recombinant molecule, referred to herein as pHisnfSPl3 700 was transformed into E. coli HB101 competent cells (available from Gibco BRL) to form recombinant cell E. coli :pHis-nfSPl3700. The recombinant cell was cultured as described in Example 20A. Immunoblot analysis of recombinant cell E. coli:pHis-nfSPl3 70 o lysates using a T7 tag monoclonal antibody (available from Novagen, Inc.) directed against the fusion portion of the recombinant PHIS-PfSP13225 fusion protein identified a protein of the appropriate size, namely an about 33-kD protein.

Example 21 This Example demonstrates the temporal induction of serine proteases in fleas feeding on cats.

Fleas contained in chambers similar to those used for in vitro feeding experiments were placed on cats and were allowed to feed for various periods of time. Upon removal from the cats, soluble extracts of flea midgut tissues were prepared as described herein. Proteases contained within the extracts were quantitated by labeling the extracts with [1,3- 3 H]DFP using a method similar to that described in Borovsky et al, 1988, Arch. Insect Biochem. Physiol. 7, 187-210. The labeled samples either were precipitated and the radioactivity in the precipitate quantitated or (b) were applied to SDS-PAGE and exposed by autoradiography.

Data generated from counting samples are shown in Fig.

which plots 3 H]-DFP in counts per minute (cpm) per flea midguts versus hours of flea feeding on cats. Also WO 96/11706 PCT/US95/14442 128 shown in Fig. 10 for comparison is a plot of the number of eggs laid per female flea per day for chamber-contained fleas feeding on cats for 1, 2, 3 and 4 days, respectively.

These results suggest that DFP-labeled proteases predominantly serine proteases) are induced in fleas in response to feeding. Induction is quite rapid once feeding begins and, unlike in mosquitos, is sustained over time.

The results also suggest a positive correlation between flea protease activity and fecundity.

In order to obtain a profile of the sizes of DFPlabeled proteases temporally induced in fleas during feeding, samples were applied to SDS-PAGE and autoradiographed. Fig. 11 indicates protein molecular weight standards and samples of soluble flea midgut extracts obtained from fleas having fed for various times on cats at, respectively, 3, 8, 15, 18, 24, 30, 34, 44, 48, 52, 58, 68, 72, 78 and 88 hours of feeding).

Analysis of the results indicates that primarily proteases migrating with a molecular weight of about 25-35 kD are induced in a flea relatively soon after the flea has begun feeding at least within about 3 to about 8 hours).

The amount of such proteases increases over time for about the first 2 days. Over time, several intensely labeled bands of lower molecular weight (primarily in the range of about 12-15 kD) also appear that may be representative of proteases having undergone degradation.

WO 96/11706 PCT/US95/14442 129 SEQUENCE LISTING The following Sequence Listing is submitted pursuant to 37 CFR §1.821. A copy in computer readable form is also submitted herewith.

Applicants assert pursuant to 37 CFR §1.821(f) that the content of the paper and computer readable copies of SEQ ID NO:1 through SEQ ID NO:119 submitted herewith are the same.

GENERAL INFORMATION: APPLICANTS: Grieve, Robert B.

Rushlow, Keith E.

Hunter, Shirley Wu Frank, Glenn R.

Heath, Andrew W.

Yamaka, Miles Yamanaka Arfsten, Ann Dale, Beverly Stiegler, Gary (ii) TITLE OF INVENTION: USE OF PROTEASE INHIBITORS AND PROTEASE VACCINES TO PROTECT ANIMALS FROM FLEA INFESTATION, AND FLEA PROTEASE PROTEINS, NUCLEIC ACID MOLECULES, AND USES THEREOF (iii) NUMBER OF SEQUENCES: 119 (iv) CORRESPONDENCE

ADDRESS:

ADDRESSEE: Sheridan Ross McIntosh STREET: 1700 Lincoln Street, Suite 3500 CITY: Denver STATE: Colorado COUNTRY: USA ZIP: 80203 COMPUTER READABLE FORM: MEDIUM TYPE: Floppy disk COMPUTER: IBM PC compatible OPERATING SYSTEM: PC-DOS/MS-DOS SOFTWARE: PatentIn Release Version 1.25 (vi) CURRENT APPLICATION

DATA:

APPLICATION

NUMBER:

FILING DATE:

CLASSIFICATION:

WO 96/11706 PCT/US95/14442 130 (viii) ATTORNEY/AGENT INFORMATION: NAME: Gary J. Connell REGISTRATION NUMBER: 32,020 REFERENCE/DOCKET NUMBER: (ix) TELECOMMUNICATION

INFORMATION:

TELEPHONE: (303) 863-9700 TELEFAX: (303 863-0223 WO 96/11706 PCT/US95/14442 131 INFORMATION FOR SEQ ID NO:1: SEQUENCE CHARACTERISTICS: LENGTH: 32 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: Ile Ile Gly Gly Glu Val Ala Gly Glu Gly Ser Ala Pro Tyr Gin Val 1 5 10 Ser Leu Arg Thr Lys Glu Gly Asn His Phe Ser Gly Gly Ser Ile Leu 25 INFORMATION FOR SEQ ID NO:2: SEQUENCE CHARACTERISTICS: LENGTH: 17 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Xaa Val Gly Gly His Asp Thr Ser Ile Asp Xaa His Pro His Gin Val 1 5 10 Thr INFORMATION FOR SEQ ID NO:3: SEQUENCE CHARACTERISTICS: LENGTH: 22 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: Ile Val Gly Gly Ala Asp Ala Ala Pro Gly Asn Ala Pro Phe Gin Val 1 5 10 Ser Leu Arg Asp Lys Gly WO 96/11706 PCT/US95/14442 132 INFORMATION FOR SEQ ID NO:4: SEQUENCE CHARACTERISTICS: LENGTH: 34 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Ile Val Gly Gly Gln Asp Ala Asp Ile Ala Lys Tyr Gly Tyr Gin Ala 1 5 10 Ser Leu Gin Val Phe Asn Glu His Phe Xaa Gly Ala Xaa Ile Leu Asn 25 Asn Tyr INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 25 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Ile Val Gly Gly Thr Asp Val Asn Ile Glu Asn Phe Gly Trp Gin Val 1 5 10 Ser Leu Phe Asp Arg Asn Gly His Phe INFORMATION FOR SEQ ID NO:6: SEQUENCE CHARACTERISTICS: LENGTH: 22 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Ile Val Gly Gly His Asp Thr Ser Ile Asp Lys His Pro Phe Gin Val 1 5 10 Ser Leu Ile Asp Lys Asn WO 96/11706 PCT/US95/14442 133 INFORMATION FOR SEQ ID NO:7: SEQUENCE CHARACTERISTICS: LENGTH: 23 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: Val Val Gly Gly Leu Glu Ala Ala Glu Gly Ser Ala Pro Tyr Gin Val 1 5 10 Xaa Leu Gin Trp Gly Asn Phe INFORMATION FOR SEQ ID NO:8: SEQUENCE CHARACTERISTICS: LENGTH: 15 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: Ile Val Gly Gly Glu Asp Ala Glu Leu Gly Glu Xaa Pro Thr Gin 1 5 10 INFORMATION FOR SEQ ID NO:9: SEQUENCE CHARACTERISTICS: LENGTH: 13 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: Asp Glu Asp Gly Lys Asp Asp Ser Ala Pro Gly Glu Ile 1 5 WO 96/11706 PCT/US95/14442 134 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 9 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE: NAME/KEY: Xaa Gin or Asn LOCATION: 2 (xi) SEQUENCE DESCRIPTION: SEQ ID Cys Xaa Gly Asp Ser Gly Gly Pro Leu 1 INFORMATION FOR SEQ ID NO:11: SEQUENCE CHARACTERISTICS: LENGTH: 27 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: TAAWGGWCCW CCYGAATCTC CCTGGCA 27 INFORMATION FOR SEQ ID NO:12: SEQUENCE CHARACTERISTICS: LENGTH: 24 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: TAAWGGWCCA GARTCTCCTT GACA 24 INFORMATION FOR SEQ ID NO:13: SEQUENCE CHARACTERISTICS: LENGTH: 19 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GGAAACAGCT ATGACCATG in WO 96/11706 PCT/US95/14442 135 INFORMATION FOR SEQ ID NO:14: SEQUENCE CHARACTERISTICS: LENGTH: 17 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: ATTAACCCTC ACTAAAG 17 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 23 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (probe) (xi) SEQUENCE DESCRIPTION: SEQ ID TGGGTWGTWA CWGCWGCWCA TTG 9 WO 96/11706 PCT/US95/14442 136 INFORMATION FOR SEQ ID NO:16: SEQUENCE CHARACTERISTICS: LENGTH: 672 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..672 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

GCA

Ala 1 CGA GAT CGC Arg Asp Arg

ATT

Ile 5 GTT GGA GGA TTG GAG GCG AAA AAT GGA TCA GCC Val Gly Gly Leu Glu Ala Lys Asn Gly Ser Ala 10 CCA TTC ATG Pro Phe Met TCC TCT ATT Ser Ser Ile 35

GTT

Val TCT TTG CAA Ser Leu Gin GCG GAA GAC TAT TTT CAT TTT TGT GGA Ala Glu Asp Tyr Phe His Phe Cys Gly 25 96 144 CTG AAT GAG AGA Leu Asn Glu Arg TGG GTT Trp Val 40 CTT ACT GCT GCT CAC TGT ATC Leu Thr Ala Ala His Cys Ile CAA CCA Gin Pro AAT GTA CAC AAG Asn Val His Lys

TAC

Tyr 55 GTT TAC GTC GGT TCG AAC AAC GTA GAA Val Tyr Val Gly Ser Asn Asn Val Glu

GTA

Val GGC GGA ACA CAC Gly Gly Thr His

TAC

Tyr 70 GAA ATC GAA AAA Glu Ile Glu Lys GCT TTC TAT CAC GAA GAA Ala Phe Tyr His Glu Glu 75 TAT GAT GGA GTA Tyr Asp Gly Val CTT GTA GAT CAT Leu Val Asp His GAT GTG ATT GAT CAA AGT GAG Asp Val Ile Asp Gin Ser Glu CCC ATT AAA TTA CGA AGA AAG Pro Ile Lys Leu Arg Arg Lys 110 240 288 336 ACA AAC ATT Thr Asn Ile

GAT

Asp 100 TTA ATG AAG Leu Met Lys TGT CAA Cys Gin 105 CCA CTC GTT GGT GGT GAG GAA TTG Pro Leu Val Gly Gly Glu Glu Leu 115 120 AGA GCA GTA GGC TGG GGA AAT ACA Arg Ala Val Gly Trp Gly Asn Thr 125 TTG AAA CTT CAA GAA TTG TAC GTG Leu Lys Leu Gin Glu Leu Tyr Val 140 AAT TCA Asn Ser 130 GCA GGG GAA AAT Ala Gly Glu Asn

AAA

Lys 145 GCT TTG ACT AAT Ala Leu Thr Asn GAG TGC AAA Glu Cys Lys GCT AAA TCA CCA ATT CCA CCA Ala Lys Ser Pro Ile Pro Pro 155 160 ACG ACC CAA GTC Thr Thr Gin Val ACA CTT TTG Thr Leu Leu GAA AAG AAT CAT GGT GTA TGC TCG Glu Lys Asn His Gly Val Cys Ser 170 175 TTG GAT GGC GAG CAA GTT GGC ATT Leu Asp Gly Glu Gin Val Gly Ile 185 190 480 528 576 624 GGA GAT TCT Gly Asp Ser GCC TCA TTT Ala Ser Phe 195

GGT

Gly 180 GGT CCA TTG CTT Gly Pro Leu Leu GTT ATC TTC AAA Val Ile Phe Lys TGC GCA Cys Ala 200 ATG GGG TAC CCT GAC TAT TTC Met Gly Tyr Pro Asp Tyr Phe 205 137 ACA AGA TTG TCT CTA TAT GTA GAT TGG ATT GAA CAA CAC ATG GAT TAA 672 Thr Arg Leu Ser Leu Tyr Val Asp Trp Ile Glu Gin His Met Asp 210 215 220 INFORMATION FOR SEQ ID NO:17: SEQUENCE CHARACTERISTICS: LENGTH: 223 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: Ala Arg Asp Arg Ile Val Gly Gly Leu Glu Ala Lys Asn Gly Ser Ala 1 5 10 Pro Phe Met Val Ser Leu Gin Ala Glu Asp Tyr Phe His Phe Cys Gly 25 Ser Ser Ile Leu Asn Glu Arg Trp Val Leu Thr Ala Ala His Cys Ile 40 G1n Pro Asn Val His Lys Tyr Val Tyr Val Gly Ser Asn Asn Val Glu 55 Val Gly Gly Thr His Tyr Glu Ile Glu Lys Ala Phe Tyr His Glu Glu 65 70 75 Tyr Asp Gly Val Asp Leu Val Asp His Asp Val Ile Asp Gin Ser Glu 90 Thr Asn Ile Asp Leu Met Lys Cys Gin Pro Ile Lys Leu Arg Arg Lys 100 105 110 Pro Leu Val Gly Gly Glu Glu Leu Arg Ala Val Gly Trp Gly Asn Thr 115 120 125 Asn Ser Ala Gly Glu Asn Phe Pro Leu Lys Leu Gin Glu Leu Tyr Val 130 135 140 Lys Ala Leu Thr Asn Glu Glu Cys Lys Ala Lys Ser Pro Ile Pro Pro 145 150 155 160 Thr Thr Gin Val Cys Thr Leu Leu Glu Lys Asn His Gly Val Cys Ser 165 170 175 Gly Asp Ser Gly Gly Pro Leu Leu Leu Asp Gly Glu Gin Val Gly Ile 180 185 190 Ala Ser Phe Val Ile Phe Lys Cys Ala Met Gly Tyr Pro Asp Tyr Phe 195 200 205 Thr Arg Leu Ser Leu Tyr Val Asp Trp Ile Glu Gln His Met Asp 210 215 220 7. 1 WO 96/11706 PCT/US95/14442 138 INFORMATION FOR SEQ ID NO:18: SEQUENCE CHARACTERISTICS: LENGTH: 156 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..156 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

GGG

Gly 1 TGG GGA AGA Trp Gly Arg GGA GCT AAC Gly Ala Asn TTG AAT Leu Asn 10 CAC CAG His Gln 25 GGA CCG AAT GAA CTC CAA Gly Pro Asn Glu Leu Gin CAA TGT GTA AGA CAA CAA Gin Cys Val Arg Gin Gin GAA CTT AAC Glu Leu Asn ATT TAT CCA Ile Tyr Pro 35

ACT

Thr GTC ACA TTA AGC Val Thr Leu Ser 48 96 144 156 GTA TAC GAC AGC CAA Val Tyr Asp Ser Gin 40 CTT TGC ACA TTT GTT GGC AGT GGA Leu Cys Thr Phe Val Gly Ser Gly CGA GGC GCC TGC Arg Gly Ala Cys INFORMATION FOR SEQ ID NO:19: SEQUENCE CHARACTERISTICS: LENGTH: 52 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: Gly Trp Gly Arg Leu Gly Ala Asn Leu Asn Gly Pro Asn Glu Leu Gin 1 5 10 Glu Leu Asn Thr Val Thr Leu Ser His Gin 25 Gin Cys Val Arg Gin Gin Gly Ser Gly Ile Tyr Pro Val Tyr Asp Ser Gin Leu Cys Thr Phe Val 40 Arg Gly Ala Cys INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 168 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA WO 96/11706 PCTfUS95/14442 139 (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..168 (xi) SEQUENCE DESCRIPTION: SEQ ID TGG GGC AAA TTA AGT GAA TCA GGA CCC AAG CCA GTA AAT CTA CAA Trp Gly Lys Leu Ser Glu Ser Gly Pro Lys Pro Val Asn Leu Gin 5 10

GGA

Gly 1 GGA GTA AAA Gly Val Lys TCT TTG CAG Ser Leu Gin

GTG

Val CCT TAT GTG ACC AAG ATA Pro Tyr Val Thr Lys Ile 25 CAT GCT CTG ACA GCT ACG His Ala Leu Thr Ala Thr GTA AAA GAT ATC ACC GAA AAC ATG TTG TGT GCC GGA GTT Val Lys Asp Ile Thr Glu Asn Met Leu Cys Ala Gly Val 40 AGA AGA Arg Arg GGT GGC AAG Gly Gly Lys GAC TCC TGC Asp Ser Cys 168 INFORMATION FOR SEQ ID NO:21: SEQUENCE CHARACTERISTICS: LENGTH: 56 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: Gly Trp Gly Lys Leu Ser Glu Ser Gly Pro Lys Pro 1 5 10 Val Asn Leu Gin Gly Val Lys Val Pro Tyr Val Thr Lys Ile His Ala Leu Thr Ala Thr 25 Ser Leu Gin Val Lys Asp Ile Thr Glu Asn Met Leu Cys 40 Arg Arg Gly Gly Lys Asp Ser Cys Ala Gly Val WO 96/11706 PCT/US95/14442 140 INFORMATION FOR SEQ ID NO:22: SEQUENCE CHARACTERISTICS: LENGTH: 177 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..177 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

GGA

Gly 1 TGG GGA TCA Trp Gly Ser TCT ACT TCC AAT TTC CCA TCT TAC CCC AAC CTT Ser Thr Ser Asn Phe Pro Ser Tyr Pro Asn Leu TTA CAG ACC Leu Gln Thr GTA TTG GGA Val Leu Gly 35

GTT

Val GAC AAA CCA Asp Lys Pro ATT GTA Ile Val 25 TCA CCA Ser Pro 40 TCT TAT GCC GAA TGT GAG AAA Ser Tyr Ala Glu Cys Glu Lys CTT CAC CCC TTG AAC CTC TGC Leu His Pro Leu Asn Leu Cys GGT CCT GGA GCC Gly Pro Gly Ala ACT GGA Thr Gly CCC TTG ACC GGT Pro Leu Thr Gly

GGA

Gly GTA AGC GCT TGT Val Ser Ala Cys 177 INFORMATION FOR SEQ ID NO:23: SEQUENCE CHARACTERISTICS: LENGTH: 59 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: Gly Trp Gly Ser Arg Ser Thr Ser Asn Phe 1 5 10 Leu Gln Thr Val Asp Lys Pro Ile Val Ser 25 Pro Ser Tyr Pro Asn Leu Tyr Ala Glu Cys Glu Lys Val Leu Gly Gly Pro Gly Ala Ser Pro Leu His Pro Leu 40 Asn Leu Cys Thr Gly Pro Leu Thr Gly Gly Val Ser Ala Cys WO 96/11706 PCT/US95/14442 141 INFORMATION FOR SEQ ID NO:24: SEQUENCE CHARACTERISTICS: LENGTH: 156 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..156 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

GGC

Gly 1 TGG GGA AAT Trp Gly Asn AAT TCA GCA GGG GAA AAT TTT Asn Ser Ala Gly Glu Asn Phe 10 CCA TTG AAA CTT Pro Leu Lys Leu CAA GAA TTG Gln Glu Leu

TAC

Tyr GTG AAA GCT Val Lys Ala TTG ACT AAT GAG Leu Thr Asn Glu 25 CAA GTC TGC ACA Gin Val Cys Thr 40 GAG TGC AAA GCT AAA Glu Cys Lys Ala Lys CTT TTG GAA AAG AAT Leu Leu Glu Lys Asn TCA CCA ATT CCA CCA ACG ACC Ser Pro Ile Pro Pro Thr Thr CAT GGT GTA TGC His Gly Val Cys INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 52 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID 156 Gly Trp Gly Asn Thr Asn Ser Ala Gly Glu 1 5 10 Gin Glu Leu Tyr Val Lys Ala Leu Thr Asn 25 Asn Phe Pro Leu Lys Leu Glu Glu Cys Lys Ala Lys Glu Lys Asn Ser Pro Ile Pro Pro Thr Thr Gin Val Cys Thr Leu Leu 40 His Gly Val Cys WO 96/11706 PCT/US95/14442 142 INFORMATION FOR SEQ ID NO:26: SEQUENCE CHARACTERISTICS: LENGTH: 159 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..159 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:

GGA

Gly 1 TGG GGA TCA Trp Gly Ser GGA TCT GGT GGT CCA ATT ACA AAT GTT CTA CAA Gly Ser Gly Gly Pro Ile Thr Asn Val Leu Gln 10 GAA GTC GAA Glu Val Glu CCA TTT ATC GAC Pro Phe Ile Asp AAC ACC TGC CGA AAA TCC TAC Asn Thr Cys Arg Lys Ser Tyr TCA ACC AGC Ser Thr Ser TTA ACC GAC CGT Leu Thr Asp Arg TTC TGC GCT GGA TTT Phe Cys Ala Gly Phe TTG GGA ATT Leu Gly Ile 144 GGT GGT AAG GCT TGC Gly Gly Lys Ala Cys INFORMATION FOR SEQ ID NO:27: SEQUENCE CHARACTERISTICS: LENGTH: 53 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: Gly Trp Gly Ser Thr Gly Ser Gly Gly Pro 1 5 10 Glu Val Glu Val Pro Phe Ile Asp Phe Asn 25 Ile Thr Asn Val Leu Gln Thr Cys Arg Lys Ser Tyr Ser Thr Ser Leu Thr Asp Arg Met Phe Cys Ala Gly Phe 40 Leu Gly Ile Gly Gly Lys Ala Cys WO 96/11706 PCT/US95/14442 143 INFORMATION FOR SEQ ID NO:28: SEQUENCE CHARACTERISTICS: LENGTH: 168 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..168 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

