WO1994016062A1 - Complement regulatory proteins of herpesvirus saimiri - Google Patents

Abstract

Gene sequences for three complement regulatory proteins encoded within the genome of Herpesvirus Saimiri (HVS) are disclosed, namely, mCCPH, sCCPH, and HVS-15. mCCPH and sCCPH share substantial homology with the human complement inhibitory proteins factor H, CD35, CD46, CD55, and C4bp which inhibit C3 convertase activity in the complement cascade. HVS-15 shares substantial homology with the human complement inhibitory protein CD59 which inhibits formation of the membrane attack complex of the complement system. The gene sequences and corresponding proteins can be used as therapeutic agents to control the complement arm of the immune system.

Description

COMPLEMENT REGULATORY PROTEINS OF HERPESVIRUS SAIMIRI

FIELD OF THE INVENTION

The present invention relates to viral proteins having complement regulatory activity. BACKGROUND OF THE INVENTION

I. The HVS Viral Genome

Viruses are infectious pathogenic particles which contain genetic elements that enable the virus to replicate within a living host cell. By identifying and sequencing viral genomes and analyzing the thus obtained DNA sequence, it is possible to identify open reading frames (ORFs) within the viral genome comprising long stretches of coding sequence beginning with a translation-initiation codon (preceded by a ribosome binding site) and uninterrupted by a translational stop codon.

The existence of an ORF in a virus' genome does not necessarily mean that the ORF encodes a protein. In p.articular, the genomic organization and

DNA sequence of several ORFs of the Herpesvirus Saimiri (HVS), which is a member of the distinct family of Gammaheipesvirinae . have recently been identified (Albrecht et al., J. Virology 66:5047-5058, 1992). As many as 76 major ORFs were identified along with a set of seven U-RNA genes for a total of 83 potential genes. The criteria used to define a potential ORF included (i) a minimum of 60 amino acids in the derived polypeptide, (ii) no more than a 60% overlap with other reading frames, (iii) the presence of typical translation start signals, (iv) potential promoter and transcriptional termination elements, (v) codon preference similar to those of unambiguously identified viral genes, and (vi) sequence homologies to known reading frames of other herpesviruses .and cellular genes. mRNA transcripts and viral proteins, however, have not been demonstrated for most of these ORFs.

The present invention identifies a specific class of viral proteins encoded within the genome of HNS that are complement regulatory proteins. As such, the invention establishes for the first time the existence of an animal virus expressing 1) a membrane glycoprotein (and its secreted derivative) with the characteristic structure of a cellular inhibitor of complement activation (hereinafter referred to as "mCCPH" for the membrane glycoprotein and "sCCPH" for the secreted glycoprotein, where the acronym "CCPH" stands for "complement control protein homologue"), and 2) a homologue of human

CD59, the only identified cellular inhibitor of the terminal complement membrane attack complex (hereinafter referred to as "HNS-15"). To date, these viral complement regulatory proteins are unique to the Herpesvirus Saimiri genome. Moreover, in accordance with the invention, these proteins, when expressed, isolated and purified, can be used to protect cells against lysis by human complement, π. The Complement System

The complement system is a complex interaction of plasma proteins and membrane cofactors which act in a multistep, multiprotein cascade sequence in conjunction with other immunological systems of the body to provide immunity from intrusion of foreign cells. Complement proteins represent up to about 10% of globulins in normal serum of humans and other vertebrates.

The classical complement pathway involves an initial antibody recognition of, and binding to, an antigenic site on a target cell. This surface bound antibody subsequently reacts with the first component of complement,

Clq, forming a Clq-antibody complex with Ca²⁺. That complex forms Clr and Cls, which is proteolytically active. Cls cleaves C2 and C4 into active components, C2a and C4a and by-products C2b and C4b. The complex of C4b and C2a is an active protease called C3 convertase, and acts to cleave C3 into C3a and C3b. C3b forms a complex with C4b,C2a to produce

C4b,2a,3b, or C5 convertase, which cleaves C5 into C5a and C5b. C5b combines with C6 and this complex combines with C7 to form the ternary complex C5b,6,7. The C5b,6,7 complex binds C8 at the surface of the cell. The C5b,6,7,8 complex has the ability to develop functional membrane lesions and allow the cell to undergo slow lysis (Law, S.K.A., and Reid, K.B.M. 1988, In: Complement. IRL Press, Oxford, UK pp. 1-71). Upon binding of

C9, the complete membrane attack complex (MAC) is formed (C5b-9) and the lysis of foreign cells and microorganisms is rapidly accelerated. In the case of mammalian cells, such as endothelial cells and platelets, the C5b-9 complex can also cause cell activation. Control of the complement system is necessary in order to prevent destruction of autologous cells. One of the central molecules in the complement cascade is C3b which aggregates in increasing amounts on foreign substances or organisms thereby targeting them for removal. The complement precursor proteins are activated to form C3b as described above in two ways: (i) by interacting with antibody bound to a foreign target (classical pathway) or

(ii) non-specifically by progressive and rapidly increasing accumulation on foreign substances on the surface of foreign cells (the alternative pathway).

Activation of the alternative pathway relies on molecular structures on the target cell to upset the delicate balance of the proteins involved so that their activation and deposition are focused on the surface of the target cell. In the alternative pathway C3b is continuously activated at a slow rate in the fluid phase by various agents including endotoxin, lipopolysaccharide, and serum proteases that convert C3 to C3b. C5b can also be formed from C5 by plasmin, elastase and other serum proteases to initiate formation of the MAC. In order to control this process of complement activation and to protect normal syngeneic cells from indiscriminate destruction, a family of cell-surface proteins has evolved that interacts with C3b molecules. These proteins are as follows:

(a) Membrane cofactor protein (MCP or CD46) which exists on all cells, except red blood cells, and binds to C3b .and activates molecules that cleave C3b into inactive fragments before it can accumulate on the surface of a target cell to destroy that cell.

(b) Decay accelerating factor (DAF or CD55) which exists on all cells including red blood cells and prevents C3b from reacting with other complement components preventing destruction of the cell. CD55, unlike CD46, does not destroy C3b.

(c) Complement receptor 1 (CR1 or CD35) which exists on a select group of lymphocytes as well as erythrocytes, neutrophils, and eosinophils and causes degradation of C3b molecules adhering to neighboring cells. (d) Factor H and C4b-binding protein which both inhibit C3 convertase activity of the alternative complement pathway.

All of these proteins are encoded at a single chromosomal location identified as the RCA, i.e., the regulators of complement activation. They are each uniquely characterized structurally by a short consensus repeating unit (SCR) of approximately 60 amino acids composed mostly of cysteine, proline, glycine, tryptophan, .and several hydrophobic residues. Reid, et al., 1986, "Complement system proteins which interact with C3b and C4b", Immunol. Today. 7:230. Coyne, et al., 1992, "Mapping epitopes, glycosylation sites, and complement regulatory domains in human decay accelerating factor", Immunol.. 149:2906-2913. For CD46 and CD55, these SCRs are known to encode the functional domains of the proteins necessary for full complement regulatory activity. Adams, et al., 1991, "Contribution of the repeating domains of membrane cofactor protein (CD46) in the complement system to ligand binding and cofactor activity", J. Immunol.. 147:3005-3011. For a discussion of SCRs generally see Perkins et al. 1988, Biochemistry.

27:4004-4012; for a discussion of SCRs of factor H and CD35 see Krych et al., PNAS. 88:4353-4357 (1991) and Weisman et al., Science. 249:146 (1990).

The genes encoding .all of these proteins have been localized to the long arm of chromosome 1, band lq32 and form the multigene family designated the RCA gene cluster. Both membrane and secreted forms of both CD55 (DAF) and CD46 (MCP) have been identified and their cDNAs cloned. Moran et al., 1992, "Human recombinant soluble decay accelerating factor inhibits complement activation in vitro and in vivo". J. Immunol.. 140:1736-1743. Purcell et al., 1991, "Alternatively spliced RNAs encode several isoforms of CD46 (MCP), a regulator of complement activation", Immunogenetics. 33:335-344.

In addition to membrane and soluble inhibitors of the C3 convertase enzymes, human blood cells and the vascular endothelium express a cell surface glycoprotein, CD59, that serves to prevent assembly of the C5b-9 lytic MAC and, therefore, protects these cells from complement-mediated cell activation and lysis. CD59 is a glycoprotein of apparent molecular mass of 18-21 kilodaltons (kD). See, for example, Sims et al., U.S. Patent No. 5,135,916. CD59 is tethered to the plasma cell membrane by a glycophospholipid anchor (GPI) and is deleted from the membranes of the most hemolytically sensitive erythrocytes that arise in the stem cell disorder paroxysmal nocturnal hemoglobinuria. Reviewed in Venneker, et al., 1992, "CD59: A molecule involved in antigen presentation as well as down regulation of membrane attack complex", Exp. Clin. Immunogenet.. 9:33-47. The activity of CD59 is species-restricted, showing selectivity for C8 and C9 that are derived from homologous (i.e., human) serum. Ibid. CD59 appears to function by competing with C9 for binding to C8, thereby decreasing the incorporation of C9 into the membrane C5b-9 complex and limiting propagation of the C9 homopolymer. Rollins, et al., 1990, "The complement inhibitory activity of CD59 resides in its capacity to block incorporation of C9 into membrane C5b-9", J. Immunol.. 144:3478-3483.

HI. Complement- Associated Diseases and Effects of Complement on Endothelial Cells. Platelets, and Transplanted Organs

Complement activation and lysis have been implicated in the etiology of a wide array of diseases in both human studies and in animal models of human disease. In certain cases the complement activation is initiated by the classical pathway and in other disorders the activation occurs via the alternative pathway, or potentially by direct protease-mediated generation of C5b.

