WO1994002644A1 - In situ detection of nucleic acids using 3sr amplification - Google Patents

Abstract

The process of detecting RNA molecules in situ using the 3SR amplification process, for example where the molecules are translocation-junction-spanning molecules in cells that have undergone chromosomal translocation. Also process modifications that enhance its effectiveness.

Description

IN SITU DETECTION OF NUCLEIC ACIDS USING 3SR AMPLIFICATION

FIELD OF THE INVENTION

The inventions described herein concern the detection of nucleic acids through the use of nucleic acid probes.

BACKGROUND

By the use of specific nucleic add probes, cellular and viral RNA molecules that signify infection other diseases, and genetic disorders, may be detected by hybridization reactions in which the probe reacts with the RNAmolecule of interest. A particularly useful approach is to use such hybridization reactions m situ, a procedure where the cells or viruses being analyzed are kept intact and the hybridization reaction takes place within the cell. Frequently, however, the number of copies of the RNA molecules to be detected is small indeed only a single copy may be present in a given cell. The smaller the copy number, the more difficult it is to detect the RNA molecule of interest.

One way to deal with the problem of small copy number is to use an amplification procedure. The SSR amplification procedure has been used for the amplification of RNA molecules in purified cell-free nucleic acid populations, Proc. Natl. A

cad. Sci. U.S.A., voI.87^, pp 1874-1878 (1990) reaction enzymatically converts the single stranded analyte RNA molecule into a double-stranded DNA molecule with binding regions for amplifying enzymes (Le., promoters for polymerases) and with one strand the equivalent of that analyte molecule. RNA polymerases bind to the promoters and proceeds to generate multiple RNA transcripts of one of the strands of the DNA molecule. New rounds of amplification take place using the multiple RNA transcripts as starting material.

The reported uses of 3SR have been for the amplification of RNA molecules purified to be free of most or all other cellular material. The reports therefore leave open the question of whether 3SR amplification can be effective in situ, a situation where the 3SR reaction must take place within an essentially intact cell, and often one that has been treated with cross-linking and/or precipitating fixatives in order to preserve cellular morphology. The problems faced in situ include having the enzymes enter the cell, having the enzymes function in the cell, and avoiding sources of non-specific background that are not present in purified RNA populations. Problems of this nature have been addressed with the PCR amplification process (M.J. Embleton et al., Nucleic Acids Research, vol 20, pp 3831-3837 (1992)). The PCR results are only of limited relevance for predicting the extent of success with 3SR, however, because the PCR amplification process uses different enzymes and different targets than 3SR amplification.

One type of RNA molecule of interest are those that result in cells that have EITHER INTERCHROMOSOMAL OR INTRA CHROMOSOMAL , undergone chromosomal translocation,^ in particular those whose origin of transcription is at or near the junction point created by the joining of two normally separated chromosomal fragments. Nucleic acid technology has been used to detect nucleic acids created by chromosomal translocations ( M. J. Embleton, et al., cited above; Fritsch et al., U.S. patent 4,725,536; Stephenson et al., U.S. patent 4,681,840.)

ANOTHER TYPE OF RNA MOLECULE OF INTEREST IS ONE TRANSCRIBED FROM A CHROMOSOMAL DNA SEGMENT CONTAINING A POINT MUTATION. In a particular useful embodiment, it is the use of 3SR in situ to detect RNA molecules that only occur in cells that have undergone chromosomal translocation, especially various types of tumor cells.

In order to enhance the overall speed and/or efficiency of the 3SR reaction in situ, additional enhancing inventions are disclosed and combined with 3SR. One such invention is the use of 3SR probes or primers that are specific for the translocation junction region of the analyte RNA molecules. Other inventions are the use of permeation and signal enhancers, the use of background reducers, and the use of improved probes.

BRIEF SUMMARY OF THE INVENTION

The present invention is, in part, the 3SR amplification process to detect RNA molecules in situ. The invention is also the use of one or more of the following inventions to improve the speed and/or sensitivity of the 3SR m situ process; permeation enhancers during the hybridization process, signal enhancers to enhance fluorescent probe signal, background reducers during fluorimetric detection of probes, free radical scavengers to reduce background fluorescence, multiple reporter groups per probe, and analogues of reporter groups to reduce hybridization background. The invention is also the use of short probes that will only hybridize to sequences that span the translocation junctions on RNA molecules from cells that have undergone interchromsomal or intrachromosomal chromosomal translocation, or the use of short probes that will hybridize only to sequences that contain a particular point mutation.

