AU763586B2 - Production of heterologous proteins in filamentous fungi - Google Patents

Description

AUSTRALIA

Patent's Act COMPLETE SPECIFICATION

(ORIGINAL)

Class Int. Class Application Number: Lodged: Complete Specification Lodged: Accepted: Published: Priority Related Art: IP Australia Documents receeO on.

0 1 MAY 2001 3 Batch No: Name of Applicant: Gist-Brocades N.V.

Actual Inventor(s): William E Hintz, Peter A Lagosky Address for Service: PHILLIPS ORMONDE FITZPATRICK Patent and Trade Mark Attorneys 367 Collins Street Melbourne 3000 AUSTRALIA Invention Title: PRODUCTION OF HETEROLOGOUS PROTEINS IN FILAMENTOUS FUNGI Our Ref: 643239 POF Code: 118217/118217 The following statement is a full description of this invention, including the best method of performing it known to applicant(s): 1o PRODUCTION OF HETEROLOGOUS PROTEINS IN FILAMENTOUS

FUNGI

Technical Field This invention applies the art of recombinant DNA technology to the product of desired proteins in microbial hosts, particularly the filamentous fungi including Aspergillus species.

Background of the Invention The present application is a divisional application of Australian patent application number 66534/94, the entire disclosure of which is incorporated herein by reference.

A variety of gene expression systems have been developed for use with filamentous fungal hosts. Among these are systems that exploit carbon catabolite-repressed promoters, e.g., 1 glucose-repressed promoters, selected primarily because their Sability to drive gene expression can be tightly controlled simply by altering fermentation conditions. One system of this t ype utilizes the promoter of the Aspergillus nidulans alcA gene, which is repressed in the presence of glucose and is induced by ethanol, threonine or related metabolites under glucose-depleted conditions (see Gwynne et al., Biochem. Soc.

20 20 Trans., 17:338). This dual control offers an attractive, phased approach to fermentation, in which the host Aspergillus strain is first cultured in the presence of glucose to maximize biomass, and is then cultured under glucose-depleted conditions in the presence of inducer, to elicit production of the desired protein. Similarly regulated systems have also been developed, and make use of other glucose-repressed promoters such as the S* promoter of the aldA gene of Aspergillus nidulans (see Pickett et al., Gene (1987) 51:217), the amdS gene of Aspergillus nidulans (see Scazzocchio et al., 1992, infra), the gla gene of Aspergillus niqer (see Fowler et al., Curr. Genet. (1990), 18:537) and the acvA and ipnA genes of Aspergillus nidulans and of Cephalosporium chrysogenum (see Brakhage et al., (1992) 174:3789).

Although the control over gene expression offered by glucose-repressed promoters is desirable in many instances, their use can complicate the production phase of fermentation.

For gene product to form, the host strain must be cultured not W:janelle\speci666443div.doc only under glucose-depleted conditions, but also in a medium that employs a carbon source alternative to the more preferred substrate, glucose. It would accordingly be desirable to develop promoters that are relieved of their glucose-repressed function.

Studies of the glucose-mediated mechanism of carbon catabolite repression in Asperqillus and other filamentous fungi have implicated the product of the creA gene as the priniciple repressor. It is now widely accepted (see Scazzocchio, in Asperaillus; Biology and Industrial Applications, Butterworth-Heinemann, 1992 at pp.43-63) that when glucose is present, the creA gene product represses expression of genes involved in utilization of other carbon substrates such as ethanol and lactose, and thereby inhibits utilization of those other pathways when glucose is available.

Cloning and analysis of Asperqillus nidulans creA has been reported recently by Dowzer and Kelly in Mol. Cell. Biol.

(1991) 11:5701.

The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia before the priority date of each claim of this application.

*ee ee *e *ee* 2a Summary of the Invention The present invention provides a recombinant DNA construct in which protein-encoding DNA is linked operably with a filamentous fungal promoter variant having at least one creA binding site which has been functionally disrupted and other regulatory sequences, wherein said promoter variant can mediate expression of said protein-encoding DNA in the presence of glucose and can be induced.

The domain at which the creA gene product binds within the promoter regions of glucose-repressed filamentous fungal genes has now been identified.

