WO1994013820A1 - Production of heterologous proteins in filamentous fungi - Google Patents

Production of heterologous proteins in filamentous fungi Download PDF

Info

Publication number
WO1994013820A1
WO1994013820A1 PCT/EP1993/003553 EP9303553W WO9413820A1 WO 1994013820 A1 WO1994013820 A1 WO 1994013820A1 EP 9303553 W EP9303553 W EP 9303553W WO 9413820 A1 WO9413820 A1 WO 9413820A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
glucose
variant
protein
strain
Prior art date
Application number
PCT/EP1993/003553
Other languages
French (fr)
Inventor
William E. Hintz
Peter A. Lagosky
Original Assignee
Gist-Brocades N.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=25534474&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1994013820(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Gist-Brocades N.V. filed Critical Gist-Brocades N.V.
Priority to EP94903785A priority Critical patent/EP0673429B1/en
Priority to DE69332030T priority patent/DE69332030T2/en
Priority to AU66534/94A priority patent/AU666443B2/en
Priority to JP6513800A priority patent/JPH08504327A/en
Priority to DK94903785T priority patent/DK0673429T3/en
Priority to CA002151154A priority patent/CA2151154C/en
Priority to AT94903785T priority patent/ATE219143T1/en
Publication of WO1994013820A1 publication Critical patent/WO1994013820A1/en
Priority to FI952801A priority patent/FI952801A/en
Priority to NO952293A priority patent/NO952293D0/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi

