WO1994004660A1 - Insect viruses and their uses in protecting plants - Google Patents

Insect viruses and their uses in protecting plants Download PDF

Info

Publication number
WO1994004660A1
WO1994004660A1 PCT/AU1993/000411 AU9300411W WO9404660A1 WO 1994004660 A1 WO1994004660 A1 WO 1994004660A1 AU 9300411 W AU9300411 W AU 9300411W WO 9404660 A1 WO9404660 A1 WO 9404660A1
Authority
WO
WIPO (PCT)
Prior art keywords
ala
ser
leu
thr
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU1993/000411
Other languages
English (en)
French (fr)
Inventor
Peter Daniel Christian
Karl Heinrich Julius Gordon
Terry Nelson Hanzlik
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Pacific Seeds Pty Ltd
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Pacific Seeds Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO, Pacific Seeds Pty Ltd filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to EP93917448A priority Critical patent/EP0786003A1/en
Priority to BR9306907A priority patent/BR9306907A/pt
Priority to AU46912/93A priority patent/AU678982B2/en
Publication of WO1994004660A1 publication Critical patent/WO1994004660A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/55Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/61Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/14011Baculoviridae
    • C12N2710/14111Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/14011Baculoviridae
    • C12N2710/14111Nucleopolyhedrovirus, e.g. autographa californica nucleopolyhedrovirus
    • C12N2710/14141Use of virus, viral particle or viral elements as a vector
    • C12N2710/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/00021Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/00022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/00023Virus like particles [VLP]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/00041Use of virus, viral particle or viral elements as a vector
    • C12N2770/00043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to insect viruses useful in control of insect attack on plants. It particularly relates to biological insecticides, especially those comprised of insect viruses. In particular applications, the invention also provides recombinant viruses and transgenic plants.
  • viruses include members of the picomaviridae, the Nodaviridae, the tetraviridae and the unclassified viruses. Descriptions of these groups can be found in the Adas of Invertebrate Viruses (eds J.R. Adams and J. R. Bonami) (CRC Press, Boca Raton, 1991) and Viruses of Invertebrates (ed. E. Kurstak) (Marcel Dekker, New York, 1991). These disclosures relating to these viruses concern their pathology and biology, not their use in biological control.
  • an isolated small RNA virus capable of infecting insect species including Heliothis species.
  • the present invention provides an isolated preparation of Heliothis armigera stunt virus referred to as "HaSV" herein.
  • an isolated nucleic acid molecule comprising a nucleic acid sequence hybridizable with RNA 1 or RNA 2 described herein under low stringency conditions.
  • the invention provides a vector comprising a nucleic acid molecule, the sequence of which is hybridizable with RNA 1 or RNA 2 as described herein.
  • vectors include expression and transfer vectors for use in animals including insect, plant and bacterial cells.
  • the invention provides an isolated protein or polypeptide preparation of the proteins or polypeptides derivable from the isolated virus of the present invention.
  • the invention also extends to antibodies specific for the protein and polypeptide preparations.
  • the invention provides a recombinant insect virus vector incorporating all or a part of the isolated virus of the present invention.
  • a method of controlling insect attack in a plant comprising genetically manipulating said plant so that it is capable of expressing HaSV or mutants, derivatives or variants thereof or an insecticidally effective portion of HaSV, mutants, variants or derivatives thereof and optionally other insecticidally effective agents such that insects feeding on the plants are deleteriously effected.
  • Figure 1 is the complete sequence of RNA 1 and of major encoded
  • Figure 2 is the complete sequence of RNA 2 in the authentic version, and its encoded polypeptides (the RNA 2 variant called the "5C version" is also shown around nucleotide position 570 [the amino acid sequence encoded by the 5C version is not included but this may be deduced from the nucleotide sequence given]).
  • Figure 3 is bioassay data showing HaSV-induced stunting of larvae.
  • Figure 4 is a schematic representation of the proteins encoded by RNA 1 and RNA 2.
  • FIG. 5 is a schematic representation of the proteins expressed by RNA 2 in bacteria DNA fragments encoding P17, P71, P64, P7 and the fusion protein P70 were synthesised by PCR. The flanking Ndel and BamHI sites used in cloning are indicated. (Note that P17 is followed by a BgIII site, whose cohesive ends are compatible with those of BamHI).
  • Figure 6 illustrates the 3'-te ⁇ ninal secondary structure of HaSV RNAs.
  • the tRNA-like structures at the 3' ends of RNAs 1 and 2 are shown. Residues in bold are common to both sequences.
  • FIG. 7 Expression strategies for HaSV cDNAs in insect cells.
  • the upper part of the figure shows the genome organization of RNAs 1 and 2.
  • the lower part shows insertion of cDNAs corresponding to these RNAs into a plasmid vector, between the heat shock protein (HSP70) promoter of Drosophila and a suitable polyadenylation (pA) signal.
  • HSP70 heat shock protein
  • pA polyadenylation
  • the HSP promoter was obtained by PCR using suitable primers, with a BaMHI site inserted by PCR immediately upstream of the start of transcription, giving the following sequence:
  • GGATCCACAGnnn where the underlined residue is the transcription start site for either RNA.
  • the cDNAs are termined by Clal sites, allowing direct linkage to ribozyme sequences as described in the text.
  • FIG. 8 Ribozymes to yield correct 3' ends.
  • the sequences of the ribozymes inserted as short cDNA fragments into HaSV cDNA clones are shown.
  • the ribozyme fragments were assembled and cloned as described in the text.
  • Figure 9 Immunoblots to map epitopes on HaSV.
  • Lane 1 Detected with HaSV antiserum.
  • Lane 1 pTP70delSP
  • lane 2 PTP70
  • lane 3 PTP17
  • lane 4 control
  • lane 5 pTP70delN
  • lane 6 pTP70
  • lane 7 pTP71
  • lane 8 HaSV virions
  • lane 9 molecular weight markers.
  • B Detected with HaSV antiserum.
  • Lane 1 PTP70delN;
  • lane 2 PTP70delSPN;
  • lane 3 pTP70.
  • C Detected with an antiserum to the Bt toxin (CryIA(c)).
  • lane 1 pTP70;
  • lane 2 HaSV virions;
  • lane 3 control extract.
  • Figure 10 New field isolates of HaSV.
  • the genomic organization of RNA 2 is shown at the top of the Figure.
  • PCR using appropriate primers with BamHI restriction sites and in some cases altered context sequences of the AUG initiating translation of the P17 or P71 genes were used to make fragments for cloning into the BamHI sites of the expression vectors.
  • Constructs 17E71 and P71 have altered context sequences of the AUG initiating translation of the P17 and P71 genes respectively, these alterations correspond to the context derived from the JHE gene (see text). All context sequences are given on the right of the figure.
  • R2 is a clone of the complete RNA sequence as a BamHI fragment in the vector.
  • FIG. 11 Maps of the expression constructs in baculovirus vectors.
  • FIG. 13 Expression of RNAs 1 and 2 from baculovirus vectors.
  • the full- length cDNA clone of HaSV RNA 1 or 2 was inserted as a BamHI fragment into the baculoexpression vectors.
  • PCR was used to add BamHI sites immediately adjacent to the 5' and 3' termini of the RNA 1 sequence;
  • FIG. 14 Expression strategies for HaSV cDNAs in plant cells.
  • the upper part of the Figure shows the genome organization of RNAs 1 and 2.
  • the lower part shows insertion of cDNAs corresponding to these RNAs into a plasmid vector, between 35S promoter of cauliflower mosaic virus and the polyadenylation (pA) signal on plasmid pDH51 (Pietrzak et al, 1986).
  • the cDNAs were obtained by PCR using suitable primers, with a BaMHI site inserted by PCR immediately upstream of the start of each cDNA.
  • the cDNAs are terminated by Clal sites, allowing direct linkage to ribozyme sequences as described in the text.
  • a first aspect of the invention contemplates use of small RNA viruses for biological control of insects.
  • an isolated small RNA virus particularly H. armigera stunt virus or mutants, variants or derivatives thereof capable of infecting insects, in particular the insect species such as Helicove ⁇ a armigera.
  • the small RNA virus isolate of the instant invention is insecticidal and in particular stunts the growth of insect larvae, for example Helicoverpa armigera larvae and inhibits or prevents development into the adult stage.
  • the small RNA viruses of the instant invention have insecticidal, anti-feeding, gut-binding or any synergistic property or other activity useful for insect control.
  • HaSV particles are isometric and approximately 36 nm in diameter with a buoyant density on CsCl gradients of 1.36g/ml.
  • the virus is composed of two major capsid proteins of
  • HaSV genome is much later than the largest known nodavirus (another class of RNA viruses) and comprises two ss (+) RNA molecules of approximately 5.3 and 2.4 kb. The genome appears to lack a blockage of unknown structure at the 3' termini that is found in Nodaviridae. The HaSV genome however shares a capped structure and non-polyadenylation with Nodaviridae. HaSV differs significantly from Nodaviridae and Nudaurelia ⁇ virus in terms of its immunological properties. In particular the large capsid protein has different antigenic determinants. Other properties of HaSV are described in the
  • the host range of HaSV includes Lepidopterans such as from the subfamily Heliothinae. Species known to be hosts are Helicoverpa (Heliothis) armigera, H. punctigera, H. zea, Heliothis virescens and other such noctuides as Spodoptera exigua. H. armigera which is known by the common names corn ear worm, cotton ball worm, tomato grub and tobacco bud worm is a pest of economic significance in most countries. Hpunctigera, the native bud worm, is a pests of the great economic significance in Australia.
  • the first aspect of the invention provides an isolated small RNA virus capable of infecting insects including Heliothis species.
  • the invention relates to mutants, variants and derivatives of HaSV.
  • mutants include all naturally occurring and artificially created viruses or viral components which differ from the HaSV isolate as herein described in nucleotide content or sequence, amino acid content or sequence, immunological reactivity, non-glycosylation or glycosylation pattern and/or infectivity but generally retain insecticidal activity.
