WO2000024938A2 - CCG REPEATS IN cDNAs FROM HUMAN BRAIN - Google Patents

Abstract

Expansion mutations of trinucleotide repeats and other units of unstable DNA have been proposed to account for at least some of the genetic susceptibility to a number of neuropsychiatric disorders, including bipolar affective disorder, schizophrenia, autism, and panic disorder. To generate additional candidate genes for these and other disorders, cDNA libraries from humain brain were probed at high stringency for clones containing CCG, CGC, GCC, CGG, GCG, and GGC repeats (referred to collectively as CCG repeats). 18 cDNAs containing previously unpublished or uncharacterized repeats were characterized for chromosomal locus, repeat length polymorphism, and similarity to genes of known function. The cDNAs were also compared to the 37 human genes in GenBank with eight or more consecutive CCG triplets. The repeats were mapped to a number of loci, including 1p34, 2p11.2, 2q30-32, 3p21, 3p22, 4q35, 6q22, 7qter, 13p13, 17q24, 18p11, 19p13.3, 20q12, 20q13.3 and 22q12. Length polymorphism was detected in 50 % of the repects. The newly cloned cDNAs include a complete transcript of human neurexin 1B, a portion of BCNG-1 (a newly described brain-specific ion channel), a previously unreported polymorphic repeat located in the 5' UTR region of the guanine nucleotide-binding protein (G-protein)β2 subunit, and a human version of the mouse proline rich protein 7.

Description

CCG Repeats in cDNAs From Human Brain

This application claims the benefit of copending provisional application no. 60/105,885 filed October 27, 1998, which is expressly incorporated by reference in its entirety herein. This invention was made using funds supplied by the United States government.

Under the terms of grants from the National Institutes of Health, MHO 1275 and MH50763, the U.S. government may retain certain rights in the invention.

TECHNICAL FIELD OF THE INVENTION

This invention is related to diseases which result from expansion of microsatellite repeats. Such diseases are primarily of the central nervous system.

BACKGROUND OF THE INVENTION

Seventeen human disorders caused by trinucleotide repeat expansion or related mutations of repetitive DNA have been identified over the past seven years. Eight genes contain an expansion of a CAG repeat encoding glutamine, resulting in a group of eight dominant neurodegenerative disorders (Ross, 1997; Ross et al. 1998). Inheritance of two alleles with an expanded intronic GAA expansion in the frataxin gene causes most cases of Friedreich's ataxia (Campuzano et al. 1996), and a 3' untranslated CTG repeat in the DMPK gene causes myotonic dystropy (Brook et al. 1992; Mahadevan et al. 1992). Six different disorders are associated with mutations in the length of CCG, CGC,

GCC, CGG, GCG, and GGC repeats (here collectively referred to as CCG repeats). Large expansions of 5' untranslated CCG repeats cause fragile X A (FMR1 gene) (Yu et al. 1992) and fragile X E (FMR2 gene) (Knight et al. 1993). These disorders are characterized phenotypically by cognitive and psychiatric abnormalities, and genetically by the phenomenon of anticipation. Large expansions of a 5 ' -UTR CCG repeat in the

CBL2 protooncogene also result in some cases of Jacobsen's syndrome, an 1 lq deletion syndrome (Jones et al. 1995). Relatively small changes in the number of (GCN)n triplets encoding alanine cause several different disorders. A form of the developmental disorder cleidocranial dysplasia results from insertion of (GCN)10 (encoding 10 additional alanines) into a GCG repeat in core binding factor alpha 1 subunit A (CBFA1) (Mundlos et al. 1997). In HOXD13, an increase from (GCN)14 (encoding polyalanine) to

(GCN)21-28 results in synpolydactyly (Muragaki et al. 1996). Pedigrees with longer alanine expansions tend to have a more severe phenotype, suggesting that the insertion leads to a gain-of-function that alters the transcriptional regulatory function of this gene (Goodman et al. 1997). Most recently, an increase from (GCG)6 to (GCG)8-13 in PABP2 was found to cause the autosomal dominant form of oculopharyngeal muscular dystrophy (OMPD) (Brais et al. 1998). Homozygotes with (GCG)7~a single triplet longer than normal—develop an autosomal recessive form of the disease.

Two other disorders also reflect mutations in C-G rich sequences. An expansion of a dodecamer repeat (CCCCGCCCCGCG)in the 5' flanking region of the cystatin B gene is one of the mutations that can lead to the recessive disease progressive episodic myoclonic epilepsy (EPM1) (Lalioti et al. 1997; LaFreniere et al. 1997). The semidominant mouse mutant hypodactyly, characterized by a deficit in digital arch formation (Mortlock et al. 1996), is caused by a 50 base pair deletion in which the sequence ...CGGCGGCGGC N^ CGGCGGCGGC... is reduced to CGGCGGCGGC, presumably from a recombination or misalignment of the two identical trinucleotide repeat-containing regions during replication.

These discoveries have led to the hypothesis that variation in CCG repeat length may cause other diseases characterized by developmental abnormalities and/or anticipation, including neuropsychiatric disorders such as autism, schizophrenia, and bipolar affective disorder (Ross et al. 1993; Mclnnisa and Margolis, 1998; Mclnnis,

1996). Previous efforts to find candidate genes with repeats have primarily focused on CAG repeats (Li et al. 1993; Margolis et al. 1997; Reddy et al. 1997; Riggins et al. 1992; Neri et al. 1996; Bulle et al. 1997; Jiang et al. 1995; Albanese et al. 1998; Gastier et al. 1996; Breschel et al. 1997), with some attention to AAT (Margolis et al. 1995b) and CCA (Margolis et al. 1995a) repeats. Identification of candidate CAG repeats has led to the discovery of expansion mutations causing four neurodegenerative diseases: dentatorubral pallidoluysian atrophy (DRPLA) (Koide et al. 1994; Nagafuchi et al. 1994), spinocerebellar ataxia type 2 (Imbert et al. 1996), spinocerebellar ataxia type 3 (Machado-Joseph disease, Kawaguchi et al. 1994), and spinocerebellar ataxia type 6 (Zhuchenko et al. 1997). Despite the success of using library screens to identify CAG repeats associated with disease, less attention has been paid to the identification of CCG repeats (Li et al. 1993; Riggins et al. 1992; Albanese et al. 1998), even though seven human diseases arise from expansion of CCG (and related) repeats. There is a need in the art for identification of additional microsatellite markers which are involved in diseases of the central nervous system. SUMMARY OF THE INVENTION

It is an object of the present invention to provide a polynucleotide for detecting a microsatellite marker.