DESCRIPTION OF THE INVENTION

DEFINITIONS An "analyte RNA molecule" is a molecule that the assay is designed to detect.

An "amplification RNA molecule" is an RNA molecule that is generated by using the amplification process. It will either have a nucleotide sequence complementary to all or part of an RNA analyte molecule or have a nucleotide sequence equivalent to all or part of an analyte RNA molecule.

A "probe" is a molecule that comprises an oligonucleotide and usually also a reporter moiety, the reporter being detectable, the oligonucleotide hybridizable to an amplification RNA molecule. Reporter moieties can be radioactive, fluorescent, chemilurninescent, enzymes (e.g., alkaline phosphatase, horseradish peroxidase, or other enzymes that catalyze

OR HAPTENATED DIGOXIGENIN REACTABLE WITH AN ANTIBODY

colorimetric reactions), or ligands (such as biotin _^ that can react specifically to ligand-specific binding molecules (such as streptavidin) linked to directly detectable moieties that are, for example, radioactive, fluorescent, chemiluminescent, or enzymes.

A first nucleotide sequence is "complementary" to a second nucleotide sequence if

"Watson-Crick" base-pairing rules define the relationship between the two sequences:

wherever there is a guanine (G) in one sequence, there is a cytosine (C) in the other sequence and wherever there is an adenine in one sequence there is either a thymine (T) or a uracil (U) in the other sequence.

A "hybrid" is a double-stranded (or partially double-stranded) molecule formed by two nucleic acid molecules wherein one molecule has a nucleotide sequence complementary to a sequence in the other molecule. A first nucleotide sequence is "the equivalent" of a second nucleotide sequence if either they are identical or they are identical except for the fact that one sequence is a DNA sequence and the other an RNA sequence wherein uracil replaces thymine.

OR ALTERED

When a new ^ chromosome is created from two chromosomal segments that came together because of translocation, the point at which the two segments came together is the " chromosomal translocation junction."

"Nucleotide sequence" is a term intended to cover a sequence where there is some atom (e.g., sulfur) other than phosphorus at some of the positions where internucleoside phosphorus normally occur. A "translocation junction-spanning RNA molecule" is an RNA molecule (such as an hnRNA or mRNA molecule) comprising nucleotide sequences transcribed from portions of a chromosome on both sides of a chromosomal translocation junction. A translocation junction-spanning mRNA molecule can, for example, be created in a cell by cellular processing of a translocation junction-spanning hnRNA molecule.

A "translocation junction-spanning RNA segment" is any RNA molecule segment that comprises nucleotide sequences transcribed from portions of a chromosome on both sides of a chromosomal translocation junction.

A "translocation junction-spanning amplification RNA molecule" is an amplification RNA molecule if part or all of its nucleotide sequence is complementary to or equivalent to a junction-spanning RNA molecule or RNA segment.

A "primer" is an oligonucleotide which is extended into a longer molecule by reverse transcriptase in the 3SR process. "Intrachromosomal chromosomal translocation" is a translocation that arises when one or more alterations within a single chromosome creates two adjacent chromosome segments from two segments that are not adjacent in normal cells. Alterations that can cause interchromosomal chromosomal translocations include deletions of a chromosome segment, duplication of such a segment, and rearrangement or transposition of such a segment.

"Interchromosomal chromosomal translocation" is a translocation that arises when a segment of one chromosome combines with one or more segments of another chromosome.

A "point mutation" is mutation in a chromosome' wherein a single base (e.g., guanine, cytosine, thymine, or adenine) normally present at a certain position in the chromosome's base sequence is replaced by another base (for example: cytosine, thymine, or adenine, if the base is normally guanine). Point mutations of particular interest are those associated with a disease or genetic defect. The use of the processes of the inventions herein for detecting a point mutation as a diagnostic or prognostic tool (e.g., for cancer, cystic fibrosis, or any other disease or genetic defect) is also one of the present inventions.

A "point mutation-spanning" RNA molecule or segment is an RNA molecule or segment comprising a nucleotide sequence transcribed from a chromosomal nucleotide sequence comprising a point mutation and nucleotides on both sides of said mutation.

A "point mutation-spanning" probe or primer is a probe or primer that comprises a nucleotide sequence complementary or equivalent to a chromosomal nucleotide sequence comprising a point mutation and nucleotides on both sides of said mutation.