Antibody stimulated, complement-mediated, inflammation plays an important role in autoimmune disorders and transplant rejection directed at the vascular endothelium. Antibodies directed against the vascular endothelium can result in C5b-9 mediated endothelial cell activation and lysis via direct pore formation (Hattori et al. J. Biol. Chem. 1989, 264:9053-9060; Hamilton et al. 1990, Blood 76:2572-2577). Ten percent of allogeneic solid donor organs in HLA-identical matches are rejected by antibody/compl- ement-mediated mechanisms (Brasile et al. 1987, Trans. Proceed.

19:894-895). In 78% of the cases of rejection under these conditions, the antibodies are directed against the vascular endothelial cells (Brasile et al. 1985, Trans. 40:672-675). In the xenogeneic setting, when non-primate organs are transplanted into primates, complement activation with antibodies directed against the endothelial cells lining the vessels of the donor organ account for the nearly universal occurrence of hyperacute rejection (Dalmasso et al. 1992, Am. J. Pathol. 140:1157-1166). Classical autoimmune disorders such as glomerulonephritis, the anti-basement membrane disorder Goodpasture's syndrome, and systemic lupus erythematosus, are also associated with antibody/complement mediated inflammation.

Antibodies directed against platelets can also result in C5b-9 mediated activation and lysis of platelets (Sims et al. 1989, J. Biol. Chem. 264:19228-19235; Morgan 1992, Biochem. J. 282:409-413). The destruction of platelets by antibodies in vivo results in thrombocytopenia which is frequently refractory to current forms of therapy. Platelets can also be injured by complement assembled on the platelet surface either via activation through the alternative pathway or via direct protease-mediated C5b generation. The assembly of C5b-9 membrane attack complexes on the surface of platelets during storage in platelet-rich plasma and after washing (Zimmerman and Kolb 1976, J. Clin. Invest. 57:203-211) may contribute to the platelet storage lesion. Complement-mediated inflammation also contributes to disease in certain conditions where the alternative pathway, or direct protease-mediated C5b generation, is more likely to be responsible for complement activation. Since the C5b-9 membrane attack complex activates and lyses endothelial cells (Hattori et al. J. Biol. Chem. 1989, 264:9053-9060; Hamilton et al. 1990,

Blood 76:2572-2577), intrinsic complement activation during storage of donor organs may lead to reduced vascular viability and reduced vascular integrity prior to transplantation. Complement activation is apparent in patients with adult respiratory distress syndrome (Hammerschmidt et al. 1980, Lancet 1:947-949; Zilow et al. 1990, Clin. Exp. Immunol. 79:151-157; Zilow et al.

1992, Crit. Care Med. 20: 468-473) and depletion of complement appears to be beneficial in animal models of lung injury (Gelfand et al. 1982, J. Clin. Invest. 70:1170-1176; Till and Ward 1986, Federation Proc. 45:13-18; Mulligan et al. 1992, J. Immunol. 148:1479-1485; Rabinovici et al. 1992, Immunol. 149:1744-1750). Complement deposition, including deposition of

C5b-9 membrane attack complexes, has been demonstrated in human myocardium and animal myocardium after myocardial infarction and following ischemia/reperfusion (Pinckard et al. 1980, J. Clin. Invest. 66:1050-1056; Rossen et al. 1985, Circ. Res. 57:119-130; Schafer et al. 1986, J. Immunol. 137:1945-1949; Weisman et al. 1990, Science 249:146-151). Further, systemic complement activation occurs after myocardial infarction in humans due to an antibody-independent mechanism (Pinckard et al. 1975, J. Clin. Invest. 56:740-750). Depletion of complement reduces the extent of myocardial infarction in animal models during ischemia/reperfusion and following coronary occlusion without reperfusion (Maroko et al. 1978,

Clin. Invest. 61:661-670; Crawford et al. 1988, Circ. 78:1449-1458; Weisman et al. 1990, Science 249:146-151). Complement activation also occurs in animal models following ischemia/reperfusion of organs other than the heart and following burns, endotoxin administration, and bacterial infection (Gelfand et al. 1982, J. Clin. Invest. 70:1170-1176; Bergh et al.

1991, Acta Anaesthesiol. Scand. 35:267-274; Rabinovici et al. 1992, Immunol. 149:1744-1750; Hill et al. 1992, J. Immunol. 149:1723-1728). Moreover, depletion of complement reduces the disease severity in animal models following burns, intestinal ischemia/reperfusion, and endotoxin administration (Gelfand et al. 1982, J. Clin. Invest. 70: 1170-1176; Rabinovici et al. 1992, J. Immunol. 149:1744-1750; Hill et al. 1992, J. Immunol.

149:1723-1728). Complement activation likely contributes to the morbidity and mortality associated with other ischemia/reperfusion conditions including pulmonary embolism, cerebrovascular accidents, and unstable angina.

Recent reports have demonstrated that activated components of the complement system are markedly increased in patients with a variety of central nervous system disorders and have suggested that activation of the classical pathway of complement activation may play a significant role in the generation of central nervous system disease. Substantial increases in the lytic C5b-9 membrane attack complexes were found in the cerebrospinal fluid of patients with Guillain-Barr syndrome and multiple sclerosis, and in patients with central nervous system involvement of Primary Sjogren's syndrome .and systemic lupus erythematosus (Sanders et al. 1986, J. Immunol. 136:4456-4459; Sanders et al. 1987, J. Immunol. 138:2095-2099). Further, activated components of the classical pathway and C5b-9 membrane attack complexes were observed immunohistochemically only rarely in tissue from normal patients but at substantially increased levels in brain tissue from patients with Alzheimer's dementia, Pick's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis, progressive supranuclear palsy, and Shy-Drager syndrome (McGeer et al. 1989, Neurosci. Lttrs. 107:341-346; Eikelenboom et al. 1989, Virchow's Archiv. B. Cell. Pathol.

56:259-262; Yamada et al. 1990, Neurosci. Lttrs. 112:161-166). These observations suggest that both intermediate and terminal complement components may contribute to the degeneration of brain tissue, and subsequent morbidity and mortality, associated with a variety of central nervous system disorders. IN. Viral Complement Regulatory Proteins

The complement cascade functions both as an innate antiviral defense and, when activated by antibody (i.e., the classical complement pathway), as an important effector arm of the adaptive immune response. Activation of complement can lead to virus destruction. It directly mediates lysis or phagocytosis of free virus and virus-infected cells.

Latent or persistent infections are part of the lifestyle of several viruses. This capacity to maintain a long-term relationship with its host means that viruses are able to produce proteins for circumventing antiviral defenses. For example, the major secreted protein of vaccinia virus, VCP, binds the C4b fragment of complement component C4. Kotwal et al., 1990, "Inhibition of the complement cascade by the major secretory protein of vaccinia virus", Science. 250:827-830; Isaacs, et al., 1992, PΝAS. 89:628-632.

Inhibition of both the classical and alternative complement pathways is mediated by the glycoprotein C-l of herpes simplex viruses. Glycoprotein

C-l binds the C3b fragment of complement component C3 and prevents both complement-mediated viral neutralization as well as cytolysis of virus-infected cells. McΝearney, et al., 1987, "Herpes simplex virus glycoproteins gC-1 and gC-2 bind to the third component of complement and provide protection against complement-mediated neutralization of viral infectivity", J. Exp.

Med.. 166:1525-1535. Herpes viruses have adopted an additional barrier to antibody-dependent complement-mediated destruction by encoding a pair of proteins, gE and gl, that bind the Fc region of IgG. The gE-gl membrane heterodimer not only prevents complement-mediated lysis of infected cells and enveloped virions, it may protect against Fc-facilitated phagocytosis as well.

Bell et al., 1990, "Induction of immunoglobin G Fc receptors by recombinant vaccinia viruses expressing glycoproteins E and I of Herpes Simplex virus type l", J. Virol.. 64:2181-2186.

These complement regulatory proteins provide the viruses which produce them with a selective protective advantage when placed in the hostile environment created by the host immune system. Characterization of these proteins provides information on the molecular basis for viral pathogenesis. With regard to the present invention, the proteins can serve as powerful biotherapeutics to treat immune disorders. With regard to treating viral diseases, antibodies against the proteins will disable the virus' protective mechanism thus allowing removal of the virus by the host's natural immune system. SUMMARY OF THE INVENTION

In view of the foregoing, it is an object of this invention to provide novel proteins which can be used in controlling the complement system of humans and other primates. It is a further object of the invention to provide

DNA sequences and associated genetic engineering constructs for producing such proteins. It is an additional object of the invention to provide antibodies against the novel proteins for use in diagnostic and other laboratory assays and as anti- viral biotherapeutics. To achieve the foregoing and other objects, the present invention provides DNA sequences encoding viral proteins having complement regulatory activity and pharmaceutical compositions comprising such viral proteins for regulating the complement arm of the immune system. The present invention also provides expression vector/host systems, purification processes, and formulation methods for preparing isolated recombinant viral proteins having complement regulatory activity to be used as therapeutic agents.

The viral proteins and their gene sequences are similar in structure and sequence to human complement regulatory proteins and are capable of inhibiting complement-mediated lysis of mammalian cells by human complement. Therefore, the viral proteins of the present invention can be used to regulate human complement attack on mammalian cells in a therapeutic manner.

The present invention specifically provides the proteins mCCPH and sCCPH, which are expression products of the number 04 a/b open reading frame of HVS, and the protein HVS-15, which is an expression product of the number 15 open reading frame of HVS.

The accompanying drawings, which are incorporated in and constitute part of the specification, illustrate the preferred embodiments of the invention, and together with the description, serve to explain the principles of the invention. It is to t understood, of course, that both the drawings and the description are explanatory only and are not restrictive of the invention. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows DNA and amino acid sequences for CCPH. Figure 2 shows a comparison of mCCPH and sCCPH with other complement regulatory proteins.

Figure 3 shows transcription of the CCPH gene.

Figure 4 shows detection of mCCPH and sCCPH protein by radioimmunoprecipitation with monoclonal antibody SE. Figure 5 shows DNA and amino acid sequences for HVS-15.