Definitions

  • This invention applies the art of recombinant DNA technology to the production of desired proteins in microbial hosts, particularly the filamentous fungi including Aspergillus species. Background of the Invention
  • a variety of gene expression systems have been developed for use with filamentous fungal hosts. Among these are systems that exploit carbon catabolite-repressed promoters, e.g., glucose-repressed promoters, selected primarily because their ability to drive gene expression can be tightly controlled simply by altering fermentation conditions.
  • One system of this type utilizes the promoter of the Aspergillus nidulans alcA gene, which is repressed in the presence of glucose and is induced by ethanol, threonine or related metabolites under glucose-depleted conditions (see Gwynne et al., Biochem. Soc. Trans., 17:338).
  • This dual control offers an attractive, phased approach to fermentation, in which the host Aspergillus strain is first cultured in the presence of glucose to maximize biomass, and is then cultured under glucose-depleted conditions in the presence of inducer, to elicit production of the desired protein.
  • regulated systems have also been developed, and make use of other glucose-repressed promoters such as the promoter of the aldA gene of Asperqillus nidulans (see Pickett et al., Gene (1987) 51 :217), the amdS gene of Asperqillus nidulans (see Scazzocchio et al., 1992, infra), the gla gene of
  • glucose-repressed promoters Although the control over gene expression offered by glucose-repressed promoters is desirable in many instances, their use can complicate the production phase of fermentation.
  • the host strain For gene product to form, the host strain must be cultured not only under glucose-depleted conditions, but also in a medium that employs a carbon source alternative to the more preferred substrate, glucose. It would accordingly be desirable to develop promoters that are relieved of their glucose-repressed function.
  • a recombinant DNA expression cassette useful to achieve expression of protein-encoding DNA in a filamentous fungal host, the cassette comprising the protein-encoding DNA and, linked operably therewith, a promoter variant having a creA binding site that is disrupted to permit expression of the protein-encoding DNA in the presence of glucose.
  • the promoter variant is derived from the promoter of an Aspergillus gene involved in ethanol metabolism, selected for example from the alcA, aldA and alcR genes of Aspergillus nidulans.
  • the present invention provides a filamentous fungal strain having incorporated therein a recombinant DNA expression cassette comprising heterologous DNA and, linked operably therewith, a promoter variant having a disrupted creA binding site.
  • a method for producing a desired protein which comprises the step of culturing in the presence of glucose a filamentous fungal strain having incorporated therein a recombinant DNA expression cassette comprising DNA coding for the desired protein and, linked operably therewith, a promoter variant having a disrupted and spatially preserved creA binding site.
  • Figure 1 illustrates the nucleotide sequence of a region of the Aspergillus nidulans alcA promoter. See also SEQ ID NO: 3 of the Sequence Listing.
  • Figure 2 illustrates schematically the construction of an alcA promoter variant.
  • the present invention provides a strategy for altering those promoters of filamentous fungal genes that are normally glucose repressed, in order to provide promoter variants that function in the presence of glucose to drive expression of protein-encoding DNA linked operably with the promoter variant. This is achieved by eliminating the creA binding site within the glucose-repressed promoter, either by deletion or more desirably by nucleotide substitution.
  • promoter variant thus refers to a glucose-repressed promoter in which a creA binding site normally resident therein has been disrupted, allowing the promoter variant to function in the presence of a glucose concentration sufficient to sustain growth of a given filamentous fungal strain.
  • promoter variants can in principle be developed from the promoter of any glucose- repressed filamentous fungal gene that incorporates within its promoter sequence the creA binding domain.
  • the creA binding domain is characterized as a GC rich motif, and is more particularly identified as a nucleotide region in which at least six G or C residues are incorporated within a contiguous ten nucleotide stretch.
  • the specific sequence of a creA binding domain can vary widely within this parameter, and may for example consist entirely of contiguous G/C residues, e.g., GCGGGGC, or of G/C residues interrupted by one or more A and T residues.
  • the creA binding domain within a promoter is located typically upstream of each of the required regulatory elements, i.e. the translational and transcriptional start sites.
  • identifying the creA binding domain within the promoter will of course be a simple task of locating the GC rich sequence within that sequence.
  • the creA binding domain can be located after sequencing the 5'-untranslated region of the gene, using techniques established in the art. For other glucose-regulated genes, cloning and then sequencing of the 5'-untranslated region thereof will be necessary but can be achieved also according to procedures well established in the art of molecular biology.
  • promoter variants that are functional in the presence of glucose are obtained by disrupting the creA binding domain.
  • Disruption can be achieved either by wholesale deletion of the creA binding domain and the region 5' thereof, by selective deletion from within the promoter of the creA binding domain or a functional portion thereof, or, more preferably, by replacing one or more of the G/C residues within the creA binding domain.
  • Replacement residues are desirably adenine and thymine.
  • G/C replacement has the advantage of preserving the spatial relationship, and function, of other regulatory domains within the promoter variant. Of course, this can be particularly important in the circumstance where expression regulating regions exist within the promoter at a site upstream of the creA binding site.
  • promoters may contain more than one creA binding site, and it is desirable, in order to eliminate glucose-repression thereof, to disrupt each of the creA binding sites within that promoter. This can be achieved, as just mentioned, either by deleting those sites, by replacing residues within those sites, or by using a combination of these disrupting techniques.
  • the promoter variant is a variant of an Aspergillus nidulans promoter identified below, in which the creA binding site noted below is disrupted by nucleotide replacement:
  • promoter variants functional in the presence of glucose can be achieved using these and other promoters by applying now conventional techniques of gene manipulation. For instance, a region of the selected promoter containing the creA binding site can be excised using flanking restriction sites and then incorporated into a vector suitable for amplification and subsequent gene manipulation work. The technigue of site-directed mutagenesis can then be applied to disrupt the targetted creA binding site. To delete the creA binding site and sequences 5' thereof, for example, an oligonucleotide can be designed which introduces any desired restriction site just 3' of the creA site, to allow excision.
  • the same technique can also be applied to introduce a nucleotide substitution within the creA binding site, using an oligonucleotide that is mismatched at the desired location but which otherwise is complementary to and hybridizes with the region targetted for disruption.
  • the convenient technique of polymerase chain reaction (PCR) can also be applied in combination with the site-directed approach, to mutagenize and then amplify either the entire promoter or a selected region thereof.
  • the desired promoter variant may of course also be synthesized de novo by applying methods now standard in the gene synthesis art.
  • this entails the successive 3' to 5' coupling of suitably protected nucleotide reagents in an automated synthesizer, and then the recovery by gel purification of the deprotected polynucleotide.
  • the block ligation approach may be employed, whereby "blocks" of oligonucleotide pairs, up to about 80 nucleotides in length, are synthesized and ligated in correct succession by overhang complementarity, as described for example by Wosnick et al. in Gene (1989) 76:153.
  • the desired DNA may be synthesized in toto, and then amplified by the PCR technique, using the strategy disclosed for instance by Barnett et al. in Nucl. Acids Res. (1990) 18:3094.
  • the promoter variant may be exploited to drive expression of DNA coding for any desired protein in a filamentous fungal host, in accordance with techniques already otherwise established for the filamentous fungi (for a review see Ballance, Yeast (1986) 2:229).
  • the present invention provides recombinant DNA constructs in which the promoter variant is linked operably with the protein- encoding DNA.
  • linked operably means that the promoter is linked with the protein-encoding DNA in a manner enabling expression thereof in the filamentous fungal host.
  • the protein-encoding DNA is understood to comprise a translational start codon and a translational stop codon; and otherwise encodes either the desired protein end-product per se; a fusion protein in which the desired protein is initially produced in cleavable combination with a carrier protein such as Aspergillus niger glucoamylase; or a secretable precursor in which the desired protein end-product is coupled with a cleavable signal peptide, such as a signal peptide normally associated with an Aspergillus protein e.g. glucoamylase, or any functional equivalent thereof.
  • the constructs of the present invention may also incorporate a transcriptional terminator at a location 3' of the protein-encoding DNA, although experience has shown that such terminators are not essential components of the constructs.
  • transcriptional terminators can be obtained as 0.5-1.0 kb fragments of the 3'non-coding regions of Aspergillus genes, for example of the Aspergillus niger glucoamylase gene.
  • the construct can be introduced either in linear form or in plasmid form, e.g., in a pUC-based or other vector, into a selected filamentous fungal host using a technique such as DNA-mediated transformation, electro- poration, particle gun bombardment, protoplast fusion and the like.
  • a technique such as DNA-mediated transformation, electro- poration, particle gun bombardment, protoplast fusion and the like.
  • the transformation typically also involves a selectable gene marker which is introduced with the expression cassette, either on the same vector or by co-transformation, into a host strain in which the gene marker is selectable.
  • Various marker/host systems are available, including the pyrG, argB and niaD genes for use with auxotrophic strains of Aspergillus nidulans; pyrG and argB genes for Aspergillus oryzae auxotrophs; pyrG, trpC and niaD genes for Penicillium chrysogenum auxotrophs; and the argB gene for Trichoderma reesei auxotrophs.
  • Dominant selectable markers including amdS, oliC, hyg and phleo are also now available for use with such filamentous fungi as A. niger, A. oryzae, A. ficuum, P.
  • chrysogenum Cephalosporium acremonium, Cochliobolus heterostrophus, Glomerella cingulata, Fulvia fulva and Leotosphaeria maculans (for a review see Ward in Modern Microbial Genetics, 1991, Wiley-Liss, Inc., at pages 455-495).
  • Filamentous fungal strains resulting from the transformation are cultured, according to another aspect of the invention, in the presence of a growth-sustaining concentration of glucose, for the purpose of obtaining the desired protein product.
  • Culturing of the strain can be achieved without the need to establish glucose-depleted growth conditions, since the promoter variant driving expression of the desired gene product is no longer functionally repressed in the presence of glucose.
  • production of the desired protein can be achieved throughout the fermentation period.
  • Phased production can also still be achieved, using promoter variants that are controlled by mechanisms other than glucose-repression.
  • the alcA promoter can be functionally controlled, even after disruption of its creA binding site, using an inducing agent to limit protein production to a certain window within the fermentation period.
  • the promoter of the A. nidulans alcA gene is repressed by a combination of the creA gene product and glucose; it is also induced under glucose-depleted conditions by a combination of the alcR gene product and an inducing agent such as ethanol.
  • an alcA promoter variant that functions in glucose at concentrations sufficient to sustain Aspergillus growth, the alcA promoter was obtained in the manner reported by Gwynne et al. in Bio/Technology (1987) 5:713, and manipulated as described below.
  • the holding vector and the full length alcA gene were then each restricted with SphI and SplI, and then selectively ligated to form plasmid palcA var -2EB, in which the Sphl/SplI region of wild type alcA promoter is replaced with the variant region containing mutations in the two putative creA binding sites.
  • spatial arrangement of the nucleotides within the alcA promoter was also conserved.
  • an Aspergillus nidulans strain that produces the alcR product in a constitutive manner was exploited for expression of the alcA gene from the variant promoter.
  • the selected host strain was constructed from the Glasgow double auxotroph FGSC4 (argB-;ura-) by transforming with a plasmid carrying both the A. nidulans argB gene , as selectable marker, and an expression cassette in which DNA coding for the alcR product (see Felenbok et al., Gene (1989) 73: 385) was placed under expression control of the constitutive promoter of the A.
  • the plasmid palcA var -2EB was then introduced into the selected host A. nidulans strain, together with a marker plasmid pFB94 which carries the pyr4 gene of Neurospora crassa (see Buxton and Radford, Mol. Gen. Genet. (1983) 190:403). Transformation was achieved using the PEG/CaCl 2 -mediated technique according to the protocol reported by Royer et al., Mol. Gen. Genet. (1991) 225:168. Putative transformants, containing the pFB94 construct, were first selected without uridine on minimal medium.
  • Spore suspensions were inoculated into 50 ml of liquid medium supplemented with 0.67% yeast nitrogen base (YNB) and 1mM uridine; and optionally ethanol (1.0%), glucose (0.4%) or the non-metabolized analogue, 2-deoxyglucose (2-DOG) (0.4%).
  • the host strain was able to grow in the presence of either ethanol or glucose, or a combination thereof. It was unable to grow in the presence only of a non-metabolized glucose analogue 2-DOG, nor could it utilize ethanol in the presence of 2-DOG.
  • 2-DOG effectively repressed expression from the wild type alcA gene, the product of which is required for ethanol utilization.
  • the palcA var -2EB transformants were able to grow in the presence of ethanol when present either in combination with glucose or when present as the sole carbon source (even when glucose or its 2-DOG equivalent were present), demonstrating conclusively that expression of the alcA gene product required for ethanol utilization was mediated by the alcA promoter variant.
  • MOLECULE TYPE DNA (genomic)
  • ORGANISM Aspergillus nidulans

Abstract

Expression of proteins in filamentous fungal hosts is achieved in the presence of glucose using promoter variants in which creA binding sites are functionally disrupted.