This discovery is exploited, in accordance with the present invention, to disrupt the creA binding domain within glucose-repressed promoters, and thereby provide promoter variants that can~drive expression in the presence of glucose.

More particularly, and according to one aspect of the invention, there is provided a recombinant DNA expression cassette useful to achieve expression of protein-encoding DNA in a filamentous fungal host, the cassette comprising the protein-encoding DNA and, linked operably therewith, a promoter variant having a creA binding site that is disrupted to permit expression of the proteinencoding DNA in the presence of glucose.

In embodiments of the present invention, the promoter X:\Ellsab(th\pJC\SPECI\4 3 8 7 4-Ol .doc 3 involved in ethanol metabolism, selected for example from the alcA, aldA and alcR genes of Asper-ill-u nidulanM.

In another of its aspects, the present invention provides a filamentous fungal strain having incorporated therein a recombinant DNA expression cassette comprising heterologous

DNA

and, linked operably therewith, a promoter variant having a disrupted creA binding site.

According to another aspect of the invention, there is io provided a method for producing a desired protein, which comprises the step of culturing in the presence of glucose a filamentous fungal strain having incorporated therein a recombinant DNA expression cassette comprising DNA coding for the desired protein and, linked operably therewith, a promoter 15 variant having a disrupted and spatially preserved creA binding site.

siteThe invention and its preferred embodiments are now described in greater detail with reference to the accompanying drawings.

Brief Reference to the Drawinqs Figure 1 illustrates the nucleotide sequence of a region of the Asperillus niduans alcA promoter. See also SEQ ID NO: 3 of the Sequence Listing.

Figure 2 illustrates schematically the construction of an alcA promoter variant.

Detailed Descrition and preferred Embodiments The present invention provides a strategy for altering those promoters of filamentous fungal genes that are normally glucose repressed, in order to provide promoter variants that function in the presence of glucose to drive expression of s3 protein-encoding DNA linked operably with the promoter variant.

This is achieved by eliminating the creA binding site within the glucose-repressed promoter, either by deletion or more desirably by nucleotide substitution. As used herein, the term "promoter variant" thus refers to a glucose-repressed promoter in which a creA binding site normally resident therein has been disrupted, allowing the promoter variant to function in the presence of a glucose concentration sufficient to sustain growth of a given filamentous fungal strain.

Throughout the description and claims of this specification, the word "comprise" and variations of the word, such as "comprising" and "comprises", is not intended to exclude other additives, components, integers or steps.

For purposes of the present invention, promoter variants can in principle be developed from the promoter of any glucoserepressed filamentous fungal gene that incorporates within its promoter sequence the creA binding domain. The creA binding domain is characterized as a GC rich motif, and is more particularly identified as a nucleotide region in which at 15 least six G or C residues are incorporated within a contiguous ten nucleotide stretch. The specific sequence of a creA binding domain can vary widely within this parameter, and may for example consist entirely of contiguous G/C residues, e.g., GCGGGGC, or of G/C residues interrupted by one or more A and T residues.

The creA binding domain within a promoter is located typically upstream of each of the required regulatory elements, i.e. the translational and transcriptional start sites. For glucose-repressed filamentous fungal genes having published sequences, identifying the creA binding domain within the promoter will of course be a simple task of locating the GC 25 rich sequence within that sequence. For genes that have been cloned but for which no sequence is yet known, the creA binding domain can be located after sequencing the region of the gene, using techniques established in the art.

For other glucose-regulated genes, cloning and then sequencing of the 5'-untranslated region thereof will be necessary but can be achieved also according to procedures well established in the art of molecular biology.

From those glucose-repressed promoters incorporating the creA binding domain, promoter variants that are functional in the presence of glucose are obtained by disrupting the creA binding domain. Disruption can be achieved either by wholesale deletion of the creA binding domain and the region 5' thereof, W:janellesped666443divdoc 5 by selective deletion from within the promoter of the creA binding domain or a functional portion thereof, or, more preferably, by replacing one or more of the G/C residues within the creA binding domain. Replacement residues are desirably s adenine and thymine. Relative to wholesale and selective deletion, G/C replacement has the advantage of preserving the spatial relationship, and function, of other regulatory domains within the promoter variant. Of course, this can be particularly important in the circumstance where expression o0 regulating regions exist within the promoter at a site upstream of the creA binding site.