Figure 6 shows a comparison of the DNA and amino acid sequences of HVS-15 with human CD59.

Figure 7 shows detection of HVS-15 protein in mammalian cells by immunoprecipitation with anti-CD59 antibody followed by Western blot with either anti-CD59 antibody or anti-FLAG monoclonal antibody.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

As discussed above, the complement regulatory proteins of the present invention are mCCPH, sCCPH, and HVS-15 from the HVS genome. These proteins and the DNA sequences which code them have the following properties.

I. mCCPH and sCCPH mCCPH and sCCPH are produced by an ORF of Herpesvirus Saimiri which has the coding capacity for a polypeptide of 360 amino acids with seven potential N-linked glycosylation sites, a predicted signal peptide of 20 amino acids, and a transmembrane domain of 23 amino acids (positions 308-330) near the C-terminus. See Example 1 below. From amino acid 1 through 245, the polypeptide consists of four short consensus repeat units, (SCRs), with 33 to 37% amino acid identity between any pair of repeats. These SCRs share a typical pattern of cysteine, proline, tryptophan, and several hydrophobic residues. See Examples 1 and 2. A search in protein data bases has shown that mCCPH and sCCPH have substantial homology to known members of the complement regulatory protein family within the RCA that function by inhibiting C3 convertase. See Example 2. π. HVS-15 HVS-15 is produced by an ORF of Herpesvirus Saimiri which has the coding capacity for a 121 amino acid protein which by computer searching analysis shows substantial homology to the only known human inhibitor of the membrane attack complex, CD59. A nucleotide identity of 64% was found between the HVS-15 DNA sequence and the human CD59 reading frame, and a 48% identity exists between the corresponding protein sequences. The comparison of the amino acid sequences revealed a number of conserved structural features such as a conservation of N-linked glycosylation sites, a similar pattern of hydrophobic termini, a well conserved signal peptide, and an identical cysteine skeleton. See Examples 8 and 9. These structural features of human CD59 all contribute to its biological activity.

The primary amino acid structure of the viral proteins of the invention may be modified by creating amino acid mutants. Such mutants should retain at least some complement regulatory activity. Other modifications include forming derivatives of the viral protein to include covalent or aggregated conjugates of the protein or its fragments with other proteins or polypeptides, such as by synthesis of recombinant proteins with N-terminal or C-terminal fusions to the viral protein. For example, the conjugated peptide may be a signal (or leader) polypeptide sequence at the N-terminal region of the protein which co-translationally or post-translationally directs transfer of the protein from its site of synthesis to its site of function inside or outside of the cell membrane. For example, as discussed in Example 10 below, the prosequence of human CD59 may be added to the viral protein to aid in direct processing and secretion of the protein to the cell surface.

Other protein fusions can comprise peptides added to facilitate purification or identification of the viral proteins. For example, the FLAG octapeptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) fused by oligonucle- otide-primed PCR may be constructed and expressed. This peptide is highly antigenic and provides an epitope for easy identification of the viral protein. Also, the epitope binds reversibly to a commercially available monoclonal antibody enabling ready purification of the expressed viral protein. This sequence is also specifically cleaved by bovine mucosal enterokinase at the residue immediately following the Asp-Lys pairing. See Example 10 below.

The present invention also includes viral proteins with or without associated native pattern of glycosylation. For example, proteins expressed recombinantly in bacteria such as E. coli provides non-glycosylated molecules. The present invention provides recombinant expression vectors which include synthetic or cDNA-derived DNA fragments encoding viral complement regulatory proteins from Herpesvirus Saimiri. The nucleotide sequence coding for mCCPH, sCCPH, or HVS-15 can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. The necessary transcriptional and translational signals can also be supplied by the native viral genes and/or their flanking regions. A variety of host vector systems may be utilized to express the protein-coding sequence. These include, but are not limited to, mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, retroviruses, etc.); mammalian cell systems transfected with plasmids; insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA. Useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well-known cloning vector pBR322 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20852, United States of America; ATCC Accession No. 37017). These pBR322 "backbone sections" are combined with an appropriate promoter and the structural gene to be expressed. Promoters commonly used in recombinant microbial expression vectors include, but are not limited to, the lactose promoter system (Chang et al., Nature 275:615, 1978), the tryptophan (trp) promoter (Goeddel et al., Nucl. Acids Res. 8:4057, 1980) and the tac promoter, or a fusion between the tac and trp promoters referred to as the trc promoter (Maniatis, Molecular Cloning: A Laboratory Manual. Cold

Spring Harbor Laboratory, p 412, 1982). Preferred bacterial expression vectors include, but .are not limited to, vector pSE420 (Invitrogen Corporation). This vector harbors the trc promoter, the lacO operon, an anti-terminator sequence, the glO ribosome binding sequence, a translation terminator sequence, the laclq repressor, the ColEl origin of replication, and the ampicillin resistance gene.

Recombinant viral complement regulatory proteins may also be expressed in yeast hosts, preferably from the Sacchromyces species such as J Cerevisae. Yeast of other genera such as Pichea or Kluveromyces may also be employed. Yeast vectors will generally contain an origin of replication from the 2 μm yeast plasmid or an autonomously replicating sequence (ARS), a promoter, DNA encoding the viral protein, sequences for polyadenylation and transcription termination and a selectable marker gene. Preferably, yeast vectors will include an origin of replication and a selectable marker permitting transformation of both E. coli and yeast. Suitable promoter systems in yeast include the promoters for metallothionein, 3-phosphoglycerate kinase, or other glycolytic enzymes such as enolase, hexokinase, pyruvate kinase, glucokinase, the glucose-repressible alcohol dehydrogenase promoter (ADH2), the constitutive promoter from the alcohol dehydrogenase gene, ADCI, and others. Preferred yeast expression vectors can be assembled using DNA sequences from pBFJ22 for selection and replication in bacteria and yeast DNA sequences inJi. .ing the ADCI promoter and the alcohol dehydrogenase ADCI termination uence as found in vector pAAH5 (Ammerer, 1983, Methods Enzymol. -:192). The ADHI promoter is effective in yeast in that

ADHI mRNA is estimated to be 1 - 2% of total ρoly(A) RNA.

Various mammalian or insect cell culture systems can be employed to express recombinant viral complement regulatory protein. Baculovirus systems for production of heterologous proteins in insect cells are reviewed by Luckow and Summers, Bio/Technology 6:47 (1988). Examples of suitable mammalian host cell lines include the COS cell of monkey kidney origin, mouse L cells, murine C127 mammary epithelial cells, mouse Balb/3T3 cells, Chinese hamster ovary cells (CHO), HeLa, myeloma, and baby hamster kidney (BHK) ce^' s. Mammalian expression vectors may comprise non-transcribed elements such as origin of replication, a suitable promoter and enhancer linked to the viral gene to be expressed, and other 5' or 3' flanking sequences such as ribosome binding sites, a polyadenylation sequence, splice donor and acceptor sites, and transcriptional termination sequences.

The transcriptional and translational control sequences in mammalian expression vector systems to be used in transforming vertebrate cells may be provided by viral sources. For example, commonly used promoters and enhancers are derived from Polyoma virus, Adenovirus, Simian Virus 40 (SV40), and human cytomegalovirus immediate-early gene 1 promoter and enhancer (CMV). Particularly preferred eukaryotic vectors for the expression of mCCPH, sCCPH, and HVS-15 include pCMV4 (Andersen et al., 1989, J. Biol. Chem.. 264:8222-8224) and pcDNAI/Amp (Invitrogen Corporation) as described below in Examples 5, 6, and 10. The pCMN4 and pcDΝAI/Amp expression vectors both contain the human cytomegalovirus immediate-early gene I promoter and enhancer elements and the Simian Virus 40 (SV40) consensus intron donor and acceptor splice sequences and either the SV40 consensus polyadenylation signal (for pcDNAI/Amp) or the human growth hormone polyadenylation signal (for pCMV4). These vectors also contain an SV40 origin of replication which allows for episomal amplification in cells (e.g., COS cells) transformed with SV40 large T antigen, and an ampicillin resistance gene for propagation and selection in bacterial hosts.

Purified viral complement regulatory proteins are prepared by culturing suitable host/vector systems to express the recombinant translation products of the DNAs of the present invention, which are then purified from the culture media or cell extracts of the host system, e.g., the bacteria, insect cells, yeast, or mammalian cells. Fermentation of yeast which express viral protein as a secreted product greatly simplifies purification.

In general terms, the purification is performed using a suitable set of concentration and chromatography steps well known in the art. For recombinant viral proteins requiring correct disulfide bond formation for full biological activity, denaturation of the purified protein followed by chemical-mediated refolding under reducing conditions can be done to promote proper disulfide interaction.

Viral complement regulatory protein synthesized in recombinant culture and subsequently purified is characterized by the presence of non-viral cell components, including proteins, in amounts and of a character which depend on the purification process. These components will ordinarily be of yeast, prokaryotic or non-human eukaryotic origin and preferably are present in innocuous contaminant quantities, on the order of less than about 1 % by weight. Further, recombinant cell culture enables the production of viral complement regulatory protein free of other proteins which may normally be associated with the protein as it is found in nature.

According to the invention, purified viral complement regulatory proteins, or fragments or derivatives thereof, may be used as immunogens to generate monoclonal or polyclonal anti-viral protein .antibodies which can then be used in vivo as anti-viral therapeutics or in vitro in diagnostic assays or other laboratory techniques. In the case of therapeutics, monoclonal antibodies are used, and these antibodies can be blocking antibodies that either inhibit the life cycle of the virus in infected primates or make the virus more susceptible to lysis by complement. The antibodies may be human monoclonal antibodies or chimeric human-mouse (or other species) monoclonal antibodies. Human monoclonal antibodies may be made by any of numerous techniques known in the art (e.g., Teng et al. 1983, Proc. Natl. Acad. Sci. U.S.A. 80:7308; Kozbor et al., 1983, Immunology Today 4:72; Olsson et al., 1982, Meth. Enzymol. 92:3). Chimeric antibody molecules may be prepared containing a mouse antigen-binding domain with human constant regions (Morrison et al. ,

1984, Proc. Natl. Acad. Sci. U.S.A. 81:6851; Takeda et al., 1985 Nature 314:452).