It is another object of the present invention to provide a method of determining a change in number of trinucleotide repeats in a microsatellite marker. It is an object of the present invention to provide a pair of primers for amplifying a microsatellite marker.

These and other objects of the invention are achieved by providing by one or more of the embodiments described below. In one embodiment a polynucleotide is provided for detecting a microsatellite marker selected from the group consisting of: P12A7, P12E1, P32B10, P32D9, P32H12, P42A5, P42F11, P55G12, P62D12, P72D4, P95B10,

CCG43, CCG82, CCG98, CCGFB48, CCGFB60, CCGFB64, and CCGFB84. The polynucleotide comprises at least 12 nucleotides complementary to contiguous nucleotides within 500 nucleotides of a trinucleotide repeat in the microsatellite marker in the human genome. According to another aspect of the invention a method is provided for determining a change in number of trinucleotide repeats in a microsatellite marker. A polynucleotide is hybridized to a nucleic acid sample of a patient to form a hybridized polynucleotide. The polynucleotide comprises at least 12 nucleotides complementary to contiguous nucleotides within 500 nucleotides of a trinucleotide repeat in a microsatellite marker in the human genome. The size of the hybridized polynucleotide is determined. An increase in the size of the hybridized polynucleotide relative to size of the polynucleotide hybridized to a nucleic acid sample of a normal human indicates a change in the number of trinucleotide repeats.

According to still another embodiment of the invention a pair of primers is provided for amplifying a microsatellite marker selected from the group consisting of P12A7, P12E1, P32B10, P32D9, P32H12, P42A5, P42F11, P55G12, P62D12, P72D4,

P95B10, CCG43, CCG82, CCG98, CCGFB48, CCGFB60, CCGFB64, and CCGFB84. Each primer is complementary to at least 12 contiguous nucleotides which are within 500 nucleotides of a trinucleotide repeat in the microsatellite marker in the human genome. Each primer of the pair is complementary to opposite strands of the micro satellite marker.

In yet another aspect of the invention a method is provided for determining a change in number of trinucleotide repeats in a microsatellite marker comprising. A pair of primers is used to amplify a template comprising a nucleic acid sample of a patient. The pair of primers amplify a microsatellite marker selected from the group consisting of P12A7, P12E1, P32B10, P32D9, P32H12, P42A5, P42F11, P55G12, P62D12,

P72D4, P95B10, CCG43, CCG82, CCG98, CCGFB48, CCGFB60, CCGFB64, and CCGFB84. Each primer is complementary to at least 12 contiguous nucleotides which are within 500 nucleotides of a trinucleotide repeat in the microsatellite marker in the human genome. Each primer of the pair is complementary to opposite strands of the microsatellite marker. The size of the microsatellite marker amplified is determined. An increase in size of the amplified microsatellite marker relative to the size of a microsatellite marker amplified using the pair of primers and a template comprising a nucleic acid sample of a normal human indicates a change in the number of trinucleotide repeats. Thus the present invention provides the art with additional tools for detecting the presence and in some cases the severity of disease-causing trinucleotide repeat expansion mutations. DETAILED DESCRIPTION

We have found a series of cDNAs derived from human brain that contain previously undescribed or uncharacterized CCG repeats. These cDNAs are useful in the diagnosis and evaluation of neuropsychiatric diseases. Rearrangements of microsatellite markers can be detected by Southern blotting,

PCR amplification, or any other technique known in the art for observing particular segments of DNA. Rearrangements typically involve an increase or decrease in the copy number of the repeated sequence, more typically an increase. For analysis of size of such markers one typically generates fragments of defined length. This can be done using restriction endonucleases, or PCR amplification, for example. Any other types of reactions which generate fragments of defined length as are known in the art can also be used.

Oligonucleotide probes and primers for detecting such microsatellite markers are preferably complementary, or mostly complementary to contiguous nucleotides which are adjacent to the actual CCG trinucleotide repeat. Typically the contiguous nucleotides are within 2 kb of the trinucleotide repeat, more typically within 1 kb, preferably within 500 bp, and more preferably within 250 bp. Additional features of the probes or primers may be present, such as linker sites comprising particular restriction endonuclease sites or other sites for specific interactions with particular proteins. The hybridization probes of the present invention can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence, and the like. After hybridization, the probes may be detected using known methods. The nucleic acid probes of the present invention include RNA, as well as DNA probes, suchprobes being generated using techniques known in the art.

A typical method for measuring the size of a microsatellite marker is by its electrophoretic mobility on a polyacrylamide gel. Other size measurements of polynucleotides may also be employed as are known in the art.

Samples for testing can be derived from patient samples or from immortalized cell lines. For example, blood cells can be used as a source of DNA which can be tested for the changes in the size of the trinucleotide repeat markers of the present invention. Any cells of the human body from which nuclear DNA can be extracted can be used as the sample source. Alternatively, cells can be immortalized and then tested, such as immortalized lymphoblastoid cells.