GGC

Gly 1 TGG GGA AAT Trp Gly Asn TTA GGG GAA GAT GAG GAC GAC CCC GAA CAA CTG CAA Leu Gly Glu Asp Glu Asp Asp Pro Glu Gin Leu Gin 5 10 TAT GTA AAG Tyr Val Lys CCT ATT GTT AAC TGG ACT CAG TGC Pro Ile Val Asn Trp Thr Gin Cys AAA ACT ATA TAT Lys Thr Ile Tyr TGT GCT GGT TAT Cys Ala Gly Tyr GGA AAT GAA Gly Asn Glu GGA CTA ATA Gly Leu Ile ATT ACC Ile Thr 40 CAA AAT ATG ATT Gin Asn Met Ile CCT GAT GGC GGT AAG GAC TCT TGC Pro Asp Gly Gly Lys Asp Ser Cys INFORMATION FOR SEQ ID NO:29: SEQUENCE CHARACTERISTICS: LENGTH: 56 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: Gly Trp Gly Asn Leu Gly Glu Asp Glu Asp Asp Pro Glu Gin Leu Gin 1 5 10 Tyr Val Lys Val Pro Ile Val Asn Trp Thr Gin Cys Lys Thr Ile Tyr 25 Gly Asn Glu Gly Leu Ile Ile Thr Gin Asn Met Ile Cys 40 Pro Asp Gly Gly Lys Asp Ser Cys Ala Gly Tyr WO 96/11706 PCT/US95/14442 144 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 159 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS 0 LOCATION: 1..159 (xi) SEQUENCE DESCRIPTION: SEQ ID

GGA

Gly 1 TGG GCA TCT CCA AAG ATT TCC CCT GCT TTC GAA Trp Ala Ser Pro Lys Ile Ser Pro Ala Phe Glu TTG CCT GAC AAA Leu Pro Asp Lys CTA CAG TAC Leu Gln Tyr GTA TGG GCC Val Trp Ala 35 ACT TTG GAA GTC Thr Leu Glu Val CAA CCA AGT GAA GAC TGC AAA AAA Gln Pro Ser Glu Asp Cys Lys Lys CCT TAC ATG Pro Tyr Met CGC GAC Arg Asp 40 TAC ATC CTT TGT Tyr Ile Leu Cys GCC AAA TTT GAA Ala Lys Phe Glu AAA CAA AAC ATT TGC Lys Gln Asn Ile Cys INFORMATION FOR SEQ ID NO:31: SEQUENCE CHARACTERISTICS: LENGTH: 53 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: Gly Trp Ala Ser Pro Lys Ile Ser Pro Ala 1 5 10 Leu Gln Tyr Thr Thr Leu Glu Val Gln Pro 25 Val Trp Ala Pro Tyr Met Arg Asp Tyr Ile 40 Phe Glu Leu Pro Asp Lys Ser Glu Asp Cys Lys Lys Leu Cys Ala Lys Phe Glu Lys Gln Asn Ile Cys 1PEAIS 1 9 145 INFORMATION FOR SEQ ID NO:32: SEQUENCE CHARACTERISTICS: LENGTH: 186 base pairs TYPE: nucleic acid STRANDEDNESS: .single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..186 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

GGT

Gly 1 TGG GGA AAG Trp Gly Lys

ATA

Ile 5 GAC TAT TCT Asp Tyr Ser AAA GTA GTA Lys Val Val GTT GAT CAG Val Asp Gln 35

CTG

Leu AAA ATT ATT GAT Lys Ile Ile Asp GAG AGC AGA AGT GAT GAC CTA CTG Glu Ser Arg Ser Asp Asp Leu Leu 10 AAT AGG CAA TGC GVY CCC TTA TAC Asn Arg Gln Cys Xaa Pro Leu Tyr 25 TTG AGA AAT GGA ATT GTA GAA ACA Leu Arg Asn Gly Ile Val Glu Thr ATT AAT AGA Ile Asn Arg AGA AGA Arg Arg 40 TTG GAT Leu Asp 55 CAG ATG Gln Met TGT GCA GGA GAA Cys Ala Gly Glu GGT GGA AAA GAC ACT TGC Gly Gly Lys Asp Thr Cys INFORMATION FOR SEQ ID NO:33: SEQUENCE CHARACTERISTICS: LENGTH: 62 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE: NAME/KEY: Xaa Val, Ala, Asp, Glu or Gly LOCATION: 29 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: Gly Trp Gly Lys Ile Asp Tyr Ser Glu Ser 1 5 10 Lys Val Val Leu Lys Ile Ile Asp Asn Arg 25 Arg Ser Asp Asp Leu Leu Gln Cys Xaa Pro Leu Tyr Val Asp Gin Ile Asn Arg Arg Arg Leu Arg Asn Gly Ile 40 Val Glu Thr Gin Met Cys Ala GLy Glu Leu Asp Gly Gly Lys Asp Thr Cys 55 WO 96/11706 PCT/US95/14442 146 INFORMATION FOR SEQ ID NO:34: SEQUENCE CHARACTERISTICS: LENGTH: 168 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..168 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

GGA

Gly 1 TGG GGA AGA Trp Gly Arg ACA TCG Thr Ser 5 TTC GGT GGC CAA TTG TCT AAA AAT CTG CGA Phe Gly Gly Gln Leu Ser Lys Asn Leu Arg 10 GGA GTC GAG Gly Val Glu ATG GAT AAA Met Asp Lys 35

TTG

Leu GAA ATA ATA GAT CTA TTC GAT TGT Glu Ile Ile Asp Leu Phe Asp Cys TTC CTT TCC TAC Phe Leu Ser Tyr 96 144 GTA AAC GTG Val Asn Val TCC GAA Ser Glu 40 TCT TGC Ser Cys AGG CAA GTT TGC GCT GGA ATC CCC Arg Gln Val Cys Ala Gly Ile Pro GTT GTA Val Val GGT GGT AAA GAT Gly Gly Lys Asp INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 56 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Gly Trp Gly Arg Thr Ser Phe Gly Gly Gln 1 5 10 Gly Val Glu Leu Glu Ile Ile Asp Leu Phe 25 Leu Ser Lys Asn Leu Arg Asp Cys Phe Leu Ser Tyr Gly Ile Pro Met Asp Lys Val Asn Val Ser Glu Arg Gln Val Cys Ala 40 Val Val Gly Gly Lys Asp Ser Cys WO 96/11706 PCT/US95/14442 147 INFORMATION FOR SEQ ID NO:36: SEQUENCE CHARACTERISTICS: LENGTH: 120 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..120 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

GGA

Gly 1 TGG GGT GCA GTC Trp Gly Ala Val 5 TAC GAA GGA GGT GCA GGA TCC ACC CAA TTA CTA Tyr Glu Gly Gly Ala Gly Ser Thr Gln Leu Leu 10 TAC TCC CAA Tyr Ser Gin GAC CAA GGC Asp Gin Gly GGC GGT GTT Gly Gly Val GCT CCT AGC ATG ATC TGC GCT GGA TTT Ala Pro Ser Met Ile Cys Ala Gly Phe GGT AAG GAC GCT Gly Lys Asp Ala 120 WO 96/11706 PCT/US95/14442 148 INFORMATION FOR SEQ ID NO:37: SEQUENCE CHARACTERISTICS: LENGTH: 40 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: Gly Trp Gly Ala Val Tyr Glu Gly Gly Ala 1 5 10 Tyr Ser Gln Phe Gly Gly Val Ala Pro Ser 25 Gly Ser Thr Gln Leu Leu Met Ile Cys Ala Gly Phe Asp Gln Gly Gly Lys Asp Ala Cys INFORMATION FOR SEQ ID NO:38: SEQUENCE CHARACTERISTICS: LENGTH: 162 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..162 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:

GGT

Gly 1 TGG GGA ACT ACA Trp Gly Thr Thr 5 GAG AGT ACT Glu Ser Thr GTA TCT AAT Val Ser Asn GAA TCA TCA Glu Ser Ser 10 AGT GAA TGT Ser Glu Cys 25 CAC CAC CTG AAA GAA His His Leu Lys Glu CAA AGG CCT AAT GAA Gln Arg Pro Asn Glu GTT GAA GTG Val Glu Val GAT CTT GCT Asp Leu Ala AAC GCT Asn Ala ACT ATA TCA Thr Ile Ser TCA CAT Ser His 40 GAG ATA TGT GCA AGC GTT CCT GGT Glu Ile Cys Ala Ser Val Pro Gly 144 GGC GGC Gly Gly AAA GAT TCT TGT Lys Asp Ser Cys WO 96/11706 PCT/US95/14442 149 INFORMATION FOR SEQ ID NO:39: SEQUENCE CHARACTERISTICS: LENGTH: 54 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: Gly Trp Gly Thr Thr Glu Ser Thr Glu Ser Ser His His Leu Lys Glu 1 5 10 Val Glu Val Asn Ala Val Ser Asn Ser Glu Cys Gin Arg Pro Asn Glu 25 Asp Leu Ala Thr Ile Ser Ser His Glu Ile Cys Ala Ser Val Pro Gly 40 Gly Gly Lys Asp Ser Cys INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 40 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Ile Val Gly Gly Glu Asn Ala Lys Glu Lys Ser Asp Val Pro Tyr Gin 1 5 10 Val Ser Leu Arg Asn Ala Glu Asn Lys His Phe Cys Gly Gly Ala Ile 25 Ile Asp Asp Tyr Trp Val Leu Thr WO 96/11706 PCT/US95/14442 150 INFORMATION FOR SEQ ID NO:41: SEQUENCE CHARACTERISTICS: LENGTH: 25 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: Ile Val Gly Gly Leu Glu Ala Lys Asn Gly Ser Ala Pro Phe Met Val 1 5 10 Ser Leu Gin Ala Glu Asp Tyr Phe His INFORMATION FOR SEQ ID NO:42: SEQUENCE CHARACTERISTICS: LENGTH: 26 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: Ile Ile Gly Gly Glu Val Ala Gly Glu Gly Ser Ala Pro Tyr Gin Val 1 5 10 Ser Leu Arg Thr Lys Glu Gly Asn His Phe INFORMATION FOR SEQ ID NO:43: SEQUENCE CHARACTERISTICS: LENGTH: 29 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: Ile Val Gly Gly Thr Ala Val Asp Ile Arg Gly Phe Pro Gly Arg Tyr 1 5 10 Gin Phe Lys Pro Lys Pro Ser Phe Leu Trp Trp Phe Tyr WO 96/11706 PCT/US95/14442 151 INFORMATION FOR SEQ ID NO:44: SEQUENCE CHARACTERISTICS: LENGTH: 35 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: Ile Val Asn Gly Leu Glu Ala Gly Val Gly Gin Phe Pro Ile Gin Val 1 5 10 Phe Leu Asp Leu Thr Asn Ile Arg Asp Glu Lys Ser Arg Cys Gly Gly 25 Ala Leu Phe INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 24 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Ile Val Gly Gly Leu Glu Ala Lys Asn Gly Ile Thr Pro Phe Ile Gly 1 5 10 Phe Phe Ala Ser Gly Arg Leu Phe INFORMATION FOR SEQ ID NO:46: SEQUENCE CHARACTERISTICS: LENGTH: 26 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: Ile Val Gly Gly Asn Asp Val Ser Xaa Lys Ile Phe Trp Gin Val Ser 1 5 10 Ile Gin Ser Asn Xaa Gin His Phe Cys Gly 20 WO 96/11706 PCTIUS95/14442 152 INFORMATION FOR SEQ ID NO:47: SEQUENCE CHARACTERISTICS: LENGTH: 31 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: Ile Ile Gly Gly Glu Asp Ala Pro Glu Gly Ser Ala Pro Tyr Gin Val 1 5 10 Ser Leu Arg Asn Gin Asn Leu Glu His Phe Cys Gly Gly Ser Ile 25 INFORMATION FOR SEQ ID NO:48: SEQUENCE CHARACTERISTICS: LENGTH: 32 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: GTWGGWAAAG GWWTWACWTT YGATTCWGGW GG 32 INFORMATION FOR SEQ ID NO:49: SEQUENCE CHARACTERISTICS: LENGTH: 20 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: CGWCCTTCWG CATCWGTATT WO 96/11706 PCT/US95/14442 153 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 453 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..453 (xi) SEQUENCE DESCRIPTION: SEQ ID CAC GAG TTT TGT GCG AGT His Glu Phe Cys Ala Ser GTC AGA TAT TGC AGC TCT ATG AGT AAC AAG Val Arg Tyr Cys Ser Ser Met Ser Asn Lys AAA GGA TTA Lys Gly Leu AGG TTA ACG Arg Leu Thr 35 GTA CTG GGC ATC TAC Val Leu Gly Ile Tyr CCA ACT GCT GAA CAA Pro Thr Ala Glu Gin 40 GAC AAT GAA TTC GAT AAA AAA ATA Asp Asn Glu Phe Asp Lys Lys Ile 25 TTC AAT CGG CGA TTG CAG GGG CGT Phe Asn Arg Arg Leu Gin Gly Arg 96 144 TTA CTA Leu Leu GAT CTA ATT CAT Asp Leu Ile His

TTG

Leu 55 AGT GGA CCC ATT AAA TTG GGC AAG AGC Ser Gly Pro Ile Lys Leu Gly Lys Ser GAA TTC GGC GCA GTT GCA GTT GCA GGT Glu Phe Gly Ala Val Ala Val Ala Gly 75

CGT

Arg ATT TTC TGG GAT Ile Phe Trp Asp CTC GAT Leu Asp 70 TTG GGA AAT CAC TCC CCC TGC GAA CTC Leu Gly Asn His Ser Pro Cys Glu Leu CTG GAA GAA CTC GAT GTT TTG Leu Glu Glu Leu Asp Val Leu 90 GCT GGT TGC CAA GCT CTT GCC Ala Gly Cys Gin Ala Leu Ala 110 CGC GAA AAT Arg Glu Asn GCC AGA Ala Arg 100 ATA GCT GCC GGT Ile Ala Ala Gly 105 288 336 384 GCC GAT GGA Ala Asp Gly 115 ATC ACT ACC Ile Thr Thr ATT AGC GTT GAA GTA TGG AGC ACC CGG AGG Ile Ser Val Glu Val Trp Ser Thr Arg Arg 120 125 ATA CTA TCG ACG TTC AAA TTC AGG TCA ACA Ile Leu Ser Thr Phe Lys Phe Arg Ser Thr 135 140 CGG CCA Arg Pro 130 TGC GAA GGT GCA Cys Glu Gly Ala

GAA

Glu 145 GTA GTC CAG TGT Val Val Gin Cys AGC GGT Ser Gly 150 WO 96/11706 PCT/US95/14442 154 INFORMATION FOR SEQ ID NO:51: SEQUENCE CHARACTERISTICS: LENGTH: 151 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein His 1 Lys Arg Leu Arg Leu Arg Ala Arg Glu 145 (xi) SEQUENCE Glu Phe Cys Ala 5 Gly Leu Val Leu Leu Thr Pro Thr Leu Asp Leu Ile 50 Ile Phe Trp Asp Gly Asn His Ser Glu Asn Ala Arg 100 Asp Gly Ile Thr 115 Pro Cys Glu Gly 130 Val Val Gin Cys DESCRIPTION: SEQ ID Ser Val Arg Tyr Cys 10 Gly Ile Tyr Asp Asn 25 Ala Glu Gin Phe Asn 40 His Leu Ser Gly Pro 55 Leu Asp Glu Phe Gly 70 Pro Cys Glu Leu Leu 90 Ile Ala Ala Gly Ala 105 Thr Ile Ser Val Glu 120 Ala Ile Leu Ser Thr 135 Ser Gly 150 NO: 51: Ser Ser Met Glu Phe Asp Arg Arg Leu Ile Lys Leu Ala Val Ala 75 Glu Glu Leu Gly Cys Gin Val Trp Ser 125 Phe Lys Phe 140 Ser Lys Gin Gly Val Asp Ala 110 Thr Arg Asn Lys Lys Ile Gly Arg Lys Ser Ala Gly Val Leu Leu Ala Arg Arg Ser Thr WO 96/11706 PCT/US95/14442 155 INFORMATION FOR SEQ ID NO:52: SEQUENCE CHARACTERISTICS: LENGTH: 258 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..258 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: TCA GCA CTC GTT Ser Ala Leu Val

GCC

Ala TTG TCT GCA GCT Leu Ser Ala Ala ATT CCT Ile Pro 10 CAC TCC AAC AGA GTC His Ser Asn Arg Val GTT GGA GGA Val Gly Gly TTG CAA GTT Leu Gln Val 35 GAA GCT GCA Glu Ala Ala GAG GGT Glu Gly TCT GCA CCT TAT CAA GTA TCC Ser Ala Pro Tyr Gln Val Ser 48 96 144 GGC AAC TTC CAC Gly Asn Phe His TTC TGT GGT GGT TCA ATT CTG AAC GAA Phe Cys Gly Gly Ser Ile Leu Asn Glu 40 CAC TGT TTG GGT TAT GAC TTC GAC GTG His Cys Leu Gly Tyr Asp Phe Asp Val TAT TGG Tyr Trp GTT TTG ACT GCT Val Leu Thr Ala

GCT

Ala 55

GTA

Val GTT GGA ACA Val Gly Thr AAC AAA Asn Lys 70 GTT CAC Val His CTT GAT CAA CCA GGT GAA AGA TAC CTC GTA Leu Asp Gln Pro Gly Glu Arg Tyr Leu Val 75 GAA CAA ACT TTT Glu Gin Thr Phe WO 96/11706 PCT/US95/14442 156 INFORMATION FOR SEQ ID NO:53: SEQUENCE CHARACTERISTICS: LENGTH: 86 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Ser Ala Leu Val Ala Leu Ser Ala Ala Ile 1 5 10 Val Gly Gly Leu Glu Ala Ala Glu Gly Ser 25 Leu Gln Val Gly Asn Phe His Phe Cys Gly 40 Tyr Trp Val Leu Thr Ala Ala His Cys Leu 50 55 Val Val Gly Thr Asn Lys Leu Asp Gln Pro 70 Glu Gln Thr Phe Val His NO:53: Pro His Ser Asn Arg Val Ala Pro Tyr Gln Val Ser Gly Ser Ile Leu Asn Glu Gly Tyr Asp Phe Asp Val Gly Glu Arg Tyr Leu Val 75 WO 96/11706 PCTUS95/14442 157

C

A

INFORMATION FOR SEQ ID NO:54: SEQUENCE CHARACTERISTICS: LENGTH: 240 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..240 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: TTA GAT GGG CGC ATT GTT GGA GGA CAA GAT GCT GAT ATT GCC AAA TAT Leu Asp Gly Arg Ile Val Gly Gly Gin Asp Ala Asp Ile Ala Lys Tyr 1 5 10 ;GC TAT CAA GCT TCA CTC CAA GTA TTT AAC GAA CAT TTC TGT GGA GCT Gly Tyr Gin Ala Ser Leu Gln Val Phe Asn Glu His Phe Cys Gly Ala 25 CCA ATA TTG AAT AAT TAT TGG ATT GTC ACA GCA GCT CAT TGC ATA TAT 3er Ile Leu Asn Asn Tyr Trp Ile Val Thr Ala Ala His Cys Ile Tyr 35 40 AT GAA TTC ACG TAT TCA GTT CGA GTC GGC ACC AGT TTC CAA GGA AGA sp Glu Phe Thr Tyr Ser Val Arg Val Gly Thr Ser Phe Gin Gly Arg 55 :GT GGT TCC GTT CAT CCT GTG GCA CAA ATT ATC AAG CAT CCT GCA TAC rg Gly Ser Val His Pro Val Ala Gin Ile Ile Lys His Pro Ala Tyr 70 75 48 96 144 192 240 2) INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 80 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Leu Asp Gly Arg Ile Val Gly Gly Gin Asp 1 5 10 Gly Tyr Gin Ala Ser Leu Gin Val Phe Asn 25 Ser Ile Leu Asn Asn Tyr Trp Ile Val Thr 40 Asp Glu Phe Thr Tyr Ser Val Arg Val Gly 55 Arg Gly Ser Val His Pro Val Ala Gin Ile 70 Ala Asp Ile Ala Lys Tyr Glu His Phe Cys Gly Ala Ala Ala His Cys Ile Tyr Thr Ser Phe Gin Gly Arg Ile Lys His Pro Ala Tyr 75 WO 96/11706 PCT/US95/14442 158 INFORMATION FOR SEQ ID NO:56: SEQUENCE CHARACTERISTICS: LENGTH: 218 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..216 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: AGG GAA CAA AAG CTG GAG CTC CAC CGC GGT GCG CCG GCT CTA GAA CTA Arg Glu Gin Lys Leu Glu Leu His Arg Gly Ala Pro Ala Leu Glu Leu 1 5 10 GTG GAT CCC CCG GGT CTG CAG GAA TTG GCA CGA GGA TGT TCT TGG CTG Val Asp Pro Pro Gly Leu Gin Glu Leu Ala Arg Gly Cys Ser Trp Leu 25 TGT TTA GTA GCT ATT CTT TGT GCA GTG GCT GCT GGG CCT ACT AAT CGC Cys Leu Val Ala Ile Leu Cys Ala Val Ala Ala Gly Pro Thr Asn Arg 35 40 ATT GTT GGA GGA TTG GAG GCG AAA AAT GGA ATC ACC CCA TTC ATC GGT Ile Val Gly Gly Leu Glu Ala Lys Asn Gly Ile Thr Pro Phe Ile Gly 55 TTC TTT GCA AGC GGA AGA CTA TTT CA Phe Phe Ala Ser Gly Arg Leu Phe INFORMATION FOR SEQ ID NO:57: 48 96 144 192 218 Arg 1 Val Cys Ile Phe SEQUENCE CHARACTERISTICS: LENGTH: 72 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: Glu Gin Lys Leu Glu Leu His Arg Gly Ala Pro Ala Leu Glu Leu 5 10 Asp Pro Pro Gly Leu Gin Glu Leu Ala Arg Gly Cys Ser Trp Leu 25 Leu Val Ala Ile Leu Cys Ala Val Ala Ala Gly Pro Thr Asn Arg 40 Val Gly Gly Leu Glu Ala Lys Asn Gly Ile Thr Pro Phe Ile Gly 55 Phe Ala Ser Gly Arg Leu Phe WO 96/11706 PCT/US95/14442 159 c