  • mutants, variants or derivatives of HaSV include small RNA viruses that have different nucleic or amino acid sequences from HaSV but retain one of more functional features of HaSV. These may include strains with genetically silent substitutions, strains carrying replication and
  • the invention relates to mutants, variants or derivatives 2of HaSV which encode replication or encapsidation sequences, structures or signals with 60%, preferably 70%, more preferably 80%, still more preferably 90% and even more preferably 95% nucleotide sequence identity to the nucleotide sequences HaSV.
  • the invention relates to mutants, variants or derivatives of HaSV which encode proteins with at least 50%, preferably 60%, preferably 70%, more preferably 80%, still more preferably 90% and even more preferably 95% amino acid sequence identity to proteins or polypeptides of HaSV.
  • the invention relates to mutants, variants or derivatives of HaSV with 50%, more preferably 60%, still more preferably 70%, more preferably 80%, still more preferably 90 or 95% nucleotide sequence identity to the following biologically active domains encoded by the
  • RNA 2 in the capsid protein
  • the viral isolate of the present invention is biologically pure which means a preparation of the virus comprising at least 20% relative to other components as determined by weight, viral activity or any other convenient means. More preferably the isolates are 50% pure, still more preferably it is 60%, even more preferably it is 70% pure, still more preferably it is 80% pure and even more preferably it is 90% or more, pure.
  • the present invention relates to a nucleotide sequence or sequences hybridizable with those of HaSV.
  • nucleotide sequence used herein includes RNA, DNA, cDNA and nucleotide sequences complementary thereto.
  • nucleotide sequences also include single or double stranded nucleic acid molecules and linear and covalentiy closed circular molecules.
  • the nucleic acid sequences may be the same as the HaSV sequences as herein described or may contain single or multiple nucleotide substitutions and/or deletions and/or additions thereto.
  • nucleotide sequence also includes sequences with sufficient homology to hybridize with the nucleotide sequence under low, preferably medium and most preferably high stringency conditions (Sambrook J, Fritsch, E.F. & Maniatis T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbour Laboratories Press) and to nucleotide sequences encoding functionally equivalent sequences.
  • the invention comprises the nucleotide sequences of genome components 1 and 2 as represented by Figures 1 and 2 hereinafter or parts thereof, or mutants, variants, or derivatives thereof.
  • the terms "mutants”, 'Variants” or “derivatives" of nucleotide genome components 1 and 2 has the same meaning, when applied to nucleotide sequences as that given above and includes parts of genome components 1 and 2.
  • the second aspect of the invention also relates to nucleotide signals, sequences or structures which enable the nucleic acid on which they are present to be replicated by HaSV replicase. Furthermore the invention relates to the nucleotide signals, sequences or structures which enable nucleic acids on which they are present to be encapsidated.
  • the invention comprises nucleotide sequences which are mutants of the capsid gene having the following sequences:
  • the invention relates to nucleotide sequences of HaSV encoding insecticidal activity including the capsid protein gene and P17 and mutants, variants and derivatives thereof.
  • the invention comprises nucleotide sequences including the following ribozyme oligonucleotides:
  • Ribozyme sequences are useful for obtaining translation, replication and encapsidation of the transcript. It is therefore desirable to cleave the transcript downstream of its t-RNA-like structure or poly A tail prior to translation, replication or encapsidation of the transcript.
  • the present invention also further extends to oligonucleotide primers for the above sequences, antisense sequences and nucleotide probes for the above sequences and homologues and analogues of said primers, antisense sequences and probes.
  • Such primers and probes are useful in the identification, isolation and/ or cloning of genes encoding insecticidally effective proteins or proteins required for viral activity, from HaSV or another virus (whether related or unrelated) carrying a similar gene or similar RNA sequence. They are also useful in screening for HaSV or other viruses in the field or in identifying HaSV or other viruses in insects, especially in order to identify related viruses capable of causing pathogenecity similar to HaSV.
  • oligonucleotide primers derived from either RNA 1 or RNA 2 and located between ca 300 and 1500 bp apart can be used as primers.
  • the following pairs of primer sequences exemplify particularly preferred
  • RNA 1 Specifically for RNA 1:
  • HVR1B5' (described below) and the primer complementary to nucleotides 1192-1212 of Figure 1.
  • RNA 2 Specifically for RNA 2:
  • primers include: 5 ' GGGGGGAATTCATTTAGGTGACACTATAGTTCTGCCTCCCCGGAC (called “HvR1SP5p” herein)
  • HvR23p TCAGCAGGTGGCATAGG
  • HVPET65N AAATAATTTTGTTACTTTAGAAGGAGATATACATATGAGCGAGCGA GCACAC
  • HVPET63N AAATAATTTTGTTTAACCTTAAGAAGGAGATCTACATATGCTGGAGT GGCGTCAC (called “HVPET63N” herein)
  • HVP65C GGGGGATCCTCAGTTGTCAGTGGCGGGGTAG
  • HVP6C2 GGGGGATCCTCAGTTGTCAGTGGCGGGGTAG
  • HVP6MA AATTACATATGGCGGCCGCCGTTTCTGCC
  • HVP6MF AATTACATATGTTCGCGGCCGCCGTTTCT
  • the invention also relates to vectors encoding the nucleotide sequence described above and to host cells including the same.
  • vectors are capable of expression in animal, plant or bacterial cell or are capable of transferring the sequences of the present invention to the genome of other organisms such as plants. More preferably they are capable of expression in insect and crop plant cells.
  • the invention relates to the vectors pDHVR1 pDHVR1RZ, pDHVR2, pDHVR2RZ, p17V71, pl7E71, pPH, pV71, p17V64 P17E64, pP64, pV64, pBacHVR1, pBacHVR1RZ, pBacHUR2, pBacHVR2RZ pHSPR1, pHSPR1RZ, pHSPR2, pHSPR2RZ, pSR1(E3)A, pSR1(E3)B, pSR2A, pSR2B, pSX2P70, pSXR2P70, pSRP2B, pBHVR1B, pBHVR2B pT7T2P64, pSR2P70, pT7T2P65, pT7T2P70, pT7T2-P71, pBSKSE3,
  • the invention in a third aspect relates to polypeptides or proteins encoded by HaSV and to homologues and analogues thereof.
  • This aspect of the invention also relates to derivatives and variants of the polypeptides and proteins of HaSV.
  • Such derivatives and variants include substitutions and/or deletions of one or more amino acids, and amino and carboxy terminal fusions with other polypeptides or proteins.
  • the invention relates to the proteins P7, P16, P17, P64, P70, P71, P11a, P11b, P14 and P187 described herein and to homologues and analogues thereof, including fusion proteins particularly of P71 such as P70 described herein.
  • the invention relates to polypeptides or proteins from HaSV which have insecticidal activity themselves or provide target specificity for insecticidal agents.
  • the invention relates to polypeptides or fragments thereof with insect gut binding specificity, particularly to the variable domains thereof as herein described.
  • homologues and analogues with said insecticidal activity of the polypeptides and proteins are also included within the scope of the invention.
  • the invention also relates to antibodies (such as monoclonal or polyclonal antibodies or chimeric antibodies including phage antibodies produced in bacteria) specific for said polypeptide and protein sequences. Such antibodies are useful in detecting HaSV and related viruses or the protein products thereof.
  • the invention provides an infectious, recombinant insect virus including a vector, an expressible nucleic acid sequence comprising all of, or a portion of the HaSV genome, including an insecticidally effective portion of the genome and optionally, material derived from another insect virus species or isolate(s).
  • Insect virus vectors suitable for the invention according to this aspect include baculoviruses, entomopoxviruses and cytoplasmic polyhedrosis viruses.
  • the insect virus vector is selected from the group comprising the baculovirus genera of nuclear polyhedrosis viruses (NPVs) and granulosis viruses (GVs).
  • the vector acts as a carrier for the HaSV genes encoding insectidical activity.
  • the recombinant insect virus vector may be grown by either established procedures Shieh, (1989), Vlak (in press) or any other suitable procedure and the virus disseminated as needed.
  • the insect virus vectors may be those described in copending International application No. PCT/AU92/00413.
  • the nucleic acid sequence or sequences incorporated into the recombinant vector may be a cDNA, DNA or DNA sequence and may comprise the genome or portion thereof of a DNA or RNA of HaSV or another species.
  • the term "material derived from another insect virus species or isolate” includes any nucleic acid sequence, or protein sequence or parts thereof which are useful in exerting an insecticidal effect when incorporated in the
  • Suitable nucleic acid sequences for incorporation into the recombinant vector include insecticidally effective agents such as a neurotoxin from the mite Pyemotes tritici (Tomalski, M.D. & Miller, L.K. Nature 352, 82-85 (1991) a toxin component of the venom of the North African scorpion Androctonus australia Maeda, S. et al. Virology 184-777-780 (1991) Stewart, L.M.D. et al., Nature 352, 85-88 (1991), Conotoxins from the venom of Corns spp. (Olivera B.M. et al., Science 249, 257-263 (1990);
  • the exogenous nucleic acid sequence may be operably placed into the insect virus vector between a viral or cellular promoter and a polyadenylation signal.
  • the vector virus Upon infection of an insect cell, the vector virus will cause the production of either infectious virus genomic RNA or infectious encapsidated viral particles.
  • the promoters may be constitutively expressed or inducible. These include tissue specific promoters, temperature sensitive promoters or promoters which are activated when the insect feeds on a metabolite in the plant that it is desired to protect.
  • Recombinant insect virus vectors according to the present invention may include nucleic acid sequences comprising all or an infectious or insecticidally effective portion of genome the HaSV and optionally another insect virus species or isolate.
  • assembled capsids comprising one or more of the capsid proteins of the present invention, or derivatives or variants thereof as contemplated or described herein.
  • assembled virus capsids are useful as vectors for insecticidal agents.
  • the assembled viral capsids may be used to administer insecticidal agents such as various nucleotide sequences with insecticidal activity or various toxins to an insect.
  • Nucleotide sequences in the form of RNA or DNA which can be used include those of the HaSV genome or other insect viruses.
  • Toxins which can be used advantageously include those which are active intracellularly and may also include neurotoxins with an appropriate transportation mechanism to reach the insect neurones.