In some cases, promoters may contain more than one creA binding site, and it is desirable, in order to eliminate glucose-repression thereof, to disrupt each of the creA binding sites within that promoter. This can be achieved, as just S mentioned, either by deleting those sites, by replacing residues within those sites, or by using a combination of these disrupting techniques.

According to specific embodiments of the invention, the 2o promoter variant is a variant of an Asperqillus nidulans promoter identified below, in which the creA binding site noted below is disrupted by nucleotide replacement: SGene 5'flank creA site 3'flank location alcA' GCACGAGG GCGGGG CGGAAATT -302 ACAAACGA GCGGGG CCCCGTAC -167 aldA 2 TATCGATC GCGGGG ATCCTCAA -435 TGGGCACC GCGGCG AAGGGGAC -290 alcR 3 GCGGAAAT GCGGGG GGCGGCCA -359 amdS 4 CCAATATA GCCGGG TTTTGTTA -729 prnB 5 AGCCGTTA GCGGGA GGGAATTT -650 1 2 3 4 Gwynne et al., Gene (1987) 51:205 Picket et al., Gene (1987) 51:217 Felenbok et al., Gene (1988) 73:385 Scazzocchio et al., 1992, supra Sophianopoulou et al., Mol. Microbiol. (1989) 3:705 6 The creation of promoter variants functional in the presence of glucose can be achieved using these and other promoters by applying now conventional techniques of gene manipulation. For instance, a region of the selected promoter containing the creA binding site can be excised using flanking restriction sites and then incorporated into a vector suitable for amplification and subsequent gene manipulation work. The technique of site-directed mutagenesis can then be applied to disrupt the targetted creA binding site. To delete the creA io binding site and sequences 5' thereof, for example, an oligonucleotide can be designed which introduces any desired restriction site just 3' of the creA site, to allow excision.

The same technique can also be applied to introduce a nucleotide substitution within the creA binding site, using an :is oligonucleotide that is mismatched at the desired location but which otherwise is complementary to and hybridizes with the region targetted for disruption. The convenient technique of polymerase chain reaction (PCR) can also be applied in combination with the site-directed approach, to mutagenize and then amplify either the entire promoter or a selected region thereof. The desired promoter variant may of course also be synthesized de novo by applying methods now standard in the gene synthesis art. Briefly, this entails the successive 3' to coupling of suitably protected nucleotide reagents in an automated synthesizer, and then the recovery by el purification of the deprotected polynucleotide. The block ligation approach may be employed, whereby sblocks t of oligonucleotide pairs, up to about 80 nucleotides in length, are synthesized and ligated in correct succession by overhang complementarity, as described for example by Wosnick t al. in Gene (1989) 76:153. In an alternative approach, the desired

DNA

may be synthesized in toto, and then amplified by the PCR technique, using the strategy disclosed for instance by Barnett et al. in Nucl. Acids Res. (1990) 18:3094.

nce obtained, the promoter variant may be exploited to drive expression of DNA coding for any desired protein in a filamentous fungal host, in accordance with techniques already 7 otherwise established for the filamentous fungi (for a review see Ballance, Yeast (1986) 2:229). For this purpose, the present invention provides recombinant DNA constructs in which the promoter variant is linked operably with the proteins encoding DNA. The term "linked operably" means that the promoter is linked with the protein-encoding DNA in a manner enabling expression thereof in the filamentous fungal host. For the purposes of this specification, the protein-encoding DNA is understood to comprise a translational start codon and a ,o translational stop codon; and otherwise encodes either the desired protein end-product per se; a fusion protein in which the desired protein is initially produced in cleavable combination with a carrier protein such as Aspercillu nier glucoamylase; or a secretable precursor in which the desired 15 protein end-product is coupled with a cleavable signal peptide, S such as a signal peptide normally associated with an Aspergillus protein e.g. glucoamylase, or any functional S equivalent thereof.