A "translocation junction-spanning primer" is a primer that has a nucleotide sequence complementary to or equivalent to a junction-spanning RNA segment.

"In situ" is a term used to describe processes (e.g., hybridization or 3SR) that take place inside a cell or virus that is essentially intact; the cell or virus is frequently one that has been treated with a cross-linking or precipitating fixative, many but not all of which are named herein.

"translocation junction-spanning probe" is a probe that has a nucleotide sequence complementary to or equivalent to a junction-spanning RNA segment.

A "biological entity" as used herein is either a cell or a virus. 3SR PROCESS

The 3SR process is a process utilizing a reverse transcπptase, a DNA-dependent

RNA polymerase, an RNase H, oligonucleotide primers, deoxyribonucleoside triphosphates

(deoxyadenosine 5'-triphosphate, deoxycytidine 5'-triphosphate, deoxyguanosine 5'- 5'- triphosph ate

triphosphate, and deoxythymidine; dATP, dCTP, dGTP, and dTTP), ribonucleoside

^

triphosphates (adenosine 5'-triphosphate, cytidine 5'-triphosphate, guanosine 5'-triphosphate, uridine 5'-triphosphate; ATP, CTP, GTP, UTP) and appropriate reagents such as a buffer, salts, and divalent cations, so as to generate multiple copies of at least part of an analyte RNA molecule or the complement of an analyte RNA. One primer will be complementary to part of the analyte RNA molecule of interest, the other will be equivalent to part of the analyte RNA molecule of interest. At least one of the primers will have a portion that is not complementary or equivalent to part of the analyte RNA molecule, but rather is one strand of a double-stranded promoterfor a DNA-dependent RNA polymerase

The process proceeds because one of the primers hybridizes to the analyte RNA molecule and then, by using the reverse transciptase, that primer is extended so that a cDNA copy of at least part of the analyte RNA molecule is formed. The analyte RNA molecule is then destroyed by the RNase H. The second primer is annealed to the cDNA molecule and that primer is extended by the reverse transcriptase to form a second DNA strand complementary to the cDNA molecule. The second DNA strand will have a nucleotide sequence equivalent to part of the original analyte RNA molecule. The result of the foregoing will be a double-stranded template DNA molecule.

The double-stranded template DNA molecule formed by the successive extensions of the two primers will have one or two promoters for a DNA-dependent RNA polymerase. If the first primer has one strand of such a promoter, then the reverse transcriptase will make the second strand of the promoter when it extends the second primer. If the second primer has one strand of such a promoter, the reverse transcriptase will, simultaneous with its extension of the second primer, further extend the cDNA molecule to complete the second strand of the promoter.

The 3SR process continues with the DNA polymerase making amplification RNA molecules each of which is complementary to a strand of the template DNA molecule. The amplification molecules so formed can

themselves be amplified by the enzymes and primers present just as the analyte molecule was amplified.

THE 3SR PROCESS IN SITU In a general aspect, the invention is a "3SR in situ process", which is a process of detecting an analyte RNA molecule in a biological entity (especially a cell and preferably eukaryotic; especially human) which process comprises the steps of:

1) incubating the biological entity in the presence of a reverse transcriptase, a DNA- dependent RNA polymerase (preferably prokaryotic), an RNase H, and a first primer and a second primer each a DNA oligonucleotide (and also the necessary deoxyribonucleoside and ribonucleoside triphosphates and reaction solution reagents such as buffers, salts, divalent cations), so as to generate amplification molecules that have a nucleotide sequence complementary or identical to a sequence of nucleotides in said analyte RNA molecule ("amplification step"),

2) forming hybrids between probe molecules and said amplification molecules in said biological entity ("hybridization step"), and

3) detecting the probe molecules in said hybrids ("detection step"),

wherein the first primer comprises a nucleotide sequence complementary to a first nucleotide sequence of the analyte RNA molecule,

wherein the second primer comprises a nucleotide sequence equivalent to a second nucleotide sequence the analyte RNA molecule,

wherein said first nucleotide sequence is positioned in the analyte RNA molecule at a location between said second nucleotide sequence and the 3' end of the analyte molecule, wherein at least one of said two primers comprises a promoter nucleotide sequence for said polymerase, and wherein the probe comprises an oligonucleotide with a nucleotide sequence complementary to an nucleotide sequence in one of said amplification molecules.