Description

PRODUCTION OF HETEROLOGOUS PROTEINS IN FILAMENTOUS FUNGI
Technical Field This invention applies the art of recombinant DNA technology to the production of desired proteins in microbial hosts, particularly the filamentous fungi including Aspergillus species. Background of the Invention
A variety of gene expression systems have been developed for use with filamentous fungal hosts. Among these are systems that exploit carbon catabolite-repressed promoters, e.g., glucose-repressed promoters, selected primarily because their ability to drive gene expression can be tightly controlled simply by altering fermentation conditions. One system of this type utilizes the promoter of the Aspergillus nidulans alcA gene, which is repressed in the presence of glucose and is induced by ethanol, threonine or related metabolites under glucose-depleted conditions (see Gwynne et al., Biochem. Soc. Trans., 17:338). This dual control offers an attractive, phased approach to fermentation, in which the host Aspergillus strain is first cultured in the presence of glucose to maximize biomass, and is then cultured under glucose-depleted conditions in the presence of inducer, to elicit production of the desired protein. Similarly regulated systems have also been developed, and make use of other glucose-repressed promoters such as the promoter of the aldA gene of Asperqillus nidulans (see Pickett et al., Gene (1987) 51 :217), the amdS gene of Asperqillus nidulans (see Scazzocchio et al., 1992, infra), the gla gene of
Aspergillus niger (see Fowler et al., Curr. Genet. (1990),
18.: 537) and the acvA and ipnA genes of Aspergillus nidulans and of Cephalosporium chrysogenum (see Brakhage et al ., (1992) 174:3789).
Although the control over gene expression offered by glucose-repressed promoters is desirable in many instances, their use can complicate the production phase of fermentation. For gene product to form, the host strain must be cultured not only under glucose-depleted conditions, but also in a medium that employs a carbon source alternative to the more preferred substrate, glucose. It would accordingly be desirable to develop promoters that are relieved of their glucose-repressed function.
Studies of the glucose-mediated mechanism of carbon catabolite repression in Aspergillus and other filamentous fungi have implicated the product of the creA gene as the priniciple repressor. It is now widely accepted (see Scazzocchio, in Aspergillus; Biology and Industrial Applications, Butterworth-Heinemann, 1992 at pp.43-63) that when glucose is present, the creA gene product represses expression of genes involved in utilization of other carbon substrates such as ethanol and lactose, and thereby inhibits utilization of those other pathways when glucose is available. Cloning and analysis of Asperqillus nidulans creA has been reported recently by Dowzer and Kelly in Mol. Cell. Biol. (1991) 11:5701. Summary of the Invention
The domain at which the creA gene product binds within the promoter regions of glucose-repressed filamentous fungal genes has now been identified. This discovery is exploited, in accordance with the present invention, to disrupt the creA binding domain within glucose-repressed promoters, and thereby provide promoter variants that can drive expression in the presence of glucose.
More particularly, and according to one aspect of the invention, there is provided a recombinant DNA expression cassette useful to achieve expression of protein-encoding DNA in a filamentous fungal host, the cassette comprising the protein-encoding DNA and, linked operably therewith, a promoter variant having a creA binding site that is disrupted to permit expression of the protein-encoding DNA in the presence of glucose.
In embodiments of the present invention, the promoter variant is derived from the promoter of an Aspergillus gene involved in ethanol metabolism, selected for example from the alcA, aldA and alcR genes of Aspergillus nidulans.
In another of its aspects, the present invention provides a filamentous fungal strain having incorporated therein a recombinant DNA expression cassette comprising heterologous DNA and, linked operably therewith, a promoter variant having a disrupted creA binding site.
According to another aspect of the invention, there is provided a method for producing a desired protein, which comprises the step of culturing in the presence of glucose a filamentous fungal strain having incorporated therein a recombinant DNA expression cassette comprising DNA coding for the desired protein and, linked operably therewith, a promoter variant having a disrupted and spatially preserved creA binding site.
The invention and its preferred embodiments are now described in greater detail with reference to the accompanying drawings.
Brief Reference to the Drawings
Figure 1 illustrates the nucleotide sequence of a region of the Aspergillus nidulans alcA promoter. See also SEQ ID NO: 3 of the Sequence Listing.
Figure 2 illustrates schematically the construction of an alcA promoter variant.
Detailed Description and Preferred Embodiments
The present invention provides a strategy for altering those promoters of filamentous fungal genes that are normally glucose repressed, in order to provide promoter variants that function in the presence of glucose to drive expression of protein-encoding DNA linked operably with the promoter variant. This is achieved by eliminating the creA binding site within the glucose-repressed promoter, either by deletion or more desirably by nucleotide substitution. As used herein, the term "promoter variant" thus refers to a glucose-repressed promoter in which a creA binding site normally resident therein has been disrupted, allowing the promoter variant to function in the presence of a glucose concentration sufficient to sustain growth of a given filamentous fungal strain.
For purposes of the present invention, promoter variants can in principle be developed from the promoter of any glucose- repressed filamentous fungal gene that incorporates within its promoter sequence the creA binding domain. The creA binding domain is characterized as a GC rich motif, and is more particularly identified as a nucleotide region in which at least six G or C residues are incorporated within a contiguous ten nucleotide stretch. The specific sequence of a creA binding domain can vary widely within this parameter, and may for example consist entirely of contiguous G/C residues, e.g., GCGGGGC, or of G/C residues interrupted by one or more A and T residues.
The creA binding domain within a promoter is located typically upstream of each of the required regulatory elements, i.e. the translational and transcriptional start sites. For glucose-repressed filamentous fungal genes having published sequences, identifying the creA binding domain within the promoter will of course be a simple task of locating the GC rich sequence within that sequence. For genes that have been cloned but for which no sequence is yet known, the creA binding domain can be located after sequencing the 5'-untranslated region of the gene, using techniques established in the art. For other glucose-regulated genes, cloning and then sequencing of the 5'-untranslated region thereof will be necessary but can be achieved also according to procedures well established in the art of molecular biology.
From those glucose-repressed promoters incorporating the creA binding domain, promoter variants that are functional in the presence of glucose are obtained by disrupting the creA binding domain. Disruption can be achieved either by wholesale deletion of the creA binding domain and the region 5' thereof, by selective deletion from within the promoter of the creA binding domain or a functional portion thereof, or, more preferably, by replacing one or more of the G/C residues within the creA binding domain. Replacement residues are desirably adenine and thymine. Relative to wholesale and selective deletion, G/C replacement has the advantage of preserving the spatial relationship, and function, of other regulatory domains within the promoter variant. Of course, this can be particularly important in the circumstance where expression regulating regions exist within the promoter at a site upstream of the creA binding site.
In some cases, promoters may contain more than one creA binding site, and it is desirable, in order to eliminate glucose-repression thereof, to disrupt each of the creA binding sites within that promoter. This can be achieved, as just mentioned, either by deleting those sites, by replacing residues within those sites, or by using a combination of these disrupting techniques.
According to specific embodiments of the invention, the promoter variant is a variant of an Aspergillus nidulans promoter identified below, in which the creA binding site noted below is disrupted by nucleotide replacement:
Figure imgf000007_0001
1 = Gwynne et al., Gene (1987) 51:205
2 = Picket et al., Gene (1987) 51:217
3 = Felenbok et al., Gene (1988) 73:385
4 = Scazzocchio et al . , 1992, supra
5 = Sophianopoulou et al., Mol. Microbiol. (1989) 3:705 The creation of promoter variants functional in the presence of glucose can be achieved using these and other promoters by applying now conventional techniques of gene manipulation. For instance, a region of the selected promoter containing the creA binding site can be excised using flanking restriction sites and then incorporated into a vector suitable for amplification and subsequent gene manipulation work. The technigue of site-directed mutagenesis can then be applied to disrupt the targetted creA binding site. To delete the creA binding site and sequences 5' thereof, for example, an oligonucleotide can be designed which introduces any desired restriction site just 3' of the creA site, to allow excision. The same technique can also be applied to introduce a nucleotide substitution within the creA binding site, using an oligonucleotide that is mismatched at the desired location but which otherwise is complementary to and hybridizes with the region targetted for disruption. The convenient technique of polymerase chain reaction (PCR) can also be applied in combination with the site-directed approach, to mutagenize and then amplify either the entire promoter or a selected region thereof. The desired promoter variant may of course also be synthesized de novo by applying methods now standard in the gene synthesis art. Briefly, this entails the successive 3' to 5' coupling of suitably protected nucleotide reagents in an automated synthesizer, and then the recovery by gel purification of the deprotected polynucleotide. The block ligation approach may be employed, whereby "blocks" of oligonucleotide pairs, up to about 80 nucleotides in length, are synthesized and ligated in correct succession by overhang complementarity, as described for example by Wosnick et al. in Gene (1989) 76:153. In an alternative approach, the desired DNA may be synthesized in toto, and then amplified by the PCR technique, using the strategy disclosed for instance by Barnett et al. in Nucl. Acids Res. (1990) 18:3094.