In the case of diagnostic assays, monoclonal or polyclonal antibodies can be used to determine whether an animal is infected with the HVS virus. The antibodies can also be used in laboratory assays to determine if other viruses in addition to HVS express the complement regulatory proteins of the invention or similar proteins. If desired, the CCPH and HVS-15 gene sequences can also be used diagnostically for these applications by, for example, PCR techniques. For preparation of monoclonal antibodies directed toward viral complement regulatory proteins, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495), as well as other techniques (Kozbor et al., 1983, Immunology Today 4:72; Cole et al., 1985 in Monoclonal

Antibodies and Cancer Therapy. Alan Liss, Inc. pp. 77-96) and the like are within the scope of the present invention.

Various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of the viral complement regulatory proteins. For production of antibody, various host animals can be immunized by injection of preferably purified viral complement regulatory proteins, or fragments or derivatives thereof, including but not limited to mice, rats, rabbits, etc. Various adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyananins, and potentially useful human adjuvants such as BCG (Bacille Calmette-Guerin).

To further improve the likelihood of producing an anti-viral protein response, the amino acid sequences of the viral complement regulatory proteins may be analyzed in order to identify portions of the molecule which may be associated with increased immunogenicity. For example, the amino acid sequence may be subjected to computer analysis to identify surface epitopes according to the method of Hopp and Woods (1981, Proc. Natl. Acad. Sci. U.S.A.. 78:3828) which has been successfully used to identify antigenic peptides of Hepatitis B virus surface antigen. The fragments so identified can be used as antigens/haptens for producing the antigenic response.

Antibody molecules may be purified by known techniques including immunoabsorption, immunoaffinity chromatography, HPLC, or a combination thereof.

The viral complement regulatory proteins of the invention can be used in therapeutic compositions to treat a variety of diseases involving the complement immune response (see above). For these applications, purified viral complement regulatory protein can be administered to a patient, e.g., a human, in a variety of ways. Thus, for example, viral complement regulatory proteins can be given by bolus injection, continuous infusion, sustained release from implants, or other suitable techniques.

Typically, a therapeutic agent will be administered in the form of a composition comprising purified viral complement regulatory protein in conjunction with physiologically acceptable carriers or diluents. Such carriers will be nontoxic to recipients at the dosages and concentrations employed. Ordinarily, the preparation of such compositions entails combining the viral complement regulatory protein with buffers, antioxidants such as ascorbic acid, low molecular weight polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione, detergents such as SDS, NP-40, or LDAO, and other stabilizers and excipients. Neutral buffered saline or saline mixed with serum albumin are exemplary appropriate diluents. Preferably, the product is formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose) as diluents. The amount and frequency of administration will depend, of course, on such factors as the nature and severity of the indication being treated, the desired response, the condition of the patient, and so forth.

Without intending to limit it in any manner, the present invention will be more fully described by the following examples.

Example 1 mCCPH and sCCPH DNA Sequences

This example describes the identification of the DNA and amino acid sequences for mCCPH and sCCPH.

Figure 1 shows the nucleotide sequence of the gene encoding both the mCCPH and sCCPH proteins of Herpesvirus Saimiri. The nucleotide positions refer to the EMBL Accession Number X60283 (CCPH). The poly(dA) signals, and synthetic oligonucleotides used for PCR-based cDNA amplification of the HVS strain 11 ORF 04 are underlined. Two PCR amplification products were obtained which corresponded to the membrane form of CCPH (mCCPH) and the secreted form of CCPH (sCCPH) which is a product generated by alternative splicing of the CCPH ORF mRNA. The alternative splicing reaction removes the region of CCPH corresponding to the transmembrane domain which is indicated in Figure 1.

The nucleotide sequences of mCCPH and sCCPH were generated by first subcloning the PCR products into the commercially available plasmid pKS- (from Stratagene, San Diego, California) to yield plasmid pKS-/mCCPH

(ATCC accession number 69178) and pKSJsCCPH (ATCC Accession number 69179). These plasmids have been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20852, United States of America, in E. coli strain DH5α and have been assigned the above accession numbers. These deposits were made under the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the

Purposes of Patent Procedure (1977).

In addition to showing the coding sequences for mCCPH and sCCPH, Figure 1 also shows splice donor and splice acceptor sites which are marked by angle brackets. The order of the amino acids, in one letter code, was deduced from the nucleotide sequence. The short consensus repeats are flanked by single angle brackets; predicted N-linked glycosylation sites (Asn X Ser/Thr) and conserved cysteine residues within the repeating units are underlined. The signal peptide and transmembrane domain are shown as indicated, and the carboxyl terminus of secreted CCPH (sCCPH) is marked. The sequence information of Figure 1 is repeated in SEQ. 1 and SEQ.

2. The entire open reading frame from which the DNA sequences are derived is set forth in SEQ. 1. The mCCPH DNA sequence comprises nucleotides 427 through 1446 of SEQ. 1, and the amino acid sequence of the mCCPH protein comprises amino acids 1 through 340 in SEQ. 1. The sCCPH DNA sequence and corresponding amino acid sequence is set forth in SEQ. 2 where the DNA sequence comprises nucleotides 427 through 1272 and the amino acid sequence comprises amino acids 1 through 282. It is to be understood of course that the DNA sequences of SEQ. 1 and SEQ. 2 can be changed based on third nucleotide degeneracy within a single codon without changing the amino acid sequence. Accordingly, as used in the claims hereof, the references to the DNA sequences of SEQ. 1 and SEQ. 2 are to be interpreted as including variations of the sequences shown based on such degeneracy which do not change the resulting amino acid sequence. Example 2 Comparison of mCCPH and sCCPH With Other Complement Regulatory Proteins This example demonstrates that the amino acid sequences for mCCPH and sCCPH include short consensus repeats which share a high degree of homology with the short consensus repeats of the human complement regulatory proteins DAF, MCP, and C4bp, as well as with the short consensus repeats of the major secretory complement regulatory protein of vaccinia virus (Wsp35). The results of this comparison are shown in Figures 2A and 2B where in Figure 2A, the mCCPH and sCCPH proteins of HVS and the comparison proteins have been divided in their structural domains with the signal peptide shown by a filled circle, the short consensus repeats identified as "SCR" segments, the Ser/Thr-rich region shown by an open square, the transmembrane domain by a filled square, and the carboxyl-terminal tail by an open circle. The length of each SCR block and the percent identity between the CCPH protein and the comparison protein are shown for each SCR segment. As can be seen, the percent identities are as high as 52.7%

Figure 2B shows alignment of the best matching SCRs and a common consensus sequence determined when four of five sequences matched. Gaps imposed to maximize alignment are indicated by periods, and consensus residues are indicated by capital letters.

Example 3 HVS Produces mRNA from the CCPH gene This example demonstrates that HVS transcribes the CCPH gene to produce mRNA, i.e., that the ORF for this gene is transcribed in HVS-infected cells.

Figure 3A shows a Northern blot of total RNA prepared from

HVS-infected owl monkey kidney cells. The Northern blot was hybridized with a randomly labeled cDNA probe corresponding to the CCPH gene region. Lane 1 represents RNA from mock-infected cells while lane 2 corresponds to RNA from HVS-infected cells. Two major transcripts were detected at 1.5 and 1.7 kbp corresponding to sCCPH and mCCPH, respectively. Minor bands detected at 2.0 and 5.2 kbp correspond to ribosomal RNA. The identity of the 1.5 and 1.7 kbp mRNAs was confirmed by taking total RNA from mock-infected cells and infected owl monkey kidney cells and using that mRNA to synthesize cDNA using oligo(dT) as a primer. Second strand synthesis was done with a synthetic oligonucleotide (positions 362 to 386 in Figure 1) and [alρha-³²P]dATP and T7 DNA polymerase. The results are shown in Figure 3B where the synthetic DNA from mock-infected cells is in lane 1 and that from infected owl monkey kidney cells in lane 2. As can be seen in this figure, two mRNAs of 1.5 and 1.7 kbp were detected in the infected cells but not in the mock-infected cells.

Example 4 HVS Expresses mCCPH and sCCPH

This example demonstrates that the ORF for the CCPH gene is translated in HVS-infected cells.

Figure 4A and 4B demonstrate synthesis of the mCCPH and sCCPH proteins in mammalian cells as followed by radioimmunoprecipitation with monoclonal antibody SE. See Randall et al., 1984, J. Virol.. 52:872-883.

Owl monkey kidney cells were labeled with f Sjcysteine for 15 hours at 48 to 60 hours post-infection. Cells were infected with HVS stain 11. Virion particles were purified by centrifugation through sucrose gradients. Glycoproteins were purified by running the cell extracts through phosphate-buffer-equilibrated concanavalin A-Sepharose columns to specifically bind glycosylated proteins which were cleared with elution buffer (50 mM Tris [pH8], 1 mM MgCl₂, 1 mM CaCl₂, 150 mM methyl-alpha-D-mannopyranoside, 250 mM methyl-alpha-D glucopyranoside, 1 % Triton X-100, 1 % sodium deoxycholate, 0.1 % sodium dodecyl sulfate [SDS], 2 mM PMSF, 5 mM EDTA) for 2 hours. Proteins were precipitated with mouse monoclonal antibody SE, and complexes were bound to protein A-Sepharose, extensively washed with cell lysis buffer (50 mM Iris [pH8], 150 mM NaCl, 0.1 % SDS, 100 μg of PMSF/ml, 1 % Triton X-100, 0.5% sodium deoxycholate), boiled and electrophoresed on 10 to 12% SDS polyacrylamide gels. Figure 4A shows the following: Lane 1, glycoproteins precipitated from cell culture supernatants of uninfected owl monkey kidney cells; Lane 2, glycoproteins precipitated from the cell culture supernatants of cells infected with HVS strain 11; Lane 3, purified virion particles; and Lane M, relative molecular mass markers. As can be seen in this figure, sCCPH protein with a molecular weight of between 45 to 52 kD is expressed in the supernatant from infected cells (Lane 2) and mCCPH protein with a molecular weight of 65 to 75 kD is expressed on the surface of virion particles (Lane 3).