The foregoing process is particularly suited to detecting translocation-junction spanning RNA molecules in cells that have undergone chromosomal translocation. This is a result of the fact that amplification of an analyte molecule will occur only if it contains a nucleotide sequence complementary to that of the first primer and a nucleotide sequence equivalent to that of the second primer: if those two analyte molecule nucleotide sequences are chosen so that one is on the "3' side" of the translocation junction while the other is on the "5' side of that junction", normal cells will not have a molecule that can be amplified. Rather there will be some molecules in normal cells that may have the first analyte molecule nucleotide sequence, and some molecules that have the second analyte molecule nucleotide sequence, but there will be no molecules that have both of those sequences. Molecules that have both of those sequences are only possible where chromosomal translocation has occurred.

The specificity of the process can be improved, in cases where the analyte molecule has a translocation junction, by choosing a probe so that it comprises a nucleotide sequence that is both a translocation junction-spanning probe and relatively short. If that latter sequence is a sufficiently short, it will have to completely hybridize to be stable: only cells that have undergone chromosomal translocation will produce analyte molecules to which a translocation junction-spanning probe is completely complementary as regards nucleotide sequence. The process for detecting translocations can be used to detect point mutations, by using point mutation-spanning probes or primers instead of translocation junction-spanning probes or primers.

The strategy of using a junction-spanning probe can also be extended by using a translocation junction-spanning primer.

In a particular aspect of the invention, step (2) is done by hybridizing reporter-probes to amplification RNA molecules generated by step (1), each of said reporter probes comprising both a reporter group that is detectable and an oligonucleotide comprising a base sequence complementary to a base sequence in said amplification RNA molecules.

Primers serve as primers for reverse transcriptase. The promoter region of a promoter nucleotide sequence, if present, will serve as one half of a DNA-dependent RNA polymerase promoter; the other half will be an DNA complementary in base sequence to the promoter region. Optionally, the primer will have a promoter region that will serve as one half of a DNA-dependent RNA polymerase promoter.

DESIGN OF A JUNCTION-SPANNING PROBE OR PRIMER

In the present inventions, when a junction-spanning primer or probe is hybridized to a junction-spanning RNA molecule in the cell, then the hybridization is done under conditions (temperature, time, ionic strength, etc.) wherein the probe will not hybridize to a molecule that is not a junction-spanning molecule. This selectivity of hybridization is accomplished by appropriate choice of the length of the primer or probe, as well as appropriate choice of the hybridization conditions according to the following principles:

For any pair of single-stranded molecules, if one has within itself a nucleotide sequence that is complementary to a nucleotide sequence in the second molecule, and both of those sequences are N nucleotides long (the total length of either molecule can be greater than N) then the molecules will form a hybrid only if N is larger than some critical value.

The critical value will depend partly on the hybridization conditions (temperature, choice of solvent, etc.) and partly on the nucleotide composition of the complementary sequences.

By varying the hybridization conditions and/or the base sequences of the probe molecules, one can vary the critical value of N. By routine experimentation, one can determine the critical value for any set of hybridization conditions and thereby perform the processes of this invention.

The fact-that N must exceed a critical value provides a basis for detecting nucleic acid sequences that include a junction point. The nucleic acid of normal cells will have both parts of such a sequence but the two parts will not be joined. Therefore if the probe is complementary to a sequence of no more than N-1 nucleotides (or a sequence of no more then N-3 nucleotides, which is preferred) on one side of the junction point and complementary to a sequence of no more than N-1 nucleotides (or a sequence of no more than N-3 nucleotides, which is preferred) on the other side of the junction point, it will not hybridize to normal cell nucleic adds.

It is preferred that a translocation junction spanning probe or primer have a nucleotide sequence complementary to that of a translocation junction-spanning segment 15 to 50 nucleotides in length (more preferably, 20 to 35 nucleotides in length). Preferably one half of the junction-spanning segment to which the probe or primer is complementary should be on one side of the translocation junction containing that segment (implying that the other half will be on the other side of that junction).