37 genes previously entered in GenBank have eight or more consecutive CCG repeats. A large proportion of these genes (38%) encode some form of transcription factor. As a rough comparison, 3.6% (229 of 41018 entries) of the human unigene database, 2.6% (2643 of 101225) of the Entrez GenBank human entries, and 2.6% (164 of 6245 entries) of the Swissprot database human entries contain the word "transcription". Since some transcription factors are not labeled as such, these figures underestimate the true number of transcription factor entries in these databanks.

Nonetheless, the implication is that genes with CCG repeats are more likely to encode transcription factors than other genes. In addition, expansion mutations in six of these 37 genes are known to cause human disease.

We have now cloned and partially characterized 18 cDNAs from human brain containing CCG repeats. 15 of these repeats have not been previously described. Our detection of a relatively large number of unreported repeats probably reflects the difficulty of sequencing ESTs that include extremely C-G rich domains, and also a bias against the presence of extreme 5' UTR sequence in known genes, particularly when such sequence is C-G rich. This suggests that as large scale sequencing of human genomic DNA continues over the next several years, specific efforts to clone C-G rich expressed sequences may remain a valuable tool in identifying transcribed C-G rich repeats.

Five of the repeats reported here have heterozygosities of at least 40%. The recent descriptions of disease-associated repeats that are only minimally polymorphic in the general population yet expand to cause disease (the repeats in SCA2, CBL2,

CBFA1, HOXD13, and PABP2) demonstrate that marked polymorphism is not necessary for expansion. Nonetheless, a disproportionate number of expansion mutations arise from polymorphic repeats, and such repeats are therefore of particular interest. Analysis of microsatellite sequences by polymerase chain reaction, for example, may follow the methods of Weber and May, Abundant Class of Human DNA Polymorphisms Which Can Be Typed Using the Polymerase Chain Reaction, Am. I. Hum. Genet. 44:388-96 (1989). Primer pairs are selected to hybridize to the DNA flanking the interspersed repetitive sequence loci at selected chromosomal locations. A variety of gene amplification techniques may be used for analysis of individual loci of interspersed repetitive sequences. Such methods may include, without limitation,

Polymerase Chain Reaction (PCR), Saiki et al., Enzymatic Amplification of Beta-Globin Genomic Sequences and Restriction Site Analysis for the Diagnosis of Sickle Cell Anemia, Science 230:1350-54 (1985); Ligase Chain Reaction (LCR), Wu and Wallace, The Ligation Amplification Reaction (LAR)- Amplification of Specific DNA Sequences Using Sequential Rounds of Template-Dependent Ligation, Genomics 4:560-69 (1989) and Landegren et al., A Ligase Mediated Gene Detection Technique, Science 241:1077-80 (1988); Q-beta-Replicase Template Amplification (Q-beta), Lomeli et al., Quantitative Assays Based on the Use of Replicatable Hybridization Probes, Clin. Chem. 35: 1826-31 (1989); and Strand Displacement Activation (SDA), Walder et al., Isothermal in vitro Amplification of DNA by a Restriction Enzyme/DNA Polymerase

System, Proc. Nat'l Acad. Sci. USA 89:392-96 (1992). RNA-based amplification methods may be used for those interspersed repetitive sequences that are expressed as RNA. An example of an RNA-based amplification method is Self-Sustained Sequence Replication (3SR), Guatelli et al., Isothermal In Vitro Amplification of Nucleic Acids by a Multi-enzyme Reaction Modified After Retroviral Replication, Proc. Nat'l Acad. Sci.

USA 87:1874 (1990).

Of the eighteen cDNAs with CCG repeats that we cloned, at least eight are present in 5'-UTR, consistent with the high rate (59%) of 5'-UTR repeats in known genes with CCG repeats. The function of 5'-UTR C-G rich regions in general remains unclear, though alterations of the G-C content in the promotor regions of various expression vectors influences the expression of reporter genes (Amirhaeri et al. 1995; Krajewski, 1996). It remains unknown whether the high rate of CCG trinucleotide repeats in 5'-UTRs reflects a specific function of the repeat or is a stochastic epiphenomenon of the high G-C content of 5'-UTRs. Four of the cDNAs are of particular interest because of their homology at the amino acid level to proteins with known neuronal functions. CCGFB60 contains the entire human coding sequence for neurexin-lβ, one of a family of brain-specific cell surface proteins that may have a role in mediating cell recognition (Missler and Sudhof, 1998). P42F11 contains part of human BCNG-1, a recently described brain-specific gene that appears to encode a new form of ion channel with pacemaker properties (Santoro et al. 1997, Santoro et al. 1998). P72D4 corresponds to the guanine nucleotide-binding protein (G-protein) β2 subunit, a ubiquitous component of signal transduction pathways (Sprang, 1997). The clone includes a CCG repeat located 5' to the sequence entry in GenBank. The repeat is polymorphic (heterozygosity of 40%), reaching a length of at least 18 consecutive triplets. CCGFB84 is the human version of the mouse proline rich protein 7, which interacts with the neuronal protein FE65 that in turn interacts with the β-amyloid precursor protein (Ermekova et al. 1997).

Finally, assignment of these repeats to chromosomal loci facilitates testing for associated expansions in diseases linked to these regions. For instance, P12A7 is near a region (18pl 1) linked to bipolar affective disorder (Berrettini et al. 1994), P42A5 is near a linkage site for schizophrenia (22ql2) (Gill et al. 1996) and CCG98 is near a linkage site for oculodentodigitial dysplasia (6q22) (Galdwin et al. 1997).

The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention.