In addition to the promoter and the protein-encoding DNA, the constructs of the present invention may also incorporate a transcriptional terminator at a location 3' of the protein-encoding DNA, although experience has shown that such terminators are not essential components of the constructs. Such transcriptional terminators can be obtained as 25 0.5-1.0 kb fragments of the 3'non-coding regions of Asperillus genes, for example of the Asperaillus nicer glucoamylase gene.

Once the construct is obtained, it can be introduced either in linear form or in plasmid form, in a pUC-based or other vector, into a selected filamentous fungal host using 3o a technique such as DNA-mediated transformation, electroporation, particle gun bombardment, protoplast fusion and the like. To allow for selection of the resulting transformants, the transformation typically also involves a selectable gene marker which is introduced with the expression cassette, either on the same vector or by co-transformation, into a host strain in which the gene marker is selectable. Various marker/host systems are available, including the pyrG, argB and niaD genes 8 for use with auxotrophic strains of A.erf il- dulan pyrG and argB genes for Asperil oryzae auxotrophs; pyrG, trpC and niaD genes for penicillium chrysogenum auxotrophs; and the argB gene for Trichoderma reesei auxotrophs. Dominant selectable markers including amdS, oliC, hyg and phleo are also now available for use with such filamentous unalungi as A. ersul Aoryzae, A. iculuM, F. chrys ucn, Cephalosporium acremo estuablish cose-depleterod gsrowthus, conditions, since th, _Fulvia fu v and 22ePshaXeriA M (for a review see Ward.

in Modern Microbial Genetics, 1991, Wiley-Liss, Inc., at pages 455-495).

Filariamentous fungal strains resulting from the transformation are cultured, according to another aspect of the invention, in the presence of a growth-sustainin concentration Is of glucose, for the purpose of obtaining the desired protein product. Culturing of the strain can be achieved without the need to establish glucosedepleted growth conditio cans, since the promoter variant driving expression of the desired gene product is no longer functionally repressed in the presence of glucose.

For those promoters whose function is otherwise not controlled, production of the desired protein can be achieved throughout the fermentation period. Phased production can also still be achieved, using promoter variants that are controlled by mechanisms other than glucose-repression. As is hereinafter exemplified, the alcA promoter can be functionally controlled, even after disruption of its creA binding site, using an inducing agent to limit protein production to a certain window within the fermentation period.

Example 1 Creation of an alcA promoter variant The promoter of the A. nidulans alcA gene is repressed by a combination of the creA gene product and glucose; it is also induced under glucose-depleted conditions by a combination of the alcR gene product and an inducing agent such as ethano..

9 To construct an alcA promoter variant that functions in glucose at concentrations sufficient to sustain Asperillus growth, the alcA promoter was obtained in the manner reported by Gwynne et al. in Bio/Technology (1987) 5:713, and manipulated as s described below.

Two putative creA binding sites (both GCGGGGC) were first identified by sequence scanning. As shown in Figure 1, these sites reside upstream of the ATG initiation codon of the alcA gene at positions -302 and -167, and both are conveniently o0 within a SphI/SplI region of the promoter. To provide an alcA promoter disrupted at these sites by nucleotide replacement, a 160bp fragment of the promoter was amplified using the tailed S* primers noted below: 15 (Forward)HindIII SphI -302 5'GACTGACTAAGCTTGCATGCGGAACCGCACGAGGGTACTACGGAAATTGAC 3' (SEQ ID NO: 1) (Reverse) EcoRI SplI -167 5',GACTGACTGAATTCCGTACGGGTAGTACTCGTTGTGGCTCTCCGTGCG 3' (SEO ID NO: 2) 25 Twenty-five cycles of PCR amplification were performed *according to the method reported by Scharf, 1990, In: "PCR Protocols: A Guide to Methods and Applicatons". M.A.Innis et al. Academic Press. The HindIII/EcoRI-tailed amplification product was then sub-cloned into a pTZ18R holding vector and the correct, variant sequence was verified by DNA sequence analysis. The holding vector and the full length alcA gene (pUC8 background) were then each restricted with SphI and SplI, and then selectively ligated to form plasmid palcA"r 2

EB,

in which the SphI/SplI region of wild type alcA promoter is replaced with the variant region containing mutations in the two putative creA binding sites. By this approach, spatial arrangement of the nucleotides within the alcA promoter was 10 also conserved.