Once obtained, the promoter variant may be exploited to drive expression of DNA coding for any desired protein in a filamentous fungal host, in accordance with techniques already otherwise established for the filamentous fungi (for a review see Ballance, Yeast (1986) 2:229). For this purpose, the present invention provides recombinant DNA constructs in which the promoter variant is linked operably with the protein- encoding DNA. The term "linked operably" means that the promoter is linked with the protein-encoding DNA in a manner enabling expression thereof in the filamentous fungal host. For the purposes of this specification, the protein-encoding DNA is understood to comprise a translational start codon and a translational stop codon; and otherwise encodes either the desired protein end-product per se; a fusion protein in which the desired protein is initially produced in cleavable combination with a carrier protein such as Aspergillus niger glucoamylase; or a secretable precursor in which the desired protein end-product is coupled with a cleavable signal peptide, such as a signal peptide normally associated with an Aspergillus protein e.g. glucoamylase, or any functional equivalent thereof.
In addition to the promoter and the protein-encoding DNA, the constructs of the present invention may also incorporate a transcriptional terminator at a location 3' of the protein-encoding DNA, although experience has shown that such terminators are not essential components of the constructs. Such transcriptional terminators can be obtained as 0.5-1.0 kb fragments of the 3'non-coding regions of Aspergillus genes, for example of the Aspergillus niger glucoamylase gene.
Once the construct is obtained, it can be introduced either in linear form or in plasmid form, e.g., in a pUC-based or other vector, into a selected filamentous fungal host using a technique such as DNA-mediated transformation, electro- poration, particle gun bombardment, protoplast fusion and the like. To allow for selection of the resulting transformants, the transformation typically also involves a selectable gene marker which is introduced with the expression cassette, either on the same vector or by co-transformation, into a host strain in which the gene marker is selectable. Various marker/host systems are available, including the pyrG, argB and niaD genes for use with auxotrophic strains of Aspergillus nidulans; pyrG and argB genes for Aspergillus oryzae auxotrophs; pyrG, trpC and niaD genes for Penicillium chrysogenum auxotrophs; and the argB gene for Trichoderma reesei auxotrophs. Dominant selectable markers including amdS, oliC, hyg and phleo are also now available for use with such filamentous fungi as A. niger, A. oryzae, A. ficuum, P. chrysogenum, Cephalosporium acremonium, Cochliobolus heterostrophus, Glomerella cingulata, Fulvia fulva and Leotosphaeria maculans (for a review see Ward in Modern Microbial Genetics, 1991, Wiley-Liss, Inc., at pages 455-495).
Filamentous fungal strains resulting from the transformation are cultured, according to another aspect of the invention, in the presence of a growth-sustaining concentration of glucose, for the purpose of obtaining the desired protein product. Culturing of the strain can be achieved without the need to establish glucose-depleted growth conditions, since the promoter variant driving expression of the desired gene product is no longer functionally repressed in the presence of glucose. For those promoters whose function is otherwise not controlled, production of the desired protein can be achieved throughout the fermentation period. Phased production can also still be achieved, using promoter variants that are controlled by mechanisms other than glucose-repression. As is hereinafter exemplified, the alcA promoter can be functionally controlled, even after disruption of its creA binding site, using an inducing agent to limit protein production to a certain window within the fermentation period. Example 1
Creation of an alcA promoter variant
The promoter of the A. nidulans alcA gene is repressed by a combination of the creA gene product and glucose; it is also induced under glucose-depleted conditions by a combination of the alcR gene product and an inducing agent such as ethanol. To construct an alcA promoter variant that functions in glucose at concentrations sufficient to sustain Aspergillus growth, the alcA promoter was obtained in the manner reported by Gwynne et al. in Bio/Technology (1987) 5:713, and manipulated as described below.
Two putative creA binding sites (both GCGGGGC) were first identified by sequence scanning. As shown in Figure 1, these sites reside upstream of the ATG initiation codon of the alcA gene at positions -302 and -167, and both are conveniently within a Sphl/SplI region of the promoter. To provide an alcA promoter disrupted at these sites by nucleotide replacement, a 160bp fragment of the promoter was amplified using the tailed primers noted below: (Forward) Hindlll SphI -302
5'GACTGACTAAGCTTGCATGCGGAACCGCACGAGGGTACTACGGAAATTGAC 3'
(SEO ID NO: 1) (Reverse) EcoRI SplI -167
5'GACTGACTGAATTCCGTACGGGGTAGTACTCGTTTGTGGCTCTCCGTGCG 3'
(SEQ ID NO: 2) Twenty-five cycles of PCR amplification were performed according to the method reported by Scharf, 1990, In: "PCR Protocols: A Guide to Methods and Applicatons". M.A.Innis et al. (Eds.), Academic Press. The Hindlll/EcoRI-tailed amplification product was then sub-cloned into a pTZ18R holding vector and the correct, variant sequence was verified by DNA sequence analysis. The holding vector and the full length alcA gene (pUC8 background) were then each restricted with SphI and SplI, and then selectively ligated to form plasmid palcAvar-2EB, in which the Sphl/SplI region of wild type alcA promoter is replaced with the variant region containing mutations in the two putative creA binding sites. By this approach, spatial arrangement of the nucleotides within the alcA promoter was also conserved.
Because expression from the alcA promoter variant requires induction by the product of the alcR gene which is itself glucose-repressed by a creA-mediated mechanism, an Aspergillus nidulans strain that produces the alcR product in a constitutive manner was exploited for expression of the alcA gene from the variant promoter. The selected host strain was constructed from the Glasgow double auxotroph FGSC4 (argB-;ura-) by transforming with a plasmid carrying both the A. nidulans argB gene , as selectable marker, and an expression cassette in which DNA coding for the alcR product (see Felenbok et al., Gene (1989) 73: 385) was placed under expression control of the constitutive promoter of the A. nidulans glyceraldehye-3- phosphate dehydrogenase gene (see Punt et al., Gene (1988) 69:49. To accomodate multiple copy integration of cassettes carrying the alcA promoter variant, a strain carrying multiple copies of the constitutive alcR gene was chosen, and designated T2625 (ura , multiple alcRc).
The plasmid palcAvar-2EB was then introduced into the selected host A. nidulans strain, together with a marker plasmid pFB94 which carries the pyr4 gene of Neurospora crassa (see Buxton and Radford, Mol. Gen. Genet. (1983) 190:403). Transformation was achieved using the PEG/CaCl2-mediated technique according to the protocol reported by Royer et al., Mol. Gen. Genet. (1991) 225:168. Putative transformants, containing the pFB94 construct, were first selected without uridine on minimal medium. Mixed spores collected from approximately 80 ura+ transformants (3mm colonies) on a single plate were inoculated into 50ml of selective medium (0.4% 2- deoxyglucose (2-DOG), 1.0% ethanol, 0.67% yeast nutrient broth). The culture was incubated at 30°C with agitation (200 rpm) for 3 days. Flocculent colonies were collected from the liquid cultures and isolates derived from single spores were prepared from each of the 2-DOG resistant colonies for further analysis.
The host strain and transformants were next cultured for 48 hours at 30°C in liguid medium containing various supplements selected to examine effects of carbon source on growth. Results are presented in Table 1 below:
Table 1
Figure imgf000013_0001
Spore suspensions were inoculated into 50 ml of liquid medium supplemented with 0.67% yeast nitrogen base (YNB) and 1mM uridine; and optionally ethanol (1.0%), glucose (0.4%) or the non-metabolized analogue, 2-deoxyglucose (2-DOG) (0.4%).
As the table indicates, the host strain was able to grow in the presence of either ethanol or glucose, or a combination thereof. It was unable to grow in the presence only of a non-metabolized glucose analogue 2-DOG, nor could it utilize ethanol in the presence of 2-DOG. Clearly, 2-DOG effectively repressed expression from the wild type alcA gene, the product of which is required for ethanol utilization. On the other hand, the palcAvar-2EB transformants were able to grow in the presence of ethanol when present either in combination with glucose or when present as the sole carbon source (even when glucose or its 2-DOG equivalent were present), demonstrating conclusively that expression of the alcA gene product required for ethanol utilization was mediated by the alcA promoter variant. SEQUENCE LISTING
(1) GENERAL INFOR MATION:
(i) APPLICANT:
(A) NAME: GIST-BROCADES N.V.
(B) STREET: P.O. Box 1
(C) CITY: Delft
(E) COUNTRY: Netherlands
(F) POSTAL CODE (ZIP) : NL-2600 MA
(G) TELEPHONE: 31.15.799111
(H) TELEFAX: 31.15.793957
(ii) TITLE OF INVENTION: PRODUCTION OF HETEROLOGOUS PROTEINS IN
FILAMENTOUS FUNGI
(iii) NUMBER OF SEQUENCES: 3
(iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (EPO)
(vi) PRIOR APPLI CATION DATA:
(A) APPLICATION NUMBER: US 07/988,778
(B) FILING DATE: 10-DEC-1992
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cENA
(iii) HYPOTHETICAL: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GACTGACEAA GCTTCCATGC GGAACCGCAC GAGGGTACTA CGGAAATTGA C 51
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 50 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cENA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2 :
GACTGACTGA ATTCCGTACG GGGTAGTACT CGTTT GTGGC TCTCCGTGCG 50
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHAR ACTERISTICS:
(A) LEN GTH: 360 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: DNA (genomic)
(iii) HYPOTHETICAL: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Aspergillus nidulans
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
CGCAGCTCGG GATAGTTCCG ACCTAGGATT GGATGCATGC GGAACCGCAC GAGGGCGGGG 60
CGGAAATTGA CACACCACTC CTCTCCACGC AGCCGTTCCA AGAGGTACGC GTATAGAGCC 120
GT ATAGAGCA GAGACGGAGC ACTTTCTGGT ACTGTCCGCA CGGGATGTCC GCACGGAGAG 180
CCACAAACGA GCGGGGCCCC GTACGTGCTC TCCTACCCCA GGATCGCATC CTCGCATAGC 240
TGAACATCTA TATAAAGACC CCCAAGGTTC TCAGTCTCAC CAACATCATC AACCAACAAT 300 CAACA GTTCT CTACTCAGTT AATTAGAACA CTTCCAATCC TATCACCTCG CATCAAAATG 360