I

V

INFORMATION FOR SEQ ID NO:58: SEQUENCE CHARACTERISTICS: LENGTH: 240 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..240 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: ACG AGG TTT CGC TTA GCA ATT GTA TGT GCT CTC GCT GTC TGC ACA TTC Thr Arg Phe Arg Leu Ala Ile Val Cys Ala Leu Ala Val Cys Thr Phe 1 5 10 GGT GCC AGT GTT CCA GAA CCA TGG AAA AGA TTA GAT GGT AGA ATC GTA Gly Ala Ser Val Pro Glu Pro Trp Lys Arg Leu Asp Gly Arg Ile Val 25 GGA GGA CAC GAT ACC AGC ATC GAT AAA CAC CCT CAT CAA GTA TCT TTA Gly Gly His Asp Thr Ser Ile Asp Lys His Pro His Gln Val Ser Leu 35 40 CTG TAC TCC AGC CAC AAT TGT GGT GGT TCC TTG ATT GCC AAA AAC TGG Leu Tyr Ser Ser His Asn Cys Gly Gly Ser Leu Ile Ala Lys Asn Trp 55 ;TT TTG ACT GCA GCT CAT TGC ATT GGA GTT AAC AAA TAC AAT GTC CGT Tal Leu Thr Ala Ala His Cys Ile Gly Val Asn Lys Tyr Asn Val Arg 70 75 48 96 144 192 240 :2) Thr 1 Gly Gly Leu Val INFORMATION FOR SEQ ID NO:59: SEQUENCE CHARACTERISTICS: LENGTH: 80 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Arg Phe Arg Leu Ala Ile Val Cys Ala 5 10 Ala Ser Val Pro Glu Pro Trp Lys Arg 25 Gly His Asp Thr Ser Ile Asp Lys His 40 Tyr Ser Ser His Asn Cys Gly Gly Ser 55 Leu Thr Ala Ala His Cys Ile Gly Val 70 NO:59: Leu Ala Val Cys Thr Phe Leu Asp Gly Arg Ile Val Pro His Gin Val Ser Leu Leu Ile Ala Lys Asn Trp Asn Lys Tyr Asn Val Arg 75 WO 96/11706 PCT/US95/14442 160 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 234 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..234 (xi) SEQUENCE DESCRIPTION: SEQ ID CCC TCA CTA AAG GGA ACA AAA GCT GGA GCT CCA CCG CGG TGC GCC GCT Pro Ser Leu Lys Gly Thr Lys Ala Gly Ala Pro Pro Arg Cys Ala Ala 1 5 10 CTA GAA CTA GTG GAT CCC CCG GGC TGC AGG AAT TCG GCA CGA GCG TTT Leu Glu Leu Val Asp Pro Pro Gly Cys Arg Asn Ser Ala Arg Ala Phe 25 GGT TGG ATT GAG CGC GTC TCA TCT TAC AAG ATA AAG GAT AGA TTA GAT Gly Trp Ile Glu Arg Val Ser Ser Tyr Lys Ile Lys Asp Arg Leu Asp 35 40 GGG CGC ATT GTT GGA GGA CAA GAT GCT GAT ATT GCC AAA TAT GGC TAT Gly Arg Ile Val Gly Gly Gln Asp Ala Asp Ile Ala Lys Tyr Gly Tyr 55 CAA GCT TCA CTC CAA GTA CTT AAC GAA CAT TTC TGT GGA GCT Gln Ala Ser Leu Gln Val Leu Asn Glu His Phe Cys Gly Ala 70 INFORMATION FOR SEQ ID NO:61: 48 96 144 192 234 SEQUENCE CHARACTERISTICS: LENGTH: 78 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Pro Ser Leu Lys Gly Thr Lys Ala Gly Ala 1 5 10 Leu Glu Leu Val Asp Pro Pro Gly Cys Arg 25 Gly Trp Ile Glu Arg Val Ser Ser Tyr Lys 40 Gly Arg Ile Val Gly Gly Gln Asp Ala Asp 55 Gln Ala Ser Leu Gln Val Leu Asn Glu His 70 NO: 61: Pro Pro Arg Cys Ala Ala Asn Ser Ala Arg Ala Phe Ile Lys Asp Arg Leu Asp Ile Ala Lys Tyr Gly Tyr Phe Cys Gly Ala WO 96/11706 PCTIUS95/14442 161

I

T

S

G

A

C

H

G

INFORMATION FOR SEQ ID NO:62: SEQUENCE CHARACTERISTICS: LENGTH: 291 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..291 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62: 3CG GTG ATT GTG TCA TTT GTT CTG GCT TGT GCA TTT TCT GTA CAG GCT Ala Val Ile Val Ser Phe Val Leu Ala Cys Ala Phe Ser Val Gln Ala 1 5 10 CTT CCA TCA AGC AGA ATT GTC AAT GGA CTT GAA GCA GGA GTT GGA CAA Leu Pro Ser Ser Arg Ile Val Asn Gly Leu Glu Ala Gly Val Gly Gln 25 'TT CCA ATT CAG GTT TTC TTA GAC TTG ACA AAT ATC AGA GAC GAA AAA >he Pro Ile Gln Val Phe Leu Asp Leu Thr Asn Ile Arg Asp Glu Lys 35 40 'CC AGA TGT GGT GGT GCT TTG TTA TCA GAT TCA TGG GTT TTG ACT GCT ;er Arg Cys Gly Gly Ala Leu Leu Ser Asp Ser Trp Val Leu Thr Ala 55 !CT CAT TGT TTT GAT GAT TTG AAG TCT ATG GTA GTG TCC GTT GGT GCT Lla His Cys Phe Asp Asp Leu Lys Ser Met Val Val Ser Val Gly Ala 70 75 AT GAT GTC AGC AAA TCT GAA GAA CCT CAC AGG CAA ACC AGG AAA CCT is Asp Val Ser Lys Ser Glu Glu Pro His Arg Gln Thr Arg Lys Pro 90

AA

lu 48 96 144 192 240 288 INFORMATION FOR SEQ ID NO:63: SEQUENCE CHARACTERISTICS: LENGTH: 97 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63: Ala Val Ile Val Ser Phe Val Leu Ala Cys Ala Phe Ser Val Gln Ala 1 5 10 Leu Pro Ser Ser Arg Ile Val Asn Gly Leu Glu Ala Gly Val Gly Gln 25 Phe Pro Ile Gln Val Phe Leu Asp Leu Thr Asn Ile Arg Asp Glu Lys 40 Ser Arg Cys Gly Gly Ala Leu Leu Ser Asp Ser Trp Val Leu Thr Ala 55 WO 96/11706 PCT/US95/14442 162 Ala His Cys Phe Asp Asp Leu Lys Ser Met Val 70 75 His Asp Val Ser Lys Ser Glu Glu Pro His Arg 90 Glu INFORMATION FOR SEQ ID NO:64: Val Ser Val Gly Ala Gin Thr Arg Lys Pro SEQUENCE CHARACTERISTICS: LENGTH: 144 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..144 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: GTA CTG ATC GTT TTA GCA GTC ATT GAA TTC GCA TCA GCG Val Leu Ile Val Leu Ala Val Ile Glu Phe Ala Ser Ala 1 5 10 TCT TCA ATC Ser Ser Ile GGC TGG AGA Gly Trp Arg TAT CAA GTT Tyr Gin Val ATC GTG GGT GGT GAA AAT GCT AAA GAA AAA TCG GTG CCC Ile Val Gly Gly Glu Asn Ala Lys Glu Lys Ser Val Pro 25 TCM CTT CGA AAT GCT GAA AAC AAA CAT TTY TGT GGR GGR Ser Leu Arg Asn Ala Glu Asn Lys His Phe Cys Gly Gly 40 WO 96/11706 PCT/US95/14442 163 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 48 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Val Leu Ile Val Leu Ala Val Ile Glu Phe Ala Ser Ala Ser Ser Ile 1 5 10 Gly Trp Arg Ile Val Gly Gly Glu Asn Ala Lys Glu Lys Ser Val Pro 25 Tyr Gin Val Ser Leu Arg Asn Ala Glu Asn Lys His Phe Cys Gly Gly 40 INFORMATION FOR SEQ ID NO:66: SEQUENCE CHARACTERISTICS: LENGTH: 390 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..390 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66: TTC GGC TTC AAG CTA AGT CAT TTG GTA AGT AAG TAC TGT GCT TGT GCA 48 Phe Gly Phe Lys Leu Ser His Leu Val Ser Lys Tyr Cys Ala Cys Ala 1 5 10 TTA GCA TCG GCA CTG AAG TAC TCC ATC GAT CAT GGT CCT CGT ATC ATC 96 Leu Ala Ser Ala Leu Lys Tyr Ser Ile Asp His Gly Pro Arg Ile Ile 20 25 GGA GGT GAA GTT GCA GGT GAA GGA TCA GCA CCT TAC CAG GTG TCC TTA 144 Gly Gly Glu Val Ala Gly Glu Gly Ser Ala Pro Tyr Gin Val Ser Leu 40 AGA ACC AAG GAA GGA AAT CAT TTT TGC GGT GGA TCA ATA CTA AAT AAG 192 Arg Thr Lys Glu Gly Asn His Phe Cys Gly Gly Ser Ile Leu Asn Lys 55 CGA TGG GTT GTA ACT GCA GCA CAT TGT CTT GAA CCG GAA ATA TTA GAT 240 Arg Trp Val Val Thr Ala Ala His Cys Leu Glu Pro Glu Ile Leu Asp 70 75 TCG GTA TAC GTC GGA TCC AAT CAC TTA GAC CGA AAA GGC AGA TAT TAC 288 Ser Val Tyr Val Gly Ser Asn His Leu Asp Arg Lys Gly Arg Tyr Tyr 90 GAC GTA GAA CGG TAT ATA ATT CAT GAA AAA TAT ATA GGA GAA CTA AAT 336 Asp Val Glu Arg Tyr Ile Ile His Glu Lys Tyr Ile Gly Glu Leu Asn 100 105 110 WO 96/11706 PCT/US95/14442 164 AAT TTT TAT GCT GAC ATC GGT CTA ATA AAA CTT GAT GGA AGA CTT AGA Asn Phe Tyr Ala Asp Ile Gly Leu Ile Lys Leu Asp Gly Arg Leu Arg 115 120 125 ATT CAA Ile Gin 130 INFORMATION FOR SEQ ID NO:67: SEQUENCE CHARACTERISTICS: LENGTH: 130 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67: Phe Gly Phe Lys Leu Ser His Leu Val Ser Lys Tyr Cys Ala Cys Ala 1 5 10 Leu Ala Ser Ala Leu Lys Tyr Ser Ile Asp His Gly Pro Arg Ile Ile 25 Gly Gly Glu Val Ala Gly Glu Gly Ser Ala Pro Tyr Gin Val Ser Leu 40 Arg Thr Lys Glu Gly Asn His Phe Cys Gly Gly Ser Ile Leu Asn Lys 55 Arg Trp Val Val Thr Ala Ala His Cys Leu Glu Pro Glu Ile Leu Asp 70 75 Ser Val Tyr Val Gly Ser Asn His Leu Asp Arg Lys Gly Arg Tyr Tyr 85 90 Asp Val Glu Arg Tyr Ile Ile His Glu Lys Tyr Ile Gly Glu Leu Asn 100 105 110 Asn Phe Tyr Ala Asp Ile Gly Leu Ile Lys Leu Asp Gly Arg Leu Arg 115 120 125 Ile Gin 130 384 390 WO 96/11706 PCT/US95/14442 165 INFORMATION FOR SEQ ID NO:68: SEQUENCE CHARACTERISTICS: LENGTH: 240 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..240 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 73 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68: CGG GCT GCA GGA ATT CGG CAC GAG AAG AAA CTG CCA ATA TTA ATC GCC Arg Ala Ala Gly Ile Arg His Glu Lys Lys Leu Pro Ile Leu Ile Ala 1 5 10 TTG ATC GGA TGC GTT CTT TCT GAA GAA ATA GAG GAT CGC ATT GTC GGC Leu Ile Gly Cys Val Leu Ser Glu Glu Ile Glu Asp Arg Ile Val Gly 20 25 GGA ACG GCA GTT GAT ATA AGA GGT TTT CCC TGG CAG GTA TCA ATT CAA Gly Thr Ala Val Asp Ile Arg Gly Phe Pro Trp Gin Val Ser Ile Gin 40 ACC GAA AAC CGT CAT TTT TGT GGT GGT TCT ATT ATC GAT AAA AGC TGG Thr Glu Asn Arg His Phe Cys Gly Gly Ser Ile Ile Asp Lys Ser Trp 55 ATA TTA ACT GCC GCA CAT TGT GTA CMC GAT ATG AAG ATG TCG AAC TGG Ile Leu Thr Ala Ala His Cys Val Xaa Asp Met Lys Met Ser Asn Trp 70 75 INFORMATION FOR SEQ ID NO:69: 48 96 144 192 240 Arg 1 Leu Gly Thr Ile SEQUENCE CHARACTERISTICS: LENGTH: 80 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ.ID Ala Ala Gly Ile Arg His Glu Lys Lys 5 10 Ile Gly Cys Val Leu Ser Glu Glu Ile 20 25 Thr Ala Val Asp Ile Arg Gly Phe Pro 40 Glu Asn Arg His Phe Cys Gly Gly Ser 55 Leu Thr Ala Ala His Cys Val Xaa Asp 70 NO:69: Leu Pro Ile Leu Ile Ala Glu Asp Arg Ile Val Gly Trp Gin Val Ser Ile Gin Ile Ile Asp Lys Ser Trp Met Lys Met Ser Asn Trp 75 WO 96/11706 PCT/US95/14442 166 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 177 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..177 (xi) SEQUENCE DESCRIPTION: SEQ ID

CAC

His 1 GAG ATT TTA Glu Ile Leu

TTA

Leu 5 AGC GCA TTA Ser Ala Leu TTT GCA AGT GTA ATT Phe Ala Ser Val Ile 10 TGC TCC TTT Cys Ser Phe AAC GCG GAA Asn Ala Glu TCA AAA ATT Ser Lys Ile 35 CAA AAT CGA ATC Gln Asn Arg Ile GTT GGT GGC AAT GAT GTA AGT ATT Val Gly Gly Asn Asp Val Ser Ile GGG TGG CAA Gly Trp Gln GTA TCT Val Ser 40 GCT AAA Ala Lys ATT CAA AGT AAT Ile Gln Ser Asn AAA CAA CAT TTC Lys Gln His Phe TGT GGT Cys Gly GGT TCA ATC ATT Gly Ser Ile Ile GAT GGG TCC Asp Gly Ser 177 INFORMATION FOR SEQ ID NO:71: SEQUENCE CHARACTERISTICS: LENGTH: 59 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71: His Glu Ile Leu Leu Ser Ala Leu Phe Ala 1 5 10 Asn Ala Glu Val Gln Asn Arg Ile Val Gly 25 Ser Val Ile Cys Ser Phe Gly Asn Asp Val Ser Ile Gln His Phe Ser Lys Ile Gly Trp Gln Val Ser Ile Gln Ser Asn Lys 40 Cys Gly Gly Ser Ile Ile Ala Lys Asp Gly Ser INFORMATION FOR SEQ ID NO:72: SEQUENCE CHARACTERISTICS: LENGTH: 168 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA WO 96/11706 PCT/US95/14442 167 (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..168 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72: ATC ATG GCA AAT TTT AGG CTA TTC ACC TTA CTA GCC TTG GTT TCA GTA Ile Met Ala Asn Phe Arg Leu Phe Thr Leu Leu Ala Leu Val Ser Val 1 5 10 GCA ACT TCC AAA TAT ATT GAT CCA AGA ATA ATT GGA GGC GAA GAT GCT Ala Thr Ser Lys Tyr Ile Asp Pro Arg Ile Ile Gly Gly Glu Asp Ala 20 25 CCT GAA GGC TCG GCT CCG TAC CAA GTT TCA TTG AGA AAT CAG AAT CTG Pro Glu Gly Ser Ala Pro Tyr Gin Val Ser Leu Arg Asn Gln Asn Leu 40 GAG CAT TTC TGT GGT GGT TCC ATT Glu His Phe Cys Gly Gly Ser Ile INFORMATION FOR SEQ ID NO:73: SEQUENCE CHARACTERISTICS: LENGTH: 56 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73: Ile Met Ala Asn Phe Arg Leu Phe Thr Leu Leu Ala Leu Val Ser Val 1 5 10 Ala Thr Ser Lys Tyr Ile Asp Pro Arg Ile Ile Gly Gly Glu Asp Ala 25 Pro Glu Gly Ser Ala Pro Tyr Gin Val Ser Leu Arg Asn Gin Asn Leu 40 Glu His Phe Cys Gly Gly Ser Ile WO 96/11706 PCTfUS95/14442 168 INFORMATION FOR SEQ ID NO:74: SEQUENCE CHARACTERISTICS: LENGTH: 192 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..192 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74: GCA CGA GAT CGC ATT GTT GGA GGA TTG GAG GCG AAA AAT GGA TCA GCC Ala Arg Asp Arg Ile Val Gly Gly Leu Glu Ala Lys Asn Gly Ser Ala 1 5 10 CCA TTC ATG GTT TCT TTG CAA GCG GAA GAC TAT TTT CAT TTT TGT GGA Pro Phe Met Val Ser Leu Gln Ala Glu Asp Tyr Phe His Phe Cys Gly 25 TCC TCT ATT CTG AAT GAG AGA TGG GTT CTT ACT GCT GCT CAC TGT ATC Ser Ser Ile Leu Asn Glu Arg Trp Val Leu Thr Ala Ala His Cys Ile 35 40 CAA CCA AAT GTA CAC AAG TAC GTT TAC GTC GGT TCG AAC AAC GTA GAA Gln Pro Asn Val His Lys Tyr Val Tyr Val Gly Ser Asn Asn Val Glu 55 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 64 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Ala Arg Asp Arg Ile Val Gly Gly Leu Glu Ala Lys Asn Gly Ser Ala 1 5 10 Pro Phe Met Val Ser Leu Gln Ala Glu Asp Tyr Phe His Phe Cys Gly 25 Ser Ser Ile Leu Asn Glu Arg Trp Val Leu Thr Ala Ala His Cys Ile 40 Gln Pro Asn Val His Lys Tyr Val Tyr Val Gly Ser Asn Asn Val Glu 55 48 96 144 192 WO 96/11706 PCTIUS95/14442 169 INFORMATION FOR SEQ ID NO:76: SEQUENCE CHARACTERISTICS: LENGTH: 207 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS 0 LOCATION: 1..204 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76: CCA ATC CAC Pro Ile His 1 GCA TGT AAG Ala Cys Lys CAT GGA ATT His Gly Ile 35 GAT AGC Asp Ser 5 CAA TAT GCA CTT Gin Tyr Ala Leu TTG CAG ATA TGG GTC AAG GGT Leu Gin Ile Trp Val Lys Gly 10 TTA GTC ATC AAT GGA CAA CTT Leu Val Ile Asn Gly Gin Leu GAT TCC GGT Asp Ser Gly GGC CCC Gly Pro GTT TCC TGG Val Ser Trp GGC ATT CCT TGC GCT GTC GCA AGC CTG ATG Gly Ile Pro Cys Ala Val Ala Ser Leu Met 40 TAT TCA Tyr Ser CAA GAG TTT Gin Glu Phe CTC ATT ATG TCG ATT GGA TTA AAT CCA AAA TTG Leu Ile Met Ser Ile Gly Leu Asn Pro Lys Leu 55