  • infectious genomic RNA or viral particles produced by insect cells infected with insect vectors may be enhanced as described below.
  • virus vector itself may include within a non- essential region(s), one or more nucleic acid sequences encoding substances that are deleterious to insects such as the insecticidally effective agents described above.
  • an extra genome component may be added to the HaSV genome either by insertion into one of the HaSV genes or by adding it to the ends of the genome.
  • a recombinant baculovirus vector comprising HaSV or part thereof having insecticidal properties.
  • modifications which may be made to the infectious recombinant insect virus according to the fourth aspect include: i) splitting the exogenous HaSV nucleic acid molecules comprising the genome and cloning the fragments into the insect vector so that they cannot rejoin.
  • One component preferably the virus RNA replicase, could be expressed from a separately-transcribed fragment, the transcripts of which would not be replicated by the replicase they encode.
  • the remainder of the genome (having insecticidal activity or encoding the capsid protein or a separate toxin m-RNA) could be encoded by, for example, a second separately-transcribed fragment, the transcripts of which are capable of being amplified by the replicase.
  • RNAs dependent on the virus for replication This involves determination of RNA
  • deletion mutants can be used to carry genes for insect control factors/toxins to larvae after replacing the reporter gene by a suitable toxin gene such as shown in Fig. 12; iii) using an insect promoter responsive to virus infection and, for example, placing copies of the viral replicase gene under the control of two promoters, one which is constitutive or expressed at early stages of vector infection, and the other being a cellular promoter turned on by the ensuing RNA viral infection.
  • Such a promoter may be isolated using techniques analogous to enhancer trapping, that is, transforming insect cells with a suitable reporter gene and looking for induction of the reporter upon virus infection of a population of transformed cells.
  • the invention in a fifth aspect relates to a method of controlling insect attack in plants by genetically manipulating plants to express HaSV or parts thereof which can confer insecticidal activity optionally in combination with other insecticidally effective agents.
  • Such plants are referred to as transgenic plants.
  • the term "express" should be understood as referring to the process of transcribing the genome or portion thereof into RNA or, alternatively, the process of transcribing the genome or portion thereof into RNA and then, in turn, translating the RNA into a protein or peptide.
  • Transgenic plants according to the invention may be prepared for example by introducing a DNA construct including a cDNA or DNA fragment encoding all or a desired infectious portion of HaSV, into the genome of a plant.
  • the cDNA or DNA fragment may, preferably, be operably placed between a plant promoter and a polyadenylation signal. Promoters may cause constitutive or inducible expression of the sequences under their control. Furthermore they may be specific to certain tissues, such as the leaves of a plant where insect attack occurs but not to other parts of the plant such as that used for food.
  • the inducible promoters may be induced by stimuli such as disturbance of wind or insect movement on the plant's tissues, or may be specifically turned on by insect damage to plant tissues. Heat may also be a stimulus for promoter induction such as in spring where temperatures increase and likelihood of insect attack also increases. Other stimuli such as spraying by a chemical (for instances a harmless chemical) may induce the promoter.
  • the cDNA or DNA fragment may encode all or a desired infectious portion of the wild-type, recombinant or otherwise mutated HaSV.
  • deletion mutants could be used which lack segments of the viral genome which are non-essential for replication or perhaps pathogenicity.
  • nucleotide sequences of the invention can be inserted into a plant genome by already established techniques, for example by an Agrobacterium transfer system or by electroporation.
  • Plants which may be used in this aspect of the invention include plants of both economic and scientific interest. Such plants may be those in general which need protection against the insect pests discussed herein and in particular include tomato, potato, corn, cotton, field pea and tobacco.
  • the DNA construct introduced into the plants' genome may be engineered to include one or more exogenous nucleic acid sequences encoding substances that are deleterious to insects.
  • exogenous nucleic acid sequences encoding substances that are deleterious to insects.
  • substances include, for example, Bacilllus thuringiensis ⁇ -toxin, insect neurohormones, insecticidal compounds form wasp or scorpion venom or of heterologous origin, or factors designed to attack and kill infected cells in such a way so as to cause pathogenesis in the infected tissue (for example, a ribozyme targeted against an essential cellular function).
  • DNA constructs may also be provided which include: i) mechanisms for regulating pathogen expression (for example,
  • Transgenic plants according to the present invention may also be capable of expressing all or an infectious or insecticidal portion of genomes from HaSV and one or more species or isolates of insect viruses.
  • HaSV, or insecticidally effective parts thereof, or the infectious recombinant virus vectors of the fourth aspect of the present invention may be applied directly to the plant to control insect attack.
  • HaSV or the recombinant virus vectors may be produced either in whole or in part in either whole insects or in culture cells of insects or in bacteria or in yeast or in some other expression system.
  • HaSV or the recombinant virus forms may be applied in a crude form, semi purified or purified form
  • HaSV may also be applied as a facilitator of infection where existing insect populations already infected with another agent, such as one or more other viruses whereby HaSV is able to act synergistically to bring about an insecticidal effect.
  • HaSV and another agent such as one or more viruses may be applied together to plants to control insects feeding thereon.
  • the pelleted virus was resuspended overnight in 1ml of buffer at 4 oC then layered onto a discontinuous CsCl gradient containing equal volumes of 60% and 30% CsCl (w/v) in a Beckman SW-41 tube and centrifuged at 12 h at 200 xg. The resultant pellet was suspended in 100 ⁇ l of buffer and frozen for further use.
  • Buoyant density was estimated in CsCl gradients according to Scotti P.D., Longworth J.F., Plus N, Crozier G. and Reignanum C. (1981) Advances in Virus Research 26: 117-143.
  • Rabbit anti-sera to HaSV was produced by standard immunological procedures. Rabbit antisera to the Nudaurelia o virus in addition to the virus itself was provided by Don Hendry (Rhodes University, Grahamstown, South Africa). Rabbit antisera to the Nudaurelia b virus was supplied by the late Carl Reinganum (Plant
  • Antibodies monospecific for the major 65 kDa capsid protein were prepared by incubating polyclonal antisera with sections of
  • nitrocellulose blotted with the 65 kDa protein After extensive washing in Tris buffered saline, the bound antibodies were eluted in 50mM citric buffer, pH 8.0 after a 5 minute incubation.
  • Digestions of the HaSV nucleic acid with RNAse A and DNAse I (Boehringer Mannheim) were done with pBSSK(-) phagemid ssDNA and dsDNA (Stratagene) and RNA controls (BRL).
  • Denaturing agarose gel electrophoresis in the presence of formaldehyde was performed according to Sambrook et al (1989). The state of polyandenylation of the viral RNA was determined by two methods.
  • the first method was to compare the binding of identical amounts (20 ⁇ g) of viral RNA and poly(A)-selected RNA from Helicoverpa virescens to a 1ml slurry of 5mg of oligo-d(T) cellulose (Pharmacia) in a binding buffer consisting of 20 mM Tris pH 7.8, 500 mM NaCl, 1 mM EDTA and 0.04% SDS.
  • the second method was to observe specific priming of viral RNA and viral RNA polyadenylated with poly(A) polymerase
  • RNA sequencing reactions using reverse transcriptase (US Biochemical) and a protocol provided by the supplier.
  • the 5' cap structure of the genomic RNA and HaSV was determined by observing the ability of polynucleotide kinase to phosphorylate viral RNA with and without preincubation with tobacco acid pyrophosphatase and alkaline phosphatase (Promega) under conditions described by the supplier.
  • F In vitm translation of HaSV RNA In vitro translation of HaSV RNA was performed with lysates of both rabbit reticulocytes and wheat germ (Promega) as directed by the supplier.
  • the virus particles are isometric and are approximately 36 - 38 nm in
  • the virions contain two single-stranded (+) RNA species of 5.3 kb and 2.4 kb lengdi.
  • the buoyant density of HaSV was calculated to be 1.296g/ml in CsCl at pH 7.2.
  • the A 260 /A 280 ratio of HaSV viral particles was 1.22 indicating a nucleic acid content of approximately 7% (Gibbs and Harrison, (1976) Plant Virology: The Principles London: Edward Arnold. Reciprocal immuno-double diffusion comparisons between HaSV and the Nudaurelia ⁇ virus showed no serological relationship. The more sensitive technique of immunoblotting also showed a complete lack of any antigenic relationship.
  • HaSV did not react with antisera to the Nudaurelia ⁇ virus in a immuno-diffusion test or when immunoblotted.
  • the capsid proteins were shown to be non-glycosylated as they failed to react with a hydrazine analog after oxidation with periodic acid.
  • the N-terminus of the 65 kDa protein appeared to be blocked in some manner as two efforts to conduct an Edman degradation failed. After the second attempt, the sample was treated with n-chlorosuccinimide and shown to be in a quantity normally adequate for sequencing.
  • the N-terminus of the 6 kDa protein was not blocked as an unambiguous 16-residue sequence was readily obtained.
  • the sequence of the N-terminus of the 6 kDa capsid protein and those of a cyanogen bromide cleaved fragment of the 65 kDa protein are as follows:
  • RNA 1 encodes a protein of molecular weight 186,980 hereinafter referred to as PI 87 and RNA 2 encodes proteins with molecular weight 16, 522 (called P17) and 70,670 (called P71). P71 is processed into two proteins of molecular weight 63,378 (called P64) and 7,309 (called P7).
  • the extracted nucleic acid from HaSV was readily hydrolysed by RNAse A but not by DNAse I. Denaturing agarose gel electrophoresis of the extracted RNA genome of HaSV indicated two strands that migrated at 5.5 kb and 2.4 kb. The RNA strands were shown not to have extensive regions of polyadenylation as only 24% of the viral RNA bound to the oligo-d(T) cellulose matrix as opposed to 82% of poly(A)-selected RNA. Further evidence for the non-polyadenylation of the viral genome was provided by the observation that the oligo primer, d(T) 16 G, gave a clear sequencing ladder using reverse