The foregoing principles and preferred (and more preferred) sizes also apply to point mutation-spanning probes and primers. ENHANCEMENTS OF THE 3SR IN SITU PROCEDURE

In preferred embodiments of the 3SR process in situ process invention, the invention is also the use of one or more of the following inventions to improve the speed and/or sensitivity of the 3SR in situ process: permeation enhancers during the hybridization process, signal enhancers to enhance fluorescent probe signal, background reducers during fluorimetric detection of probes, free radical scavengers to reduce background fluorescence, multiple reporter groups per probe, and analogues of reporter groups to reduce hybridization background. Each of these enhancing inventions is described in more detail in sections below.

PERMEATION ENHANCERS AND SIGNAL ENHANCERS

In another aspect of the 3SR in situ process, a permeation enhancer is used such that step (2) is done in a solution comprising a compound selected from the group dimethyl sulfoxide (DMSO), an alcohol, an aliphatic alkane, an alkene, a cyclodextrin, a fatty acid ester, an amide or lactam, and an organic silane.

The fact that a compound of the group, if added to the assay solution, increases the signal ultimately observed strongly suggests such a compound is a permeation enhancer. On that basis, the above invention is labeled here as a "permeation enhancer-modified" process. That designation is useful for distinguishing such an invention from a "signal enhancer-modified" process, described below, wherein the enhancing compound is added after the cells or viruses have been removed from the assay solution, especially when the enhancing compound is present during the fluorimetric measurement which is the final step in such an assay.

In a preferred embodiment of the permeation enhancer-modified process, the assay solution used in step (2) comprises a nucleic acid probe and DMSO (2 to 20 percent) and one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty acid ester (2 to 20 percent) of the formula R₁(COO)R₂, an amide or lactam (2 to 15 percent) of the formula R₃(NH)(CO)R₄, and an organic silane (2 to 20 percent) of the formula (SiR₅R₆R₇)N(SiR₈R₉R₁₀), (SiR₅R₆R₇)-(SiR₈R₉R₁₀), (SiR₅R₆R₇)O(SiR₈R₉R₁₀), or (SiR₅R₆O)(SiR₇R₈O)(SiR₉R₁₀O) and the combined volumes of DMSO and the compounds selected from the group not being more than 30 percent of the assay solution (v/v).

In a combination aspect of the permeation enhancer-modified process, the assay solution used in step (2) comprises a nucleic add probe and DMSO (2 to 20 percent) and one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty acid ester (2 to 20 percent) of the formula R₁(COO)R₂, an amide or lactam (2 to 15 percent) of the formula R₃(NH)(CO)R₄, and an organic silane (2 to 20 percent) of the formula (SiR₅R₆R₇)N(SiR₈R₉R₁₀), (SiR₅R₆R₇)-(SiR₈R₉R₁₀), (SiR₅R₆R₇)O(SiR₈R₉R₁₀), or (SiR₅R₆O)(SiR₇R₈O)(SiR₉R₁₀O), the combined volumes of DMSO and the compounds selected from the group not being more than 30 percent of the assay solution (v/v). In another variation of the permeation enhancer-modified process, in addition to DMSO, an alkene or (preferably) an alkane, and at least one other compound are selected from the group. Preferred structures are those described above as preferred.

In a particular embodiment of the permeation enhancer-modified process, the assay solution contains about 10 percent Triton X-100(v/v).

In particular preferred embodiments of the permeation enhancer-modified process, the only compound selected from the group is DMSO and the volume of DMSO is between 2 and 20 percent of that of the assay solution (v/v); it is particularly preferred that the volume of DMSO is about 10 percent of that of the assay solution (v/v).

It is preferred that the concentration of a compound be kept low enough so that none of it precipitates out of solution and so that no other compound in the assay solution precipitates. Alkanes, especially squalane and those similar in structure to squalane or larger than squalane, and alcohols, especially oleyl alcohol and those similar in structure or larger than oleyl alcohol, may-depending on what other ingredients are present-partially predpitate out of the assay solution when added to concentrations of 10 percent or higher.

Preferred compounds include squalane, dodecyl alcohol, beta-cyclodextrin, isopropyl palmitate, 1,2-propanediol, hexamethyldisiloxane, and oleyl alcohol, pyrrolidinone, and squalane. About 10% DMSO with about 10% pyrrolidinone is a preferred combination. About 10% DMSO with 5% squalane and 5% pyrrolidinone is another preferred combination.