AAT

Asn AAA ATT GTT TAG Lys Ile Val INFORMATION FOR SEQ ID NO:77: SEQUENCE CHARACTERISTICS: LENGTH: 68 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77: Pro Ile His Asp Ser Gin Tyr Ala Leu Leu Gin Ile Trp Val Lys Gly 1 5 10 Ala Cys Lys Gly Asp Ser Gly Gly Pro Leu Val Ile Asn Gly Gin Leu 25 His Gly Ile Val Ser Trp Gly Ile Pro Cys Ala Val Ala Ser Leu Met 40 Tyr Ser Gin Glu Phe Leu Ile Met Ser Ile Gly Leu Asn Pro Lys Leu 55 Asn Lys Ile Val WO 96/11706 PCT/US95/14442 170 INFORMATION FOR SEQ ID NO:78: SEQUENCE CHARACTERISTICS: LENGTH: 159 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..156 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78: GGA GGT CCT TTG GCA ATC AAT GGT GAA CTT GTT GGT GTT ACT TCA TTC 48 Gly Gly Pro Leu Ala Ile Asn Gly Glu Leu Val Gly Val Thr Ser Phe 1 5 10 ATT ATG GGG ACA TGT GGA GGA GGA CAT CCT GAT GTC TTC GGT CGA GTC 96 Ile Met Gly Thr Cys Gly Gly Gly His Pro Asp Val Phe Gly Arg Val 25 CTT GAC TTC AAA CCA TGG ATT GAT TCT CAT ATG GCA AAT GAC GGC GCT 144 Leu Asp Phe Lys Pro Trp Ile Asp Ser His Met Ala Asn Asp Gly Ala 35 40 AAT TCT TTT ATT TAA 159 Asn Ser Phe Ile INFORMATION FOR SEQ ID NO:79: SEQUENCE CHARACTERISTICS: LENGTH: 52 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79: Gly Gly Pro Leu Ala Ile Asn Gly Glu Leu Val Gly Val Thr Ser Phe 1 5 10 Ile Met Gly Thr Cys Gly Gly Gly His Pro Asp Val Phe Gly Arg Val 25 Leu Asp Phe Lys Pro Trp Ile Asp Ser His Met Ala Asn Asp Gly Ala 40 Asn Ser Phe Ile WO 96/11706 PCTIUS95/14442 171 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 779 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 3..699 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 123 (xi) SEQUENCE DESCRIPTION: SEQ ID TT TTC TCA GCA CTC GTT GCC TTG TCT GCA GCT ATT CCT CAC TCC AAC Phe Ser Ala Leu Val Ala Leu Ser Ala Ala Ile Pro His Ser Asn 1 5 10 AGA GTC GTT Arg Val Val GGA GGA Gly Gly CTG GAA GCT GCA GAA GGT TCT GCA CCT TAC CAA Leu Glu Ala Ala Glu Gly Ser Ala Pro Tyr Gin 25 GTA TCC TTG Val Ser Leu AAC GAA TAT Asn Glu Tyr GAC GTG GTA Asp Val Val CAA GTT GGT AAC TTC CAC TTC TGT GGT GGT TCA ATT TTG Gin Val Gly Asn Phe His Phe Cys Gly Gly Ser Ile Leu 40 TGG GTT TTG ACT GCT GCT CAC TGT TTG GGT TAT GAC TTC Trp Val Leu Thr Ala Ala His Cys Leu Gly Tyr Asp Phe 55 GTG GGA ACA AAC AAA CTT GAT CAA CCA GGT GAA AGA TAC Val Gly Thr Asn Lys Leu Asp Gin Pro Gly Glu Arg Tyr 70

CTC

Leu GTA GAA CAA ACT TTT GTT CAC CAA TTC GAC CAG GAA TCT TTA AGA Val Glu Gin Thr Phe Val His Gin Phe Asp Gin Glu Ser Leu Arg 85 90 143 191 239 287 335 383 431 479 527 CAC GAT CTT GCT TTG GTA AAA GTG TCC AGC CCT ATC GAA TTC AAT GAT His Asp Leu Ala Leu Val Lys Val Ser Ser Pro Ile Glu Phe Asn Asp 100 105 110 TAT GTT CAA CCA ATT CCA TTG GGC GAA ACT TAT GTB GGC GGT GAA GTT Tyr Val Gin Pro Ile Pro Leu Gly Glu Thr Tyr Xaa Gly Gly Glu Val 115 120 125 GCT CGT CTT ACT GGA TGG GGA AGA CTT GGA GCT AAC TTG AAT GGA CCG Ala Arg Leu Thr Gly Trp Gly Arg Leu Gly Ala Asn Leu Asn Gly Pro 130 135 140 AAT GAA Asn Glu 145 GTA AGA Val Arg 160 CTC CAA GAA CTT AAC ACT GTC ACA TTA AGC CAC CAG CAA TGT Leu Gin Glu Leu Asn Thr Val Thr Leu Ser His Gin Gin Cys 150 155 CAA CAA ATT TAT CCA GTA TAC GAC AGC CAA CTT TGC ACA TTT Gin Gin Ile Tyr Pro Val Tyr Asp Ser Gin Leu Cys Thr Phe 165 170 175 WO 96/11706 PCT/US95/14442 172 GTT GGC AGT GGA CGA GGC GCC TGC AAC GGT GAC TCT GGT GGT CCA TTG 575 Val Gly Ser Gly Arg Gly Ala Cys Asn Gly Asp Ser Gly Gly Pro Leu 180 185 190 GTC GTC AAT GGA GAA CTT CAC GGA GTC GTC TCC TGG GGA ATC CCC TGC 623 Val Val Asn Gly Glu Leu His Gly Val Val Ser Trp Gly Ile Pro Cys 195 200 205 GCC GTT GGA TTA CCC GAT GTC TTC ACA AGA GTT TCA CAC TAC GCT GAC 671 Ala Val Gly Leu Pro Asp Val Phe Thr Arg Val Ser His Tyr Ala Asp 210 215 220 TGG ATT AGA GAG ACC ATG GAA AAT AAC T AATTTTTAAT GGCATATTAT 719 Trp Ile Arg Glu Thr Met Glu Asn Asn 225 230 TGTATTGTCT GTGATGAAAA TTAATAAAAA CGTGATAGAT TAAAAAAAAA AAAAAAAAAA 779 INFORMATION FOR SEQ ID NO:81: SEQUENCE CHARACTERISTICS: LENGTH: 232 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81: Phe Ser Ala Leu Val Ala Leu Ser Ala Ala Ile Pro His Ser Asn Arg 1 5 10 Val Val Gly Gly Leu Glu Ala Ala Glu Gly Ser Ala Pro Tyr Gin Val 25 Ser Leu Gin Val Gly Asn Phe His Phe Cys Gly Gly Ser Ile Leu Asn 40 Glu Tyr Trp Val Leu Thr Ala Ala His Cys Leu Gly Tyr Asp Phe Asp 55 Val Val Val Gly Thr Asn Lys Leu Asp Gin Pro Gly Glu Arg Tyr Leu 65 70 75 Val Glu Gin Thr Phe Val His Gin Phe Asp Gin Glu Ser Leu Arg His 90 Asp Leu Ala Leu Val Lys Val Ser Ser Pro Ile Glu Phe Asn Asp Tyr 100 105 110 Val Gln Pro Ile Pro Leu Gly Glu Thr Tyr Xaa Gly Gly Glu Val Ala 115 120 125 Arg Leu Thr Gly Trp Gly Arg Leu Gly Ala Asn Leu Asn Gly Pro Asn 130 135 140 Glu Leu Gin Glu Leu Asn Thr Val Thr Leu Ser His Gin Gin Cys Val 145 150 155 160 Arg Gin Gln Ile Tyr Pro Val Tyr Asp Ser Gin Leu Cys Thr Phe Val 165 170 175 Gly Ser Gly Arg Gly Ala Cys Asn Gly Asp Ser Gly Gly Pro Leu Val 180 185 4v WO 96/11706 PCT/US95/14442 Val Val Ile 225 (2) 173 Asn Gly Glu Leu His Gly Val Val Ser Trp Gly Ile Pro Cys Ala 195 200 205 Gly Leu Pro Asp Val Phe Thr Arg Val Ser His Tyr Ala Asp Trp 210 215 220 Arg Glu Thr Met Glu Asn Asn 230 INFORMATION FOR SEQ ID NO:82: SEQUENCE CHARACTERISTICS: LENGTH: 944 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 3..768 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82: CT GAA GTG TGG ATT CAT CGT TGT TTT CCT TGT GGC GGC AGC TTG GGT Glu Val Trp Ile His Arg Cys Phe Pro Cys Gly Gly Ser Leu Gly 1 5 10 GAA GAT TCG GTC GTC GAC CGC ATC GTC GGC GGC ACC AGT GTT AAA ATT Glu Asp Ser Val Val Asp Arg Ile Val Gly Gly Thr Ser Val Lys Ile 25 GAG AAC TTC GGA TGG CAA GTG TCC TTA TTC GAT CGT AAG GGT CAC TTT Glu Asn Phe Gly Trp Gin Val Ser Leu Phe Asp Arg Lys Gly His Phe 40 TGC GGT GGT TCT ATA ATC AGC GAC GAA TGG GTC TTG ACT GCT GCA CAT Cys Gly Gly Ser Ile Ile Ser Asp Glu Trp Val Leu Thr Ala Ala His 55 TGC GTA TAC GAT TAT TTC TCG CCA AAG CAA TAT GGA GTG CGT GTC GGA Cys Val Tyr Asp Tyr Phe Ser Pro Lys Gin Tyr Gly Val Arg Val Gly 70 AGC AGT TTA CGC AAC AAA GGT GGA GTC CTT CAC AGA ATT TCC AGG GTA Ser Ser Leu Arg Asn Lys Gly Gly Val Leu His Arg Ile Ser Arg Val 80 85 90 CAC ATT CAC CCA GAC TAC GAC ACG GTC AGC TAC GAC AAT GAC GTC GCG His Ile His Pro Asp Tyr Asp Thr Val Ser Tyr Asp Asn Asp Val Ala 100 105 110 CTC CTG AAA GTT GAA ACC AAA TTT AAA CTA AAC GGC AGG AGC GTT CGC Leu Leu Lys Val Glu Thr Lys Phe Lys Leu Asn Gly Arg Ser Val Arg 115 120 125 47 143 191 239 287 335 383 431 479

AAA

Lys

CTC

Leu

GTT

Val

ACC

Thr 145 TTG GTT GAC GAA GAT CAC GAG GTT GAT GAT GGT GCC CGG Leu Val Asp Glu Asp His Glu Val Asp Asp Gly Ala Arg 135 140 ACT GGA TGG GGC AAA TTA AGT GAA TCA GGA CCC AAG CCA Thr Gly Trp Gly Lys Leu Ser Glu Ser Gly Pro Lys Pro 150 155

I

WO 96/11706 PCTIUS95/14442 174 GTA AAT CTA CAA GGA GTA AAA GTG CCT TAT GTG GAC CAA GAT ACA TGC 527 Val Asn Leu Gin Gly Val Lys Val Pro Tyr Val Asp Gin Asp Thr Cys 160 165 170 175 TCT GAC AGC TAC GTC TTT GCA GGA AAA GAT ATC ACC GAA AAC ATG TTG 575 Ser Asp Ser Tyr Val Phe Ala Gly Lys Asp Ile Thr Glu Asn Met Leu 180 185 190 TGT GCC GGA GTT AGA AGA GGT GGC AAG GAC TCC TGC CAG GGT GAC AGC 623 Cys Ala Gly Val Arg Arg Gly Gly Lys Asp Ser Cys Gin Gly Asp Ser 195 200 205 GGT GGT CCA CTT GTG GAC GAA AAC AAA AAT CTG GTC GGA GTC GTC TCT 671 Gly Gly Pro Leu Val Asp Glu Asn Lys Asn Leu Val Gly Val Val Ser 210 215 220 TGG GGA AAT GGT TGT GCC AGA CCA AAC ATG CCA GGA GTA TAC GOT AAA 719 Trp Gly Asn Gly Cys Ala Arg Pro Asn Met Pro Gly Val Tyr Ala Lys 225 230 235 GTT GCT GCT TCT AGC ATT AGA GAG TTC ATT CGC AAA AAA ACT GGT CTT T 768 Val Ala Ala Ser Ser Ile Arg Glu Phe Ile Arg Lys Lys Thr Gly Leu 240 245 250 255 AATTTCCTTA TATGAACAAA TGTTCCACCA AAAATATAGT TTAGATTTTA GTATAATAAA 828 TCCTTTGTGA TTCATGCAAA TATTTTGTTT TATTTATTTA TTTACTTTAT TCAAACGAAT 888 GTATAAAGTG AATTAACAAT AAAAATGTTA GTGTTGCCAA AAAAAAAAAA AAAAAA 944 INFORMATION FOR SEQ ID NO:83: SEQUENCE CHARACTERISTICS: LENGTH: 255 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83: Glu Val Trp Ile His Arg Cys Phe Pro Cys Gly Gly Ser Leu Gly Glu 1 5 10 Asp Ser Val Val Asp Arg Ile Val Gly Gly Thr Ser Val Lys Ile Glu 25 Asn Phe Gly Trp Gin Val Ser Leu Phe Asp Arg Lys Gly His Phe Cys 40 Gly Gly Ser Ile Ile Ser Asp Glu Trp Val Leu Thr Ala Ala His Cys 55 Val Tyr Asp Tyr Phe Ser Pro Lys Gin Tyr Gly Val Arg Val Gly Ser 70 75 Ser Leu Arg Asn Lys Gly Gly Val Leu His Arg Ile Ser Arg Val His 85 90 Ile His Pro Asp Tyr Asp Thr Val Ser Tyr Asp Asn Asp Val Ala Leu 100 105 110 Leu Lys Val Glu Thr Lys Phe Lys Leu Asn Gly Arg Ser Val Arg Lys 115 120 125 WO 96/11706 PCT/US95/14442 175 Val Lys Leu Val Asp Glu Asp His Glu Val Asp Asp Gly Ala Arg Leu 130 135 140 Thr Val Thr Gly Trp Gly Lys Leu Ser Glu Ser Gly Pro Lys Pro Val 145 150 155 160 Asn Leu Gin Gly Val Lys Val Pro Tyr Val Asp Gin Asp Thr Cys Ser 165 170 175 Asp Ser Tyr Val Phe Ala Gly Lys Asp Ile Thr Glu Asn Met Leu Cys 180 185 190 Ala Gly Val Arg Arg Gly Gly Lys Asp Ser Cys Gin Gly Asp Ser Gly 195 200 205 Gly Pro Leu Val Asp Glu Asn Lys Asn Leu Val Gly Val Val Ser Trp 210 215 220 Gly Asn Gly Cys Ala Arg Pro Asn Met Pro Gly Val Tyr Ala Lys Val 225 230 235 240 Ala Ala Ser Ser Ile Arg Glu Phe Ile Arg Lys Lys Thr Gly Leu 245 250 255 INFORMATION FOR SEQ ID NO:84: SEQUENCE CHARACTERISTICS: LENGTH: 157 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..157 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84: GGA ATT CGG CAC GAG TAT CTG TGC CCT CGC AGT CTG CAC CCT TGG CGT Gly Ile Arg His Glu Tyr Leu Cys Pro Arg Ser Leu His Pro Trp Arg 1 5 10 AGC GTT CCT GAC TTT TGG AAC AGG TTA GAT GGC AGA ATC GTT GGA GGA Ser Val Pro Asp Phe Trp Asn Arg Leu Asp Gly Arg Ile Val Gly Gly 25 CAC GAT ACT AGC ATT GAT AAC ATC CTC ATG CAA GTA TCT TTG AGT TTA His Asp Thr Ser Ile Asp Asn Ile Leu Met Gin Val Ser Leu Ser Leu 40 CAC AAA CCA CAA T His Lys Pro Gin 48 96 144 157 WO 96/11706 PCT/US95/14442 176 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 52 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Gly Ile Arg His Glu Tyr Leu Cys Pro Arg Ser Leu His Pro Trp Arg 1 5 10 Ser Val Pro Asp Phe Trp Asn Arg Leu Asp Gly Arg Ile Val Gly Gly 25 His Asp Thr Ser Ile Asp Asn Ile Leu Met Gin Val Ser Leu Ser Leu 40 His Lys Pro Gin INFORMATION FOR SEQ ID NO:86: SEQUENCE CHARACTERISTICS: LENGTH: 218 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 3..218 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86: AA GAT GTA GAA TTA ACA CCT GGA ACT ATG TGC ACT GTT ACT GGA TGG 47 Asp Val Glu Leu Thr Pro Gly Thr Met Cys Thr Val Thr Gly Trp 1 5 10 GGA TCA ACT GGA TCT GGT GGT CCA ATT ACA AAT GTT CTA CAA GAA GTC Gly Ser Thr Gly Ser Gly Gly Pro Ile Thr Asn Val Leu Gin Glu Val 25 GAA GTT CCA TTT ATC GAC TTC AAC ACC TGC CGA AAA TCC TAC TCA ACC 143 Glu Val Pro Phe Ile Asp Phe Asn Thr Cys Arg Lys Ser Tyr Ser Thr 35 40 AGC TTA ACC GAC CGT ATG TTC TGC GCT GGA TTT TTG GGA ATT GGT GGT 191 Ser Leu Thr Asp Arg Met Phe Cys Ala Gly Phe Leu Gly Ile Gly Gly 55 AAG GAC GCT TGC CAA GGC GAC TCC GGA 218 Lys Asp Ala Cys Gin Gly Asp Ser Gly WO 96/11706 PCTIUS95/14442 177

J

INFORMATION FOR SEQ ID NO:87: SEQUENCE CHARACTERISTICS: LENGTH: 72 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87: Asp Val Glu Leu Thr Pro Gly Thr Met Cys Thr Val Thr Gly Trp Gly 1 5 10 Ser Thr Gly Ser Gly Gly Pro Ile Thr Asn Val Leu Gin Glu Val Glu 25 Val Pro Phe Ile Asp Phe Asn Thr Cys Arg Lys Ser Tyr Ser Thr Ser 40 Leu Thr Asp Arg Met Phe Cys Ala Gly Phe Leu Gly Ile Gly Gly Lys 50 55 Asp Ala Cys Gin Gly Asp Ser Gly INFORMATION FOR SEQ ID NO:88: SEQUENCE CHARACTERISTICS: LENGTH: 932 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 2..770 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 92 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 111 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88: G TTC ATA TTT GTG CTC GTT TGC GTT GGA TTG AGC GCC GTC TCA TCT Phe Ile Phe Val Leu Val Cys Val Gly Leu Ser Ala Val Ser Ser 1 5 10 TAC AAG ATA AAG GAT GGA TTA GAT GGG CGC ATT GTT GGA GGA CAA GAT Tyr Lys Ile Lys Asp Gly Leu Asp Gly Arg Ile Val Gly Gly Gin Asp 20 25 GCT GAT ATT GCC AAA TAT GGC TAT CAA GCT TCA CTC CAA GTA TTT AAC Ala Asp Ile Ala Lys Tyr Gly Tyr Gin Ala Ser Leu Gin Val Phe Asn 40 GAA CAT TTC TGT GGA GCT TCA ATA TTG AAT AAT TAT TGG ATT GTC ACA Glu His Phe Cys Gly Ala Ser Ile Leu Asn Asn Tyr Trp Ile Val Thr 55 46 94 142 190 WO 96/11706 PCTUS95/14442