EXAMPLE 1 Methods

Approximately 1 million plaques each from human frontal cortex and fetal brain cDNA phagemid libraries (Stratagene) were screened for cDNA inserts containing CCG repeats, as previously described (Margolis et al. 1997). The final wash was performed at 74-75° and filters were rescreened to exclude inserts of 28S RNA. Clones CCG43, CCG82, and CCG98 were obtained from the frontal cortex library, and clones CCGFB48, CCGFB60, CCGFB64, CCGFB84 were obtained from the fetal brain library. In addition, a human fetal brain cDNA library in pCMV- Sport (Life Technologies) was similarly screened using a modified version of the

GeneTrapper™ protocol (Wang et al. 1996). Inserts were sequenced (ABI) and compared to GenBank entries using BLASTN (Altshul et al. 1997) to exclude cDNAs derived from genes with previously characterized repeats. Double stranded sequence was obtained for at least 500 base pairs in the region of the repeat of each novel insert. Long open reading frames were examined for motifs at the amino acid level (Henikoff and Henikoff, 1994; Bairoch et al. 1997; Worley et al.

1995).

Length polymorphism was assessed in cDNAs containing at least five consecutive triplets by amplification across the repeat using a radiolabelled PCR primer as previously described (Margolis et al. 1997). The typical PCR protocol involved denaturation at 96° for 5 minutes, then 33 cycles of 95° for 1 minute, annealing (see Table 3) for 1 minute, and 72° for 1 minute, followed by a final extension of 72° for 7 minutes. Buffer J (Epicentre) improved product specificity, with the addition of 5% DMSO (CCGFB84) or 2.5% DMSO (P62D12). Template consisted of 40-80 ng of genomic DNA from a set of unrelated individuals from the Centre dΕtude du Polymorphisme Humaine (CEPH) collection (Dausset et al. 1990). Southern blots of each PCR product were probed with a radiolabelled (CGG)10 oligonucleotide to establish the presence of the repeat.

Most cDNAs were assigned to a specific locus using the Genebridge4 radiation hybrid panel (Walter et al. 1996). When possible, PCR was performed with the same primer pair used for analysis of length polymorphism. Primer pairs amplifying a region of cDNA adjacent to the repeat were used for radiation hybrid mapping of clones CCGFB48 (TGGCCTGCTGCTGGAG, ATGCCACTTGGTGCTCGTAT), CCGFB64 (CACCGGAGGCAGTGAGG, CCAGCACCAGCCAATAAAGC), P12E1 (GCGGGCAGGGTCATCAAG, TACGCGGTCGAGTCCAGGTA), P62D12 (GCACGCTGTCTCAATGTG, CATCATATTCTTGGCGATTT). Clones CCGFB60 and P32H12 were assigned to a locus by sequence identity to a mapped STS (Schuler, 1996). Clone CCGFB64 was assigned to chromosome 2 or 10 and P12E1 was assigned to chromosome 3 with the NIGMS monochromosomal human-rodent hybrid cell line panel 2 (Dubois and Naylor, 1993). EXAMPLE 2 Search of GenBank for CCG repeats

To determine the general characteristics of known genes containing CCG repeats in the human genome, the nonredundant GenBank database was searched for perfect matches with a (CGG)8 sequence using the BLASTN algorithm (Altshul et al. 1997).

Only human genes with 8 or more CGG repeats, in any orientation, were included. The resulting list (Table 1) contains 37 genes (and 3 other repeats of interest). 14 of the 37 (38%) encode some form of transcription factor.

Of the 37 genes with CCG repeats, 3 are in untranscribed regions, 22 (59%) are located in 5' untranslated regions (UTRs), while only 1 (3%) is in a 3 ' UTR. 11 repeats are in coding sequence; 6 encode polyalanine, 4 encode polyglycine, and 1 encodes polyproline. At least 12 of the 37 repeats are polymorphic in length, though information on many of the others is not available. Expansion mutation in the CGG repeats of 3 of the 37 are known to cause disease (FMRl, FMR2 and CBL2). CAG repeats in three other genes from this group expand to cause disease (HD, CACNA1 A, and AR).

EXAMPLE 3 Screening cDNA libraries for CCG repeats

Details of the cDNAs isolated by screening cDNA libraries are described in Table 2. The number of consecutive triplets ranges from five to 13. Many repeats are flanked by regions containing exclusively C-G base pairs, and five of the cDNAs contain two adjacent regions of perfect repeats. In 10 cDNAs, the coding status of the repeat could be definitively ascertained. Eight of these repeats are in 5' UTRs. Of the remaining two, one encodes alanine and the other encodes proline. 16 of the 18 cDNAs could be assigned to a chromosome by somatic hybrid mapping or a match to an STS. Polymorphism was generally assessed in 20 chromosomes, providing a rough estimate of the extent of heterozygosity and the range of common alleles (Table 3). Nine of the 18 repeats are polymorphic in length. The mean heterozygosity of the polymorphic repeats is 34%. Longer repeats tend to be more polymorphic: heterozygosity is 10% for loci with modal repeat lengths of 5-9 triplets (N=13) and 36% for loci with modal repeat lengths of 10-13 triplets (N=5) (t = .099, df = 16, p = .01, one-tailed). Differences in allele length in all cases appear to be in units of three base pairs (Wells and Warren, 1998).

References

Albanese V, Holbert S, Saada C, Meier-Ewert S, Lebre A-S, Moriniere S, Bougueleret

L, Le Gall I, Weissenbach J, Lennon G, Lehrach H, Cohen D, Cann HM, Neri C

(1998) CAG/CTG and CGG/GCC repeats in human brain reference cDNA: outcome in searching for new dynamic mutations. Genom 47:414-418

Altshul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997)

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389-3402 Amirhaeri S, Wohlrab F, Wells RD (1995) Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promotor. J Biol Chem

270:3313-3319 Bairoch A, Bucher P, Hofmann K (1997) The PROSITE database, its status in 1997.