Claims

1. A recombinant DNA construct in which protein- encoding DNA is linked operably with a filamentous fungal promoter variant having a disrupted creA binding site, whereby said promoter variant mediates expression of said protein- encoding DNA in the presence of glucose.
2. A recombinant DNA construct according to claim 1, wherein said creA binding site is disrupted and spatially conserved by replacement of nucleotide residues in that site.
3. A recombinant DNA construct according to claim 2, wherein the nucleotide replacements are selected from A and T.
4. A recombinant DNA construct according to claims 1, wherein said promoter variant is a variant of an Aspergillus promoter.
5. A recombinant DNA construct according to claim 4, wherein said promoter variant is a variant of an Aspergillus promoter selected from alcA, aldA and alcR.
6. A filamentous fungal strain having incorporated therein a recombinant DNA construct as defined in claim 1.
7. A filamentous fungal strain according to claim 5, of the genus Aspergillus.
8. A filamentous fungal strain according to claim 6, of the species Aspergillus nidulans.
9. A method for producing a desired protein, comprising the step of culturing in the presence of glucose a filamentous fungus strain as defined in claim 5.
10. An Aspergillus nidulans strain that expresses the alcR gene product in the presence of glucose and has incorporated therein a recombinant DNA construct in which protein-encoding DNA is linked operably with a variant of the alcA promoter in which all creA binding sites are functionally disrupted, whereby the protein-encoding DNA is expressed when said strain is cultured in the presence of glucose and inducer.
11. A method for producing a desired protein, comprising the step of culturing an Aspergillus nidulans strain as defined in claim 9 in the presence of glucose and inducer.
PCT/EP1993/003553 1992-12-10 1993-12-10 Production of heterologous proteins in filamentous fungi WO1994013820A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
EP94903785A EP0673429B1 (en) 1992-12-10 1993-12-10 Production of heterologous proteins in filamentous fungi
DE69332030T DE69332030T2 (en) 1992-12-10 1993-12-10 PRODUCTION OF HETEROLOGICAL PROTEINS IN FILAMENTOUS FUNGI
AU66534/94A AU666443B2 (en) 1992-12-10 1993-12-10 Production of heterologous proteins in filamentous fungi
JP6513800A JPH08504327A (en) 1992-12-10 1993-12-10 Heterologous protein production in filamentous fungi
DK94903785T DK0673429T3 (en) 1992-12-10 1993-12-10 Preparation of heterologous proteins in filamentous fungi
CA002151154A CA2151154C (en) 1992-12-10 1993-12-10 Production of heterologous proteins in filamentous fungi
AT94903785T ATE219143T1 (en) 1992-12-10 1993-12-10 PRODUCTION OF HETEROLOGUE PROTEINS IN FILAMENTOUS FUNGI
FI952801A FI952801A (en) 1992-12-10 1995-06-07 Production of heterologous proteins in filamentous fungi
NO952293A NO952293D0 (en) 1992-12-10 1995-06-09 Preparation of heterologous proteins in filamentous fungi