Figure 4B shows the following: Lane 1 , proteins precipitated from total cell extracts of mock-infected owl monkey kidney cells; Lane 2, proteins precipitated from cell extracts prepared from HVS-infected cells; Lane 3, glycoproteins purified by Con A chromatography from cell extracts of mock-infected cells; Lane 4, as in Lane 3 but from HVS-infected cells. Two predominant proteins are identified migrating at molecular weights of approximately 65 kD (mCCPH) and 45 kD (sCCPH).

Example 5 Expression of sCCPH This example demonstrates the expression of sCCPH by COS-7 cells transiently transfected with the sCCPH portion of the CCPH gene. The sCCPH gene was first subcloned into expression vector pCMV-4 to yield pCMV-sCCPH. This expression construct was transfected into owl monkey kidney cells by the calcium phosphate precipitation method. 48 hours after transfection, cells were metabolically labeled for 15 hours with f Sjcysteine. Proteins secreted into the growth media were purified by Con A chromatography, immunoprecipitated, and resolved by SDS polyacrylamide gel electrophoresis as described in Example 4 above. The results of these experiments are shown in Figure 4A as follows: Lane 4, supernatants of COS-7 cells transfected with pCMN-sCCPH; Lane 5, supernatants of COS-7 cells transfected with vector pCMN-4 one. Lane M shows relative molecular mass markers. As can be seen in lane 4, secreted CCPH migrates with a molecular mass of approximately 45 kD.

Example 6 Preparation of an Expression Vector Containing mCCPH This example describes the preparation of a mammalian expression vector containing the mCCPH DΝA sequence. The nucleotide sequence encoding the full length complement regulatory protein mCCPH was excised by restriction enzyme digest from plasmid pKS-/mCCPH using restriction enzymes EcoRI and ΝotI and then subcloned by ligation into the EcoRI/ΝotI sites of the commercially available mammalian expression vector pcDΝAI/AMP to yield the mammalian expression vector pC8/mCCPH.

Example 7 Purification of mCCPH and sCCPH mCCPH protein is purified from mammalian cells, insect cells, yeast, and/or bacteria as follows. Cells expressing mCCPH are lysed in hypotonic media (for mammalian or insect cells) or are disrupted by glass beads (for yeast) or sonication (for bacteria). Cell lysates are concentrated using a Millipore Pellicon concentration system. Membrane proteins are extracted from concentrated cell lysates with butanol and the glycoprotein component of the membrane fraction is isolated by concanavalin A chromatography. Isolated membrane glycoproteins are first subjected to DEAE anion exchange chromatography in the presence of between 0.1 to 0.5% ΝP40. mCCPH-containing DEAE fractions are pooled and then subjected to QMA-silica chromatography. mCCPH-containing fractions are again pooled and finally subjected to MonoQ column chromatography to achieve the final purified mCCPH product. Purified sCCPH is obtained in the same manner except that the starting material for protein purification is the cell culture media.

Example 8 HVS-15 DNA Sequence This example describes the identification of the DNA and amino acid sequences for HVS-15.

Figure 5 shows the nucleotide sequence of the gene encoding the HVS-15 protein of Herpesvirus Saimiri. The nucleotide sequence of HVS-15 was generated by PCR amplification of the HVS- 15 open reading frame. Two Hindm fragments of 218 and 815 bp, respectively are shown in Figure 5. The

5' region of HNS-15 bears a 38-bp dyad symmetry, the 3' region has a polyadenylation signal as indicated. The predicted leader peptide of 19 amino acids is flanked by arrowheads as is the mature peptide. The consensus for Ν-linked glycosylation is underlined and a possible site for GPI-anchoring at amino acid position 89 is marked by a double arrowhead.

The nucleotide sequence of HNS-15 was generated by first subcloning PCR products into the commercially available plasmid pKS- (from Stratagene, San Diego, California) to yield plasmid pKS-/HVS-15 (ATCC accession number 69177). This plasmid has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20852,

United States of America, in E. coli strain DH5α and has been assigned the above accession number. This deposit was made under the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure (1977). The sequence information of Figure 5 is repeated in SEQ. 3. The

HVS-15 DΝA sequence comprises nucleotides 329 through 634 of SEQ. 3 and the amino acid sequence of the HVS- 15 protein comprises amino acids 1 through 102 of SEQ. 3. It is to be understood of course that the DΝA sequence of SEQ. 3 can be changed based on third nucleotide degeneracy within a single codon without changing the amino acid sequence.

Accordingly, as used in the claims hereof, the references to the DΝA sequence of SEQ. 3 are to be interpreted as including variations of the sequence shown based on such degeneracy which do not change the resulting amino acid sequence.

Example 9 Comparison of HVS- 15 with Human CD59

This example demonstrates that the DNA sequence for HVS-15 shares substantial homology with the cDNA sequence for human CD59.

Figure 6 identifies amino acid homology between HVS-15 and human

CD59. Vertical lines indicate nucleotide sequence identity. The nucleotide positions refer to the EMBL Accession Numbers X64293 (HVS-15, upper row) and XI 6447 (human CD59, lower row). The putative signal peptide cleavage site is shown as a small arrow, possibly glycosylated asparagine residues are circled, conserved cysteines are marked by solid triangles and the proposed carboxy termini by a solid circle. Identical amino acids and conservative substitutions are boxed. The nucleotide sequence identity is 64% and the amino acid sequence identity is 48% (62% similarity allowing for conservative replacements). The alignments were generated using the GAP option of the GCG program package with the parameters for gap weight set to

5.0 and 0.3, respectively. Example 10

Expression of HVS- 15 This example demonstrates the expression of HVS-15 by cells transfected with the HVS-15 gene.

I. Generation of mammalian expression vector for expression of HVS-15 tagged with the FLAG epitope and processed using the pro sequence of human CD59

Expression construct pC8/hCD59pro/5'FLAG/HVS-15 (ATCC

Accession Number 69180) was constructed with the human CD59 leader sequence 5' flanked by sequence coding for the FLAG M2 epitope (International Biotechnologies, Inc., IBI) followed by sequence coding for the mature viral protein. This plasmid has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20852, United States of America, in E. coli strain DH5α and has been assigned the above accession number. This deposit was made under the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure (1977).

Initially, pHNS-15 in pBluescript π KS- (pKS-/HNS-15) was PCR amplified using a 5' FLAG primer and a 3' primer containing homology with the T7 promoter contained in pBluescript II KS-. The 5' FLAG oligonucleotide (5' GCCGGCCTGCAGGACTACAAAGACG- ATGACGATAAACTGCAATGCTACAACTGTCCTAACCC 3') contained 24 nucleotides coding for the 8 amino acid FLAG epitope (indicated by underlining) followed by 26 nucleotides homologous to pHVS-15 downstream of the leader sequence (shown in bold). A PstI site was included for subcloning and to conserve the native Ser/Leu clipping site for correct processing of the leader peptide. A PCR product of approximately 475 bp was cloned directly into pCRTMH using TA CLONING following the manufacturer's standard protocol (Invitrogen Corporation, San Diego, California). The sequence of the pCRTMH clone was verified and a Pstl/EcoRl fragment was subcloned into pcDNAI/AMP BamHl /EcoRI in a three-way ligation including the human CD59 prosequence BamHl/Pstl which had been sequenced previously, i.e., the sequence: ATG GGA ATC CAA GGA GGG TCT GTC CTG TTC GGG CTG CTG CTC GTC CTG GCT GTC TTC TGC CAT TCA GGT CAT AGC. See EPO Patent Publication No. 351,313. π. Transfection of mammalian cells with chimeric HVS- 15 expression vector.

Transient transfections were performed on murine MOP 8 cells (ATCC Accession Number CRL 1709) using the TRANSFECTAM method as described in the manufacturer's protocol (Promega, Madison, Wisconsin). The plating density was 2.5 x 10 cells per well in 6 well plates and transfections were done the next day using 37.5 μg of TRANSFECTAM and 5 μg of pC8/hCD59pro/5'FLAG/HVS-15. 48 hours following transfection, the 1.5 ml of medium were removed, cells were rinsed and 0.5 ml of RIPA lysis buffer (PBS with 1 % NP-40, 0.1 % SDS, 0.5% deoxycholate, ImM PMSF and 0.14 U/ml aprotinin) were added to harvest the cells. Media and lysates were incubated with anti-FLAG M2 antibody (TBI, New Haven, Connecticut) at a final concentration of 10 μg/ml overnight at 4°C with rotation. 50 μl of anti-mouse IgG-agarose (Sigma) were added and incubation at 4°C allowed for 1 hour with rotation. Immunoprecipitations were spun briefly in a microcentrifuge and pellets were rinsed 2x with TBS before resuspending in 50 μl of non-denaturing loading dye. Samples were heated at 95 °C for 5 minutes, spun briefly and 25 μl of each were loaded onto a 17-27% gradient gel. Proteins were electophoretically transferred to nitrocellulose using standard procedures. The membrane was blocked with TBS containing 5% BSA for 1 hour. After washing with TBS containing 0.5 % Tween-20 (TBST), the membrane was incubated in TBS with 1 % BSA and 10 μg/ml of primary antibody (either anti-CD59 polyclonal serum or anti-FLAG M2 monoclonal antibody/IBI) for 1 hour. The immunoblot was again washed 3x with TBST before incubating for 1 hour with TBS containing 1 % BSA and alkaline phosphatase (AP) conjugated antibody at a 1:5000 dilution (AP goat anti-mouse IgG or AP goat anti-rabbit IgG, depending on the primary antibody used). Finally, the immunoblot was washed 3x in TBST and developed with the NBT/BCIP kit as described (Promega).