  • transcriptase only after in vitro polyadenylation of the viral strands with poly(A)-polymerase.
  • the demonstration that the strands could be modified with poly(A)-polymerase also showed the lack of any 3' modification.
  • the 5' termini of the viral strands were shown to be capped, most likely with m 7 G(5')ppp(5')G, as they could not be labelled with polynucleotide kinase unless pretreated with tobacco acid pyrophosphatase and alkaline phosphatase. v) In vitro translation.
  • the molar ratio of the two RNA strands was determined by quantitative densitometry of fluorograms of the resolved strands.
  • the ratio derived from an average of four measurements of various loadings on denaturing gels proved to be 1.7:1 (5.5 kb strand: 2.4 kb strand) which is somewhat lower than the expected ratio of 2.3:1 for equimolar amounts of each strand.
  • HaSV has major differences that make it distinct from those of the nodaviruses, the only other group of bipartite small RNA viruses pathogenic to animals. Although HaSV shares the characteristic of a bipartite genome with the only animal viruses having such a divided genome, the nodaviridae, it differs in virtually every other aspect from this group. Both segments of its genome are considerably larger than the corresponding nodaviral RNAs (Hendry DA, (1991) Nodaviridae of Invertebrates, in (ed. E. Kurstak) Viruses of Invertebrates. Marcel Dekker, New York, pp. 227-276).
  • RNA extraction and purification were as per Example 1.
  • Extracts of viral RNA was analysed by Northern dot-blot hybridisation using a probe made from cloned HaSV sequences derived from 3'-te ⁇ ninal 1000 units of RNA 1 and RNA 2 by random priming in a Boehringer Mannheim kit according to the supplier's instructions were employed. RNA extracts were transferred to Zeta-Probe (BioRad) for probing. Hybridization under high stringency washing conditions were as specified by BioRad. Hybridizations were carried out in the following solution:
  • the filters were washed twice in 1 mM EDTA, 40 mM HaH 2 PO 4 pH 7.2, 5% SDS, at 65 oC (1 h each), followed by 2 washes in 1 mM EDTA, 40 mM H a H 2 PO 4 , pH 7.2 1% SDS, at 65 °C (1 h
  • samples 9A, 9B, 10A, 10B and 10C contain HaSV infected positive control lab-raised larvae; 9C-H contain healthy (HaSV-free) negative control lab-raised larvae; All other wells (beginning 1-8) contain extract from field-collected larvae. Numbers 2A-D, 6C and 7D gave positive signals indicating that these isolates are either the same as HaSV or
  • the two viral RNAs were separated by a "freeze and squeeze" method after resolution on nondenaturing low melting point agarose gels in TAE
  • agarose slices containing the RNA were melted at 65 ° C in a volume of TAE buffer equal to six times the agarose volume. The solution was allowed to gel on ice before freezing it at -80 ° C for 30 minutes. The frozen solution was thawed on ice then centrifuged at 14,500g for 10 minutes after which the supernatent was withdrawn and precipitated by the addition of ethanol.
  • RNAs were reverse transcribed into cDNA using the Superscript RTase (a modified form of the Moloney murine leukaemia virus (MMLV) RTase, produced by Life Technologies Inc). Oligo(dT) was used as a primer on RNA which had been polyadenylated in vitro After size selection of DNA fragments over 1 kbp in length, the cDNA was then blunt-end ligated using T4 DNA hgase (Boehringer Mannheim or Promega, under conditions described by the suppliers) into vector pBSSK(-) (Stratagene) which had been cut with EcoRV and dephosphorylated with calf intestinal alkaline phosphatase
  • MMLV Moloney murine leukaemia virus
  • E.coli strain JM109 or JPA101 were electroporated with the ligation mixture and white colonies selected on colour-indicator plates Sambrook eLal, 1989.
  • RNA2 cDNA was synthesised using the RTase of AMV (Promega) and a specific primer complementary to nucleotide sequence 2285 - 2301 of RNA 2. The same buffer and conditions were used for the Superscript RTase (above). The AMV RTase was found not to make cDNA form a primer annealing to the terminal 18 nucleotide sequence (see below), nor to be able to reach the 5'-end of the RNA with the primer here described.
  • the cDNA clones were separated as single-stranded or double-stranded DNA, using the deaza-dGTP and deaza-dlTP nucleotide analogues (Pharmacia) in the deaza T7 sequencing kit as recommended by this supplier. Synthetic oligonucleotides were used as primers.
  • the 5' terminal sequences of the two RNAs were determined using reverse transcriptase to sequence the RNA template directly, from specific ohgonucleotide primers located about 200 nucleotides downstream from the termini. Such RNA sequencing was performed using the reverse transcriptase sequencing kit from Promega, under the conditions described by the manufacturer.
  • RNA sequence of the 20 or so nucleotides at the 5' terminus of each RNA was checked using direct RNase digestion of 5'-labelled RNA under conditions designed to confer sequence-specificity.
  • Direct RNA sequence using RNases was performed with the RNase sequencing kit from US Biochemicals,
  • PCR polymerase chain reaction
  • the product's ends were made blunt by treatment with E.coli DNA polymerase I (Klenow fragment) at ambient temperature for 15 minutes. After heating at 65 ° C for 10 minutes, the reaction was cooled on ice and the reaction mix made ImM in ATP. The product then 5'-phosphorylated using 5 units of T4 polynucleotide kinase at 37 ° C for 30 minutes. After heating at 65 ° C for 10 minutes, the product was run on a 1% low-melting agarose gel and purified as described for RNA in section E above. ligations: Vectors and restriction fragments cut with the enzymes described were run on 1% low-melting-point agarose gels and excised as slices.
  • the template for cDNA synthesis was virus RNA which had been
  • RNA 1 clones were used as a primer for the Superscript reverse transcriptase (RTase; a modified form of the Moloney murine leukaemia virus (MMLV) RTase, produced by Life Technologies Inc).
  • RTase Superscript reverse transcriptase
  • MMLV Moloney murine leukaemia virus
  • the cDNA was cloned into vector pBSSK(-) as described earlier.
  • the larger clones were selected for further analysis by restriction mapping and Northern hybridization. All the probes tested hybridized either to RNA 1 or to RNA 2, suggesting that there are no regions of extensive sequence homology between the two RNA's. Furthermore, screening of a number of other clones excluded the theoretical possibility that either RNA band may actually contain more than one species. ii) RNA 1 clones
  • RNA1 clones (B11U, B110 and B35) obtained for the first round of clones were further analysed by restriction mapping and shown to form an overlap spanning over 3 kbp (this was later confirmed by sequencing).
  • the second round of cloning then yielded E3 of 5.3 kbp, representing 99.7% of RNA 1.
  • a complete restriction map of clone E3 showed it to align with that previously determined for three overlapping clones.
  • the 5' end of the insert in B11U was placed about 300 nucleotides downstream from the 5' end of the RNA Once clones covering a contiguous block had been identified, the orientation 3relative to the RNA was determined. iii) RNA 2 clones
  • RNA 2 Three significant cDNA clones were isolated for RNA 2 (Fig. 2).
  • hr236, contains about 88% of RNA 2 (2470 bp total length), and runs from the 3' end to 240 bp from the 5' end.
  • the other clones, hr247 and hr 249 are 3' coterminal subgenomic fragments of 1520 bp and 760 bp, respectively.
  • Orientation of clone hr236 was determined by strand specific hybridization. While a much stronger signal was seen with a probe for one orientation, the probe specific for the other orientation also yielded a signal, indicating that there are extensive regions of reverse complementarity within the positive strand sequence. Such sequences are likely to form extensive short and long- range secondary structure.
  • the clones contain the 3' sequence of HaSV RNA 2 as they all have the same 3' sequence adjacent to the poly (A) stretch added in vitro before cDNA priming.
  • the remaining 5' sequence of RNA 2 has been obtained by direct RNA sequencing using two reverse transcriptases as described above. iv) Sequencing of virus genome
  • RNA 1 encodes a protein of molecular weight 187,000 which is regarded as the RNA-dependent RNA polymerase (replicase) in view of its amino acid sequence similarity in certain limited regions to replicases of other RNA viruses.
  • the apparent molecular weight of this protein upon in vitro translation of virus RNA and SDS-PAGE is 195,000.
  • RNA 1 was concentrated on clone E3 which extends from the 3' end of RNA 1 to 18 nucleotides form the 5' end ( Figure 1). The complete sequence has been confirmed by sequencing in both directions. An ORF of 1750 amino acids and spanning virtually the complete RNA (5310 nucleotides in length) has been detected. This ORF begins with the first AUG on the sequence at position 34 and terminates at nucleotide 5290 and is thought to encode the RNA-dependent RNA polymerase (replicase)(referred to as P187 in Fig.
  • replicase RNA-dependent RNA polymerase
  • RNA-dependent RNA replicase The sequence of the protein encoded by the major open reading frame, encoding the putative RNA-dependent RNA replicase, is shown, as are those of the small open reading frames at the 3' end, corresponding to the proteins Plla, Pllb and P14.
  • the transcript of this clone can be translated in the wheat germ system to yield the 195 kDa protein observed upon translation of fractionated RNA 1 from the virus. The latter yields more lower molecular weight products, presumably due to being contaminated with nicked and degraded RNA.
  • the products derived from the in vitro transcript can therefore be regarded as defining the coding capacity of the complete RNA 1 of HaSV.
  • the 2470 nucleotides encode a protein of molecular weight 71,000 which contains the peptide sequences corresponding to those determined from the two virus capsid proteins. This protein is therefore the precursor of these capsid proteins.
  • the protein is a major product of in vitro translation of this RNA obtained either from virus particles or by in vitro transcription of a full-length cDNA clone; in addition, another major translation product of apparent molecular weight 24,000 is obtained. This protein is derived from a molecular weight 17,000 reading frame overlappling the slab of the capsid protein gene.
  • Clones hr236 and hr247 were completely sequenced as the first step in RNA 2 sequencing. These sequences were then extensively compared to that obtained by direct RNA sequencing using AMV reverse transcriptase.
  • the plasmids contain a segment of cDNA derived for the AMV RTase, as well as the sequence corresponding to the 5' 240 nucleotides of RNA 2 which are not present on phr236 (Fig. 2).