Because expression from the alcA promoter variant requires induction by the product of the alcR gene which is itself glucose-repressed by a creA-mediated mechanism, an Aserill nidulans strain that produces the alcR product in a constitutive manner was exploited for expression of the alcA gene from the variant promoter. The selected host strain was constructed from the Glasgow double auxotroph FGSC4(arg-;ura-) by transforming with a plasmid carrying both the A. ila 0i argB gene, as selectable marker, and an expression cassette in which DNA coding for the alcR product (see Felenbok et al., Gene (1989) 73:385) was placed under expression control of the constitutive promoter of the A. nidulan glyceraldehye-3phosphate dehydrogenase gene (see Punt et Gene (1988) ,1 69:49. To accomodate multiple copy integration of cassettes carrying the alcA promoter variant, a strain carrying multiple copies of the constitutive alcR gene was chosen, and designated T262 5 (ura multiple alcRC)" n t o The plasmid palcAv'-2EB was then introduced into the 2o selected host A. ni duln strain, together with a marker plasmid pFB94 which carries the pyr4 gene of Neurospora crassa plasmid pFB94 whi h c a r i e s G th p Tenet. (1983) 10:403).

(see Buxton and Radford, Mol. Gen. Genet. (1983) 190:43) Transformation was achieved using *the PEG/CaCl-mediated technique according to the protocol reported by Royer et a., Mol. Gen. Genet. (1991) 225:168. Putative transformants, containing the pFB94 construct, were first selected without uridine on minimal medium. Mixed spores collected from approximatelY 80 ura transformants (3mm colonies) on a single plate were inoculated into 50ml of selective medium 2- 3o deoxyglucose (2-DOG), 1.0% ethanol, 0.67% yeast nutrient broth). The culture was incubated at 30"C with agitation (200 rpm) for 3 days. Flocculent colonies were collected from the liquid cultures and isolates derived from single spores were prepared from each of the 2-DOG resistant colonies for further analysis.

The host strain and transformants were next culturel, for 48 hours at 30C in liquid medium containing various 11 supplements selected to examine effects of carbon source on growth. Results are presented in Table 1 below: Table 1 glucose/ 2-DOG/ STRAIN ethanol ethanol 2-DOG ethanol host transformed 10 S Spore suspensions were inoculated into 50 ml of liquid medium S. supplemented with 0.67% yeast nitrogen base (YNB) and lmM uridine; and optionally ethanol glucose or the non-metabolized analogue, 2-deoxyglucose (2-DOG) As the table indicates, the host strain was able to grow in the presence of either ethanol or glucose, or a combination thereof. It was unable to grow in the presence only of a non-metabolized glucose analogue 2-DOG, nor could it utilize ethanol in the presence of 2-DOG. Clearly, 2-DOG effectively repressed expression from the wild type alcA gene, the product of which is required for ethanol utilization. On the other hand, the palcA v 2 EB transformants were able to grow in the presence of ethanol when present either in combination 25 with glucose or when present as the sole carbon source (even when glucose or its 2-DOG equivalent were present), demonstrating conclusively that expression of the alcA gene product required for ethanol utilization was mediated by the alcA promoter variant.

12 SEQUENC LISTING GENERAL flOINTION: AppLICANT: NAME: GIST-3PCADES

N.V.

STRE1': P.O. Box 1 CIF: Delft COjUMY: Netherlands pOSTAL CODE (ZIP): NLr-2 600 MA Tmm]ONE: 31.15.799111 T=LEAX: 31.15.793957 (ii) TILE OF INVENTION: PRODUCrIoN OF HMEIDGUS F01ITNS IN FILAMEN~IUM3

FUNGI

(iii) NUBER OF SEQUENCES: 3 (iv) C341.7ER ?XEABIE Fum~: MEDIUM TIYPE: Flqcyy disk CIVUTERh IE24 PC =rPatible OPEIRATING SYSTEM4:

PC-DO/MS-XS

soFIwARE: Patentln Release version Wl.25 (EP) PRIOR APPLICATION DM:: S0798,7 APPizCATION NUMBER:S0/8,7 FILIN DATE: 1O-DEC-1992 .30 flTFOzjTION FOR SEQ ID NO: 1: LEN~GM: 51 base pairs TYPE: nucleic acid 51ADEES sin~gle 'IOPOI=Y: linear (ii) M:)LEC=L TYPE: cIIKA SEQUENCE DESCRIPTION: SEQ ID NO: 1: GACIC.ACEAA C1'IGCAaGC GGAACCAC GAG=T A CGAAATIGA C 51 IN1:Oy~iiTON FOR SEQ ID NO: 2: iSEUNECAATRSIS LENGflI: 50 base pairs TYPE: nucleic acid STRANDE~iNESS: single EoFCLDY: linear 13 (iij) M4)LE=3~ TE: cEl4A (iii) Hyp=IIWICAL: YES (xi) SEQUEN~CE DESCRIPTION~: SEQ ID NO: 2: GACIGACrGA ATrCO=rCX CG'.rACI oCrIGTM7 TCIQ2OTGO 1(2) INFOdIoN FOR SEQ2 ID NO: 3: SEQUENCE c~C rERISTICS: LIEGni: 360 base Pairs 7YPE: nucleic acid siMMNESS: dou.ble 'OIO:CrxY: 1linear (ii) M4DLD3JTLE TYPE: ENA (giernxic) ii)HYPI'MTCAL:

NO

(vi) ORIGINAL SOURCE ORGANISM4: Aspergillus r-Lidulans SEQUC DESIpriN SD2 ID NO: 3: CGCcG GATAG'IT AcrAAGr WA-ITCATC GGAA003CAC 1GGX(XXG OMGAMTI CACCC CrIICAC:C AGC0XrrICXA AGAGGTAZXC G]WI2AGACC 120 *9C* GTATAGAGCA CGAGGAGC ACrrltTGG ACIVIVX33CA O1GGGTCC GCAO3GAGA 180 XCACAAA03A GcXGGCCCC GTrAOC1C TOCTACCOCA GGXT O3CA'JC CI CGCA2TAGC 240 rGAACVaCA TAT AWAA CC:EAAG=IC TCAG-D=CAC CAACAICATC AACCAACAAT 300 CAACA=~ CrACrCA=r AAITAhGMCA C'I-A=T TATCAIt1 C AAM 360

Claims (13)

1. A recombinant DNA construct in which protein-encoding DNA is linked operably with a filamentous fungal promoter variant having at least one creA binding site which has been functionally disrupted and other regulatory sequences, whereby the promoter variant contains more than 130 base pairs upstream of the initiation codon and wherein said promoter variant can mediate expression of said protein-encoding DNA in the presence of glucose and can be induced.

2. A recombinant DNA construct according claim 1, wherein the creA binding site has been disrupted by replacement of nucleotides in that site.

3. A recombinant DNA construct according to claim 2, wherein the nucleotide residues are replaced by nucleotides selected from A and T.

4. A recombinant DNA construct according to any one of claims 1 to 3, wherein the promoter variant is a variant of an Aspergillus promoter. 20

5. A recombinant DNA construct according to claim 4, wherein the Aspergillus promoter is selected from the group consisting of alcA, aldA, alcR, amdS, and prnB.

6. A filamentous fungal strain having incorporated therein a recombinant DNA construct according to any one of claims 1 to

7. A filamentous fungal strain according to claim 6, wherein the filamentous S* fungal strain is an Aspergillus strain. 30

8. An Aspergillus strain according to claim 7, wherein the Aspergillus strain is an Aspergillus nidulans. W:\Files\643239\643239.doc

9. A method for producing a desired protein, comprising the step of culturing in the presence of glucose a filamentous fungus strains defined in any one of claims 6 to 8.

10. A method for producing a desired protein, comprising the step of culturing an Aspergillus strain as defined in claim 7 or 8 in the presence of glucose and inducer.

11. A protein produced according to the methods of any one of claims 9 or

12. A recombinant DNA construct according to claim 1 substantially as hereinbefore described with reference to the examples.

13. A method for producing a desired protein according to any one of claims 9 or 10 substantially as hereinbefore described. DATED: 17 April 2003 PHILLIPS ORMONDE FITZPATRICK Attorneys for: GIST-BROCADES N.V. .o.o .3