HI. Identification of HVS-15 protein in mammalian cells by immunoprecipitation and Western blot. The HVS-15 protein was identified by means of a Western blot. The results are shown in Figure 7. Panel A was reacted with anti-CD59 polyclonal antibody while panel B was reacted with anti-FLAG monoclonal antibody. CD59 immunoprecipitated from human RBCs is shown as a control (C) in panel A. Lanes 1 and 2 represent the media and lysates respectively from immunoprecipitations of MOP 8 transfections using human CD59 in the same expression vector (pCDNAI/AMP from Invitrogen). Lanes 3 and 4 show the media and lysates respectively from immunoprecipitations of pC8/hCD59pro/5'FLAG/HVS-15 transfected MOP 8 cells. Protein size in kilodaltons is indicated to the left of the figure.

As can be seen in this Figure, the HVS-15 protein migrates with the same molecular mass as human CD59 (compare lanes 2 and 4 of panel A) and can be detected with an anti-FLAG monoclonal antibody (compare lanes 2 and

4 of panel B).

Example 11 Purification of HVS-15 HVS-15 protein is purified from mammalian cells, insect cells, yeast, and/or bacteria as follows. Cells expressing HVS-15 are lysed in hypotonic media (for mammalian or insect cells) or are disrupted by glass beads (for yeast) or sonication (for bacteria). Cell lysates are concentrated using a

Millipore Pellicon concentration system. Membrane proteins are extracted from concentrated cell lysates with butanol and the glycoprotein component of the membrane fraction is isolated by concanavalin A chromatography.

Isolated membrane glycoproteins are first subjected to DEAE anion exchange chromatography in the presence of between 0.1 to 0.5 % NP40.

HVS-15-containing DEAE fractions are pooled and then subjected to QMA-silica chromatography. HVS-15-containing fractions are again pooled and finally subjected to MonoQ column chromatography to achieve the final purified HVS-15 product.

Although preferred and other embodiments of the invention have been described herein, other embodiments may be perceived by those skilled in the art without departing from the scope of the invention as defined by the following claims. SEOUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Flec enstein, Bernhard

Albrecht, Jens-Christian

(ii) TITLE OF INVENTION: Complement Regulatory Proteins of Herpesvirus Saimiri

(iii) NUMBER OF SEQUENCES: 3

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Maurice M. Klee

(B) STREET: 1951 Burr Street

(C) CITY: Fairfield

(D) STATE: Connecticut

(E) COUNTRY: USA

(F) ZIP: 06430

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 inch, 760 Kb storage

(B) COMPUTER: DELL 486/50

(C) OPERATING SYSTEM: DOS 5.0

(D) SOFTWARE: Displaywrite 5 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

SUBSTITUTE SHEET (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Klee, Maurice M.

(B) REGISTRATION NUMBER: 30,399

(C) REFERENCE/DOCKET NUMBER: ALX-107PCT (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (203) 255 1400

(B) TELEFAX: (203) 254 1101

SUBSTITUTE SHEET (2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1980 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS : Double stranded

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: Genomic DNA cDNA to mRNA

(A) DESCRIPTION: Herpesvirus saimiri mCCPH gene

(iii) HYPOTHETICAL: No

( iv) AJNTTI - SENSE : No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Herpesvirus saimiri

(B) STRAIN: #11 (viii) POSITION IN GENOME:

(A) CHROMOSOME/SEGMENT: L-DNA

(B) MAP POSITION: 10546-12525

(C) UNITS: Nucleotide number (x) PUBLICATION INFORMATION:

(A) AUTHORS: Albrecht, Jens-Christian

Fleckenstein, Bernhard

(B) TITLE: New Member of the Multigene Family of Complement Control Proteins in Herpesvirus Saimiri

(C) JOURNAL: Journal of Virology

(D) VOLUME: 66

(E) ISSUE: 6

(F) PAGES: 3937-3940

(G) DATE: June 1992

SUBSTITUTE SHEET (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AAGCTTTGTC TTTTAATTCT GTAAGTTTAC TTAGGTAATT TAATAACAAA 50

TAAACTTATA AACATATTTT AAGCTTTACT GGTATTGTTG TTTATAACCT 100

TTTTGTTTTA TACATAAAAG TTTAAGTAAG ATACTTATTT TCTAGTAGCT 150

AGTACGTTGC TTGCTCATTT TTCTAATAGT GTTTATTCTA AAACTTATAT 200

AATTTAAATA TAATTTGCAG TAACAGTTTA AAATGTTAAA CTTTTGTTAT 250

TTTTAATATG ATATATGTTA ACAGCTATAG TTGCATTTTA TATTTGTGTT 300

TTTATTAATT TAAGAAGGAT TAGTAAAATA TATTTAACTT TCTGAGAAGA 350

AATTATACAG TTAGCC ATG TAC ACT TTA CAC TAC 384

Met Tyr Thr Leu His Tyr -20 -15

ATT TGT CTT GTT TTG TCA TGT GTA ATT TAT TTT GTA TGG ACT TTA AGC 432 lie Cys Leu Val Leu Ser Cys Val lie Tyr Phe Val Trp Thr Leu Ser -10 -5 +1

TGT CCT ACA CGT AAC CAG TAT GTT TCT GTC AAA TAT GTG AAT CTA ACT 480 Cys Pro Thr Arg Asn Gin Tyr Val Ser Val Lys Tyr Val Asn Leu Thr 5 10 15

AAC TAT TCA GGC CCG TAT CCA AAC GGG ACA ACG CTA CAC GTG ACA TGC 528 Asn Tyr Ser Gly Pro Tyr Pro Asn Gly Thr Thr Leu His Val Thr Cys 20 25 30

CGT GAA GGA TAT GCA AAA AGA CCA GTA CAA ACT GTT ACA TGC GTC AAT 576 Arg Glu Gly Tyr Ala Lys Arg Pro Val Gin Thr Val Thr Cys Val Asn 35 40 45 50

GGT AAC TGG ACT GTA CCT AAA AAG TGT CAG AAA AAG AAA TGT TCT ACA 624 Gly Asn Trp Thr Val Pro Lys Lys Cys Gin Lys Lys Lys Cys Ser Thr

55 60 65

CCG CAA GAT CTT TTA AAT GGA AGA TAT ACT GTA ACT GGT AAT TTA TAT 672 Pro Gin Asp Leu Leu Asn Gly Arg Tyr Thr Val Thr Gly Asn Leu Tyr 70 75 80

TAC GGT TCA GTT ATC ACT TAT ACT TGT AAT TCA GGC TAC AGC TTA ATT 72 Tyr Gly Ser Val lie Thr Tyr Thr Cys Asn Ser Gly Tyr Ser Leu lie 85 90 95

GGA AGC ACA ACA TCA GCT TGT TTA CTT AAA CGA GGT GGT CGT GTT GAC 76 Gly Ser Thr Thr Ser Ala Cys Leu Leu Lys Arg Gly Gly Arg Val Asp 100 105 110

SUBSTITUTE SHEET TGG ACT CCA CGA CCT CCA ATT TGT GAC ATT AAA AAA TGT AAA CCT CCT 816 Trp Thr Pro Arg Pro Pro He Cys Asp He Lys Lys Cys Lys Pro Pro 115 120 125 130

CCA CAA ATA GCT AAT GGG ACT CAC ACT AAT GTC AAA GAT TTC TAT ACT 864 Pro Gin He Ala Asn Gly Thr His Thr Asn Val Lys Asp Phe Tyr Thr 135 140 145

TAT TTA GAT ACA GTT ACG TAC TCA TGC AAT GAC GAA ACA AAG TTA ACT 912 Tyr Leu Asp Thr Val Thr Tyr Ser Cys Asn Asp Glu Thr Lys Leu Thr 150 • 155 160

TTA ACA GGC CCT TCA TCG AAA CTT TGT TCA GAA ACT GGC TCA TGG GTA 960 Leu Thr Gly Pro Ser Ser Lys Leu Cys Ser Glu Thr Gly Ser Trp Val 165 170 175

CCT AAT GGA GAA ACT AAG TGT GAA TTT ATA TTT TGT AAA CTA CCT CAA 1008 Pro Asn Gly Glu Thr Lys Cys Glu Phe He Phe Cys Lys Leu Pro Gin 180 185 190

GTT GCG AAT GCG TAC GTT GAA GTT AGA AAG TCA GCT ACG AGC ATG CAA 1056 Val Ala Asn Ala Tyr Val Glu Val Arg Lys Ser Ala Thr Ser Met Gin 195 200 205 210

TAT TTG CAT ATA AAT GTT AAA TGT TAT AAA GGA TTT ATG CTA TAT GGA 1104 Tyr Leu His He Asn Val Lys Cys Tyr Lys Gly Phe Met Leu Tyr Gly 215 220 225

GAA ACT CCT AAT ACG TGT AAC CAT GGA GTA TGG TCT CCA GCT ATT CCT 1152 Glu Thr Pro Asn Thr Cys Asn His Gly Val Trp Ser Pro Ala He Pro 230 235 240

GAA TGT ATG AAG ATA TCT TCT CCA AAA GGA GAC ATG CCT GGC ATA AAC 1200 Glu Cys Met Lys He Ser Ser Pro Lys Gly Asp Met Pro Gly He Asn 245 250 255

TCA AAT GAA GAT AAT TCT ACA CCT TCA GGT AGG ATA TGC AAT GGA AAT 1248 Ser Asn Glu Asp Asn Ser Thr Pro Ser Gly Arg He Cys Asn Gly Asn 260 265 270