  • the sequence of RNA in Fig. 2 is presented as the upper strand of the cDNA sequence. This strand is therefore in the same sense as the viral (positive-sense) RNA.
  • the sequence of RNA 2 encodes a major ORF running from a methionine initiation codon at nucleotides 366 to 368 to a termination codon at
  • the clear and unambiguous sequence, obtained is located near the carboxy terminus of the major ORF on RNA 2.
  • the protein encoded by the sequence 7.2 kDa and has a hydrophobic N-terminal region and an arginine rich (basic) C-terminal region. It is an extremely basic protein with a pi of 12.6.
  • RNA 2 appears to be a bicistronic mRNA (see Figs. 2 and 5).
  • the first methionine codon is encoded on the sequence of RNA at nucleotides 283 to 285. This ATG is in a poor context (TTTatgA), making it a weaker initiation codon. It initiates a reading frame of 157 amino acids, encoding a protein of molecular weight 17,000. (The second AUG [nts 366 to 368] initiates the 71 kDa precursor of the capsid protein).
  • the resultant fusion protein is called "P70” and its carboxyterminal-truncated version (a variant of the native P64) is "P65".
  • P70 carboxyterminal-truncated version
  • P65 carboxyterminal-truncated version
  • RNA2 of the Nudaurelia ⁇ virus has recently been published by Agrawal D.K. and Johnson J.E. (Virology 190 806-814,
  • the published report did not find a complete reading frame corresponding to the 157 amino acid protein (P17) gene reported above.
  • the AUG is however present, as is a reading frame - starting upstream of the start of the capsid gene - showing considerable amino acid homology to PI 7 of HaSV.
  • In vitro translation of purified Nudaurelia ⁇ virus RNA 2 and a re-examination of the nucleotide sequencing data for this RNA may help to resolve the question of whether the Nudaurelia ⁇ virus also encodes a protein homologous to the HaSV P17.
  • antisera against these two viruses which are similar at a nucleotide sequence level, do not show any cross-reactivity.
  • RNA 1 The full-length clone of RNA 1 was completed using PCR.
  • the primer defining the 5' end of the RNA carried an EcoRI site, the promoter for the SP6 RNA polymerase and a sequence corresponding to the 5' 17 nucleotides of RNA 1, as shown in Figure 1.
  • the sequence of this primer was:
  • a PCR product of 1240 bp was efficiendy made.
  • the template was cDNA synthesised using the MMLV RTase and the same oligonucleotide complementary to nucleotides 1192 - 1212 was the primer.
  • the product's ends were made blunt and then 5'-phophorylated as described below.
  • HvR13p 5'-GGGGGGATCCTQGTATCCCAGGGGCGC (the nucleotide complementary to that which was determined as the 3' one, based on its adjacency to the poly(A) stretch, is underlined; RNA terminating at the BamHI site will have the sequence GCGCCCCCUGGGAUACCaggauc).
  • the template was clone E3 and an ohgonucleotide corresponding to
  • nucleotides 4084 - 4100 was the other primer.
  • the 1220 bp product was blunt-ended, kinased and gel-purified as described above, before cleavage with HindIII.
  • the resulting plasmid is pSR1(E3)B.
  • RNA hr236 In constructing the full-length cDNA clone to enable in vitro transcription of this RNA hr236 described above was used as a basis. Two separate PCR products, one corresponding to the 5' portion of RNA 2, which is missing from this clone altogether, and another covering the region where clone hr236 lacks the hairpin-forming sequence described above, were required.
  • the primer defining the 5' end of the RNA carried a Hindlll site and a sequence corresponding to the 5' 18 nucleotides of RNA 2, as shown in Figure 2.
  • the sequence of this primer was:
  • nucleotide underlined corresponds to that identified as the first nucleotide of RNA 2.
  • a PCR product of 1.67 kbp was made.
  • the template was cDNA synthesised using the MMLV RTase and an ohgonucleotide complementary to the 18 nucleotides at the 3' end of RNA 2 as the primer.
  • the product was blunt-ended, kinased and gel-purified as described above, before cleavage with Pstl.
  • RNA 2 was cloned into plasmid pBSSK(-) (Stragene) cut with EcoRV and Pstl, giving plasmid pBSR25p.
  • plasmid pBSSK(-) Stragene
  • plasmid pBSR25p plasmid pBSSK(-) (Stragene) cut with EcoRV and Pstl
  • a 1.3 kbp Hindlll - BamHI fragment was excised from pBSR25p and ligated into Hindlll - BamHI cut pGEM-1 (Promega), giving plasmid ⁇ SR25.
  • Plasmid phr236P70 was cut at the Sad site in the vector adjacent to the 5' end of the insert and this made blunt-ended using Klenow in the absence of dNTPs. After heat-inactivation of the Klenow, the plasmid was cut with EcoRI, yielding fragments of 4.5 kbp and 380 bp. Plasmid pSR25 was cut with Nhel, blunt-ended by end-filling with Klenow and cut with EcoRI, yielding fragments of 2.8 kbp, 900 bp and 750 bp.
  • pSR2P70 The 4.5 kbp fragment of phr236P70 and the 900 bp fragment of pSR25 were ligated to give pSR2P70.
  • This clone covers all of RNA 2 except for the 3' 169 nucleotides.
  • pSR2A used the 3' end as present in phr236, together with the poly(A) tail present in this version.
  • the other pSR2B used a PCR fragment carrying a BamHI site immediately downstream of the 3' nucleotide, as in pSRl(E3)B above.
  • ⁇ SR2A a 350 bp NotI-ClaI fragment was excised from ⁇ hr236 and cloned into pSR2P70 cut with the same endonucleases.
  • the template used was a plasmid phr236.
  • the product was blunt-ended, kinased and gel-purified as described above, before cleavage with Notl.
  • the resulting 400 bp subfragment covering the required region was cloned into plasmid pSR2P70 cut with Clal, end-filled with Klenow and cut with Notl, giving plasmid pSRP2B. Linearization at the unique BamHI site allows in vitro transcription of the complete RNA 2, terminating with the sequence ACCaggatc. x) Construction of pSXR2P70
  • This plasmid was made to determine where p24 starts.
  • a 2.1 kbp XholBamHI fragment was cut from clone pSR2P70 and ligated into the vector ⁇ GEM-1 (Promega) which had been cut with Sail and BamHI.
  • In vitro transcription of the resulting plasmid after linearization at the unique BamHI site yielded an RNA covering about 70 nucleotides upstream of the first ATG at nucleotides 283 to 286, plus a short sequence derived from the vector.
  • In vitro translation of the RNA from ⁇ SXR2P70 yielded both proteins (P70 + P24).
  • Fig. 3 shows: A. neonate larvae (less than 24 h old) were fed the designated concentrations of isolated virus (in particles per ml [of diet] added to solid diet). They were weighed on following days and the mean of a statistically significant number (24) of larvae shown. Where necessary, mortality was recorded for the higher concentrations.
  • the vertical axis shows the foldincrease in weight from the hatching weight of 0.1 mg per larvae. This scale therefore also corresponds to weight in units of 0.1 mg (ie 300 is equivalent to 30 mg).
  • the expression system used initially was derived from the pET-11 system (Novagen). Trimmed down versions of pET-11b and c were constructed and used to compare expression of the capsid proteins. However, due to difficulties experienced with this system substantial modification of the original vectors was carried out in order to achieve much higher yields. These results are described in xiii-b) below.
  • pGEM-2 (Promega) which carries T7 promoter adjacent to a poly-linker sequence, but has no sequences corresponding to the lac operon, was cut at the unique XbaI (34) and Seal (1651) sites, giving fragments of 1.61 and 1.25 kbp.
  • the plasmids pET-11b and c were cut with the same enzymes, giving fragments of 4.77 and 0.91 kbp.
  • One version terminated at a point corresponding to the c-terminus of the processed (P64) form of the capsid protein and was made using oligonucleotide primer HVP65C.
  • the other version terminated at a point corresponding to the c-terminus of the precursor (P71) form of the capsid protein and was made using ohgonucleotide primer HVP6C2.
  • the sequence encoding P64 (or the precursor, P71) was synthesised in two segments using PCR.
  • HVPET64N the underlined sequence corresponds to nucleotides 373 to 390 of the sequence shown in Figure 2; the AflII (CTTAAG) and BglII (AGATCT) sites introduced into the sequence by single nucleotide changes (shown in italics) in the ohgonucleotide are shown in bold).
  • PCR products obtained from each combination of one of these primers with the abovementioned one were treated with the Klenow fragment of E.coli DNA polymerase, and then with T4 polynucleotide kinase in the presence of 1 mM ATP, before purification by agarose gel electrophoresis as described above.
  • plasmids derived from ⁇ GemP65N and pGemP65Nc carrying inserts commencing as defined by primer HVPET65N
  • the expression plasmid derived from pGemP65N which is based on PCR products made using as the template the sequence of the viral RNA, as in plasmid pSR2A, was called ⁇ TP17;
  • a truncated form of this plasmid, which expresses P17 was made by cutting at the unique BglII and BamHI sites, removing the intervening fragment (which corresponds to the c-terminal part of the insert) and religating the compatible cohesive ends, to give pTP17delBB.
  • protein MA replaced the phenylalanine at the start of this protein with methionine, giving it the amino-terminal sequence MAA...; the other carries an additional methionine residue, giving it the amino-terminal sequence MFAA.
  • the oligonucleotides used for PCR-amplified products covering the ⁇ 6 coding sequence carried a Ndel site (bold) at the ATG codon, for direct ligation into the pET-1I vectors.
  • the primers used were:
  • IPTG induction of bacteria containing plasmids pTP6MA or pTP6MF were used produce p6 for bioassay.
  • xiii-b Expression of viral genes in E. coli and bioassay in larvae
  • HVPET63N to HVP65C yielded a protein of 65 000 molecular weight.
  • the authentic capsid protein (P64) was expressed poorly from plasmid pT7T2-P64. Recloning this insert as a Ndel-BamHI fragment back into the other form of the vector (PT7T2b) did not alter this.
  • IPTG induction of bacteria containing plasmid pT7T2-P70 which contains an insert running from the location of primer HVPET65N to that of primer HVP6C2, yielded a protein of molecular weight 73 000. This was 3 000 molecular weight larger than the size of the precursor of the coat protein, as expected.
  • the authentic capsid protein precursor (P71) was expressed poorly from plasmid pT7T2-P71. Recloning this insert as a Ndel-BamHI fragment back into the other form of the vector (pT7T2b) did not alter this.
  • the P17 gene has also been cloned into the same vectors for expression and bio-assay.
  • This protein accumulates well in bacteria upon induction, and electron microscopy analysis has shown it form spectacular honeycomb-like structures under the bacterial cell wall, completely surrounding the cell interior (results not shown).