Nucl Acids Res 25:217-221 Berrettini WH, Ferraro TN, Goldin LR, Weeks DE, Detera-Wadleigh S, Numberger JI J, Gershon ES (1994) Chromosome 18 DNA markers and manic-depressive illness: evidence for a susceptibility gene. Proc Natl Acad Sci U S A 91:5918-5921 Brais B, Bourchard JP, Xie YG, Rochefort DL, Chretien N, Tome FM, LaFreniere RG,

Rommens JM, Uyama E, Nohira O, Blumen S, Korcyn AD, Heutink P, Mathieu J,

Duranceau A, Codere F, Fardeau M, Rouleau GA (1998) Short GCG expansions in the PABP2 gene cause oculopharyngeal muscular dystrophy. Nature Genet

18:164-167 Breschel T, Mclnnis MG, Margolis RL, Sirugo G, Corneliuseen B, Simpson SG,

McMahon FJ, MacKinnon DF, Xu JF, Pleasant N, Huo Y, Ashworth RG,

Grundstrom C, Grundstrom T, Kidd KK, DePaulo JR, Ross CA (1997) A novel, heritable, expanding CTG repeat in an intron of SEF2-1 localizes to human chromosome 18q21.1. Hum Mol Genet 6:1855-1864 Brook JD, McCurrach ME, Harley HG, Buckler AJ, Church D, Aburatani H, Hunter K,

Davies J, Shelbourne P, Buxton J, Jones C, Juvonen V, Johnson K, Harper PS,

Shaw DJ, Housman DE (1992) Molecular basis of myotonic dystrophy: expansion of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a protein kinase family member. Cell 68:799-808 Bulle F, Chiannilkulchai N, Pawlak A, Weissenbach J, Gyapay G, Guellaen G (1997) Identification and chromosomal localization of human genes containing CAG/CTG repeats expressed in testis and brain. Genome Res 7:705-715 Campuzano V, Monteπnini L, Molto MD, Pianese L, Cossee M, Cavalcanti F, Monros E, Rodius F, Duclos F, Monticelli A, Zara F, Canizares J, Koutnikova H,

Bidichandani S, Gellera C, Brice A, Trouillas P, DeMichele G, Filla A, DeFrutos R, Palau F, Patel PI, Pragna I, DiDonato S, Mandel J-L, Cocozza S, Koenig M, Pandolfo M (1996) Friedreich's ataxia: Autosomal recessive disease caused by an intronic GAA triplet repeat expansion. Science 271:1423-1427 Dausset J, Cann H, Cohen D, Lathrop m, Lalouel JM, White R (1990) Centre d'Etude du Polymorphisme humaine (CEPH): Collaborative genetic mapping of the human genome. . Genom 6:575-577 Dubois BL, Naylor SL (1993) Characterization of NIGMS human/rodent somatic cell hybrid mapping panel 2 by PCR. Genom 16:315-319 Ermekova KS, Zambrano N, Linn H, Minopoli G, Gertler F, Russo T, Sudol M ( 1997)

The WW domain of neural protein FE65 interacts with proline-rich motifs in Mena, the mammalian homolog of Drosophila enabled. J Biol Chem 272:32869-32877

Galdwin A, Donnai D, Metcalfe K, Schrander-Stumpel C, Brueton L, Verloes A,

Aylsworth A, Toriello H, Winter R, Dixon M (1997) Localization of a gene for oculodentodigital syndrome to human chromosome 6q22-q24. Hum Mol Genet

6:123-127 Gastier JM, Brody T, Pulido JC, Businga T, Sunden S, Hu X, Maitra S, Buetow KH, Murray JC, Sheffield VC, Boguski M, Duyk GM, Hudson TJ (1996) Development of a screening set for new (CAG/CTG)n dynamic mutations. Genom 32:75-85 Gill M, Vallada H, Collier D, Sham P, Holmans P, Murray R, McGuffin P, Nanko S,

Owen M, Antonarakis S, Housman D, Kazazian H, Nestadt G, Pulver AE, Straub RE, MacLean CJ, Walsh D, Kendler KS, DeLisi L, Polymeropoulos M, Coon H, Byerley W, Lofthouse R, Gershon E, et al. (1996) A combined analysis of D22S278 marker alleles in affected sib-pairs: support for a susceptibility locus for schizophrenia at chromosome 22ql2. Schizophrenia Collaborative Linkage Group

(Chromosome 22). Am J Med Genet 67:40-45 Goodman FR, Mundlos C, Muragaki Y, Donnai D, Giovannucci-Uzielli ML, Lapi E, Majewski F, McGaughran J, McKeown C, Reardon W, Upton J, Winter RM, Olsen BR, Scambler PJ (1997) Synpolydactyly phenotypes correlate with size of expansions in HOXD13 polyalanine tract. Proc Natl Acad Sci USA 94:7458-7463 Henikoff S, Henikoff JG (1994) Protein family classification based on searching a database of blocks Genom 19:97-107

Huntington's Disease Collaborative Research Group (1993) A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72:971-983 frnbert G, Saudou F, Yvert G, Devys D, Trottier Y, Gamier J-M, Weber C, Mandel J-L

(Group 1), Cancel G, Abbas N, Durr A, Didierjean O, Stevanin , Agid Y, Brice A (Group 2) (1996) Cloning of the gene for spinocerebellar ataxia 2 reveals a locus with high sensitivity to expanded CAG/glutamine repeats. Nature Genet 14:295-296

Jiang JX, Deprez RH, Zwarthoff EC, RiegmanPH (1995) Characterization of four novel CAG repeat-containing cDNAs. Genom 30 : 91 -93

Jones C, Penny L, Mattina T, Yu S, Baker E, Voullaire L, Langdon WY, Sutherland GR, Richards RI, Tunnacliffe A (1995) Association of a chromosome deletion syndrome with a fragile site with the proto-oncogene CBL2. Nature 376:145-149

Kawaguchi Y, Okamoto T, Taniwaki M, Aizawa M, Inoue M, Katayama S, Kawakami H, Nakamura S, Nishimura M, Akiguchi I, Kimura J, Narumiya S, Kakizuka A