GCA

Ala

ACC

Thr

ATO

Ile GCT CAT Ala His AGT TTC Ser Phe AAG CAT Lys His GCC CTC ATC Ala

AGA

Arg

TTA

Leu

CCC

Pro 160

TGC

Cys

ATT

Ile

AGC

Ser

TCT

Ser

CGA

Arg 240 Leu

ACA

Thr

GCC

Ala 145

GAA

Glu

AAA

Lys

TGT

Cys

GGT

Gly

TGG

Trp 225

GTG

Ile

GTC

Val 130

ACT

Thr

CAA

Gin

ACT

Thr

GCT

Ala

GGC

Gly 210

GGA

Gly

GCT

178 TGC ATA TAT GAT GAA TTC ACG TAT TCA GTT CGA GTC GGC Cys Ile Tyr Asp Giu Phe Thr Tyr Ser Val Arg Val Gly 70 CAA GGA AGA CGT GGT TCC GTT CAT CCT CKG GCA CAA ATT Gin Gly Arg Arg Gly Ser Val His Pro Xaa Ala Gin Ile 85 90 CCT GCA TAC GGT AAT GTA ACT GAC ATC GAT ATG GAA KGC Pro Ala Tyr Cly Aen Vai Thr Asp Ile Asp Met Giu Xaa 100 105 110 AAG GTT CGA AGA CCA TTC CGG TTG AAT AAC AGA ACT GTT Lys Val Arg Arg Pro Phe Arg Leu Asn Asn Arg Thr Val 115 120 125 AAA CTT ACT GAT GTT GGA AAA GAC ATG CCA TCA CGA GAA Lye Leu Thr Asp Val Gly Lye Asp Met Pro Ser Giy Glu 135 140 GTT ACT GGC TGG GGA AAT TTA GGG GAA GAT GAA GAC GAC Val Thr Cly Trp Gly Aen Leu Gly Glu Asp Glu Asp Asp 150 155 CTG CAA TAT GTA AAG GTA CCT ATT GTT AAC TGG ACT CAG Leu Gin Tyr Val Lye Vai Pro Ile Val Asn Trp Thr Gin 165 170 175 ATA TAT GGA AAT GAA GGA CTA ATA ATT ACC CAA AAT ATG Ile Tyr Gly Asn Glu Giy Leu Ile Ile Thr Gin Asn Met 180 185 190 GGT TAT CCT GAA GGC GGT AAG GAC TCT TGC CAA GGA GAT Gly Tyr Pro Giu Gly Cly Lye Asp Ser Cys Gin Gly Asp 195 200 205 CCA CTC GTC AAC TCT AAG GGA GTT CTG CAT GGA ATA GTG Pro Leu Val Aen Ser Lye Gly Val Leu His Gly Ile Vai 215 220 ATA GGA TGT GCA CCA CCC GAA ATC CCA GGA GTA TAT ACC Ile Giy Cys Aia Arg Pro Giu Ile Pro Gly Val Tyr Thr 230 235 TCA AAA CCA ATA AGA GAA TTT ATC AAA ATG CAC ACT GGA Ser Lye Pro Ile Arg Giu Phe Ile Lye Met His Thr Gly 245 250 255 238 286 334 382 430 478 526 574 622 670 718 766 820 880 932 Vai Ala ATA T AACAGTTTTA ACTTATAATA TTACAAATAT TTTTTGATAT TCCTTAATTT Ile CAATGATATA CTAAGACGAG ATGTTTTACA AAATTTTGAT ACTCAACTAA CAAATTAAAC CATATTACTA CTCAAATAAA TATCACTAAT AATCAAAAAA AAAAAAAAAA AA WO 96/11706 PCTUS95/14442 179 INFORMATION FOR SEQ ID NO:89: SEQUENCE CHARACTERISTICS: LENGTH: 256 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89: Phe Ile Phe Val Leu Val Cys Val Gly Leu Ser Ala Val Ser Ser Tyr 1 5 10 Lys Ile Lys Asp Gly Leu Asp Gly Arg Ile Val Gly Gly Gin Asp Ala 25 Asp Ile Ala Lys Tyr Gly Tyr Gin Ala Ser Leu Gin Val Phe Asn Glu 40 His Phe Cys Gly Ala Ser Ile Leu Asn Asn Tyr Trp Ile Val Thr Ala 50 55 Ala His Cys Ile Tyr Asp Glu Phe Thr Tyr Ser Val Arg Val Gly Thr 70 75 Ser Phe Gin Gly Arg Arg Gly Ser Val His Pro Xaa Ala Gin Ile Ile 90 Lys His Pro Ala Tyr Gly Asn Val Thr Asp Ile Asp Met Glu Xaa Ala 100 105 110 Leu Ile Lys Val Arg Arg Pro Phe Arg Leu Asn Asn Arg Thr Val Arg 115 120 125 Thr Val Lys Leu Thr Asp Val Gly Lys Asp Met Pro Ser Gly Glu Leu 130 135 140 Ala Thr Val Thr Gly Trp Gly Asn Leu Gly Glu Asp Glu Asp Asp Pro 145 150 155 160 Glu Gin Leu Gin Tyr Val Lys Val Pro Ile Val Asn Trp Thr Gin Cys 165 170 175 Lys Thr Ile Tyr Gly Asn Glu Gly Leu Ile Ile Thr Gin Asn Met Ile 180 185 190 Cys Ala Gly Tyr Pro Glu Gly Gly Lys Asp Ser Cys Gin Gly Asp Ser 195 200 205 Gly Gly Pro Leu Val Asn Ser Lys Gly Val Leu His Gly Ile Val Ser 210 215 220 Trp Gly Ile Gly Cys Ala Arg Pro Glu Ile Pro Gly Val Tyr Thr Arg 225 230 235 240 Val Ala Ser Lys Pro Ile Arg Glu Phe Ile Lys Met His Thr Gly Ile 245 250 255 WO 96/11706 PCT/US95/14442 180 INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 894 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..766 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 187 (xi) SEQUENCE DESCRIPTION: SEQ ID

CCG

Pro 1 GCG GTG ATT GTG Ala Val Ile Val 5 TCA TTT GTT CTG GCT TGT Ser Phe Val Leu Ala Cys 10 GCA TTT TCT GTA CAG Ala Phe Ser Val Gln GAA GCA GGA GTT GGA Glu Ala Gly Val Gly GCT CTT CCA Ala Leu Pro CAA TTT CCA Gln Phe Pro

TCA

Ser AGC AGA ATT GTC AAT GGA CTT Ser Arg Ile Val Asn Gly Leu ATT CAG GTT TTC Ile Gln Val Phe TTA GAC TTG ACA AAT ATC AGA GAC GAA Leu Asp Leu Thr Asn Ile Arg Asp Glu 40 TTG TTA TCA GAT TCA TGG GTT TTG ACT Leu Leu Ser Asp Ser Trp Val Leu Thr AAA TCC Lys Ser AGA TGT GGT GGT Arg Cys Gly Gly

GCT

Ala 55 96 144 192 240 288 336

GCT

Ala GCT CAT TGT TTT Ala His Cys Phe

GAT

Asp 70 GAT TTG AAG TCT ATG Asp Leu Lys Ser Met 75 GTA GTG TCC GTT GGT Val Val Ser Val Gly GCT CAT GAT GTC Ala His Asp Val AAA TCT GAA Lys Ser Glu GAA CCT CAC AGG CAA ACC AGG AAA Glu Pro His Arg Gin Thr Arg Lys CCT GAA AGG Pro Glu Arg

TAC

Tyr 100 TTC CAG CAT Phe Gln His GAA AAA TAC GAC AGG GCA AAT CTT GCA Glu Lys Tyr Asp Arg Ala Asn Leu Ala 105 110 TAT GAT CTT GGT TTG TTG AAA TTG GAC AAA CCA GTG GAA TTG AAT GAT Tyr Asp Leu Gly Leu Leu Lys Leu Asp Lys Pro Val Glu Leu Asn Asp 115 120 125 TTC GTG Phe Val 130 AAA CTC ACA AAA Lys Leu Thr Lys TTG AAC AAA GAC AAA ACT GAA ACT TTT GTC Leu Asn Lys Asp Lys Thr Glu Thr Phe Val 135 140 AGT GGA TGG GCA TCT CCA AAG ATT TCC CCT Ser Gly Trp Ala Ser Pro Lys Ile Ser Pro 155 160

GGC

Gly 145 AAA ACT GCA Lys Thr Ala ACT GTT Thr Val 150 480 528 GCT TTC GAA TTG Ala Phe Glu Leu CCT GAC AAA CTA CAG TAC ACA ACT TTG GAA GTC CAA Pro Asp Lys Leu Gln Tyr Thr Thr Leu Glu Val Gin 165 170 175 WO 96/11706 PCT/US95/14442 181 CCA AGT GAA GAC TGC AAA AAA GTA TGG GCC CNT TAC ATG CGC GAC TAC Pro Ser Glu Asp Cys Lys Lys Val Trp Ala Xaa Tyr Met Arg Asp Tyr 180 185 190 ATC CTT TGT GCC AAA TTT GAA AAA CAA AAC ATT TGC ACT GGT GAC AGT Ile Leu Cys Ala Lys Phe Glu Lys Gin Asn Ile Cys Thr Gly Asp Ser 195 200 205 GGC GGT CCA TTG ACC ATT GAT GGT GTC CAA GTT GGT GTG GTG AGT TTT Gly Gly Pro Leu Thr Ile Asp Gly Val Gin Val Gly Val Val Ser Phe 210 215 220 GGA AGT GTT CCT TGT GCC AGA GGA AAT CCT TCA GGA TTT ACC AAT GTT Gly Ser Val Pro Cys Ala Arg Gly Asn Pro Ser Gly Phe Thr Asn Val 225 230 235 240 GCT CAT TTT GTG GAT TGG ATT CAA GAA CAT ACT GGA TTG GAA TTG T Ala His Phe Val Asp Trp Ile Gin Glu His Thr Gly Leu Glu Leu 245 250 255 AAAAATAAAA CTCAAACTAA AAAAAAAATA ATTTAATTGC ACTGAAAAAT TTTTCAAGAA AAGTTTGGAT CGTTTTGTAA TTGAATGACA ATAAAAGCGT AAATTAGAAA AAAAAAAAAA

AAAAACTC

INFORMATION FOR SEQ ID NO:91: SEQUENCE CHARACTERISTICS: LENGTH: 255 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein 576 624 672 720 766 826 886 894 Pro 1 Ala Gin Lys Ala 65 Ala Pro Tyr (xi) SEQUENCE Ala Val Ile Val 5 Leu Pro Ser Ser Phe Pro Ile Gin Ser Arg Cys Gly Ala His Cys Phe His Asp Val Ser Glu Arg Tyr Phe 100 Asp Leu Gly Leu 115 DESCRIPTION: SEQ ID NO:91: Ser Phe Val Leu A kla Cys Ala Phe Ser 10 Arg Val Gly Asp 70 Lys Gin Leu Ile Val Asn 25 Phe Leu Asp 40 Ala Leu Leu 55 Asp Leu Lys Ser Glu Glu His Glu Lys 105 Lys Leu Asp 120 Leu Asn Lys 135 Gly Leu Ser Ser Pro 90 Tyr Lys Asp Leu Glu Thr Asn Asp Ser Met Val 75 His Arg Asp Arg Pro Val Lys Thr 140 Ala Ile Trp Val Gin Ala Glu 125 Glu Gly Arg Val Ser Thr Asn 110 Leu Thr Val Val Asp Leu Val Arg Leu Asn Phe Gin Gly Glu Thr Gly Lys Ala Asp Val Phe Val 130 Lys Leu Thr Lys Gly 145 Lys Thr Ala Thr Val 150 Ser Gly Trp Ala Ser 155 Pro Lys Ile Ser Pro 160 182 Ala Phe Glu Leu Pro Asp Lys Leu Gin Tyr Thr Thr Leu Glu Val Gin 165 170 175 Pro Ser Glu Asp Cys Lys Lys Val Trp Ala Xaa Tyr Met Arg Asp Tyr 180 185 190 Ile Leu Cys Ala Lys Phe Glu Lys Gin Asn Ile Cys Thr Gly Asp Ser 195 200 205 Gly Gly Pro Leu Thr Ile Asp Gly Val Gin Val Gly Val Val Ser Phe 210 215 220 Gly Ser Val Pro Cys Ala Arg Gly Asn Pro Ser Gly Phe Thr Asn Val 225 230 235 240 Ala His Phe Val Asp Trp Ile Gin Glu His Thr Gly Leu Glu Leu 245 250 255 INFORMATION FOR SEQ ID NO:92: SEQUENCE CHARACTERISTICS: LENGTH: 299 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 3..299 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 59 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:92: AA TTC GGC ACG AGA GTT AGT CTT TCC AAT TCG ATC AGA CCT TCT TGT 47 Phe Gly Thr Arg Val Ser Leu Ser Asn Set Ile Arg Pro Ser Cys 1 5 10 TTA TGG GCC AAT GAC GAG TTC GAC ACA GAT AGT TCA ATT GCT ACT GGT Leu Trp Ala Asn Asp Glu Phe Asp Thr Asp Ser Set Ile Ala Thr Gly 25 TGG GGA AAG ATA GAC TAT GCT GAG AGC AGA AGT' GAT GAC CTA CTG AAA 143 Trp Gly Lys Ile Asp Tyr Ala Glu Ser Arg Ser Asp Asp Leu Leu Lys 35 40 GTA GTA CTG AAA ATT ATT GAT AAT AGG CAA TGC GVY CCC TTA TAC GTT 191 Val Val Leu Lys Ile Ile Asp Asn Arg Gin Cys Xaa Pro Leu Tyr Val 55 GAT CAG ATT AAT AGA AGA AGA TTG AGA AAT GGA ATT GTA GAT ACA CAG 239 Asp Gin Ile Asn Arg Arg Arg Leu Arg Asn Gly Ile Val Asp Thr Gin 70 ATG TGT GCA GGA GkA TTG GAT GGT GGC AAA GAC ACT TGC CAG GGA GAT 287 Met Cys Ala Gly Glu Leu Asp Gly Gly Lys Asp Thr Cys Gin Gly Asp 85 90 TCA GGT GGT CCT 299 Ser Gly Gly Pro PCTIS 14

MA

183 INFORMATION FOR SEQ ID NO:93: SEQUENCE CHARACTERISTICS: LENGTH: 99 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Phe Gly Thr Arg Val Ser Leu Ser Asn Ser 1 5 10 Trp Ala Asn Asp Glu Phe Asp Thr Asp Ser Gly Lys Ile Asp Tyr Ala Glu Ser Arg Ser 40 Val Leu Lys Ile Ile Asp Asn Arg Gln Cys 50 55 Gln Ile Asn Arg Arg Arg Leu Arg Asn Gly 70 Cys Ala Gly Glu Leu Asp Gly Gly Lys Asp 90 Gly Gly Pro NO:93: Ile Arg Ser Ile Asp Asp Xaa Pro Ile Val 75 Thr Cys Pro Ala Leu Leu Asp Gln Cys Gly Lys Val Gin Asp Leu Trp Val Asp Met Ser INFORMATION FOR SEQ ID NO:94: SEQUENCE CHARACTERISTICS: LENGTH: 266 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..266 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:94: CTT GCA TAT CCG CTC AAG TTT AGC GAA GAC ATC CAA CCG ATC ATG ATG Leu Ala Tyr Pro Leu Lys Phe Ser Glu Asp Ile Gin Pro Ile Met Met 1 5 10 GCC GAA AAG GAC TAC GAA CCA CCA GCA GGA ACC AAG GCT TAT GTG TCT Ala Glu Lys Asp Tyr Glu Pro Pro Ala Gly Thr Lys Ala Tyr Val Ser 25 GGA TGG GGA AGA ACA TCG TTC GGT GGC CAA TTG TCT AAA AAT CTG CGA Gly Trp Gly Arg Thr Ser Phe Gly Gly Gin Leu Ser Lys Asn Leu Arg 35 40 GGA GTC GAG TTG GAA ATA ATA GAT CTA TTC GAT TGT TTC CTT TCC TAC Gly Val Glu Leu Glu Ile Ile Asp Leu Phe Asp Cys Phe Leu Ser Tyr 55 48 96 144 192 WO 96/11706 PCT/US95/14442 184 ATG GAT AAA GTA AAC GTG TCC GAA AGG CAA GTT TGC GCT GGA ATC CCC Met Asp Lys Val Asn Val Ser Glu Arg Gin Val Cys Ala Gly Ile Pro 70 75 GTT GTA GGT GGT AAA GAT TCT TGC CA Val Val Gly Gly Lys Asp Ser Cys INFORMATION FOR SEQ ID SEQUENCE CHARACTERISTICS: LENGTH: 88 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID Leu Ala Tyr Pro Leu Lys Phe Ser Glu Asp Ile Gin Pro Ile Met Met 1 5 10 Ala Glu Lys Asp Tyr Glu Pro Pro Ala Gly Thr Lys Ala Tyr Val Ser 25 Gly Trp Gly Arg Thr Ser Phe Gly Gly Gin Leu Ser Lys Asn Leu Arg 40 Gly Val Glu Leu Glu Ile Ile Asp Leu Phe Asp Cys Phe Leu Ser Tyr 55 Met Asp Lys Val Asn Val Ser Glu Arg Gin Val Cys Ala Gly Ile Pro 70 75 Val Val Gly Gly Lys Asp Ser Cys INFORMATION FOR SEQ ID NO:96: SEQUENCE CHARACTERISTICS: LENGTH: 378 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..376 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 1 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:96: GGS GGT ACT TCC CAC CGT GTT GCC CAA ATC GTC GTC CAC CCA CAA TAC Xaa Gly Thr Ser His Arg Val Ala Gin Ile Val Val His Pro Gin Tyr 1 5 10 WO 96/11706 PCTIUS95/14442

AAC

Asn

AAA

Lys

TCT

Ser

GGT

Gly

GGT

Gly

CAA

Gin

GGC

Gly GGC AAC Gly Asn TTC GTA Phe Val GGT GTT Gly Val GCA GTC Ala Val GTA CCC Val Pro TTT GGC Phe Gly GGT AAG Gly Lys 115 ACC AAC Thr Asn TTA AAC Leu Asn GAC ACT Asp Thr TAC GAA Tyr Glu ATG CGT Met Arg 85 GGT GTT Gly Val 100 GAC GCT Asp Ala ATC AAC Ile Asn GGC AGA Gly Arg CCA GCT Pro Ala 55 GGA GGT Gly Gly 70 AGC CAC Ser His GCT CCT Ala Pro TGT CAA Cys Gin 185 GAT GTT GCT GTT CTC CGT GTT CAA GAC Asp Val Ala Val Leu Arg Val Gin Asp 25 TCA GTT CGC CCC GTT GAC ATG ATC GCT Ser Val Arg Pro Val Asp Met Ile Ala 40 GGA GCT CCC CTT TAC GTC ACT GGA TGG Gly Ala Pro Leu Tyr Val Thr Gly Trp GCA GGA TCC ACC CAA TTA CTA GGA GTA Ala Gly Ser Thr Gin Leu Leu Gly Val 75 AAA AAC ACW TGT AAC AGC AAA TAC TCC Lys Asn Xaa Cys Asn Ser Lys Tyr Ser 90 AGC ATG ATC TGC GCT GGA TTT GAC CAA Ser Met Ile Cys Ala Gly Phe Asp Gin 105 110 GGA GAC TCT GGT GGT CCT T TA Gly Asp Ser Gly Gly Pro 120 125 96 144 192 240 288 336 378 INFORMATION FOR SEQ ID NO:97: Xaa 1 Asn Lys Ser Gly Gly Gin Gly SEQUENCE CHARACTERISTICS: LENGTH: 125 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:97: Gly Thr Ser His Arg Val Ala Gin Ile Val Val 5 10 Gly Asn Thr Asn Ile Asn Asp Val Ala Val Leu 25 Phe Val Leu Asn Gly Arg Ser Val Arg Pro Val 40 Gly Val Asp Thr Pro Ala Gly Ala Pro Leu Tyr 55 Ala Val Tyr Glu Gly Gly Ala Gly Ser Thr Gin 70 75 Val Pro Met Arg Ser His Lys Asn Xaa Cys Asn 85 90 Phe Gly Gly Val Ala Pro Ser Met Ile Cys Ala 100 105 Gly Lys Asp Ala Cys Gin Gly Asp Ser Gly Gly 115 120 His Arg Asp Val Leu Ser Gly Pro 125 Pro Val Met Thr Leu Lys Phe 110 Gin Gin Ile Gly Gly Tyr Asp Tyr Asp Ala Trp Val Ser Gin WO 96/11706 PCT/US95/14442 186 INFORMATION FOR SEQ ID NO:98: SEQUENCE CHARACTERISTICS: LENGTH: 252 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..252 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98: CGC GCG CCC TGT TGC CCT ACC AGC AGA GAA CGA GGA AAC CGA AAC AGG 48 Arg Ala Pro Cys Cys Pro Thr Ser Arg Glu Arg Gly Asn Arg Asn Arg 1 5 10 GTC ACA CTC ACG GTG ACG GGT TGG GGA ACT ACA GAG AGT ACT GAA TCA 96 Val Thr Leu Thr Val Thr Gly Trp Gly Thr Thr Glu Ser Thr Glu Ser 25 TCA CAC CAC CTG AAA GAA GTT GAA GTG AAC GCT GTA TCT AAT AGT GAA 144 Ser His His Leu Lys Glu Val Glu Val Asn Ala Val Ser Asn Ser Glu 35 40 TGT CAA AGG CCT AAT GAA GAT CTT GCT ACT ATA TCA TCA CAT GAG ATA 192 Cys Gln Arg Pro Asn Glu Asp Leu Ala Thr Ile Ser Ser His Glu Ile 55 TGT GCA AGC GTT CCT GGT GGC GGC AAA GAT TCT TGT CAA GGA GAC TCT 240 Cys Ala Ser Val Pro Gly Gly Gly Lys Asp Ser Cys Gln Gly Asp Ser 70 75 GGT GGT CCT TTA 252 Gly Gly Pro Leu INFORMATION FOR SEQ ID NO:99: SEQUENCE CHARACTERISTICS: LENGTH: 84 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99: Arg Ala Pro Cys Cys Pro Thr Ser Arg Glu Arg Gly Asn Arg Asn Arg 1 5 10 Val Thr Leu Thr Val Thr Gly Trp Gly Thr Thr Glu Ser Thr Glu Ser 20 25 Ser His His Leu Lys Glu Val Glu Val Asn Ala Val Ser Asn Ser Glu 40 Cys Gln Arg Pro Asn Glu Asp Leu Ala Thr Ile Ser Ser His Glu lle 55 Cys Ala Ser Val Pro Gly Gly Gly Lys Asp Ser Cys Gin Gly Asp Ser 70 75 Gly Gly Pro Leu WO 96/11706 PCT/US95/14442 187 INFORMATION FOR SEQ ID NO:100: SEQUENCE CHARACTERISTICS: LENGTH: 225 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..208 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100: CCA ATC CAC GAT AGC CAA TAT GCA CTT TTG CAG ATA TGG GTC AAG GGT Pro Ile His Asp Ser Gln Tyr Ala Leu Leu Gln Ile Trp Val Lys Gly 1 5 10 GCA TGT AAG GGT GAT TCC GGT GGC CCC TTA GTC ATC AAT GGA CAA CTT Ala Cys Lys Gly Asp Ser Gly Gly Pro Leu Val Ile Asn Gly Gln Leu 25 CAT GGA ATT GTT TCC TGG GGC ATT CCT TGC GCT GTC GCA AGC CTG ATG His Gly Ile Val Ser Trp Gly Ile Pro Cys Ala Val Ala Ser Leu Met 40 TAT TCA CAA GAG TTT CTC ATT ATG TCG ATT GGA TTA AAT CCA AAA TTG Tyr Ser Gln Glu Phe Leu Ile Met Ser Ile Gly Leu Asn Pro Lys Leu 55 CCA AAT AAA ATT GTT T AGAGTATTAA AAAAAAA Pro Asn Lys Ile Val 48 96 144 192 225 INFORMATION FOR SEQ ID NO:101: SEQUENCE CHARACTERISTICS: LENGTH: 69 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101: Pro Ile His Asp Ser Gln Tyr Ala Leu Leu Gln Ile Trp Val Lys Gly 1 5 .10 Ala Cys Lys Gly Asp Ser Gly Gly Pro Leu Val Ile Asn Gly Gln Leu 25 His Gly Ile Val Ser Trp Gly Ile Pro Cys Ala Val Ala Ser Leu Met 35 40 Tyr Ser Gln Glu Phe Leu Ile Met Ser Ile Gly Leu Asn Pro Lys Leu 55 Pro Asn Lys Ile Val WO 96/11706 PCT/US95/14442 188 INFORMATION FOR SEQ ID NO:102: SEQUENCE CHARACTERISTICS: LENGTH: 850 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 2..758 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:102: C CTG GTG AAA CTT TTC TTT GTA ATG TAC TGT GCT TGT GCA TTA GCA Leu Val Lys Leu Phe Phe Val Met Tyr Cys Ala Cys Ala Leu Ala 1 5 10 TCG GCA Ser Ala GAA GTT Glu Val AAG GAA Lys Glu GTT GTA Val Val TAC GTC Tyr Val GAA CGG Glu Arg TAT GCT Tyr Ala GAC AAA Asp Lys GAA GGG Glu Gly 145 ATT CCT Ile Pro 160 CTG AAG TAC TCC ATC GAT CAT GGT CCT CGT ATC ATC GGA GGT Leu