  • the properties of this protein including its amino acid composition and ability to form tube-like structures when expressed in bacteria suggest that it may be an homolog of a gap junction protein. The latter is involved in forming the channels linking the cytoplasms of adjacent epithelial cells in the insect gut. P17 could then play a role in enlarging or forming these channels, thereby enabling cell-to-cell movement of the virus in the insect gut, analogous to the movement or spreading proteins encoded by plant RNA viruses.
  • the capsid protein gene was amplified by PCR using the following primers: 5' primers:
  • RNA transcript corresponding to full length HaSV RNA 1 For expression of an RNA transcript corresponding to full length HaSV RNA 1, in insect cells by baculovirus infection or plasmid transfection, PCR was used to generate a fragment of cDNA linking the 5' end of RNA 1 to a Bam HI site.
  • the primers were:
  • the template was plasmid pSRl(E3)B described in Example 3 above.
  • a segment of the 1240 bp PCR fragment corresponding to the 5' 320 nucleotides of RNA 1 was excised with Bam HI and ASC II and cloned into the Bam HI site of pBSSK(-)[Stratagene] together with the 5 kbp ASCII - Bam HI fragment of pSR1(E3)B, giving plasmid pBHVR1B, which carries the complete cDNA to HaSV RNA 1, flanked by Bam HI sites.
  • plasmid pB +NR2B was made by inserting a fragment carrying Hind III and Bam HI sites from the multiple cloning site of vector pBSSK(-) [Stratagene] into plasmid pSR2B described above.
  • the resulting plasmid, called pBHVR2B carried the cDNA corresponding to full length HaSV RNA 2, flanked by Bam HI sites.
  • a series of recombinant baculoviruses has been constructed, based on the pVL941 transfer vector (PharMingen) or pBakPak8 (Clontech) and the
  • AcMNPV AcMNPV. These are designed to express the correct forms of the precursor and processed HaSV capsid proteins (P64 and P71) as well as the smaller capsid protein P6, and P17.
  • replicatable RNA encoding the nucleotide sequences of the present invention in order to get efficient rephcation, translation or encapsidation of the RNA it is necessary to excise structures downstream of the t-RNA like structure such as the 3' extension or poly A tail on the RNA.
  • ribozymes or other suitable mechanisms may be employed.
  • pAcUW31 vector (Clontech), which carries two promoters, is being used to simultaneously express p6 and p64 as separate proteins.
  • Heat shock promoters are also activated in stressed cells, for example cells stressed by baculovirus infection.
  • An even more preferable use of such a baculovirus construct is to use the HSP promoter to drive the HaSV rephcase and another gene for a toxin (as exemplified elsewhere in the specification) where the RNA expressing the toxin gene is capable of being rephcated by the HaSV replicase.
  • Such recombinant baculoviruses carrying the HaSV genome or portions thereof for expression in larvae at early or other stages of the baculovirus infection cycle are particularly effective biological insecticides.
  • Protoplasts of Nicotiana tobacum, N. plumbagin ⁇ olia and Triticum aesticum and oats were produced and electroporated with either HaSV or HaSV RNA as described in Matsunaga et al (1992) J.Gen. Virol. 73: 763-766.
  • the protoplasts are subjected to 3 cycles of freezing and thawing, and then an equal volume of 2x extraction buffer (100 mM Tris-HCI, pH 7.5, 25 mM EDTA 1% SDS, made in DEPC treated water) is added, followed by 1 volume of phenol (equilibrated in 10 mM Tris-HCI pH 8.0) heated to 65 °C.
  • the samples are mixed by vortexing and incubated at 65 °C for 15 min, vortexing every 5 min. After phase separation by centrifugation at room temperature for 5 min, the aqueous phase is re-extracted with phenol, re separated by centrifugation and re-extracted with chloroform/isoamyl alcohol.
  • Brush Border Membrane Vesicles were prepared from freshly isolated larvae midguts of H.Armigerahy the method of M.Wolfersberger et al (1987) Comp. Biochem. Physiol. 86A: 301-308, as modified by S.F.Garczyuski et.al. (1991) Applied Environ. Micro-biol 57: 1816-2820. Brush Border Membrane Vesicles binding assays using invitro labelled protein or 125 I-labelled protein were as described in Garczynski et.al. (1991) or in H.M.Horton and Burand, J.P. (1993) J.Virol. 67; 1860-1868.
  • residue 351 to residue 411 which shows only 25% identity to the corresponding region of the N ⁇ V capsid protein.
  • This region is flanked by the sequences corresponding to the ⁇ -sheet structural features ⁇ -E(residues 339-349) and ⁇ -F(residues 424-431) of the HaSV capsid protein, based on the alignment the N ⁇ V and nodavirus capsid proteins by Agrawal and Johnson (1992), and is therefore likely to form the loop of the most prominent surface protrusion on the HaSV capsid. This is based on comparison and correspondence to the nodavirus capsid protein structure and capsid structure as described by Wery J.-P.
  • the full-length clones for in vitro translation yielding highly 35 S or 3 H labelled proteins were constructed by replacing the bacterial translation interaction signal in the T7 plasmids above by the more active eucaryotic context sequence from the JHE gene.
  • the labelled capsid protein made by in vitro translation of the in vitro transcripts may be tested for binding to brush border membrane vesicles (BBMVs). Conditions are optimised by testing different procedures.
  • the deletion mutant lacking approximately 125 amino acids in the central region, and containing the variable domain, as well as others derived from it are also tested.
  • Fusion proteins comprising virus capsid midgut binding domains and other proteins
  • the following cultured insect cell lines were tested for infection by HaSV: Dmsophila melanogaster, Helicoverpa armigera (ovarian derived), Heliothis zea (ovarian derived), Plutella xylostella, Spodoptera frigiperda (SF9).
  • AU lines were grown under standard conditions. Upon reaching confluence, the culture medium was removed and all mono-layers covered with 1.5 ml of cell culture medium into which HaSV had been diluted; the average
  • multiplicity of infection was 10 4 . After adsorption at 26 °C for 2h, the inoculum was removed, the cells carefully washed twice with phosphate buffered saline (pH 7.0) and incubation continued with 5 ml of 10%. Foetal calf serum in TC199 culture medium (Cyto Systems).
  • the gel was Northern transferred to a zeta-probe membrane (Biorad) as described by Sambrook et.al. (1989).
  • the probe was prepared by random-priming the 3' sequences of the HaSV genome using DNA and cDNA clones pSHVR15GB and P T7T2p71SR-l as per manufacturer's instructions (Boehringer-Mannheim). Hybridization was carried out as described for the standard DNA probe protocol contained widiin the literature for the zeta-probe membrane (Biorad).
  • RNA 1 rephcation is clearly detectable within a few hours of infection.
  • RNA 2 is present only in very small amounts early in infection and accumulates much more slowly than RNA 1 does. This observation is consistent with one made earlier in HaSV-infected larvae, where RNA2 replication was not observed until 3 days after infection.
  • RNA 2 replication was also observed in Drosophila cells (DL2), but with the difference that more RNA 2 replication was observed at the early time points compared to the lepidopteran cell lines above.
  • Plasmids that express the HaSV genome as RNA transcripts from full length cDNA clones have been constructed and tested. These clones, constructed by PCR and carefully checked, have restriction sited immediately adjacent to the ends of the sequence. Transcription is driven from a specially-re-engineered Drosophila HSP70 promoter. i) Constructs for expression in insect cells
  • the constructs are based on vectors carrying the Drosophil HSP or actin promoters and suitable polyadenylation signals from Drosphila (Corces & Pellicer (1984) J. Biol. Chem. 259: 14812-14817) or SV40 (Angelichio et al (1991) Nucl. Acids. Res. 1& 5037-5043). Since transcription from such plasmids generates viral RNAs carrying long 3' terminal extensions derived from sequences in the poladenylation signal fragment, it is necessary to achieve cleavage of the transcript immediately after the 3'sequence of the viral RNA. These plasmids gave no virus replication, presumably because of the 3' terminal extension.
  • the method of choice for obtaining authentic 3' termini is based on introduction of DNA sequences encoding a cis-acting ribozyme into the constructs. With suitable engineering, such a ribozyme will cleave immediately 3' to the viral sequences within the transcript. Suitable ribozymes, based on the hepatitis delta virus (Been M.D., Perrotta, A T. & Rosenstein, S.P. Biochemistry 31, 11843-52 (1992) or the hairpin cassette ribozyme
  • the Leica CLSM enables the visualisation and analysis of three-dimensional cell and tissue structures at the macro and molecular levels.
  • the Leica CLSM used in this example is based on an MC 68020/68881 VME bus (20MHz) with standard 2Mbyte framestore and 4Mbyte RAM and OS9 operating system with programmes written in C code. It incorporates a Leica Diaplan research microscope and using X10/0.45, X25/0.75,X40/1.30 and X63/1.30 Huotar objectives has a claimed optical efficiency better than 90%.
  • the confocal pinhole is software controlled over the range of 20 to 200 ⁇ m. Excitation at 488 and 514 nm is provided by a 2 to 50 mW argon-ion laser.
  • tissues were dissected under saline and fixed in fresh 4% formaldehyde in phosphate buffered saline (PBS) for at least 15 mins. After multiple washes in PBS they were permeablized either by 60 mins incubation in PBT (PLBS with 0.1% Triton X-100 plus 0.2% bovine serum albumin). After 30 mins blocking in PBT+N (5% normal goat serum) tissue was incubated in primary antibody diluted (1:40) in PBT+N for at least 2 hrs at room temperature then at 4 °C overnight.
  • PBS phosphate buffered saline
  • the inventors' current model for the effect of HaSV involves the detection by the insect midgut of infected cells, their identification as infected and their subsequent shedding in numbers sufficient to cause irreparable damage to the insect midgut.
  • the evidence for this is based on the above and on the following direct observation of the fate of infected cells in midgut tissue over 1-3 days post infection. These results in repeat experiments were complicated by the discovery that another unrelated virus was present in the larval population being tested. Preliminary findings indicated that HaSV infection activates or fadlitates pathogenesis of the unrelated virus and together these cause severe disruption of the larval gut cells. Thus these two agents appear to act synergistically in causing gut cell disruption.
  • Midguts from larvae infected with HaSV were treated with the antiserum to purified HaSV particles (above) and examined under the Laser confocal microscope (described above). This established that some midgut cells were sufficiently infected with HaSV to give strong fluorescence signals. Such cells were moreover clearly separating from the surrounding tissue, a sign that they were in the process of being shed.