(1994) CAG expansions in a novel gene for Machado- Joseph disease at chromosome 14q32.1. Nature Genet 8:221-228

Knight SJL, Flannery AV, Hirst MC, Campbell L, Christodoulou Z, Phelps SR, Pointon J, Middletonprice HR, Barnicoat A, Pembrey ME, Holland J, Oostra BA, Bobrow M, Davies KE (1993) Trinucleotide repeat amplification and hypermethylation of a

CpG island in FRAXE mental retardation. Cell 74: 127-134

Koide O, Ikeuchi T, Onodera O, Tanaka H, Igarashi S, Endo K, Takahashi H, Kondo R, Ishikawa A, Hayashi T, Tomoda A, Miike T, Naito H, Ikuta F, Tsuji S (1994) Unstable expansion of CAG repeat in hereditary dentatorubral-pallidoluysian atrophy (DRPLA). Nature Genet 6:9-13 Krajewski WA (1996) Enhancement of transcription by short alternating CG tracts incorporated within a Rous sarcoma virus-based chimeric promotor: in vivo studies.

Mol Gen Genet 252:249-254 La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH (1991) Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature

352:77-79 LaFreniere RG, Rochefort DL, Chretien N, Rommens JM, Cochius JI, Kalviainen R,

Nousiainen U, Patty G, Farrell K, Soderfeldt B, Federico A, Hale BR, Cossio OH,

Sorensen T, Pouliot MA, Kmiec T, Uldall P, Janszky J, Pranzatelli MR, Andermann F, Andermann E, Rouleau GA (1997) Unstable insertion in the 5' flanking region of the cystatin B gene is the most common mutation in progressive myoclonus epilepsy type 1, EPM1. Nat Genet 15:298-302 Lalioti MD, Scott HS, Buresi C, Rossier C, Bottani A, Morris MA, Malafosse A,

Antonarakis SE (1997) Dodecamer repeat expansion in cystatin B gene in progressive myoclonus epilepsy [see comments]. Nature 386:847-851

Li S-H, Mclnnis MG, Margolis RL, Antonarakis SE, Ross CA (1993) Novel triplet repeat containing genes in human brain: Cloning, expression, and length polymorphisms. Genom 16:572-279 Mahadevan M, Tsilfidis C, Sabourin L, Shutler G, Amemiya C, Jansen G, Nelville C, Narang M, Barcelo J, OΗoy K, Leblond S, Earle-MacDonald J, DeJong PJ,

Wieringa B, Komeluk RG (1992) Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated region of the gene. Science 255:1253-1255 Margolis RL, Breschel TS, Li S-H, Kidwai AS, Antonarakis SE, Mclnnis MG, Ross CA

(1995a) Characterization of cDNA clones containing CCA trinucleotide repeats derived from human brain. Somat Cell Mol Genet 21 :279-284

Margolis RL, Breschel TS, Li S-H, Kidwai AS, Mclnnis MG, Ross CA (1995b)

Polymorphic (AAT)n trinucleotide repeats derived from a human brain cDNA library. Hum Genet 96:495-496 Margolis RL, Abraham MA, Gatchell SB, Li S-H, Kidwai AS, Breschel TS, Stine OC, Callahan C, Mclnnis MG, Ross CA (1997) cDNAs with long CAG trinucleotide repeats from human brain. Hum Genet 100:114-122 Mclnnis MG (1996) Anticipation: an old idea in new genes. Am J Hum Genet

59:973-979 McInnisaMG, Margolis RL (1998) Anticipation and psychiatric disease. In: Wells RD,

Warren ST (eds) Genetic Instabilities and Hereditary Neurological Diseases. Academic Press, Inc., San Diego pp. 401-411

MisslerM, Sudhof TC (1998) Neurexins: three genes and 1001 products. TIG 14:20-26 Mortlock DP, Post LC, Innis JW (1996) The molecular basis of hypodactyly (Hd): a deletion in Hoxa 13 leads to arrest of digital arch formation. Nature Genet

13:284-289 Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D,

Cole WG, Henn W, Knoll JHM, Owen MJ, Mertelsmann R, Zabel BU, Olsen BR

(1997) Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89:773-779 Muragaki Y, Mundlos S, Upton J, Olsen BR (1996) Altered growth and branching patterns in synpolydactyly caused by mutations in HOXD13. Science 272:548-551

Nagafuchi S, Yanagisawa H, Soto K, Shirayama T, Ohsaki E, Bundo M, Takeda T,

Tadokoro K, Kondo L MurayamaN, Tanaka Y, Kikushima H, Umino K, Kurosawa

H, Furukawa T, Nihei K, Inoue T, Sano A, Komure O, Takahashi M, Yoshizawa T,

Kanazawa L Yamada M (1994) Dentatorubral and pallidoluysian atrophy is caused by an expansion of an unstable CAG trinucleotide repeat on chromosome 12p.

Nature Genet 6:14-18 Neri C, Albanese V, Lebre AS, Holbert S, Saada C, Bougueleret L, Meier-Ewert S, Le

Gall L Millasseau P, Bui H, Giudicelli C, Massart C, Guillou S, Gervy P, Poullier E,

Rigault P, Weissenbach J, Lennon G, Chumakov I, Dausset J, Lehrach H, Cohen D, Cann HM (1996) Survey of CAG/CTG repeats in human cDNAs representing new genes: candidates for inherited neurological disorders. Hum Mol Genet 5: 1001-1009 Reddy PH, Stockburger E, Gillevet P, Tagle DA (1997) Mapping and characterization of novel (CAG)n repeat cDNAs from adult human brain derived by the oligo capture method. Genom 46: 174-182 Riggins GJ, Lokey LK, Chastain JL, Leiner HA, Sherman SL, Wilkinson KD, Warren