GCA

Ala

GGA

Gly

ACT

Thr

GGA

Gly

TAT

Tyr

GAC

Asp

GTC

Val 130

CTT

Leu

AAT

Asn Lys

GGT

Gly 35

AAT

Asn

GCA

Ala

TCC

Ser

ATA

Ile

ATC

Ile 115

AAG

Lys

AGA

Arg

AAA

Lys Tyr Ser Ile Asp His Gly Pro Arg Ile Ile Gly Gly 25 GAA GGA TCA GCA CCT TAC CAG GTG TCC TTA AGA ACC Glu Gly Ser Ala Pro Tyr Gin Val Ser Leu Arg Thr 40 CAT TTT TGC GGT GGA TCA ATA CTA AAT AAG CGA TGG His Phe Cys Gly Gly Ser Ile Leu Asn Lys Arg Trp 55 GCA CAT TGT CTT GAA CCG GAA ATA TTA GAT TCG GTA Ala His Cys Leu Glu Pro Glu Ile Leu Asp Ser Val 70 AAT CAC TTA GAC CGA AAA GGC AGA TAT TAC GAC GTA Asn His Leu Asp Arg Lys Gly Arg Tyr Tyr Asp Val 85 90 ATT CAT GAA AAA TAT ATA GGA GAA CTA AAT AAT TTT Ile His Glu Lys Tyr Ile Gly Glu Leu Asn Asn Phe 100 105 110 GGT CTA ATA AAA CTT GAT GAA GAC TTA GAA TTC AAT Gly Leu Ile Lys Leu Asp Glu Asp Leu Glu Phe Asn 120 125 CCA ATA AAA ATT CAT GAA AAC ACA ATT CAA GGT GGT Pro Ile Lys Ile His Glu Asn Thr Ile Gin Gly Gly 135 .140 GCA ACA GGT TGG GGA CGT CTT GGT GCT GGT CGC CCA Ala Thr Gly Trp Gly Arg Leu Gly Ala Gly Arg Pro 150 155 TTG CAG GAG CTA CAA ACA TTT GCT TTA AGT GAT AAA Leu Gin Glu Leu Gin Thr Phe Ala Leu Ser Asp Lys 165 170 175 AAA ACT GGT CTT GTA CCA AAG TCA CAA CTT TGT GTT Lys Thr Gly Leu Val Pro Lys Ser Gin Leu Cys Val 180 185 190 94 142 190 238 286 334 382 430 478 526 574 GAT TGT ACA GTA Asp Cys Thr Val WO 96/11706 PCT/US95/14442 189 TTC CGT GCA TCG GAA AAA GGA GTT TGC TTT GGT GAT TCG GGA GGT CCT 622 Phe Arg Ala Ser Glu Lys Gly Val Cys Phe Gly Asp Ser Gly Gly Pro 195 200 205 TTG GCA ATC AAT GGT GAA CTT GTT GGT GTT ACT TCA TTC ATT ATG GGA 670 Leu Ala Ile Asn Gly Glu Leu Val Gly Val Thr Ser Phe Ile Met Gly 210 215 220 ACA TGT GGA GGA GGA CAT CCT GAT GTC TTC GGT CGA GTC CTT GAC TTC 718 Thr Cys Gly Gly Gly His Pro Asp Val Phe Gly Arg Val Leu Asp Phe 225 230 235 AAA CCA TGG ATT GAT TCT CAT ATG GCA AAT GAC GGC GCA T AATTCTTTTA 768 Lys Pro Trp Ile Asp Ser His Met Ala Asn Asp Gly Ala 240 245 250 TTTAATAATG ATTGAATGTA AAATTATAAA CAAATTGTAA ATTGCATAAA TGATATAAAT 828 GCAGGAAATT CGAAAAAAAA AA 850 INFORMATION FOR SEQ ID NO:103: SEQUENCE CHARACTERISTICS: LENGTH: 252 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:103: Leu Val Lys Leu Phe Phe Val Met Tyr Cys Ala Cys Ala Leu Ala Ser 1 5 10 Ala Leu Lys Tyr Ser Ile Asp His Gly Pro Arg Ile Ile Gly Gly Glu 20 25 Val Ala Gly Glu Gly Ser Ala Pro Tyr Gin Val Ser Leu Arg Thr Lys 40 Glu Gly Asn His Phe Cys Gly Gly Ser Ile Leu Asn Lys Arg Trp Val 55 Val Thr Ala Ala His Cys Leu Glu Pro Glu Ile Leu Asp Ser Val Tyr 70 75 Val Gly Ser Asn His Leu Asp Arg Lys Gly Arg Tyr Tyr Asp Val Glu 90 Arg Tyr Ile Ile His Glu Lys Tyr Ile Gly Glu Leu Asn Asn Phe Tyr 100 105 110 Ala Asp Ile Gly Leu Ile Lys Leu Asp Glu Asp Leu Glu Phe Asn Asp 115 120 125 Lys Val Lys Pro Ile Lys Ile His Glu Asn Thr Ile Gin Gly Gly Glu 130 135 140 Gly Leu Arg Ala Thr Gly Trp Gly Arg Leu Gly Ala Gly Arg Pro Ile 145 150 155 160 Pro Asn Lys Leu Gin Glu Leu Gin Thr Phe Ala Leu Ser Asp Lys Asp 165 170 175 Cys Thr Val Lys Thr Gly Leu Val Pro Lys Ser Gin Leu Cys Val Phe 180 185 190 WO 96/11706 PCT/US95/14442 190 Arg Ala Ser Glu Lys Gly Val Cys Phe Gly Asp Ser Gly Gly Pro Leu 195 200 205 Ala Ile Asn Gly Glu Leu Val Gly Val Thr Ser Phe Ile Met Gly Thr 210 215 220 Cys Gly Gly Gly His Pro Asp Val Phe Gly Arg Val Leu Asp Phe Lys 225 230 235 240 Pro Trp Ile Asp Ser His Met Ala Asn Asp Gly Ala 245 250 INFORMATION FOR SEQ ID NO:104: SEQUENCE CHARACTERISTICS: LENGTH: 252 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..251 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:104: GCA RGG ATT CGG CAC GAG AAT TTA TTA AGC GCA TTA TTT GCA AGT GTA Ala Xaa Ile Arg His Glu Asn Leu Leu Ser Ala Leu Phe Ala Ser Val 1 5 10 ATT TGC TCC TTT AAC GCG GAA GTA CAA AAT CGA ATC GTT GGT GGC AAT Ile Cys Ser Phe Asn Ala Glu Val Gin Asn Arg Ile Val Gly Gly Asn 25 GAT GTA AGT ATT TCA AAA ATT GGG TGG CAA GTA TCT ATT CAA AGT AAT Asp Val Ser Ile Ser Lys Ile Gly Trp Gin Val Ser Ile Gin Ser Asn 40 AAC CAA CAT TTC TGT GGT GGT TCA ATC ATT GCT AAA GAT TGG GTA CTG Asn Gin His Phe Cys Gly Gly Ser Ile Ile Ala Lys Asp Trp Val Leu 55 ACT TCT TCT CAA TGC GTC GTG GAC AAA CAA AGT CCA CCG AAG GAT TTA Thr Ser Ser Gin Cys Val Val Asp Lys Gin Ser Pro Pro Lys Asp Leu 70 75 ACT GTT CGT GT T Thr Val Arg 48 96 144 192 240 252 WO 96/11706 PCT/US95/14442 191 INFORMATION FOR SEQ ID NO:105: SEQUENCE CHARACTERISTICS: LENGTH: 83 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:105: Ala Xaa Ile Arg His Glu Asn Leu Leu Ser Ala Leu Phe Ala Ser Val 1 5 10 Ile Cys Ser Phe Asn Ala Glu Val Gin Asn Arg Ile Val Gly Gly Asn 25 Asp Val Ser Ile Ser Lys Ile Gly Trp Gin Val Ser Ile Gin Ser Asn 40 Asn Gin His Phe Cys Gly Gly Ser Ile Ile Ala Lys Asp Trp Val Leu 50 55 Thr Ser Ser Gin Cys Val Val Asp Lys Gin Ser Pro Pro Lys Asp Leu 70 75 Thr Val Arg INFORMATION FOR SEQ ID NO:106: SEQUENCE CHARACTERISTICS: LENGTH: 534 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..534 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:106: TCA AAT CGG ATT GTT AAT GGA GTT AAT GCC AAA AAC GGT TCT GCT CCA Ser Asn Arg Ile Val Asn Gly Val Asn Ala Lys Asn Gly Ser Ala Pro 1 5 10 TAT ATG GCT TCT CTA AGA GAT GTT ATG GAA ACC ATT TCT GTG GAG CAT Tyr Met Ala Ser Leu Arg Asp Val Met Glu Thr Ile Ser Val Glu His 20 25 CGA TAT TGG ATG AAC CGC TGG ATT CTT ACT GCT GCC CAT TGC CTT ACT Arg Tyr Trp Met Asn Arg Trp Ile Leu Thr Ala Ala His Cys Leu Thr 40 GAC GGT TAT CTA GAT ACA GTC TAC GTT GGT TCA AAT CAT CTT TCT GGC Asp Gly Tyr Leu Asp Thr Val Tyr Val Gly Ser Asn His Leu Ser Gly 55 GAC GGA GAG TAC TAC AAT GTA GAA GAA CAA GTC ATC CAT GAT AAA TAT Asp Gly Glu Tyr Tyr Asn Val Glu Glu Gin Val Ile His Asp Lys Tyr 70 75 48 96 144 192 240 WO 96/11706 PCT/US95/14442 192 TTT GGT CAA ACA ACC GGC TTC AAA AAT GAT ATT GCT CTC GTC AAA GTT Phe Gly Gin Thr Thr Gly Phe Lys Asn Asp Ile Ala Leu Val Lys Val 90 TCT AGT GCT ATA AAA CTT AGC AAA AAT GTT CGT CCC ATC AAA TTG CAC Ser Ser Ala Ile Lys Leu Ser Lys Asn Val Arg Pro Ile Lys Leu His 100 105 110 AAA GAT TTT ATA CGC GGA GGT GAA AAA TTG AAA ATT ACT GGA TGG GGA Lys Asp Phe Ile Arg Gly Gly Glu Lys Leu Lys Ile Thr Gly Trp Gly 115 120 125 TTG ACC AAT CAA ACT CAT GGT GAA GTT CCT GAT GCT CTT CAA GAG TTA Leu Thr Asn Gin Thr His Gly Glu Val Pro Asp Ala Leu Gin Glu Leu 130 135 140 CAG GTA GAA GCA CTT TCT AAC TCT AAA TGC AAG GCA ATT ACT GGT GTC Gin Val Glu Ala Leu Ser Asn Ser Lys Cys Lys Ala Ile Thr Gly Val 145 150 155 160 CAT CTT CCT GCT CAT CTC TGC ACC TTC AGA GCT CCT CAA AAG GGT GTA His Leu Pro Ala His Leu Cys Thr Phe Arg Ala Pro Gin Lys Gly Val 165 170 175 TGC CAG Cys Gin INFORMATION FOR SEQ ID NO:107: SEQUENCE CHARACTERISTICS: LENGTH: 178 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein 288 336 384 432 480 528 Ser 1 Tyr Arg Asp Asp Phe Ser Lys Leu (xi) SEQUENCE Asn Arg Ile Val 5 Met Ala Ser Leu Tyr Trp Met Asn Gly Tyr Leu Asp 50 Gly Glu Tyr Tyr Gly Gin Thr Thr Ser Ala Ile Lys 100 Asp Phe Ile Arg 115 Thr Asn Gin Thr 130 DESCRIPTION: SEQ ID Asn Gly Val Asn Ala 10 Arg Asp Val Met Glu 25 Arg Trp Ile Leu Thr 40 Thr Val Tyr Val Gly 55 Asn Val Glu Glu Gin 70 Gly Phe Lys Asn Asp 90 Leu Ser Lys Asn Val 105 Gly Gly Glu Lys Leu 120 His Gly Glu Val Pro 135 NO:107: Lys Asn Thr Ile Ala Ala Ser Asn Val Ile 75 Ile Ala Arg Pro Lys Ile Asp Ala 140 Gly Ser His His His Leu Ile Thr 125 Leu Ser Val Cys Leu Asp Val Lys 110 Gly Gin Ala Glu Leu Ser Lys Lys Leu Trp Glu Pro His Thr Gly Tyr Val His Gly Leu WO 96/11706 PCTUS95/14442 193 Gln Val Glu Ala Leu Ser Asn Ser Lys Cys Lys Ala Ile Thr Gly Val 145 150 155 160 His Leu Pro Ala His Leu Cys Thr Phe Arg Ala Pro Gln Lys Gly Val 165 170 175 Cys Gin INFORMATION FOR SEQ ID NO:108: SEQUENCE CHARACTERISTICS: LENGTH: 359 base pairs 0 TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 1..359 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:108: GGG TTC GAA TTT GTG GAT CGA AAA GGC AGA TAT TAC GAT GTA GAA AGA Gly Phe Glu Phe Val Asp Arg Lys Gly Arg Tyr Tyr Asp Val Glu Arg 0 1 5 10 TTT GTG ATG Phe Val Met GAT ATA GGT Asp Ile Gly CAC CAT AAT TAT ACT GGA AAG ATA GTT GCC AAT GTC GCT His His Asn Tyr Thr Gly Lys Ile Val Ala Asn Val Ala 25 CTA ATA AAA CTA GCA GAA GAT ATA AAA TTC AGT GAC AAG Leu Ile Lys Leu Ala Glu Asp Ile Lys Phe Ser Asp Lys 96 144 192 GTA CAA Val Gin CCT GTA AAA Pro Val Lys