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US98877892A 1992-12-10 1992-12-10
US07/988,778 1992-12-10

Publications (1)

Publication Number Publication Date
WO1994013820A1 true WO1994013820A1 (en) 1994-06-23

Family

ID=25534474

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1993/003553 WO1994013820A1 (en) 1992-12-10 1993-12-10 Production of heterologous proteins in filamentous fungi

Country Status (12)

Country Link
US (2) US5710021A (en)
EP (1) EP0673429B1 (en)
JP (1) JPH08504327A (en)
AT (1) ATE219143T1 (en)
AU (1) AU666443B2 (en)
CA (1) CA2151154C (en)
DE (1) DE69332030T2 (en)
DK (1) DK0673429T3 (en)
FI (1) FI952801A (en)
NO (1) NO952293D0 (en)
NZ (1) NZ259339A (en)
WO (1) WO1994013820A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997009438A1 (en) * 1995-09-01 1997-03-13 Valtion Teknillinen Tutkimuskeskus Process for modifying glucose repression
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2002064802A2 (en) * 2001-02-13 2002-08-22 Syngenta Limited Regulatory genes suitable for use in gene expression
WO2005047302A1 (en) 2003-11-06 2005-05-26 Genencor International, Inc. Expression in filamentous fungi of protease inhibitors and variants thereof
US8268585B2 (en) 1998-10-06 2012-09-18 Dyadic International (Usa), Inc. Transformation system in the field of filamentous fungal hosts
EP2505651A2 (en) 2006-12-10 2012-10-03 Dyadic International, Inc. Isolated fungus with reduced protease activity
US8551751B2 (en) 2007-09-07 2013-10-08 Dyadic International, Inc. BX11 enzymes having xylosidase activity
WO2014012145A1 (en) * 2012-07-18 2014-01-23 Queensland University Of Technology Constructs for modulating transpiration in plants and uses therefor
US8673618B2 (en) 1996-10-10 2014-03-18 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose

Families Citing this family (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5989870A (en) * 1986-04-30 1999-11-23 Rohm Enzyme Finland Oy Method for cloning active promoters
GB0112226D0 (en) * 2001-05-18 2001-07-11 Danisco Method of improving dough and bread quality
ATE231186T1 (en) 1998-07-21 2003-02-15 Danisco GROCERIES
WO2000024938A2 (en) * 1998-10-27 2000-05-04 The Johns Hopkins University CCG REPEATS IN cDNAs FROM HUMAN BRAIN
BR0209154A (en) 2001-05-18 2004-07-20 Danisco Process of preparing a dough with an enzyme
US7955814B2 (en) 2003-01-17 2011-06-07 Danisco A/S Method
PT1748074E (en) 2003-01-17 2012-01-16 Danisco Method for the in situ production of an emulsifier in a foodstuff
US20050196766A1 (en) 2003-12-24 2005-09-08 Soe Jorn B. Proteins
DE602004030000D1 (en) * 2003-01-17 2010-12-23 Danisco PROCESS FOR IN-SITU-PRODUCTION OF AN EMULSIFIER IN A FOODSTUFF
BRPI0417533B1 (en) 2003-12-24 2016-03-01 Danisco variant enzyme glycolipid acyltransferase, use and method for its production, method for preparing a food product and flour baked product, enzymatic refinement process
US7718408B2 (en) * 2003-12-24 2010-05-18 Danisco A/S Method
GB0716126D0 (en) * 2007-08-17 2007-09-26 Danisco Process
GB0405637D0 (en) 2004-03-12 2004-04-21 Danisco Protein
CN1942586B (en) 2004-04-16 2011-08-10 帝斯曼知识产权资产管理有限公司 Fungal promoters for expressing a gene in a fungal cell
DK1791933T3 (en) 2004-07-16 2011-09-05 Danisco Process for enzymatic boiling of oil
AU2005290934C1 (en) 2004-10-04 2013-05-09 Dupont Nutrition Biosciences Aps Citrobacter freundii phytase and homologues
GB0422052D0 (en) 2004-10-04 2004-11-03 Dansico As Enzymes
GB0423139D0 (en) 2004-10-18 2004-11-17 Danisco Enzymes
GB0424940D0 (en) 2004-11-11 2004-12-15 Danisco Transcription factors
US7733310B2 (en) * 2005-04-01 2010-06-08 Prysm, Inc. Display screens having optical fluorescent materials
US7474286B2 (en) * 2005-04-01 2009-01-06 Spudnik, Inc. Laser displays using UV-excitable phosphors emitting visible colored light
US7791561B2 (en) * 2005-04-01 2010-09-07 Prysm, Inc. Display systems having screens with optical fluorescent materials
US8089425B2 (en) * 2006-03-03 2012-01-03 Prysm, Inc. Optical designs for scanning beam display systems using fluorescent screens
US7994702B2 (en) * 2005-04-27 2011-08-09 Prysm, Inc. Scanning beams displays based on light-emitting screens having phosphors
US8000005B2 (en) * 2006-03-31 2011-08-16 Prysm, Inc. Multilayered fluorescent screens for scanning beam display systems
US7884816B2 (en) * 2006-02-15 2011-02-08 Prysm, Inc. Correcting pyramidal error of polygon scanner in scanning beam display systems
US8451195B2 (en) * 2006-02-15 2013-05-28 Prysm, Inc. Servo-assisted scanning beam display systems using fluorescent screens
US20080068295A1 (en) * 2006-09-19 2008-03-20 Hajjar Roger A Compensation for Spatial Variation in Displayed Image in Scanning Beam Display Systems Using Light-Emitting Screens
US8013506B2 (en) * 2006-12-12 2011-09-06 Prysm, Inc. Organic compounds for adjusting phosphor chromaticity
BRPI0720801A2 (en) 2007-01-25 2014-09-16 Dupont Nutrition Biosci Aps Production of an acyltransferase lipid from transformed cells of Bacillus licheniformis.
US8143046B2 (en) 2007-02-07 2012-03-27 Danisco Us Inc., Genencor Division Variant Buttiauxella sp. phytases having altered properties
CN101784666A (en) 2007-02-15 2010-07-21 帝斯曼知识产权资产管理有限公司 A recombinant host cell for the production of a compound of interest
GB2460802B (en) * 2007-03-20 2012-09-05 Prysm Inc Delivering and displaying advertisment or other application data to display systems
US7697183B2 (en) * 2007-04-06 2010-04-13 Prysm, Inc. Post-objective scanning beam systems
US7878657B2 (en) * 2007-06-27 2011-02-01 Prysm, Inc. Servo feedback control based on invisible scanning servo beam in scanning beam display systems with light-emitting screens
US8556430B2 (en) * 2007-06-27 2013-10-15 Prysm, Inc. Servo feedback control based on designated scanning servo beam in scanning beam display systems with light-emitting screens
CN101978037B (en) * 2007-12-21 2015-06-17 杜邦营养生物科学有限公司 Process for edible oil refining using a lipid acyltransferase
GB0807161D0 (en) * 2008-04-18 2008-05-21 Danisco Process
EP2279248B1 (en) 2008-04-30 2015-04-01 DuPont Nutrition Biosciences ApS Proteins
US7869112B2 (en) * 2008-07-25 2011-01-11 Prysm, Inc. Beam scanning based on two-dimensional polygon scanner for display and other applications
GB0908770D0 (en) 2009-04-24 2009-07-01 Danisco Method
US20120058222A1 (en) 2009-05-19 2012-03-08 Danisco A/S Use
EP2446027A1 (en) 2009-06-25 2012-05-02 Danisco A/S Protein
GB0920089D0 (en) 2009-11-17 2009-12-30 Danisco Method
WO2011114251A1 (en) 2010-03-18 2011-09-22 Danisco A/S Foodstuff
US8686218B2 (en) 2010-04-14 2014-04-01 The Penn State Research Foundation Strategies for the transgenic manipulation of filamentous fungi
GB201011513D0 (en) 2010-07-08 2010-08-25 Danisco Method
BR112013025811A2 (en) 2011-04-08 2016-11-29 Danisco Us Inc "composition and method for removing a lipid based stain from a surface"
GB201112091D0 (en) 2011-07-14 2011-08-31 Gt Biolog Ltd Bacterial strains isolated from pigs
GB201117313D0 (en) 2011-10-07 2011-11-16 Gt Biolog Ltd Bacterium for use in medicine
BR112014031526A2 (en) 2012-06-19 2017-08-01 Dsm Ip Assets Bv promoters to express a gene in a cell
WO2014063097A1 (en) 2012-10-19 2014-04-24 Danisco Us Inc. Stabilization of biomimetic membranes
GB201306536D0 (en) 2013-04-10 2013-05-22 Gt Biolog Ltd Polypeptide and immune modulation
CA2934039A1 (en) 2013-12-19 2015-06-25 Danisco Us Inc. Use of hydrophobins to increase gas transferin aerobic fermentation processes
US20170306360A1 (en) 2014-10-24 2017-10-26 Danisco Us Inc. Method for producing alcohol by use of a tripeptidyl peptidase
DK3209773T3 (en) 2014-10-24 2020-06-15 Dupont Nutrition Biosci Aps PROLINTOLERANT TRIPEPTIDYLPEPTIDASES AND APPLICATIONS THEREOF
KR20220151045A (en) 2014-12-23 2022-11-11 4디 파마 리서치 리미티드 Immune modulation
HUE037476T2 (en) 2014-12-23 2018-08-28 4D Pharma Res Ltd Pirin polypeptide and immune modulation
MA41010B1 (en) 2015-06-15 2020-01-31 4D Pharma Res Ltd Compositions comprising bacterial strains
EA201890048A1 (en) 2015-06-15 2018-06-29 4Д Фарма Рисёрч Лимитед COMPOSITIONS CONTAINING BACTERIAL STRAINS
MA41060B1 (en) 2015-06-15 2019-11-29 4D Pharma Res Ltd Compositions comprising bacterial strains
ME03511B (en) 2015-06-15 2020-04-20 4D Pharma Res Ltd Compositions comprising bacterial strains
EA201890050A1 (en) 2015-06-15 2018-06-29 4Д Фарма Рисёрч Лимитед COMPOSITIONS CONTAINING BACTERIAL STRAINS
CN107849595A (en) 2015-06-26 2018-03-27 杜邦营养生物科学有限公司 Aminopeptidase for protein hydrolysate
EP3209310B1 (en) 2015-11-20 2018-01-31 4D Pharma Research Limited Compositions comprising bacterial strains
GB201520497D0 (en) 2015-11-20 2016-01-06 4D Pharma Res Ltd Compositions comprising bacterial strains
GB201520631D0 (en) 2015-11-23 2016-01-06 4D Pharma Res Ltd Compositions comprising bacterial strains
GB201520638D0 (en) 2015-11-23 2016-01-06 4D Pharma Res Ltd Compositions comprising bacterial strains
LT3313423T (en) 2016-03-04 2019-06-25 4D Pharma Plc Compositions comprising bacterial blautia strains for treating visceral hypersensitivity
GB201612191D0 (en) 2016-07-13 2016-08-24 4D Pharma Plc Compositions comprising bacterial strains
TWI802545B (en) 2016-07-13 2023-05-21 英商４Ｄ製藥有限公司 Compositions comprising bacterial strains
GB201621123D0 (en) 2016-12-12 2017-01-25 4D Pharma Plc Compositions comprising bacterial strains
RS61872B1 (en) 2017-05-22 2021-06-30 4D Pharma Res Ltd Compositions comprising bacterial strains
EP3630942B1 (en) 2017-05-24 2022-11-30 4D Pharma Research Limited Compositions comprising bacterial strain
EP3638271B1 (en) 2017-06-14 2020-10-14 4D Pharma Research Limited Compositions comprising bacterial strains
AU2018285453B2 (en) 2017-06-14 2020-03-19 Cj Bioscience, Inc. Compositions comprising a bacterial strain of the genus Megasphaera and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986006097A1 (en) * 1985-04-15 1986-10-23 Allelix, Inc. Promoters of filamentous fungi and use thereof
CA2024448A1 (en) * 1989-08-31 1991-03-01 Medhavinee Devchand Recombinant dna expression system for aspergillus

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2142602A1 (en) * 1992-08-19 1994-03-03 Tiina Hannele Nakari Fungal promoters active in the presence of glucose

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986006097A1 (en) * 1985-04-15 1986-10-23 Allelix, Inc. Promoters of filamentous fungi and use thereof
CA2024448A1 (en) * 1989-08-31 1991-03-01 Medhavinee Devchand Recombinant dna expression system for aspergillus
US5171672A (en) * 1989-08-31 1992-12-15 Allelix Biopharmaceuticals Inc. Recombinant DNA system for Aspergillus