TGT ACA ACT AGC ATG CCC ACT CAA ACA TAT ACA ATA ATT ACT GCG CGC 1296 Cys Thr Thr Ser Met Pro Thr Gin Thr Tyr Thr He He Thr Ala Arg 275 280 285 290

TAT ACA AGT CAC ATA TAT TTC CCT ACT GGG AAA ACC TAT AAA CTT CCT 1344 Tyr Thr Ser His He Tyr Phe Pro Thr Gly Lys Thr Tyr Lys Leu Pro 295 300 305

CGG GGA GTT CTA GTA ATT ATT CTT ACC ACA AGC TTT ATT ATT ATT GGA 1392 Arg Gly Val Leu Val He He Leu Thr Thr Ser Phe He He He Gly 310 315 320

ATA ATA CTT ACT GGA GTG TGT TTA CAC AGG TGC AGA GTG TGC ATG TCC 1440 He He Leu Thr Gly Val Cys Leu His Arg Cys Arg Val Cys Met Ser 325 330 335

SUBSTITUTE SHEET GGG CAG TAACTACCCA ATTTCTTCAT AAATATGAGA ATCTCCGTTA CAAGTTCTTA 1496 Gly Gin 340

ACTGGCCATA ATCCACACGA GAAGCATCTA AACGAGTATA CGCTCCGCAT 1546

CCATCATCAT ACATATCATC TTCTGGATAG CAAACATCAT CATATATAGA 1596

GTCATTTAAA CTAGTTGTAT TTCTATTACA TTCTTCTGAA AGTGGTTGAA 1646

TTTCTTCATA AACTGGGTCA TTAGAATAAT TGTTTTCTTC TGCTTGTAAT 1696

AGCTTGTGTT TTGCCTTCAA GTGAAATAAA AAAATTTCAG TCATAATTTT 1746

TAAAAAAATA TAGAAGTTTC AGTAAATTGT TGTACTTACC AAACAAGCAC 1796

CCATTATTAG TCTTGGTAGC AGCTAGAATA AATCACTTTA AGTTTAAAAG 1846

TTTAAAAATT TCCTGTCAAT GTGGTTTGCT TGGAACAAGG TGTCTACTTA 1896

GGATGTGAGT CATTTACTCT TTGAAGTTCA AAAAAAATAA CATAGTTAAA 1946

AGCTAAGCCC ATTTTCAGTG ATATTTAAAA GCTT 1980

SUBSTITUTE SHEET (3) INFORMATION FOR SEQ ID NO:2 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1787 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS : Double stranded

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: Genomic DNA cDNA to mRNA

(A) DESCRIPTION: Herpesvirus saimiri sCCPH gene

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Herpesvirus saimiri

(B) STRAIN: #11 (viii) POSITION IN GENOME:

(A) CHROMOSOME/SEGMENT: L-DNA

(B) MAP POSITION: 10546-11773, 11966-12525

(C) UNITS: Nucleotide number (x) PUBLICATION INFORMATION:

(A) AUTHORS: Albrecht, Jens-Christian

Flec enstein, Bernhard

(B) TITLE: New Member of the Multigene Family of Complement Control Proteins in Herpesvirus Saimiri

(C) JOURNAL: Journal of Virology

(D) VOLUME: 66

(E) ISSUE: 6

(F) PAGES: 3937-3940

(G) DATE: June 1992

SUBSTITUTE SHEET (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

AAGCTTTGTC TTTTAATTCT GTAAGTTTAC TTAGGTAATT TAATAACAAA 50

TAAACTTATA AACATATTTT AAGCTTTACT GGTATTGTTG TTTATAACCT 100

TTTTGTTTTA TACATAAAAG TTTAAGTAAG ATACTTATTT TCTAGTAGCT 150

AGTACGTTGC TTGCTCATTT TTCTAATAGT GTTTATTCTA AAACTTATAT 200

AATTTAAATA TAATTTGCAG TAACAGTTTA AAATGTTAAA CTTTTGTTAT 250

TTTTAATATG ATATATGTTA ACAGCTATAG TTGCATTTTA TATTTGTGTT 300

TTTATTAATT TAAGAAGGAT TAGTAAAATA TATTTAACTT TCTGAGAAGA 350

AATTATACAG TTAGCC ATG TAC ACT TTA CAC TAC 384

Met Tyr Thr Leu His Tyr -20 -15

ATT TGT CTT GTT TTG TCA TGT GTA ATT TAT TTT GTA TGG ACT TTA AGC 432 He Cys Leu Val Leu Ser Cys Val He Tyr Phe Val Trp Thr Leu Ser -10 -5 +1

TGT CCT ACA CGT AAC CAG TAT GTT TCT GTC AAA TAT GTG AAT CTA ACT 480 Cys Pro Thr Arg Asn Gin Tyr Val Ser Val Lys Tyr Val Asn Leu Thr 5 10 15

AAC TAT TCA GGC CCG TAT CCA AAC GGG ACA ACG CTA CAC GTG ACA TGC 528 Asn Tyr Ser Gly Pro Tyr Pro Asn Gly Thr Thr Leu His Val Thr Cys 20 25 30

CGT GAA GGA TAT GCA AAA AGA CCA GTA CAA ACT GTT ACA TGC GTC AAT 576 Arg Glu Gly Tyr Ala Lys Arg Pro Val Gin Thr Val Thr Cys Val Asn 35 40 45 50

GGT AAC TGG ACT GTA CCT AAA AAG TGT CAG AAA AAG AAA TGT TCT ACA 624 Gly Asn Trp Thr Val Pro Lys Lys Cys Gin Lys Lys Lys Cys Ser Thr

55 60 65

CCG CAA GAT CTT TTA AAT GGA AGA TAT ACT GTA ACT GGT AAT TTA TAT 672 Pro Gin Asp Leu Leu Asn Gly Arg Tyr Thr Val Thr Gly Asn Leu Tyr 70 75 80

TAC GGT TCA GTT ATC ACT TAT ACT TGT AAT TCA GGC TAC AGC TTA ATT 720 Tyr Gly Ser Val He Thr Tyr Thr Cys Asn Ser Gly Tyr Ser Leu He 85 90 95

GGA AGC ACA ACA TCA GCT TGT TTA CTT AAA CGA GGT GGT CGT GTT GAC 768 Gly Ser Thr Thr Ser Ala Cys Leu Leu Lys Arg Gly Gly Arg Val Asp 100 105 110

SUBSTITUTE SHEET TGG ACT CCA CGA CCT CCA ATT TGT GAC ATT AAA AAA TGT AAA CCT CCT 816 Trp Thr Pro Arg Pro Pro He Cys Asp He Lys Lys Cys Lys Pro Pro 115 120 125 130

CCA CAA ATA GCT AAT GGG ACT CAC ACT AAT GTC AAA GAT TTC TAT ACT 864 Pro Gin He Ala Asn Gly Thr His Thr Asn Val Lys Asp Phe Tyr Thr 135 140 145

TAT TTA GAT ACA GTT ACG TAC TCA TGC AAT GAC GAA ACA AAG TTA ACT 912 Tyr Leu Asp Thr Val Thr Tyr Ser Cys Asn Asp Glu Thr Lys Leu Thr 150 155 160

TTA ACA GGC CCT TCA TCG AAA CTT TGT TCA GAA ACT GGC TCA TGG GTA 960 Leu Thr Gly Pro Ser Ser Lys Leu Cys Ser Glu Thr Gly Ser Trp Val 165 170 175

CCT AAT GGA GAA ACT AAG TGT GAA TTT ATA TTT TGT AAA CTA CCT CAA 1008 Pro Asn Gly Glu Thr Lys Cys Glu Phe He Phe Cys Lys Leu Pro Gin 180 185 190

GTT GCG AAT GCG TAC GTT GAA GTT AGA AAG TCA GCT ACG AGC ATG CAA 1056 Val Ala Asn Ala Tyr Val Glu Val Arg Lys Ser Ala Thr Ser Met Gin 195 200 205 210

TAT TTG CAT ATA AAT GTT AAA TGT TAT AAA GGA TTT ATG CTA TAT GGA 1104 Tyr Leu His He Asn Val Lys Cys Tyr Lys Gly Phe Met Leu Tyr Gly 215 220 225

GAA ACT CCT AAT ACG TGT AAC CAT GGA GTA TGG TCT CCA GCT ATT CCT 1152 Glu Thr Pro Asn Thr Cys Asn His Gly Val Trp Ser Pro Ala He Pro 230 235 240

GAA TGT ATG AAG ATA TCT TCT CCA AAA GGA GAC ATG CCT GGC ATA AAC 1200 Glu Cys Met Lys He Ser Ser Pro Lys Gly Asp Met Pro Gly He Asn 245 250 255

TCA AAT GAA GAT AAT TCT ACA CCT TCA GGT GCA GAG TGT GCA TGT CCG 1248 Ser Asn Glu Asp Asn Ser Thr Pro Ser Gly Ala Glu Cys Ala Cys Pro 260 265 270

GGC AGT AAC TAC CCA ATT TCT TCA TAAATATGAG AATCTCCGTT ACAAGTTCTT 1302 Gly Ser Asn Tyr Pro He Ser Ser 275 280

AACTGGCCAT AATCCACACG AGAAGCATCT AAACGAGTAT ACGCTCCGCA 1352

TCCATCATCA TACATATCAT CTTCTGGATA GCAAACATCA TCATATATAG 1402

AGTCATTTAA ACTAGTTGTA TTTCTATTAC ATTCTTCTGA AAGTGGTTGA 1452

ATTTCTTCAT AAACTGGGTC ATTAGAATAA TTGTTTTCTT CTGCTTGTAA 1502

TAGCTTGTGT TTTGCCTTCA AGTGAAATAA AAAAATTTCA GTCATAATTT 155

TTAAAAAAAT ATAGAAGTTT CAGTAAATTG TTGTACTTAC CAAACAAGCA 160

SUBSTITUTE SHEET CCCATTATTA GTCTTGGTAG CAGCTAGAAT AAATCACTTT AAGTTTAAAA 1652

GTTTAAAAAT TTCCTGTCAA TGTGGTTTGC TTGGAACAAG GTGTCTACTT 1702

AGGATGTGAG TCATTTACTC TTTGAAGTTC AAAAAAAATA ACATAGTTAA 1752

AAGCTAAGCC CATTTTCAGT GATATTTAAA AGCTT 1787

SUBSTITUTE SHEET (4) INFORMATION FOR SEQ ID NO:3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1039 base pairs