  • in situ hybridization can be carried out to detect RNA rephcation in infected cells.
  • RNA rephcation infected cells.
  • larvae infected with a recombinant HaSV expressing a foreign gene at early stages by insertion of that gene into RNA 1 in place of the N-terminal portion of the replicase gene
  • a correlation between virus rephcation and cell rejection can be confirmed by histochemical analysis of the midgut cells of the infected larvae.
  • the cell-shedding phenomenon offers a direct and rapid assay for early events in HaSV-infected gut tissue.
  • Extracts of baculo-vector infected insect cells carrying empty HaSV particles can be fed to larvae directly and the midgut examined by toluidine blue staining and immunefluorescence at intervals after infection. This will allow direct determination of whether the particles can bind the brush border membranes in intact gut, and whether such binding can induce the massive disruption evident in normally infected larvae. Control experiments using extracts from cells infected with the baculovector alone can be conducted to observe and distinguish effects due to the vector.
  • the immune-fluorescence assay on midgut tissue allows analysis of binding to midgut brushborder membranes. Once determined for wild-type capsid protein expressed from a baculo-vector, deletion or replacement mutants can be inserted into the baculovectors. Suitable cell extracts from these can be used to infect larvae.
  • Genes which may be suitable include intracellular insect toxins such as ricin, neurotoxins, gelonin and diphtheria toxins.
  • the toxin gene may be placed in the viral gene such that it is a silent (downstream) cistron on a polycistronic RNA or in a minus strand orientation, requiring rephcation by the viral polymerase to be expressed. Standard techniques in molecular biology can be used to engineer these vectors.
  • the reporter gene (or one of the toxin genes mentioned above) is inserted in place of the amino-terminal portion of the putative replicase gene, such that the intiation codon used for the replicase (ie that at nucleotides 37-39 of the sequence) is now used to commence reporter gene translation.
  • the fusion is achieved by the use of artificial Ncol restriction sites common to both sequences.
  • RNA 1 The short 36 nucleotide 5'-untranslated leader of RNA 1 (shown in upper case) is synthesised as the following sequence:
  • ggggatccacaGTTCTGCCTCCCCCGGACGGTAAATATAGGGGAACCATG Gtctagagg using two overlapping oligonucleotides comprising the first 40 nucleotides and the complement of the last 40 nucleotides respectively. These primers are annealed and end-filled by Klenow. The resulting fragment is then cut with BamHI and XbaI (sites underlined) and cloned with plasmid vector
  • the GUS gene carrying a Ncol site at the ATG codon was obtained as a NcoI-SacI fragment from plasmid pRAJ275 (Jefferson, RAJ Plant Mol. Biol. Rep 5, 3387-405 (1987)). This Sad site is located just downstream from the coding sequence for the GUS gene.
  • RNA 1 The 5' leader of RNA is excised as a BamHI-NcoI fragment from the above vector, and is hgated together with the NcoI-SacI fragment carrying the GUS gene into plasmid pHSPRIRZ or pDHVRIRZ carrying the full-length cDNA insert of RNA 1 (see above) which has been cut with BamHI and Sad.
  • the resulting plasmid then carries a complete form of RNA 1 but with the amino-terminal portion of the rephcase gene substituted by the GUS gene. It is desirable to produce a construct with approximately the same size as RNA 1 for encapsidation purposes.
  • RNA 2 Similar approaches are adopted for RNA 2, with the foreign, reporter or toxin gene fused to the initiation codon of either P17 or P71. In either case the context sequence of the introduced gene is modified to give the necessary expression level of that protein.
  • the foreign gene is introduced into plasmids pHSPR2RZ or pDHVR2RZ.
  • the above recombinants have been described specifically as insertions of a reporter gene (GUS).
  • GUS reporter gene
  • the toxin genes to be inserted are described on page 13 of the specification. These preferably further require a signal peptide sequence added at the amino-terminus of the protein.
  • RNAs which can be encapsidated in HaSV particles during assembly of virus in a suitable production system.
  • the virus capsids then carry the RNA of choice into the insects midgut cells where the RNA can perform its intended function.
  • RNAs which may be encapsidated in this manner include RNAs for specific toxins such as intracellular toxins, such as ricin, gelonin, diptheria toxins or neurotoxins. This strategy is based on the resistance of the virus particle to the harsh gut environment. iii) Other uses of the capsid particle
  • the capsid particles can be used as vectors for protein toxins. Knowledge of icosahedral particle structure elucidated by the inventors suggests that the amino and especially the C-termini are present within the capsid interior. It is possible to replace or modify the amino acid sequence corresponding to P7 such that it encodes a suitable protein toxin which is cleaved off the bulk of the capsid protein during capsid maturation. As with toxin-encoding mRNAs, the HaSV capsid delivers it to the midgut cell of the feeding insect, where it exerts the desired toxic effect. iv) Use of HaSV in plants
  • HaSV HaSV in the production of insect-resistant transgenic plants
  • Fig. 12 The use of HaSV in the production of insect-resistant transgenic plants are shown in Fig. 12. These inventions are based on the use of either the complete HaSV genome, or of the rephcase gene as a tool for the
  • RNAs 1 and 2 Fragments of cDNA corresponding to the full-length HaSV genome components RNAs 1 and 2 are placed in a suitable vector for plant
  • a constitutive plant promoter e.g. the CaMV 35S promoter mentioned above
  • an inducible promoter e.g. the CaMV 35S promoter mentioned above
  • a tissue specific promoter e.g. leaf-specific
  • the cDNAs are followed by a cis-cleaving ribozyme and a suitable plant polyadenylation signal. Transcription and translation of these genes in transgenic plant tissues and cells leads to assembly of fully infectious virus particles to infect and kill feeding larvae.
  • a variation on this strategy is to remove from the cDNA for RNA2 the fragments encoding RNA encapsidation and/or replication signals. This results in either the assembly in the plant cells of HaSV particles carrying only RNA 1, or of HaSV particles carrying RNA 1 and a form of RNA 2 which cannot be rephcated in the infected insect cell.
  • a further variation on this strategy is to modify the plant transgene encoding RNA 2 so that it is still replicatable and encapsidatable, but no longer express functional capsid protein.
  • HaSV capsids made in such plant cells will then be capable of making both the replicase and P17 in infected insect cells, but not of assembling progeny virus particles therein (such as shown in Fig. 12(d)). These measures confer inherent biological safety in the form of containment on the use of such transgenic plant material.
  • Plant cells contain an additional transgene encoding a suitable insect-specific, intracellular toxin (as described above).
  • a suitable insect-specific, intracellular toxin as described above.
  • Such a toxin gene is expressed by plant RNA polymerase in either a positive or a negative sense (the latter is preferred) and in such a form that the RNA can be encapsidated by HaSV capsid protein and/or replicated by the HaSV replicase in infected insect cells (see Figs.
  • Transgenic plants would contain two different transgenes, making either unmodified capsid protein precursor or a modified form in which most of the carboxyterminal protein P7 is replaced by a suitable insect-specific toxin or one which is inactive as part of a fusion protein. (Gelonin or other ribosomeinactivating proteins, insect gut toxins or neurotoxins may be suitable here.) Expression from these two transgenes would be regulated so that only the required amounts of the modified and unmodified forms are made in the plant cell, and assembled in such proportions into the capsoids.
  • capsotixin fusion proteins One way to modulate the production of capsotixin fusion proteins is to make translation of the carboxyterminal toxin reading frame dependent on a translational frameshift or read-through of a termination codon. With an appropriate low frequency of frame-shifting (eg 0.1 - 2%), it could even be sufficient to use a single transgene, if it were possible to synthesise the P7 portion and the toxin portion as overlapping genes.
  • the protein precursors cleaved and release the mature P7 and the toxin, which remain within the capsoids. These proteins are not released until capsoid disassembly occurs in insect gut cells. The processed form of the toxin is then able to kill the pest.
  • a protein toxin (or toxins) is expressed as a fusion with the capsid protein.
  • the fusion protein then assembles into capsid carrying the toxin(s).
  • These capsids present in the plant tissue exert an antifeeding effect on insects attaching the plant.
  • Virus particles are assembled for either fully infectious virus or any of the modified or biologically contained forms described in Example 9.
  • Microbes produced in suitable fermentation or culture f acihties and carrying such forms of the virus are then delivered to the crop by spraying.
  • the microbial cell wall provides extra protection for the virus particles produced within the microbe.
  • yeast expression vector An example of a yeast expression vector is pBM272, which contains the URA3 selectable marker (Johnston, M. & Davies, R.W. Mol. Cell. Biol. 4, 1440-8, (1984); Stone, D. & Craig, E. Mol. Cell. Biol. 10, 1622-32 (1990).
  • URA3 selectable marker Johnston, M. & Davies, R.W. Mol. Cell. Biol. 4, 1440-8, (1984); Stone, D. & Craig, E. Mol. Cell. Biol. 10, 1622-32 (1990).
  • pRJ28 Another example of an expression vector is pRJ28, carrying the Trpl and Leu2 selectable markers.
  • Yeast has recentiy been shown to support replication of RNA rephcons derived from a plant RNA virus, brome mosaic virus (Janda, M. & Ahlquist, P. Cell 72, 961-70 (1993). Since the BMV replicase is distantiy related to that of HaSV, and the two viruses are likely to rephcate by similar strategies within cells, yeast cells probably contain all the cellular factors required for HaSV to generate infectious virus. For bacteria, suitable expression vectors have been described above.
  • MOLECULE TYPE protein - N-terminal
  • MOLECULE TYPE protein - N-terminal
  • MOLECULE TYPE protein - N-terminal
  • GGC CGG CCC GAG TTC AAG GCC GAC GCC TCA CTG CTC GCC AAC GGC ATT 486 Gly Arg Pro Glu Phe Lys Ala Asp Ala Ser Leu Leu Ala Asn Gly Ile
  • GCC AAA ATC AAC GTA GAG CTT GCC GAA CCC GAC GCG ACC CCG AAG CCG 2886 Ala Lys Ile Asn Val Glu Leu Ala Glu Pro Asp Ala Thr Pro Lys Pro