ST (1992) Human genes containing polymorphic trinucleotide repeats. Nat Genet

2:186-190 Ross CA, Mclnnis MG, Margolis RL, Li S-H (1993) Genes with triplet repeats: Candidate mediators of neuropsychiatric disorders. Trends Neurosci 16:254-260

Ross CA (1997) Intranuclear neuronal inclusions: A common pathogenic mechanism for glutamine-repeat neurodegenerative diseases? NeurOn 19: 1147-1150 Ross CA, Margolis RL, Becher MW, Wood JD, Engelender S, Sharp AH (1998)

Pathogenesis of polyglutamine neurodegenerative diseases: towards a unifying mechanism. In: Wells RD, Warren ST (eds) Genetic instabilities and hereditary neurological diseases. Academic Press, Inc., San Diego: Santoro B, Grant SG, Bartsch D, Kandel ER (1997) Interactive cloning with the SH3 domain of N-src identifies a new brain specific ion channel protein, with homology to eag and cyclic nucleotide-gated channels. Proc Natl Acad Sci USA 94:14815-14820

Santoro B, Liu DT, Yao H, Bartsch D, Kandel ER, Siegelbaum SA, Tibbs GR (1998)

Identification of a gene encoding a hype olarization-activated pacemaker channel of brain. Cell 93:717-729 Schuler GD (1996) A gene map of the human genome. Science 274:540-546 Sprang SR (1997) G proteins, effectors and GAPs: structure and mechanism. Curr Opin

Struct Bio 7:849-856 Walter M, Spillett D, Thomas P, Weissenbach J, Goodfellow P (1996) A method for constructing radiation hybrid maps of whole genomes. Nature Genet 7:22-28 Wang Q, Curran ME, Splawski I, Bum TC, Millholland JM, VanRaay TJ, Shen J, Timothy KW, Vincent GM, de Jager T, Schwartz PJ, Toubin JA, Moss AJ, Atkinson

DL, Landes GM, Connors TD, Keating MT (1996) Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet

12:17-23 Wells RD, Warren ST (1998) Genetic Instabilities and Hereditary Neurological Diseases. Academic Press, Inc., San Diego Worley KC, Wiese BA, Smith RF (1995) BEAUTY: An enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results. Gen Res 5:173-184

Yu S, Pritchard M, Kremer E, Lynch M, Nancarrow J, Baker E, Holman K, Mulley JC, Warren ST, Schlessinger D, Sutherland GR, Richards RI ( 1992) Fragile X genotype characterized by an unstable region of DNA. Science 252: 1179-1981

Zhuchenko O, Bailey J, Bonnen P, Ashizawa T, Stockton DW, Amos C, Dobyns WB, Subramony SH, Zoghbi HY (1997) Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the alpha_1A-voltage-dependent calcium channel. Nature Genet 15 : 62-69

Table 1. Human genes with eight or more consecutive CCG triplets.

Gene I Longest Repeat Repeat Locus

*=poιymorphic encoding

CACNAIA (alA voltage dependent calcium channel) (GCG)9 5' UTR 19pl3

ALK-5 (TGF beta receptor type 1) (GCG)9 Ala 9q33-q34

AR (androgen receptor) (GGC)18* Gly Xql l.2-Xql2

AE3 (anion exchanger 3) (CGG)IO intronic 2q32-33

ATBF1 (α-fetoprotein enhancer-binding protein) (CCG)IO 5'UTR 16q22.3-23.1

BARK1 (β-adrenergic receptor kinase type 1) (CGG)8 5* UTR l lql3

Bleo (bleomycin hydrolase) (CGG)10* 5' flanking 17qll.2

Brain- 1 (a class III POU gene) (CGG)9 3' UTR --

Brn-3b (a POU domain-containing gene) (GGC)12 Gly 4q31.2

c-Ha-ras-1 oncogene (CGG)8 5' flanking l lpl5

Calpain, small subunit (calcium-dependent protease) (GCC)IO Gly 19

CBL2 protooncogene (CGG)l l* 5 JTR l lq23.3

Finb (zinc finger transcriptional activator) (GCC)9 5'UTR

FKh 15 (for head family DNA binding protein) (GCC)9 Ala 9q22

FMR1 (fragile X mental retardation 1) (CGG) 10* 5' UTR Xq27.3

FMR2 (fragile X mental retardation 2) {CCG)15* 5' UTR Xq27.3-q28

FREAC-1 (forkhead-related activator protein) (CGG)8 5' UTR 16q24 GSTl-Hs (GTP-binding protein) (CGG) 10* 5' UTR 16pl3.1

β-HLH DNA binding protein (H-twist) (GGC)9 Gly 7p21

HAUSP (herpesvirus assoc ubiquitin-specific protease) (CCG)8 5' UTR —

HB-9 (homoeobox gene) (GCC)l l Ala Iq41-q42

HFKH4 (Forkhead like 4) (GCC)9 Ala —

HHR6B (ubiquitin conjug. enzyme) (CGG)11 5' UTR 5q23-q31

HD (huntington) (CCG)8* Pro 4pl6.3

HXC-26 (CCG)9 5' UTR Xq28

IRS-2 (insulin receptor substrate-2) (GCC)8 Ala —

KIAA0359 (brain-derived) (CGG)12 5' UTR —

LTG-19 (chromosomal translocation associated gene) (CGG)8 5' UTR 19pl3

MRP (multidrug resistance-associated protein) (GCC)14 5' UTR 16pl3.1

Na,K-ATPase β subunit (CCG)8* 5' UTR Iq23-q2f

NCAD (N-cadherin) (CCG)8* 5' UTR 18qll.2

PILOT (transcription factor) (CGG)10 5' UTR 8p21-23

RELN (reelin) (CGG)l l 5' UTR 7q22

TrkC (tyrosine receptor kinase) (CGG)8* 5' UTR 15q24-ψ

VLDL (very low density lipid) receptor (CGG)8* 5' UTR 9p24

XAP-5 (CCG)9* 5' UTR Xq28

ZIC3 (zinc-finger cerebellum 3 transcription factor) (GCC)8 Ala Xq26.2 Other CCG repeats of interest:

FRAXF (GCC)8* N/A Xq28

FRA16A (CCG)7* N/A 16pl3.11

(CCG)8 N/A pi 2 on chrom

28s rRNA 13, 14, 15, 21, 22

Table 2. cDNAs with CCG repeats: locus and homologies to known genes

Clone Longest Repeat Radiation hybrid Chromosomal

(GenBank #) consecutive translation results locus Homology repeat

CCG43 9 ? 83 cR from 2pll.2 repeat

(AF06777) GATA85A06 region and part of 5' flanking region similar to brain- 1 (POU3F3, G17183)

CCG82 6-4 ? 3.15 cR from 3p21 STS

(AF064839) WI-9324 G24812

CCG98 9 Ala 2.74 cR from 6q22 none

(AF064840) D6S266

P72D4 (AF064853)

P95B10 (AF064854)

Table 3. Repeat length polymorphism. Repeat length indicates greatest number of consecutive perfect repeats. Hz = heterozygosity.

Allele length:

Repeat Annealing Product # chrom frequency

Clone length PCR primers temp °C length (bp) tested Hz

CCG43 9 TCCGCAGCCGCCGTCAGCAC 65 145 20 145: 1.00 0% TCTCTGGGTGGAGGGGAGGG

CCG82 5 CAACGGCATGGAACAGCG 62 100 20 100: 1.00 0% GGAGCGGGTCACTTGGTCG

CCG98 9 CGTGAATGAGAGCAAACC 59 160 20 160: 1.00 0%

CGCCCTAAACTCCACTACTT

CCGFB48 13 CCGGTGGCTCGGCGG 60 68 20 77: .15 40% GGAGCTGGAGGTAGACGACGA 68: .75

65: .10

CCGFB60 10 TGCCGGTGACCTGTAGATT 56 155 20 155: 1.00 0% CCTGGCCCTGCTTTGGA

CCGFB64 10 CTCGCGCTCTGCCTCCCTC 60 268 30 280: .05 60% ACTGCCTCCGGTGGATGATG 277: .10

271 : .15

268: .45

265: .15

262: .10

CCGFB84 7-4 CGA6GAGGAGGACGACGAC 50 190 20 190: 1.00 0% TTCTTCACACCCAATGCTGA

P12A7 10 TCGCGCTGCTGGGAGGCT 65 91 20 91 : .55 30% GGCCGCCCTCGTGCTTG 82: .45

Table 3. Repeat length polymorphism. Repeat length indicates greatest number of consecutive perfect repeats. Hz = heterozygosity.

P12E1

P32B10

P32D9

P32H12

P42A5

P42F11

P55G12

P62D12

P72D4

P95B10

Claims

ClyAJMS

1. A polynucleotide for detecting a microsatellite marker selected from the group consisting of: P12A7, P12E1, P32B10, P32D9, P32H12, P42A5, P42F11, P55G12, P62D12, P72D4, P95B10, CCG43, CCG82, CCG98, CCGFB48,

CCGFB60, CCGFB64, and CCGFB84, wherein the polynucleotide comprises at least 12 nucleotides complementary to contiguous nucleotides within 500 nucleotides of a trinucleotide repeat in the microsatellite marker in the human genome.

2. A method of determining a change in number of trinucleotide repeats in a microsatelUte marker, comprising: hybridizing a polynucleotide according to claim 1 to a nucleic acid sample of a patient to form a hybridized polynucleotide; determining size of the hybridized polynucleotide, wherein an increase in the size of the hybridized polynucleotide relative to size of the polynucleotide hybridized to a nucleic acid sample of a normal human indicates a change in the number of trinucleotide repeats.

3. The method of claim 2 wherein the nucleic acid sample of the patient comprises fragments of known sizes.

4. The method of claim 2 wherein the nucleic acid sample of the patient comprises restiction enzyme digested DNA.

5. The method of claim 2 wherein the patient is suspected of having a neurological disorder.

6. A pair of primers for amplifying a microsatellite marker selected from the group consisting of P12A7, P12E1, P32B10, P32D9, P32H12, P42A5,

P42F11, P55G12, P62D12, P72D4, P95B10, CCG43, CCG82, CCG98, CCGFB48, CCGFB60, CCGFB64, and CCGFB84, wherein each primer is complementary to at least 12 consecutive nucleotides which are within 500 nucleotides of a trinucleotide repeat in the microsatellite marker in the human genome, and wherein each primer of the pair is complementary to opposite strands of the microsatellite marker.

7. The pair of primers of claim 6 which is selected from primers 1-36, (SEQ ID NOS: 19-54).

8. A method for determining a change in number of trinucleotide repeats in a microsatellite marker comprising: amplifying a microsatellite marker using a pair of primers according to claim

6 and a template comprising a nucleic acid sample of a patient; determining size of the microsatellite marker amplified, wherein an increase in size of the amplified microsatellite marker relative to the size of a microsatellite marker amplified using the pair of primers and a template comprising a nucleic acid sample of a normal human indicates a change in the number of trinucleotide repeats.

9. The method of claim 8 wherein the patient is suspected of having a neurological disorder.

10. The method of claim 2 or 8 wherein the microsatellite marker is P 12A7 and the patient is suspected of having bipolar affective disorder.

11. The method of claim 2 or 8 wherein the microsatellite marker is P42 A5 and the the patient is suspected of having schizophrenia.

12. The method of claim 2 or 8 wherein the microsatellite marker is CCG98 and the the patient is suspected of having oculodentodigitial dysplasia.