(B) TYPE: Nucleic Acid

(C) STRANDEDNESS : Double stranded

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: Genomic DNA

(A) DESCRIPTION: Herpesvirus saimiri HVS-15 gene

(iii) HYPOTHETICAL: No

(iv) ANTI-SENSE: No

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Herpesvirus saimiri

(B) STRAIN: #11 (viii) POSITION IN GENOME:

(A) CHROMOSOME/SEGMENT: L-DNA

(B) MAP POSITION: 28960-29998

(C) UNITS: Nucleotide number (x) PUBLICATION INFORMATION:

(A) AUTHORS: Albrecht, Jens-Christian

Nicholas, John Cameron, Keith R. Newman, Carol Fleckenstein, Bernhard Honess, Robert

(B) TITLE: Herpesvirus Saimiri Has a Gene Specifying a Homologue of the Cellular Membrane Glycoprotein CD59

(C) JOURNAL: Virology

(D) VOLUME: 190

(F) PAGES: 527-530

(G) DATE: October 1992

SUBSTITUTE SHEET (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

AAGCTTCTAT TTATACTACA TTAGAGGCAT TTTTTCAAAA GCAAAAATGC 50

CTCTAATTAT ATACACTGTA CTATTTACCT CTATTACACA TTTTCTATTT 100

TAAGTCTGAT AGTGATTAAT CAAGAAAAAA GTTTGTGGTT CTCAGGGGAT 150

TAGTTCACAA GCTGTCTGAG GTTAAGGGTG TTTCTTTGGC ACTGACACAG 200

AAGTTGCTAT AAGAATTGAA GCTTGCTTTA CAAAAAGTTA CTTGTGATTA 250

ATTACTATAA CAAGAAAGGT A ATG TAT ATT TTG TTT ACG TTG 292

Met Tyr He Leu Phe Thr Leu -19 -15

GTA CTG ACT TTT GTT TTT TGC AAG CCA ATA CAC AGC TTG CAA TGC TAC 340 Val Leu Thr Phe Val Phe Cys Lys Pro He His Ser Leu Gin Cys Tyr -10 -5 +1

AAC TGT TCT CAC TCA ACT ATG CAG TGT ACT ACA TCT ACT AGT TGT ACA 388 Asn Cys Ser His Ser Thr Met Gin Cys Thr Thr Ser Thr Ser Cys Thr 5 10 15 20

TCT AAT CTT GAC TCT TGT CTC ATT GCT AAA GCT GGG TCA GGA GTA TAT 436 Ser Asn Leu Asp Ser Cys Leu He Ala Lys Ala Gly Ser Gly Val Tyr

25 30 35

TAC AGG TGT TGG AAG TTT GAT GAC TGT AGC TTT AAA CGT ATC TCA AAT 484 Tyr Arg Cys Trp Lys Phe Asp Asp Cys Ser Phe Lys Arg He Ser Asn 40 45 50

CAA TTG TCT GAA ACA CAG TTA AAG TAT CAT TGT TGT AAG AAG AAC TTG 532 Gin Leu Ser Glu Thr Gin Leu Lys Tyr His Cys Cys Lys Lys Asn Leu 55 60 65

TGT AAT GTG AAC AAA GGG ATT GAA AAT ATT AAA AGA ACA ATA TCA GAT 580 Cys Asn Val Asn Lys Gly He Glu Asn He Lys Arg Thr He Ser Asp 70 75 80

AAA GCT CTT TTA CTA TTA GCA TTG TTT TTA GTA ACT GCT TGG AAC TTT 628 Lys Ala Leu Leu Leu Leu Ala Leu Phe Leu Val Thr Ala Trp Asn Phe 85 90 95 100

CCT CTT TAAAAGTCAA CAACAAAACT ATATTGTAAC ATTTATTTTT GTGTAGCTTA 684 Pro Leu

TTTGTATTGC TATTACAAGT TAAAATATTG TGTTTTTTAA ACTATAATTT 734

TTAAAAAGAT AAAATGAGAT GTAGTATACT ACATAGTCAA AATTAAAGTG 784

CTAAATATTA TTAGCAATTT TTTATCAACA ACGCAAATAA AAGTTAAGCT 834

SUBSTITUTE SHEET ACTTTATTTT TTCTGTTATC TAAATCATTA CGCGCTTCTT AGCATGTGTT 884

AAAAGTTTTA TGTGATTTTA TTCTTACATA TATAAAGCTA AATTTTAAAG 934

CAAATTATCA GTAGCATCTT ATCTTCTAAT CTGTACAGAC CTATATAATA 984

TGGGATTATC CTTAAGAAAA AACAGCGGAG AAAAAGAAAA CACAGTGCCA 1034

AGCTT 1039

SUBSTITUTE SHEET

Claims

What is claimed is:

1. A recombinant DNA molecule comprising a nucleic acid sequence encoding mCCPH, said sequence comprising nucleotide 427 through nucleotide 1446 of SEQ. 1.

2. A nucleic acid vector comprising the DNA molecule of Claim 1.

3. The recombinant DNA molecule of Claim 1 in which the expression of the nucleic acid sequence encoding mCCPH is regulated by a second nucleic acid sequence so that mCCPH is expressed in a host transformed with the recombinant DNA molecule.

4. A recombinant host containing the DNA molecule of Claim 1.

5. A nucleic acid sequence comprising a sequence encoding a protein having the amino acid sequence set forth in SEQ. 1 from amino acid 1 through amino acid 340.

6. A purified protein comprising the amino acid sequence as set forth in SEQ. 1 from amino acid 1 through amino acid 340.

7. A method for producing mCCPH protein comprising growing a recombinant host containing the DNA molecule of Claim 1 such that the DNA molecule is expressed by the host and isolating the expressed mCCPH protein.

8. The method of Claim 7 wherein the host is a eukaryotic cell.

9. The method of Claim 7 wherein the host is a yeast.

10. The method of Claim 7 wherein the host is a bacterium.

11. The product of the method of Claim 7.

12. The product of the method of Claim 8.

13. The product of the method of Claim 9.

14. The product of the method of Claim 10.

15. A method for producing an antibody which recognizes mCCPH protein comprising immunizing a host animal with the product of Claim 11.

16. The antibody of the method of Claim 15.

17. A recombinant DNA molecule comprising a nucleic acid sequence encoding sCCPH, said sequence comprising nucleotide 427 through nucleotide 1272 of SEQ. 2.

18. A nucleic acid vector comprising the DNA molecule of Claim 17.

19. The recombinant DNA molecule of Claim 17 in which the expression of the nucleic acid sequence encoding sCCPH is regulated by a second nucleic acid sequence so that sCCPH is expressed in a host transformed with the recombinant DNA molecule.

20. A recombinant host containing the DNA molecule of Claim 17.

21. A nucleic acid sequence comprising a sequence encoding a protein having the amino acid sequence set forth in SEQ. 2 from amino acid 1 through amino acid 282.

22. A purified protein comprising the amino acid sequence as set forth in SEQ. 2 from amino acid 1 through amino acid 282.

23. A method for producing sCCPH protein comprising growing a recombinant host containing the DNA molecule of Claim 17 such that the DNA molecule is expressed by the host and isolating the expressed sCCPH protein.

24. The method of Claim 23 wherein the host is a eukaryotic cell.

25. The method of Claim 23 wherein the host is a yeast.

26. The method of Claim 23 wherein the host is a bacterium.

27. The product of the method of Claim 23.

28. The product of the method of Claim 24.

29. The product of the method of Claim 25.

30. The product of the method of Claim 26.

31. A method for producing an antibody which recognizes sCCPH protein comprising immunizing a host animal with the product of Claim 27.

32. The antibody of the method of Claim 31.

33. A recombinant DNA molecule comprising a nucleic acid sequence encoding HVS-15, said sequence comprising nucleotide 329 through nucleotide 634 of SEQ. 3.

34. The recombinant DNA molecule of Claim 33 further comprising the human CD59 prosequence operatively linked to the 5' end of the nucleic acid sequence encoding HVS-15.

35. A nucleic acid vector comprising the DNA molecule of Claim 33.

36. The recombinant DNA molecule of Claim 33 in which the expression of the nucleic acid sequence encoding HVS-15 is regulated by a second nucleic acid sequence so that HVS-15 is expressed in a host transformed with the recombinant DNA molecule.

37. A recombinant host containing the DNA molecule of Claim 33.

38. A nucleic acid sequence comprising a sequence encoding a protein having the amino acid sequence set forth in SEQ. 3 from amino acid 1 through amino acid 102.

39. A purified protein comprising the amino acid sequence as set forth in SEQ. 3 from amino acid 1 through amino acid 102.

40. A method for producing HVS-15 protein comprising growing a recombinant host containing the DNA molecule of Claim 33 such that the DNA molecule is expressed by the host and isolating the expressed HVS-15 protein.

41. The method of Claim 40 wherein the host is a eukaryotic cell.

42. The method of Claim 40 wherein the host is a yeast.

43. The method of Claim 40 wherein the host is a bacterium.

44. The product of the method of Claim 40.

45. The product of the method of Claim 41.

46. The product of the method of Claim 42.

47. The product of the method of Claim 43.

48. A method for producing an antibody which recognizes HVS- 15 protein comprising immunizing a host animal with the product of Claim 44.

49. The antibody of the method of Claim 48.

50. An antibody which recognizes an antigenic determinant of

HNS-15 protein.