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHEMICAL ABSTRACTS, vol. 115, no. 9, 2 September 1991, Columbus, Ohio, US; abstract no. 86755c, page 222; *
DOWZER, C. E. A ET AL.: "Analysis of the creA gene, a regulator of carbon catabolite repression in Aspergillus nidulans", MOLECULAR AND CELLULAR BIOLOGY, vol. 11, no. 11, November 1991 (1991-11-01), WASHINGTON US, pages 5701 - 5709 *
FELENBOCK, B. ET AL.: "The ethanol regulon in Aspergillus nidulans: characterization and sequence of the positive regulatory gene alcR", GENE, vol. 73, no. 2, December 1988 (1988-12-01), AMSTERDAM NL, pages 385 - 396 *
GRIGGS, D.W. ET AL.: "Regulated expression of the GAL4 activator gene in yeast provides a sensitive genetic switch for glucose repression", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 88, October 1991 (1991-10-01), WASHINGTON US, pages 8597 - 8601 *
GWYNNE, D.I, ET AL.: "Comparison of the cis-acting control regions of two coordinately controlled genes involved in ethanol utilization in Aspergillus nidulans", GENE, vol. 51, 1987, AMSTERDAM NL, pages 205 - 216 *
HINTZ, W.E. ET AL.: "A glucose-derepressed promoter for expression of heterologous products in the filamentous fungus Aspergillus nidulans", BIOTECHNOLOGY, vol. 11, 1993, NEW YORK US, pages 815 - 818 *
KULMBURG, P. ET AL.: "Specific binding sites in the alcR and alcA promoters of the ethanol regulon for the CREA repressor mediating carbon catabolite repression in Aspergillus nidulans", MOLECULAR MICROBIOLOGY, vol. 7, no. 6, 1993, pages 847 - 857 *
LOCKINGTON. R. ET AL.: "Regulation of alcR, the positive regulatory gene of the ethanol utilization regulon of Aspergillus nidulans", MOLECULAR MICROBIOLOGY, vol. 1, no. 3, 1987, pages 275 - 281 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997009438A1 (en) * 1995-09-01 1997-03-13 Valtion Teknillinen Tutkimuskeskus Process for modifying glucose repression
US6326477B1 (en) 1995-09-01 2001-12-04 Valtion Teknillinen Tutkimuskeskus Process for modifying glucose repression
US8916363B2 (en) 1996-10-10 2014-12-23 Dyadic International (Usa), Inc. Construction of Highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
US8673618B2 (en) 1996-10-10 2014-03-18 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
US8268585B2 (en) 1998-10-06 2012-09-18 Dyadic International (Usa), Inc. Transformation system in the field of filamentous fungal hosts
WO2000024883A1 (en) 1998-10-26 2000-05-04 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
WO2002064802A2 (en) * 2001-02-13 2002-08-22 Syngenta Limited Regulatory genes suitable for use in gene expression
WO2002064802A3 (en) * 2001-02-13 2002-12-05 Syngenta Ltd Regulatory genes suitable for use in gene expression
US7592157B2 (en) 2003-11-06 2009-09-22 Genencor International, Inc. Expression in filamentous fungi of protease inhibitors and variants thereof
US7592420B2 (en) 2003-11-06 2009-09-22 Genencor International, Inc. Expression in filamentous fungi of protease inhibitors and variants thereof
EP2292641A3 (en) * 2003-11-06 2011-06-22 Genencor International, Inc. Expression in filamentous fungi of protease inhibitors and variants thereof
EP1689766A4 (en) * 2003-11-06 2008-07-23 Genencor Int Expression in filamentous fungi of protease inhibitors and variants thereof
EP1689766A1 (en) * 2003-11-06 2006-08-16 Genencor International, Inc. Expression in filamentous fungi of protease inhibitors and variants thereof
WO2005047302A1 (en) 2003-11-06 2005-05-26 Genencor International, Inc. Expression in filamentous fungi of protease inhibitors and variants thereof
EP2505651A2 (en) 2006-12-10 2012-10-03 Dyadic International, Inc. Isolated fungus with reduced protease activity
US8551751B2 (en) 2007-09-07 2013-10-08 Dyadic International, Inc. BX11 enzymes having xylosidase activity
WO2014012145A1 (en) * 2012-07-18 2014-01-23 Queensland University Of Technology Constructs for modulating transpiration in plants and uses therefor
AU2013205472B2 (en) * 2012-07-18 2015-01-29 Queensland University Of Technology Constructs for Modulating Transpiration in Plants and Uses Therefor

Also Published As

Publication number Publication date
NO952293L (en) 1995-06-09
FI952801A0 (en) 1995-06-07
CA2151154C (en) 1999-01-26
AU666443B2 (en) 1996-02-08
US5674707A (en) 1997-10-07
CA2151154A1 (en) 1994-06-23
FI952801A (en) 1995-06-07
NO952293D0 (en) 1995-06-09
ATE219143T1 (en) 2002-06-15
JPH08504327A (en) 1996-05-14
EP0673429A1 (en) 1995-09-27
AU6653494A (en) 1994-07-04
NZ259339A (en) 1996-05-28
US5710021A (en) 1998-01-20
EP0673429B1 (en) 2002-06-12
DE69332030D1 (en) 2002-07-18
DK0673429T3 (en) 2002-10-07
DE69332030T2 (en) 2002-10-02

Similar Documents

Publication Publication Date Title
EP0673429B1 (en) Production of heterologous proteins in filamentous fungi
AU567031B2 (en) Glucoamylase cdna
Chiou et al. Chromosomal location plays a role in regulation of aflatoxin gene expression in Aspergillus parasiticus
EP0758020B1 (en) amdS gene from Aspergillus niger coding for an acetamidase
US4794175A (en) Glucoamylase CDNA
US5070020A (en) Recombinant dna expression vectors and dna compounds that encode deacetoxycephalosporin c synthetase
Yoshimoto et al. Characterization of the ATF1 and Lg-ATF1 genes encoding alcohol acetyltransferases in the bottom fermenting yeast Saccharomyces pastorianus
JP3979679B2 (en) DNA fragment having promoter function
JP5729702B2 (en) A method for improving the production amount of kojic acid using a gene essential for the production of kojic acid
Reinikainen et al. Escherichia coli growth and plasmid copy numbers in continuous cultivations
HU201116B (en) Process for producing plasmids having uncontrolled replication conduct under given circumstances
KR100454831B1 (en) Penicillin V Amidohydrolase Gene from Fuzarium Oxyporum
EP0549062B1 (en) A eukaryotic expression system
AU763586B2 (en) Production of heterologous proteins in filamentous fungi
JPH0829099B2 (en) Recombinant DNA, expression vector and plasmid, production method thereof and inducible and repressible foreign gene expression method
US5045461A (en) Method for increasing yield and nodulation by bradyrhizobium
JP2009118783A (en) Improvement of secretion production of protein by filamentous fungus
US5804423A (en) Microbiological method of making 5-ketogluconate
US5045463A (en) DNA expression vector and use thereof
US5656453A (en) Process for the production of recombinant proteins in streptomycetes
US5059534A (en) Rhizobium japonicum 191 NODD-related genes
CN117965587A (en) Bacterial strain containing hok/sok genes and preparation and application thereof
Napp et al. Catabolite repression and induction time effects for a temperature-sensitive GAL-regulated yeast expression system
CN117247924A (en) Ame1-FgTad2-FgTad3 editing enzyme system, editing tool and editing method
EP0628634A2 (en) Process for preparing serine hydroxymethyltransferase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR BY CA CZ FI HU JP KP KR KZ LK MG MN MW NO NZ PL RO RU SD SK UA VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2151154

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1994903785

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 259339

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 952801

Country of ref document: FI

WWP Wipo information: published in national office

Ref document number: 1994903785

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1994903785

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1994903785

Country of ref document: EP