In another preferred aspect, which is a signal enhancer-modified process, step (3) of the 3SR in situ process comprises at least three steps 3A, 3B, and 3C, such that 3A is performed prior to step 3B, and 3B is performed before or almost simultaneously with step 3C, as follows:

(3A) removing the cell from the assay solution,

(3B) adding a signal enhancing compound to the solution in which the cell is suspended,

(3C) detecting, as the signal, light quanta generated directly or indirectly by the target-bound probe molecule,

the signal enhancing compound selected from the group, an alcohol, an aliphatic alkane, a sugar, a fatty add ester, an amide or lactam, and an organic silane.

Light quanta emitted by a fluorescent moiety of the probe molecule is considered to be quanta generated directly by the target-bound probe molecule. Light quanta emitted as a result of cleavage of a chemical bond within a reporter group (e.g., isoluminol) in a chemiluminescent group is also considered to be a photon that is emitted directly by a reporter group. Light quanta emitted by a scintillation fluid as a result of a radiant energy being emitted by a radioactive reporter group is considered to be quanta generated indirectly by the reporter group.

It is preferred that the signal enhancer be added to the solution in which the cell is suspended while the signal detection is made (the "detection solution"); i.e., during step (3c).

The fact that a compound of the group, if added to the detection solution, increases the signal ultimately observed strongly suggests such a compound is a signal enhancer.

In a preferred embodiment of the signal enhancer-modified process, the detection solution comprises one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty add ester (2 to 20 percent) of the formula R₁(COO)R₂, an amide or lactam (2 to 15 percent) of the formula R₃(NH)(CO)R₄, and an organic silane (2 to 20 percent) of the formula R₅SiOSiR₆, the combined volumes of DMSO and the compounds selected from the group not being more than 30 percent of the assay solution (v/v).

Preferred compounds include squalane, beta-cyclodextrin,, hexamethyldisiloxane, and oleyl alcohol, pyrrolidinone, squalene and especially isopropyl palmitate, 1,2-propanediol and dodecyl alcohol. With these preferred compounds, increases in the ratio of target-generated signal to background signal of up to about three- to four-fold are achievable. About 10% DMSO with about 10% pyrrolidinone is a preferred combination. About 10% DMSO with 5% squalane and 5% pyrrolidinone is another preferred combination.

Notations used

The notation R₁(COO)R₂ stands for compounds with the structural formula

The notation R₃(NH)(CO)R₄ stands for compounds with the structural formula

The notation (SiR₅R₆R₇)N(SiR₈R₉R₁₀) stands for compounds with the structural formula

The notation (SiR₅R₆R₇)-(SiR₈R₉R₁₀) stands for compounds with the structural formula

The notation (SiR₅R₆R₇)O(SiR₈R₉R₁₀) stands for compounds with the structural formula

The notation (SiR₅R₆O)(SiR₇R₈O)(SiR₉R₁₀O) stands for compounds with the structural formula

Accordingly, for example, a kit in accordance with this aspect of the invention would a compoun d

comprise a probe molecule and ^ selected from the group dimethylsulfoxide (DMSO), an alcohol, an aliphatic alkane, a cyclodextrin, a fatty acid ester, an amide or lactam, and an organic silane. Furthermore, for example, another kit would comprise a probe molecule and a solution comprising one or more compounds selected from the group, DMSO, an alcohol, an aliphatic alkane, a cyclodextrin, a fatty add ester, an amide or lactam, and an organic silane, the volumes of compounds totalling not more than 20 percent of the solution (v/v).

In the foregoing processes, solutions, and kits, R₁, R₂, R₃, R₄,R₅, R₆, R₇, R₈, R₉ and R₁₀ are alkyl hydrocarbon structures.

R₁ and R₂ may be covalently joined to form a ring structure.

R₃ and R₄ may be covalently joined to form a ring structure.

In the foregoing processes, a percent designated in parenthesis after a compound refers to the compound's concentration expressed as percent of the assay solution (v/v).

It is further preferred that the alcohol has between 2 and 40 carbon atoms; that aliphatic alkane has between 10 and 60 carbon atoms; that the alkene has between 10 and

60 carbon atoms, that R₁ plus R₂ together have between 3 and 20 carbon atoms and, where R₁ and R₂ are not covalently joined so as to form a ring, R₁ and R₂ each have at least one carbon atom; that R₃ plus R₄ together have between 2 and 20 carbon atoms and, where R₃ and R₄ are not covalently joined so as to form a ring, R₃ and R₄ each have at least one carbon atom; and that R₅, R₆, R₇, R₈, R₉ and R₁₀, each have at least one carbon atom, that the six alkyl carbon structures, R₅, R₆, R₇, R₈, R₉ and R₁₀, together have no more than 20 carbon atoms.