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Insects & Arthropods (AREA)
  • Pest Control & Pesticides (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Peptides Or Proteins (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
PCT/AU1993/000411 1992-08-14 1993-08-13 Insect viruses and their uses in protecting plants Ceased WO1994004660A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP93917448A EP0786003A1 (en) 1992-08-14 1993-08-13 Insect viruses and their uses in protecting plants
BR9306907A BR9306907A (pt) 1992-08-14 1993-08-13 Vírus de rna pequeno isolado capaz de infectar espécies de insetos molécula de ácido nucleico isolada vetor célula hospedeira preparação de polipeptídeo ou proteína isolada anticorpo isolado vetor de vírus de insetos recombinante processo para controlar o ataque de insetos planta transgênica preparação de hasv ou um mutante variante ou derivado do mesmo vetores de plasmídeos processo para identifica hasv ou mutantes e variantes ou derivados dos mesmos
AU46912/93A AU678982B2 (en) 1992-08-14 1993-08-13 Insect viruses and their uses in protecting plants

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AUPL4081 1992-08-14
AUPL408192 1992-08-14
US8937293A 1993-07-08 1993-07-08
US08/089,372 1993-07-08

Publications (1)

Publication Number Publication Date
WO1994004660A1 true WO1994004660A1 (en) 1994-03-03

Family

ID=25644308

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU1993/000411 Ceased WO1994004660A1 (en) 1992-08-14 1993-08-13 Insect viruses and their uses in protecting plants

Country Status (9)

Country Link
US (1) US6177075B1 (https=)
EP (1) EP0786003A1 (https=)
AU (1) AU678982B2 (https=)
BR (1) BR9306907A (https=)
CA (1) CA2141583A1 (https=)
NZ (1) NZ254684A (https=)
PL (1) PL307474A1 (https=)
RU (1) RU95106626A (https=)
WO (1) WO1994004660A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5843429A (en) * 1994-11-28 1998-12-01 The United States Of America As Represented By The Secretary Of Agriculture Gonad-specific virus which causes sterility in the corn earworm, Helicoverpa zea
EP1015560A4 (en) * 1996-05-31 2002-01-16 Commw Scient Ind Res Org CHANGED SMALL RNA VIRUSES
EP2970916B1 (en) 2013-03-13 2021-04-14 Merck Sharp & Dohme Corp. Adapted lepidopteran insect cells for the production of recombinant proteins
EP4647438A1 (en) * 2024-05-08 2025-11-12 A-Spectar GmbH Polypeptide comprising a capsid protein sequence

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7045685B2 (en) * 1992-08-14 2006-05-16 Commonwealth Scientific And Industrial Research Organisation Insect viruses and their uses in protecting plants
ATE430799T1 (de) * 1999-10-19 2009-05-15 Bharat Biotech International L Expression von rekombinantem, reifem lysostaphin
CA2454882A1 (en) * 2001-06-21 2003-01-03 Uab Research Foundation Chimeric capsid proteins and uses thereof
US20040002058A1 (en) * 2001-06-21 2004-01-01 Uab Research Foundation Chimeric capsid proteins and uses thereof
US20050228007A1 (en) * 2004-02-26 2005-10-13 Prakash Jagtap Isoquinoline derivatives and methods of use thereof
CN101316592A (zh) * 2005-08-24 2008-12-03 伊诺泰克制药公司 茚并异喹啉酮类似物及其用法
NZ727213A (en) 2012-03-09 2020-03-27 Vestaron Corp Toxic peptide production, peptide expression in plants and combinations of cysteine rich peptides
IL297738A (en) 2020-05-01 2022-12-01 Vestaron Corp Insecticidal combinations
WO2023010013A1 (en) * 2021-07-27 2023-02-02 BASF Agricultural Solutions Seed US LLC Viral coat delivery of insect resistance genes in plants
CN116947973B (zh) * 2023-07-18 2025-08-19 江苏科技大学 一种具有降糖化血红蛋白和降血糖作用的鲱鱼多肽及其制备方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988001833A1 (fr) * 1986-09-11 1988-03-24 Institut Pasteur Virus anticulicidien et compositions de lutte contre les moustiques de cela

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5254678A (en) * 1987-12-15 1993-10-19 Gene Shears Pty. Limited Ribozymes
JP2755817B2 (ja) * 1988-11-14 1998-05-25 アメリカ合衆国 パルボウイルスキャプシド
US5135917A (en) * 1990-07-12 1992-08-04 Nova Pharmaceutical Corporation Interleukin receptor expression inhibiting antisense oligonucleotides

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988001833A1 (fr) * 1986-09-11 1988-03-24 Institut Pasteur Virus anticulicidien et compositions de lutte contre les moustiques de cela

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Volume 53, No. 1, January 1987, T MANOUSIS AND N F MOORE, "Cricket Paralysis Virus, a Potential Control Agent for the Olive Fruit-Fly, Dacus Oleae Gmel", pages 142-148. *
See also references of EP0786003A4 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5843429A (en) * 1994-11-28 1998-12-01 The United States Of America As Represented By The Secretary Of Agriculture Gonad-specific virus which causes sterility in the corn earworm, Helicoverpa zea
EP1015560A4 (en) * 1996-05-31 2002-01-16 Commw Scient Ind Res Org CHANGED SMALL RNA VIRUSES
EP2970916B1 (en) 2013-03-13 2021-04-14 Merck Sharp & Dohme Corp. Adapted lepidopteran insect cells for the production of recombinant proteins
EP4647438A1 (en) * 2024-05-08 2025-11-12 A-Spectar GmbH Polypeptide comprising a capsid protein sequence
WO2025233437A1 (en) * 2024-05-08 2025-11-13 A-Spectar Gmbh Polypeptide comprising a capsid protein sequence

Also Published As

Publication number Publication date
US6177075B1 (en) 2001-01-23
AU678982B2 (en) 1997-06-19
BR9306907A (pt) 1998-12-08
EP0786003A1 (en) 1997-07-30
PL307474A1 (en) 1995-05-29
EP0786003A4 (https=) 1997-07-30
RU95106626A (ru) 1997-03-27
NZ254684A (en) 1997-01-29
CA2141583A1 (en) 1994-03-03
AU4691293A (en) 1994-03-15

Similar Documents

Publication Publication Date Title
US5491076A (en) Expression of foreign genes using a replicating polyprotein producing virus vector
US5955647A (en) Method for using tobacco mosaic virus to overproduce peptides and proteins
Chang et al. A cis-acting function for the coronavirus leader in defective interfering RNA replication
US5939541A (en) Method for enhancing expression of a foreign or endogenous gene product in plants
EP0278667A2 (en) Hybrid RNA virus
AU4691293A (en) Insect viruses and their uses in protecting plants
JPH03280883A (ja) Rna型ウイルス由来の配列を包含する組換えdnaおよびそれを用いる遺伝子操作方法
CA2121578A1 (en) A method for obtaining plants with reduced susceptibility to plant-parasitic nematodes
JP2000300254A (ja) 寄生体由来抵抗性
Dolja et al. Suppression of potyvirus infection by coexpressed closterovirus protein
US5840481A (en) Parasite-derived resistance
US7045685B2 (en) Insect viruses and their uses in protecting plants
SK284152B6 (sk) Spôsob indukcie rezistencie proti vírusu v bunke a v rastline, transgénna rastlina a transgénne tkanivo
JP5230608B2 (ja) P15ヘアピン構造及びその使用方法
Liu et al. Cell-to-cell trafficking, subcellular distribution, and binding to coat protein of Broad bean wilt virus 2 VP37 protein
JP7369522B2 (ja) ジェミニウイルス病の防除に有効なペプチドとその利用法
WO1995002056A2 (en) Lettuce infectious yellows virus genes
AU726197B2 (en) Methods and materials for producing pathogen-resistant plants
Cerny et al. RNA-binding protein-mediated translational repression of transgene expression in plants
JP2002525040A (ja) ウイルスタンパク質により仲介される有害昆虫に対する植物の耐性
JP2000511426A (ja) 修飾小rnaウイルス
AU711559B2 (en) Recombinant Nudaurelia Beta-like virus and vectors
US20260125656A1 (en) Baculovirus expression system
WO2000044915A1 (en) Method for conveying bnyvv resistance to sugar beet plants
WO2002055719A2 (en) Expression of foreign genes from plant virus vectors

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR BY CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU MG MN MW NL NO NZ PL PT RO RU SD SE SK UA US VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2141583

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 254684

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 1993917448

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1993917448

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993917448

Country of ref document: EP