TGC

Cys AAA GCT ACT GGA Lys Ala Thr Gly ATT CAT CAA ACT CAA ATC AAG GGC GGA GAG ATT Ile His Gin Thr Gin Ile Lys Gly Gly Glu Ile 55 TGG GGC AGG TTG GGT GCT GAT CAG CCT GTA CCA Trp Gly Arg Leu Gly Ala Asp Gin Pro Val Pro 70 75 TTG GAG ACA ATT GCT ATT AGT GAT GAG AAA TGT Leu Glu Thr Ile Ala Ile Ser Asp Glu Lys Cys 90 TTT TTA GAA CCT ACA TCT CAA ATA TGT GTA TTC Phe Leu Glu Pro Thr Ser Gin Ile Cys Val Phe 105 110 AAT AAA TTA Asn Lys Leu CAA CAA Gin Gin TAT GCA GAT ACA GGG Tyr Ala Asp Thr Gly 100 288 336 359 AGT GCA TTT Ser Ala Phe 115 GGA AAA GGA GTT GT Gly Lys Gly Val INFORMATION FOR SEQ ID NO:109: SEQUENCE CHARACTERISTICS: LENGTH: 119 amino acids TYPE: amino acid TOPOLOGY: linear WO 96/11706 PCT/US95/14442 194 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:109: Gly Phe Glu Phe Val Asp Arg Lys Gly Arg Tyr Tyr Asp Val Glu Arg 1 5 10 Phe Val Met His His Asn Tyr Thr Gly Lys Ile Val Ala Asn Val Ala 25 Asp Ile Gly Leu Ile Lys Leu Ala Glu Asp Ile Lys Phe Ser Asp Lys 40 Val Gin Pro Val Lys Ile His Gin Thr Gin Ile Lys Gly Gly Glu Ile 50 55 Cys Lys Ala Thr Gly Trp Gly Arg Leu Gly Ala Asp Gin Pro Val Pro 70 75 Asn Lys Leu Gin Gin Leu Glu Thr Ile Ala Ile Ser Asp Glu Lys Cys 90 Tyr Ala Asp Thr Gly Phe Leu Glu Pro Thr Ser Gin Ile Cys Val Phe 100 105 110 Ser Ala Phe Gly Lys Gly Val 115 INFORMATION FOR SEQ ID NO:110: SEQUENCE CHARACTERISTICS: LENGTH: 841 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 2..746 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 102 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 127 (ix) FEATURE: NAME/KEY: Xaa any amino acid LOCATION: 131 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:110: C TTA GCA ATT GTA TGT GCT CTC GCT GTC TGC ACA TTC GGT GCC AGT 46 Leu Ala Ile Val Cys Ala Leu Ala Val Cys Thr Phe Gly Ala Ser 1 5 10 GTT CCA GAA TCA TGG AAA AGA TTA GAT AGT AGA ATC GTA GGA GGA CAC 94 Val Pro Glu Ser Trp Lys Arg Leu Asp Ser Arg Ile Val Gly Gly His 25 WO 96/11706 PCTIUS95/14442 195 GAT ACC AGC ATC GAT AAA CAC CCT CAT CAA GTA TCT TTA TTG TAC TCC 142 Asp Thr Ser Ile Asp Lys His Pro His Gin Val Ser Leu Leu Tyr Ser 40 AGC CAC AAT TGT GGT GGT TCC TTG ATT GCC AAA AAC TGG TGG GTT TTG 190 Ser His Asn Cys Gly Gly Ser Leu Ile Ala Lys Asn Trp Trp Val Leu 55 ACT GCA GCT CAT TGC ATT GGA GTT AAC AAA TAC AAT GTC CGT GTA GGA 238 Thr Ala Ala His Cys Ile Gly Val Asn Lys Tyr Asn Val Arg Val Gly 70 AGT TCC ATC GTA AAC AGC GGT GGT ATC TTG CAT AAA GTT AAA AAC CAT 286 Ser Ser Ile Val Asn Ser Gly Gly Ile Leu His Lys Val Lys Asn His 85 90 TAC AGA CAT CCA AAA TAC AMC GCA GCT GCT ATT GAC TTT GAT TAC GCA 334 Tyr Arg His Pro Lys Tyr Xaa Ala Ala Ala Ile Asp Phe Asp Tyr Ala 100 105 110 CTC TTA GAA CTC GAA ACT CCT GTT CAA CTC ACA AAT GAT GTG TCC ATM 382 Leu Leu Glu Leu Glu Thr Pro Val Gin Leu Thr Asn Asp Val Ser Xaa 115 120 125 ATA AAA TTG GTS GAT GAA GGA GTA GAT CTT AAA CCT GGT ACC TTG TTA 430 Ile Lys Leu Xaa Asp Glu Gly Val Asp Leu Lys Pro Gly Thr Leu Leu 130 135 140 ACT GTT ACT GGA TGG GGA TCA ACT GGA AAT GGA CCT TCA ACC AAT GTT 478 Thr Val Thr Gly Trp Gly Ser Thr Gly Asn Gly Pro Ser Thr Asn Val 145 150 155 TTG CAA GAA GTT CAA GTA CCA CAT GTC GAC CAA ACC ACT TGC TCC AAA 526 Leu Gin Glu Val Gin Val Pro His Val Asp Gin Thr Thr Cys Ser Lys 160 165 170 175 TCT TAC CCA GGA AGT TTG ACT GAT CGT ATG TTC TGC GCT GGT TAT TTG 574 Ser Tyr Pro Gly Ser Leu Thr Asp Arg Met Phe Cys Ala Gly Tyr Leu 180 185 190 GGA CAA GGA GGC AAG GAC TCA TGC CAA GGT GAT TCT GGT GGC CCA GTT 622 Gly Gin Gly Gly Lys Asp Ser Cys Gin Gly Asp Ser Gly Gly Pro Val 195 200 205 GTT GTC AAT GGT GTT CAA CAT GGA ATT GTC TCA TGG GGT CGT GGT TGT 670 Val Val Asn Gly Val Gin His Gly Ile Val Ser Trp Gly Arg Gly Cys 210 215 220 GCA CTT CCT GAT TAT CCT GGA GTT TAC TCT AAA ATC TCT ACC GCT CGC 718 Ala Leu Pro Asp Tyr Pro Gly Val Tyr Ser Lys Ile Ser Thr Ala Arg 225 230 235 AGC TGG ATC AAG GAA GTG TCT GGT GTT T AATTTATTCT TGAAATCTCT 766 Ser Trp Ile Lys Glu Val Ser Gly Val 240 245 ATTTTGTATT ATTTATGTAT ATAGTAAGAG TTGTAAATAT AAATAGTTAC ATCTAAAAAA 826 AAAAAAAAAA AAAAA 841 WO 96/11706 PCT/US95/14442 196 INFORMATION FOR SEQ ID NO:lll: SEQUENCE CHARACTERISTICS: LENGTH: 248 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:111: Leu Ala Ile Val Cys Ala Leu Ala Val Cys Thr Phe Gly Ala Ser Val 1 5 10 Pro Glu Ser Trp Lys Arg Leu Asp Ser Arg Ile Val Gly Gly His Asp 25 Thr Ser Ile Asp Lys His Pro His Gin Val Ser Leu Leu Tyr Ser Ser 40 His Asn Cys Gly Gly Ser Leu Ile Ala Lys Asn Trp Trp Val Leu Thr 50 55 Ala Ala His Cys Ile Gly Val Asn Lys Tyr Asn Val Arg Val Gly Ser 70 75 Ser Ile Val Asn Ser Gly Gly Ile Leu His Lys Val Lys Asn His Tyr 90 Arg His Pro Lys Tyr Xaa Ala Ala Ala Ile Asp Phe Asp Tyr Ala Leu 100 105 110 Leu Glu Leu Glu Thr Pro Val Gin Leu Thr Asn Asp Val Ser Xaa Ile 115 120 125 Lys Leu Xaa Asp Glu Gly Val Asp Leu Lys Pro Gly Thr Leu Leu Thr 130 135 140 Val Thr Gly Trp Gly Ser Thr Gly Asn Gly Pro Ser Thr Asn Val Leu 145 150 155 160 Gin Glu Val Gin Val Pro His Val Asp Gin Thr Thr Cys Ser Lys Ser 165 170 175 Tyr Pro Gly Ser Leu Thr Asp Arg Met Phe Cys Ala Gly Tyr Leu Gly 180 185 190 Gin Gly Gly Lys Asp Ser Cys Gin Gly Asp Ser Gly Gly Pro Val Val 195 200 205 Val Asn Gly Val Gin His Gly Ile Val Ser Trp Gly Arg Gly Cys Ala 210 215 220 Leu Pro Asp Tyr Pro Gly Val Tyr Ser Lys Ile Ser Thr Ala Arg Ser 225 230 235 240 Trp Ile Lys Glu Val Ser Gly Val WO 96/11706 PCT/US95/14442 197 INFORMATION FOR SEQ ID NO:112: SEQUENCE CHARACTERISTICS: LENGTH: 1580 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: NAME/KEY: CDS LOCATION: 3..1491 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:112: GG CAC GAG TTT TGT GCG AGT GTC AGA TAT TGC AGC TCT ATG AGT AAC His Glu Phe Cys Ala Ser Val Arg Tyr Cys Ser Ser Met Ser Asn 1 5 10 AAG AAA GGA TTA GTA CTG GGC ATC TAC GAC AAT GAA TTC GAT AAA AAA Lys Lys Gly Leu Val Leu Gly Ile Tyr Asp Asn Glu Phe Asp Lys Lys 25 ATA AGG TTA ACG CCA ACT GCT GAA CAA TTC AAT CGG CGA TTG CAG GGG Ile Arg Leu Thr Pro Thr Ala Glu Gin Phe Asn Arg Arg Leu Gin Gly 40 CGT TTA CTA GAT CTA ATT CAT TTG AGT GGA CCC ATT AAA TTG GGC AAG Arg Leu Leu Asp Leu Ile His Leu Ser Gly Pro Ile Lys Leu Gly Lys 55 AGC CGT ATT TTC TGG GAT CTC GAT GAA TTC GGC GCA GTT GCA GTT GCA Ser Arg Ile Phe Trp Asp Leu Asp Glu Phe Gly Ala Val Ala Val Ala 70 GGT TTG GGA AAT CAC TCC CCC TGC GAA CTC CTG GAA GAA CTC GAT GTT Gly Leu Gly Asn His Ser Pro Cys Glu Leu Leu Glu Glu Leu Asp Val 80 85 90 TTG CGC GAA AAT GCC AGA ATA GCT GCC GGT GCT GGT TGC CAA GCT CTT Leu Arg Glu Asn Ala Arg Ile Ala Ala Gly Ala Gly Cys Gin Ala Leu 100 105 110 GCC GCC GAT GGA ATC ACT ACC ATT AGC GTT GAA GTA TGG AGC ACC CGG Ala Ala Asp Gly Ile Thr Thr Ile Ser Val Glu Val Trp Ser Thr Arg 115 120 125 AGG CGG CCA TGC GAA GGT GCA ATA CTA TCG ACG TTC AAA TTC AGG TCA Arg Arg Pro Cys Glu Gly Ala Ile Leu Ser Thr Phe Lys Phe Arg Ser 130 135 140 ACA GAA GAA GAG TCC AAG TGT AAG CCG ATA CCT ACC ATA ACC CCT TAC Thr Glu Glu Glu Ser Lys Cys Lys Pro Ile Pro Thr Ile Thr Pro Tyr 145 150 155 TGC CTT CAA GAT AAA GAT GCT CCA TTA TGG GAA CTT GGC CAA GTA TCA Cys Leu Gin Asp Lys Asp Ala Pro Leu Trp Glu Leu Gly Gin Val Ser 160 165 170 175 GCA GCA GCT CAA AAC TGG GCT CGT ACA TTG ATG GAT ACA CCA GCA AAT Ala Ala Ala Gin Asn Trp Ala Arg Thr Leu Met Asp Thr Pro Ala Asn 180 185 190 47 143 191 239 287 335 383 431 479 527 575 WO 96/11706 PCT/US95/14442

CAA

Gin

CCA

Pro

ATG

Met

CCA

Pro 240

CCG

Pro

AGC

Ser

GGA

Gly

ATG

Met

TTA

Leu

AAA

Lys 225

GTT

Val

TTC

Phe

ATC

Ile

GCT

Ala

AC)

Th

GGA

Gl 21(

ATG

Met

TTT

Phe

GCA

Ala

AAA

Lys

GCT

Ala 290 AAC GTC GTC Asn Val Val 198 A CCA TTT TTG TTC GCC GAA GCC GCC AAA GAA AAT TTA GTG r Pro Phe Leu Phe Ala Glu Ala Ala Lys Glu Asn Leu Val 195 200 205 SGTG AAA GTT GAA GCT AGA GAT CGG AAA TGG GCG GTA AGC y Val Lys Val Glu Ala Arg Asp Arg Lys Trp Ala Val Ser 0 215 220 SGGA TCC TTC TTG TCT GTC GCT CGT GGC TCC AAT GAA CCA Gly Ser Phe Leu Ser Val Ala Arg Gly Ser Asn Glu Pro 230 235 CTT GAA ATT TCT TAT TGT GGT GGT CCA AAA GAT GAG GCA Leu Glu Ile Ser Tyr Cys Gly Gly Pro Lys Asp Glu Ala 245 250 255 CTT GTT GGA AAG GGT GTC ACT TTC GAT ACT GGC GGT ATT Leu Val Gly Lys Gly Val Thr Phe Asp Thr Gly Gly lle 260 265 270 CCG AGT GCA TCC ATG GAC GAA ATG CGT GGA GAT ATG GGA Pro Ser Ala Ser Met Asp Glu Met Arg Gly Asp Met Gly 275 280 285 TGC GTT GTT TCT ACA TTG GCA CAA TTG AAA GCA CCA GTC Cys Val Val Ser Thr Leu Ala Gln Leu Lys Ala Pro Val 295 300 GGT CTT ATC CCC TTA ACC GAG AAT ATG CCA GGT GGT AAA Gly Leu Ile Pro Leu Thr Glu Asn Met Pro Gly Gly Lys 310 315 CCT GGT GAC GTC GTT GTT GCG ATG AAT GGG AAA TCG ATT Pro Gly Asp Val Val Val Ala Met Asn Gly Lys Ser Ile 325 330 335 AAT ACA GAT GCT GAA GGC CGT TTG ATT TTA GCT GAC GCT Asn Thr Asp Ala Glu Gly Arg Leu Ile Leu Ala Asp Ala 340 345 350 TCG GCA CAC TTC AAG CCA AAA TGG GTT CTA GAT ATA GCT Ser Ala His Phe Lys Pro Lys Trp Val Leu Asp Ile Ala 355 360 365 GGA GCT ATG AGA GTT GCT CTA GGT GAT TGT GCT ACT GGT Gly Ala Met Arg Val Ala Leu Gly Asp Cys Ala Thr Gly 375 380 TCA TGC GAT AAT CTC TGG AAC ACA CTG CAC GAA GCT GGT Ser Cys Asp Asn Leu Trp Asn Thr Leu His Glu Ala Gly 390 395 GGA GAT AGA ATG TGG AGA TTC CCT CTT TTT AAG CAC TAC Gly Asp Arg Met Trp Arg Phe Pro Leu Phe Lys His Tyr 405 410 415 GTA ACA GAA TAT TCC GGT TAC GAT GTG AAC AAC ATA GGA Val Thr Glu Tyr Ser Gly Tyr Asp Val Asn Asn Ile Gly 420 425 430

GCA

Ala 320

TGC

Cys

TTA

Leu

ACA

Thr

GTA

Val

AGA

Arg 400

GCG

305

ACA

Thr

GTG

Val

TGT

Cys

TTG

Leu

TTT

Phe 385

GTA

Val

AAT

AAA

Lys

GAC

Asp

TAC

Tyr

ACT

Thr 370

TCT

Ser

ACT

Thr

CGT

623 671 719 767 815 863 911 959 1007 1055 1103 1151 1199 1247 1295 1343 1391 Ala Asn Arg

AAG

Lys

TTT

Phe

GGC

Gly

AGA

Arg AAA GGG Lys Gly 435 CCT GAG Pro Glu 450 GGA GGC AGT TGC CTA GCA GCT GCT TTC CTT AAT CAG Gly Gly Ser Cys Leu Ala Ala Ala Phe Leu Asn Gin 440 445 GAC GTA CCC TGG ATG CAC TTG GAC ATT GCT GGA GTA Asp Val Pro Trp Met His Leu Asp Ile Ala Gly Val 455 460 WO 96/11706 PCT/US95/14442 199 ATG AGC GAT TGC TCT GAT CAG TCC TAT CTT CCT AAG GGA ATG ACA GGG 1439 Met Ser Asp Cys Ser Asp Gln Ser Tyr Leu Pro Lys Gly Met Thr Gly 465 470 475 CGA CCT ACC AGA ACT CTT GTT CAA TTT ATT CAA AGC CAA AAG CGT CAT 1487 Arg Pro Thr Arg Thr Leu Val Gin Phe Ile Gin Ser Gin Lys Arg His 480 485 490 495 TCT T GAATGCATTT AAGAAACATA TGTCACCTAA CACCTTTACA TGCGCACCTC 1541 Ser TGCTTAGCCA AACCACTTTT GTACAAAACC ATATTTTTA 1580 INFORMATION FOR SEQ ID NO:113: SEQUENCE CHARACTERISTICS: LENGTH: 496 amino acids TYPE: amino acid TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:113: His Glu Phe Cys Ala Ser Val Arg Tyr Cys Ser Ser Met Ser Asn Lys 1 5 10 Lys Gly Leu Val Leu Gly Ile Tyr Asp Asn Glu Phe Asp Lys Lys Ile 25 Arg Leu Thr Pro Thr Ala Glu Gin Phe Asn Arg Arg Leu Gin Gly Arg 40 Leu Leu Asp Leu Ile His Leu Ser Gly Pro Ile Lys Leu Gly Lys Ser 50 55 Arg Ile Phe Trp Asp Leu Asp Glu Phe Gly Ala Val Ala Val Ala Gly 70 75 Leu Gly Asn His Ser Pro Cys Glu Leu Leu Glu Glu Leu Asp Val Leu 90 Arg Glu Asn Ala Arg Ile Ala Ala Gly Ala Gly Cys Gin Ala Leu Ala 100 105 110 Ala Asp Gly Ile Thr Thr Ile Ser Val Glu Val Trp Ser Thr Arg Arg 115 120 125 Arg Pro Cys Glu Gly Ala Ile Leu Ser Thr Phe Lys Phe Arg Ser Thr 130 135 140 Glu Glu Glu Ser Lys Cys Lys Pro Ile Pro Thr Ile Thr Pro Tyr Cys 145 150 155 160 Leu Gin Asp Lys Asp Ala Pro Leu Trp Glu Leu Gly Gin Val Ser Ala 165 170 175 Ala Ala Gin Asn Trp Ala Arg Thr Leu Met Asp Thr Pro Ala Asn Gin 180 185 190 Met Thr Pro Phe Leu Phe Ala Glu Ala Ala Lys Glu Asn Leu Val Pro 195 200 205 WO 96/11706 PCT/US95/14442 200 Leu Gly Val Lys Val Glu Ala Arg Asp Arg Lys Trp Ala Val Ser Met 210 215 220 Lys Met Gly Ser Phe Leu Ser Val Ala Arg Gly Ser Asn Glu Pro Pro 225 230 235 240 Val Phe Leu Glu Ile Ser Tyr Cys Gly Gly Pro Lys Asp Glu Ala Pro 245 250 255 Phe Ala Leu Val Gly Lys Gly Val Thr Phe Asp Thr Gly Gly Ile Ser 260 265 270 Ile Lys Pro Ser Ala Ser Met Asp Glu Met Arg Gly Asp Met Gly Gly 275 280 285 Ala Ala Cys Val Val Ser Thr Leu Ala Gin Leu Lys Ala Pro Val Asn 290 295 300 Val Val Gly Leu Ile Pro Leu Thr Glu Asn Met Pro Gly Gly Lys Ala 305 310 315 320 Thr Lys Pro Gly Asp Val Val Val Ala Met Asn Gly Lys Ser Ile Cys 325 330 335 Val Asp Asn Thr Asp Ala Glu Gly Arg Leu Ile Leu Ala Asp Ala Leu 340 345 350 Cys Tyr Ser Ala His Phe Lys Pro Lys Trp Val Leu Asp Ile Ala Thr 355 360 365 Leu Thr Gly Ala Met Arg Val Ala Leu Gly Asp Cys Ala Thr Gly Val 370 375 380 Phe Ser Ser Cys Asp Asn Leu Trp Asn Thr Leu His Glu Ala Gly Arg 385 390 395 400 Val Thr Gly Asp Arg Met Trp Arg Phe Pro Leu Phe Lys His Tyr Ala 405 410 415 Asn Arg Val Thr Glu Tyr Ser Gly Tyr Asp Val Asn Asn Ile Gly Lys 420 425 430 Gly Lys Gly Gly Gly Ser Cys Leu Ala Ala Ala Phe Leu Asn Gin Phe 435 440 445 Arg Pro Glu Asp Val Pro Trp Met His Leu Asp Ile Ala Gly Val Met 450 455 460 Ser Asp Cys Ser Asp Gin Ser Tyr Leu Pro Lys Gly Met Thr Gly Arg 465 470 475 480 Pro Thr Arg Thr Leu Val Gin Phe Ile Gin Ser Gin Lys Arg His Ser 485 490 495 WO 96/11706 PCT/US95/14442 201 INFORMATION FOR SEQ ID NO:114: SEQUENCE CHARACTERISTICS: LENGTH: 32 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:114: GAGCTCTCGA GAGTTGTTGG AGGACTGGAA GC 32 INFORMATION FOR SEQ ID NO:115: SEQUENCE CHARACTERISTICS: LENGTH: 31 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:115: GGACCTCGAG AATTAGTTAT TTTCCATGGT C 31 INFORMATION FOR SEQ ID NO:116: SEQUENCE CHARACTERISTICS: LENGTH: 31 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:116: GAGCTCTCGA GCATCGTCGG CGGCACCAGT G 31 INFORMATION FOR SEQ ID NO:117: SEQUENCE CHARACTERISTICS: LENGTH: 31 base pairs TYPE: nucleic acid STRANDEDNESS: single TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:117: GGACGAATTC TTAAAGACCA GTTTTTTTGC G 31 P:\WPDOCS\KDF\635190.RH 30/10198 -202- Throughout this specification and the appended claims, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

:i o: o eeo

Claims

1. A method to protect a host animal from flea infestation comprising treating said animal with a composition comprising a compound that reduces protease activity of fleas feeding from said treated animal, thereby reducing flea burden on said animal and in the environment of said animal, wherein said compound is selected from the group consisting of: an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in flea midgut; an isolated antibody that selectively binds to a protease present in a flea midgut; and aU inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut.

2. A method to protect a host animal from flea infestation, said method comprising treating said animal with a composition comprising a first compound capable of reducing flea protease activity and a second compound that reduces flea burden by a method other than by reducing flea protease activity, wherein said step of treating reduces flea burden on said animal and in the environment of said animal, wherein said first compound is selected from 20 the group consisting of: an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibody 25 that selectively binds to a protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut.

3. A method to reduce flea infestation comprising treating an animal with a composition comprising compound capable of reducing flea protease activity, said animal being selected from the group consisting of fleas and animals susceptible to flea infestation, said step of treating thereby reducing flea burden on said animal and in the environment of said animal, P:\WPDOCS\KDF635190.RH 30/10/98 -203a- wherein said compound is selected from the group consisting of: an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibody that selectively binds to a protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut.

4. A method to treat flea infestation comprising administering to an animal a controlled release formulation comprising a composition capable of reducing flea protease activity, thereby reducipg flea burden on said animal and in the environment of said animal, wherein said composition comprises a compound selected from the group consisting of: an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibody that selectively binds to a protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated S. 20 flea protease present in a flea midgut. 20 flea protease present in a flea midgut. 9 4-O 6 9 P:\WPDOCS\KDF\635190.RH 30/10/98 -204- An isolated protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut selected from the group consisting of a midgut from a blood-fed female flea, a midgut from a blood-fed male flea, a midgut from an unfed female flea, a midgut from an unfed male flea and a mixture thereof.

6. An isolated antibody capable of selectively binding to a protease present in a flea midgut selected from the group consisting of a midgut from a blood-fed female flea, a midgut from a blood-fed male flea, a midgut from an unfed female flea, a midgut from an unfed male flea and a mixture thereof.

7. An isqoated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut.

8. An isolated soluble flea midgut preparation having protease activity, wherein at least about 70 percent of said protease activity can be inhibited by 4-2-aminoethyl- benzenesulfonylflouride-hydrochloride. *9

9. A composition comprising an isolated compound selected from the group consisting 20 of a flea protease vaccine, an anti-flea protease antibody, a protease inhibitor and a mixture thereof, said composition, when administered to an animal, being able to reduce flea burden on said animal and in the environment of said animal.

10. A composition comprising an isolated first compound capable of reducing flea protease S: 25 activity and an isolated second compound that reduces flea burden by a method other than by reducing flea protease activity, wherein said first compound is selected from the group consisting of; an isolated an purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibody that P:WPDOCS\cDM53190.RH 30/10/M -205- selectively binds toa protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut.

11. A controlled release formulation imparting long-term control of flea infestation comprising an isolated compound that reduces protease activity of fleas feeding from an animal, said compound being formulated in a controlled release vehicle, wherein said isolated compound is selected from the group consisting of; an isolated and purified flea protease protein that comprises an amino acid sequence encoded by a nucleic acid molecule capable 1of hybridizing under stringent conditions with a nucleic acid molecule that encodes a midgut 10 protease present in a flea midgut; an isolated nucleic acid molecule capable of hybridizing under stringent conditions with a gene encoding a flea protease present in a flea midgut; an isolated antibqly that selectively binds to a protease present in a flea midgut; and an inhibitor of flea protease activity identified by its ability to inhibit an isolated flea protease present in a flea midgut.

12. A method to produce an isolated flea protease comprising: disrupting a flea midgut to produce a mixture comprising a liquid portion and a solid portion; and S* purifying said protease from said liquid portion.

13. A method to produce an isolated flea protease protein comprising: culturing in an effective medium a recombinant cell capable of expressing a said protein to produce said protein; and recovering said protein. 206

14. A method to identify a compound capable of inhibiting the proteolytic activity of a flea protease, said method comprising: contacting an isolated flea protease .protein with a putative inhibitory compound under conditions in which, in the absence of said compound, said protease has proteolytic activity; and S(b) determining if said putative inhibitory compound inhibits said activity.

15. A test kit to identify a compound capable of inhibiting proteolytic activity of a flea protease, said test kit comprising an isolated flea protease protein having proteolytic activity and a means for determining the extent of inhibition of said activity in the presence of a 15 putative inhibitory compound.

16. An isolated flea nucleic acid molecule that 0: hybridizes under stringent hybridization conditions with a gene selected from the group consisting of a flea serine protease gene and a flea aminopeptidase gene.

17. An isolated flea protein that comprises an amino acid sequence encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions with a gene selected from the group consisting of a flea serine protease gene and a flea aminopeptidase gene. 18, A therapeutic composition that, when administered to an animal, reduces flea infestation, said therapeutic composition comprising a protective compound selected from the group consisting of: an isolated flea serine protease 207 nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea serine protease gene; an isolated flea serine protease protein or a mimetope thereof; an isolated antibody that selectively binds to a flea serine protease protein; an inhibitor of flea serine protease activity identified by its ability to inhibit flea serine protease activity; an isolated flea aminopeptidase nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea aminopeptidase gene; 10 an isolated flea aminopeptidase protein or a mimetope thereof; an i plated antibody that selectively binds to a flea aminopeptidase protein; an inhibitor of flea aminopeptidase activity identified by its ability to inhibit flea aminopeptidase activity; and a mixture 15 thereof.

19. A method to reduce flea infestation comprising treating an animal with a therapeutic composition comprising a protective compound selected from the group consisting of: an isolated flea serine protease nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea serine protease gene; an isolated flea serine protease protein or a mimetope thereof; an isolated antibody that selectively binds to a flea serine protease protein; an inhibitor of flea serine protease activity identified by its ability to inhibit flea serine protease activity; an isolated flea aminopeptidase nucleic acid molecule that hybridizes under stringent hybridization conditions with a flea aminopeptidase gene; an isolated 208 flea aminopeptidase protein or a mimetope thereof; an isolated antibody that selectively binds to a flea aminopeptidase protein; an inhibitor of flea aminopeptidase activity identified by its ability to inhibit flea aminopeptidase activity; and a mixture thereof. A method to produce a protein selected from the group consisting of a flea serine protease protein and a flea aminopeptidase protein, said method comprising culturing a cell capable of expressing said protein, said 10 protein being encoded by a nucleic acid molecule that hybridizes under stringent hybridization conditions with a gene selected from the group consisting of a flea serine protease gene and a flea aminopeptidase gene.

21. The invention of Claim 1-15, wherein said 15 protease is selected from the group consisting of an aminopeptidase, a carboxypeptidase, an endopeptidase, and a mixture thereof.

22. The invention of Claim 1-15, wherein said protease is selected from the group consisting of a serine protease, a metalloprotease, an aspartic acid protease and a cysteine protease.

23. The invention of Claim 1-15, wherein said protease is selected from the group consisting of a serine protease, a metalloprotease, and a mixture thereof.

24. The invention of Claim 1-15, wherein said protease comprises a serine protease. The invention of Claim 1-15, wherein said protease comprises an aminopeptidase. P:\WPDOCSKDF635190.RH 30/10/98 -209-

26. The invention of claim 1-15 wherein said protease is selected from the group consisting of a trypsin-like protease, a chymotrypsin-like protease, an aminopeptidase, and a mixture thereof.

27. The invention of Claim 1-11, wherein said protease comprises a midgut protease present in the lumen of said midgut.

28. The invention of Claim 12- 15 wherein said protease comprises a midgut protease present in the lumen of said midgut.

29. The invention of Claim 1-4 or 9-11, wherein said composition or formulation o S comprises a flea protease vaccine selected from the group consisting of a flea serine protease, a flea metalloprotease, a flea aspartic acid protease, a flea cysteine protease, and a mixture thereof. S 30. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises a flea protease vaccine selected from the group consisting of a flea serine protease vaccine, a flea metalloprotease vaccine, and a mixture thereof. 20 31. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises an aminopeptidase vaccine.

32. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises an anti-flea protease antibody that selectively binds to a flea protease selected 210 from the group consisting of a flea serine protease, a flea metalloprotease, a flea aspartic acid protease, a flea cysteine protease and a mixture thereof.

33. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises an anti-flea protease antibody that selectively binds to a flea protease selected from the group consisting of a flea serine protease and a flea metalloprotease.

34. The invention of Claim 1-4 or 9-11, wherein said 9* 10 composition or formulation comp ises an anti-flea protease antibody that selectively binds to a flea aminopeptidase.

35. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises a flea protease inhibitor selected from the group consisting of a serine protease inhibitor, a metalloprotease inhibitor, an *4 aspartic acid protease inhibitor, a cysteine protease inhibitor, an aminopeptidase inhibitor and a mixture thereof.

36. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises a flea protease inhibitor selected from the group consisting of a serine protease inhibitor, a metalloprotease inhibitor, an aminopeptidase inhibitor, and a mixture thereof.

37. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises a flea serine protease inhibitor.

38. The invention of Claim 1-4 or 9-11, wherein said composition or formulation further comprises a component 211 selected from the group consisting of a pharmaceutically acceptable excipient, an adjuvant, a carrier, and a mixture thereof.

39. The invention of Claim 1-4 or 9-11, wherein said composition or formulation reduces flea burden by a method selected from the group consisting of reducing the viability of fleas that feed from said treated animal, :reducing the fecundity of female fleas that feed from said treated animal, reducing the reproductive capacity of male fleas that feed from said treated animal, reducing the viability of eggs laid by female fleas that feed from said treated animal, altering the blood feeding behavior of fleas that feed from said treated animal, reducing the viability of flea larvae, altering the development of flea larvae, and a mixture thereof.

40. The invention of Claim 1-4 or 9-11, wherein said S. composition or formulation reduces flea viability by at least about 50 percent within at least about 21 days after said fleas begin feeding from said treated animal.

41. The invention of Claim 1-4 or 9-11, wherein said composition or formulation reduces flea fecundity by at least about 50 percent within at least about 30 days after said fleas begin feeding from said treated animal.

42. The invention of Claim 1-4 or 9-11, wherein said composition or formulation is administered by at least one route selected from the group consisting of oral, nasal, topical, transdermal, rectal, and parenteral routes.

43. The invention of Claim 1-4 or 9-11, wherein said 212 composition or formulation is administered to an animal selected from the group consisting of mammals and birds.

44. The invention of Claim 1-4 or 9-11, wherein said composition or formulation is administered to an animal selected from the group consisting of cats and dogs. The invention of Claim 1-15, wherein said fleas are of a genus selected from the group consisting of Ctenocephalides, Cyopsyllus, Diamanus, Echidnophaga, Nosopsyllus, Pulex, Tunga, and Xenopsylla.

46. The invention of Claim 1-15, wherein said fleas are of a species selected from the group consisting of Ctenocephalides felis, Ctenocephalides canis, Pulex irritans and Pulex simulans. S: 47. The invention of Claim 1-3 or 9-10, wherein said 15 composition comprises a controlled release formulation.

48. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises a biocompatible polymer.

49. The invention of Claim 1-4 or 9-11, wherein said composition or formulation comprises a liquid that upon administration to said animal forms a solid or a gel in situ. The invention of Claim 1-4 or 9-11, wherein said composition or formulation is biodegradable.

51. The invention of Claim 1-4 or 9-11, wherein said composition or formulation is capable of effecting treatment for at least about 1 month after administration of said composition or formulation to said animal. 213

52. The invention of Claim 2 or 10, wherein said first compound, by reducing flea proteolytic activity, enhances the efficacy of said second compound.

53. The invention of Claim 2 or 10, wherein said first compound is selected from the group consisting of a flea protease vaccine, an anti-flea protease antibody, a protease inhibitor and a mixture thereof.

54. The invention of Claim 2 or 10, wherein said second compound is selected from the group consisting of a compound that effects active immunization and a compound :i that effects passive immunization.

55. The invention of Claim 2 or 10, wherein said e• 4second compound is selected from the group consisting of a compound that inhibits binding between a flea membrane protein and its ligand, a compound that inhibits hormone synthesis, a compound that inhibits vitellogenesis, a compound that inhibits fat body function, a compound that inhibits flea muscle action, a compound that inhibits the flea nervous system, a compound that inhibits the flea immune system, a compound that inhibits flea feeding, and a mixture thereof.

56. The invention of Claim 5, wherein said protein, when administered to an animal, is capable of eliciting an immune response against a flea midgut protease.

57. The invention of Claim 5, wherein said protein has protease activity.

58. The invention of Claim 1-15, wherein said protease is selected from a group of midgut proteases 214 having molecular weights ranging from about 5 kD to about 200 kD, as determined by SDS-PAGE.

59. The invention of Claim 1-15, wherein said protease comprises a midgut protease selected from the group consisting of a serine protease having a molecular weight of about 26 kD, a serine protease having a molecular weight of about 24 kD, a serine protease having a molecular weight of about 19 kD, and a serine protease having a molecular weight of about 6 kD, said molecular weight being determined by SDS-PAGE. PLeO The invention of Claim 1-15, wherein said protease comprises a serine protease having a molecular 9*99 weight of about 26 kD as determined by SDS-PAGE. *4

61. The invention of Claim 1- 15, wherein said protease comprises a midgut protease having a pH activity optimum ranging from about pH 5 to about pH

62. The invention of Claim 1- 15, wherein said protease comprises a midgut protease having a proteolytic activity that is inhibited by at least about 50 percent by a serine protease inhibitor.

63. The invention of Claim 1-5, 8-11 or 14-15, wherein said compound of Claim 1, 3, 9 or 11, said first compound of Claim 2 or 10, said composition of Claim 4, said protein of Claim 5, 14 or 15, or said preparation of Claim 8 comprises a material recovered by a method comprising: disrupting a flea midgut to produce a mixture comprising a liquid portion and a solid 215 portion; and recovering said liquid portion to obtain a soluble flea midgut preparation comprising said material.

64. The invention of Claim 63, wherein said material is further purified. The invention of Claim 1-5, 8-11, or 14-15, wherein a protein of said invention is produced by a method a. comprising culturing a recombinant cell comprising a S: nucleic acid molecule encoding said protein to produce said 0 protein and recovering said protein therefrom.

66. The invention of Claim 6, wherein said antibody comprises a passive immunotherapy composition that when administered to a host animal reduces flea burden on said a. animal and in the environment of said animal.

67. A recombinant molecule comprising an isolated a nucleic acid molecule as set forth in Claim 7 operatively linked to a transcription control sequence.

68. A recombinant cell comprising a cell having at least one nucleic acid molecule as set forth in Claim 7, said cell being capable of expressing said nucleic acid molecule.

69. The invention of Claim 16-20, wherein said serine protease gene comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, and SEQ ID NO:38, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID 09 216 NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO: 72, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO: 78 I SEQ ID NO: 80, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:2.04, SEQ ID NO:106, SEQ ID NO:108, and SEQ ID and wherein said aminopeptidase gene comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:50 and SEQ ID NO:112 SEQ 1D 119:52 and SE;Q R) NG-054.

70. The invention of Claim 16-20, wherein said serine protease gene comprises a nucleic acid sequence that encodes an amino acid sequence selected from the group consisting of SEQ ID NO:l1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NQ:6, SEQ ID NO:7, SEQ ID NO:8, 15 SEQ ID NO:9, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, and SEQ ID NO:47, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO: 57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:73, SEQ ID SEQ ID NO:77, SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:l0l, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, and SEQ ID NO:ll1, apd wherein said aminopeptidase gene comprises a nucleic acid sequence that 217 encodes an amino acid sequence selected from the group consisting of SEQ ID NO:51 and SEQ ID NO:1l3 SEQ 19 NG-53.

71. The invention of Claim 16, 18, or 19,, wherein said nucleic acid molecule comprises a nucleic acid sequence that encodes a protein selected from the group consisting of a serine protease protein or an aminopeptidase protein.

72. The invention of Claim 16-20, wherein said nucleic acid molecule hybridizes under stringent hybridization conditions with a nucleic acid molecule selected from the group consisting of nfSPl, nfSP2, nfSP3, nfSP4, nfSP5, nfSP6, nfSP7, nfSP8, nfSP9, nfSPlO, nfSPll, nfSPl2, nfSPl3, nfSPl4, nfSPl5, nfSPl6, nfSPl7, nfSPl8, nfSP19, nfSP2O and nfAP 1580 15 73 The invention of Claim 16-20, wherein said *nucleic acid molecule hybridizes under stringent *hybridization conditions with a nucleic acid molecule selected from the group consisting of nfSPl1 9 nfSP2, nfS37 nfSP4 6 7 2 nfSP5 1 5 7 1, nfSP5 2 1 8 nfSP6 9 3 2 nfSP, 94 nf SP8 2 9 9 nfS P9 2 6 6 nf S P0 3 7 nfSPll 25 2 nfSPl2 14 4 nfS P12 225 nf SPl3. 5 nfSPl4 2 1 3 nfSPl5 2 5 2 nfSP16 1 6 8 nfSPl8 5 4 nfSPl9 3 5 9 1 nfSP2084 1 and nfAP 1 5 8 0

74. The invention of Claim 16-20, wherein said nucleic acid molecule comprises a nucleic acid molecule selected from the group consisting of nfSP 779 1 nfSP2 944 nfSP3 1 77 nfSP4 672 1 nfSP5 157 1 nfSP5 218 F nfSP6 93 2 nf SP7 89 4 1 nfSP8 29 9 n fSP9 26 6 nfSPO 3 78 nf S P1 2 5 2 nfSP12 144 nfSPl2 22 218 nfSP13, 5 0 nfSPl4 2 13 nfSPl5 2 5 2 nfSPl6 168' nf SP18 85341 nfSP19 3 5 9 1' nfSP2084 1 and nfAP 1580 The invention of Claim 16-20, wherein said nucleic acid molecule comprises a nucleic acid sequence that encodes a protein having an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO45 .E ID*:6 E DN:4,SQI N0:53, SEQ ID NO:46, SEQ ID NO:457, SEQ ID NO:59, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NQ:99, SEQ ID 201 NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO:67, SEQ ID NO:69, SEQ ID NO:1, SEQnd N: SEQ ID NO:75 SEQ aleic sequenc seete fro the87 SEQu IDsstn NO8,SQI of SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:l2l, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID 219 NO:32, SEQ ID NO:34, SEQ ID NO:36, and SEQ ID NO:38, SEQ ID SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:88, SEQ ID SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, and an 10 allelic variant of any of said nucleic acid molecules.

77. The invention of Claim 16, 18, or 19, wherein said nucleic acid molecule comprises an oligonucleotide.

78. The invention of Claim 71, wherein said protein, when administered to an animal is capable of eliciting an immune response against a flea protein selected from the i group consisting of a flea serine protease protein and a flea aminopeptidase protein.

79. The invention of Claim 71, wherein said protein has proteolytic activity.

80. The invention of Claim 16, wherein said nucleic acid molecule, when administered to an animal is capable of reducing flea infestation.

81. A recombinant molecule comprising a nucleic acid molecule as set forth in Claim 16 operatively linked to a transcription control sequence.

82. A recombinant virus comprising a recombinant molecule as set forth in Claim 81.

83. A recombinant cell comprising a nucleic acid 220 molecule as set forth in Claim 17, said cell being capable of expressing said nucleic acid molecule.

84. The invention of Claim 17-20, wherein said protein, when administered to an animal is capable of eliciting an immune response against a flea protein selected from the group consisting of a flea serine protease protein and a flea aminopeptidase protein. The invention of Claim 17-20, wherein said protein has proteolytic activity. 10 86. The invention of Claim 17-20, wherein said protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, a a a a. a a. a SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, 15 NO:21, NO:29, NO:37, NO:42, NO:46, NO:55, NO:63, NO: 71, NO:79, NO:87, NO:95, SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ ID ID ID ID ID SEQ ID ID ID ID ID ID NO:9, SEQ ID NO:17, NO: 23, NO:31, NO: 39, NO: 43, ID NO: NO:57, NO:65, NO:73, NO:81, NO:89, NO:97, SEQ ID NO:25, SEQ ID NO:33, SEQ ID NO:40, SEQ ID NO:44, 47, SEQ ID NO:5 SEQ ID NO:59, SEQ ID NO:67, SEQ ID NO:75, SEQ ID NO:83, SEQ ID NO:91, SEQ ID NO:99, SEQ ID NO:19, SEQ ID NO:27, SEQ ID NO:35, SEQ ID NO:41, SEQ ID NO:45, L, SEQ ID NO:53, SEQ ID NO:61, SEQ ID NO:69, SEQ ID NO:77, SEQ ID NO:85, SEQ ID NO:93, SEQ ID NO:101, SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, SEQ ID NO:113, and a protein encoded by an allelic variant of a nucleic acid molecule encoding a protein 221 comprising any of said amino acid sequences.

87. The invention of Claim 17-19, wherein said protein is produced by a process comprising culturing a recombinant cell transformed with a nucleic acid molecule encoding said protein to produce said protein.

88. The invention of Claim 17 or 20, wherein said protein or a mimetope thereof, when administered to an animal is capable of reducing flea infestation.

89. The invention of Claim 17 or 20, wherein said S.o 10 protein or a mimetope thereof, when administered to a host animal is capable of reducing flea burden on said animal 1** and in the environment of said animal.

90. The invention of Claim 17 or 20, wherein said protein is used to identify an inhibitor selected from the 15 group consisting of an inhibitor of flea serine protease activity and an inhibitor of flea aminopeptidase activity.

91. The invention of Claim 90, wherein said inhibitor, when administered to an animal, is capable of reducing flea infestation.

92. An isolated antibody that selectively binds to a protein as set forth in Claim 17 or

93. The invention of Claim 18 or 19, wherein said composition further comprises a component selected from the group consisting of an excipient, an adjuvant, a carrier, and a mixture thereof.

94. The invention of Claim 18 or 19, wherein said composition comprises a controlled release formulation. The invention of Claim 18 or 19, wherein said 222 composition further comprises a compound that reduces flea burden by a method other than by reducing flea protease activity.

96. The invention of Claim 18 or 19, wherein said animal is selected from the group consisting of adult fleas, flea larvae and animals susceptible to flea infestation.

97. The invention of Claim 18 or 19, wherein larval flea infestation is reduced by flea larvae ingesting adult 10 flea feces comprising said therapeutic composition.

98. The invention of Claim 18 or 19, wherein larval flea infestation is reduced by flea larvae ingesting adult flea feces, said feces comprising anti-flea protease antibodies elicited in a host animal in response to administration of one or more of said isolated flea protease proteins, said adult flea having fed from said host animal after said administration, said protease being selected from the group consisting of a serine protease and an aminopeptidase,

99. The invention of Claim 18 or 19, wherein said animal is selected from the group consisting of mammals and birds.

100. The invention of Claim 18 or 19, wherein said animal is selected from the group consisting of cats and dogs.

101. The invention of Claim 16-20, wherein said fleas are of a genus selected from the group consisting of Ctenocephalides, Cyopsyllus, Diamanus, Echidnophaga, P:1V4U C(F319J.J 30/i019 -223- NoWsopYllus, Pulex, Tunga, and Xenopsylla.

102. The invention of Claim 16-20 0,wherein said fleas are of a species selected from the group consisting Of Ctenocephalides fells, Cteno cephafides canis, Pule-x irritans and Pulexr simulans. 3. The invention of any preceding claim substantially as herein before described with reference to the Examples. S DATED this 5th day of March 1999 HESKA CORPORATION By its Patent Attorneys DAVIIES COLLISON CAVE,