In process embodiments even more preferred: the alcohol has between 3 and 30 carbon atoms, the aliphatic alkane has between 20 and 40 carbon atoms, R₁ plus R₂ together have between 3 and 10 carbon atoms and, where R₁ and R₂ are not covalently joined so as to form a ring, R₁ and R₂ each have at least 3 carbon atoms; R₃ plus R₄ together have between 3 and 10 carbon atoms and, where R₃ and R₄ are not covalently joined so as to form a ring, R₃ and R₄ each have at least 1 carbon atom; and R₅, R₆, R₇, R₈, R₉ and R₁₀, each have at least one carbon atom, that the six alkyl carbon structures, R₅, R₆, R₇, R₈, R₉ and R₁₀, together have no more than 10 carbon atoms.

Preferred alkenes for use as permeation enhancers are those where the ratio of carbon-carbon double bonds to carbon-carbon single bonds is less than one to three. Most preferably the ratio is less than one in ten.

BACKGROUND REDUCING COMPOUNDS

In a particular embodiment of the 3SR in situ process, step 3 comprises at least three steps 3A, 3B, and 3C, wherein step 3A takes place before step 3B and step 3B is performed prior to or essentially simultaneously with step 3C, as follows:

(3A) removing the cells (or virus) from the solution in which step (2) is performed,

(3B) exposing the cells to light at absorption wavelengths of the fluorescent probe molecules, and

(3C) measuring the amount of light emitted at emission wavelengths of the fluorescent probe;

wherein at a time after the commencement of step (1) and prior to the termination of step (3C), a background-reducing compound is present in the solution within which the cells are suspended;

the background-reducing compound comprising a light absorbing moiety with a structure different than that of the fluorescent dye moiety of the fluorescent probe; the background-reducing compound having an absorption wavelength range (the range of wavelengths over which it absorbs light when the process is performed) that overlaps that part of the emission wavelength range of the fluorescent probe (the range of wavelengths over which light is emitted by the probe) in which the amount of light is measured in step (3C).

It is preferable that the background-reducing compound be in the solution in which the cells (or virus) are is suspended in steps (3B) and (3C). For a light-absorbing compound to be an effective-background reducer with regard to a range of wavelengths, it is preferred that it have an average molar extinction coefficient in that range that is at least 2 percent as great as the average molar extinction coefficient of Trypan Blue in the range 520 nm to

560 nm; it is more preferred that it have a molar extinction coefficient in that range that is at least 10 percent as great as the average molar extinction coefficient of Trypan Blue in the range 520 nm to 560 nm.

Because many cytofluorimetric measurements are made in the visible range, about

400 nm to 660 nm, background reducers that are effective in that range are particularly valuable. There is no need, however, for a cytofluorimetric measurement to be done in the visible range; therefore, background reducers that absorb somewhere in the range 250 to

1000 nm, can also be useful in particular situations. Indeed, the principle of the invention is applicable to any wavelength at which a cytofluorimeter can be used.

photom ultiplier tu be, photodiod e, phototransistor,

"Light" in the present context refers to light that is detected by a^ flow cytometer or an observer or camera using a fluorescent microscope. As such, light will normally be light in the visible range, but if for particular purposes the cytometer or microscope is altered to detect photons with energies greater or lower than that of visible light, then such photons are also considered to fall within the term "light" for present purposes.

The light absorbing moiety of the background-reducing compound, because it has a different structure than the fluorescent dye moiety of the fluorescent probe, will normally have the desirable property that, if it emits light at all (i.e., it is a fluorescent compound), will have an emission spectrum different from that of the fluorescent moiety (i.e., as regards a given amount of light of a given wavelength that has been absorbed, there will be differences in the intensity of light emitted as a function of wavelength).

It is hypothesized that this embodiment of the invention is particularly effective partly because the background-reducing compound binds to at least some of the same non-specific targets as the probe does and, because the background-reducing compound and the probe are in close proximity, the background-reducing compound will absorb emissions from the probe. Additionally, the background-reducing compound will absorb light emitted due to autofluorescence by non-probe molecules in the cells. After absorbing light emitted by either nonspecifically bound probe or autofluorescing molecules, the background compound may emit light at its own emission wavelengths. The light emitted by the specifically bound background

probe molecules is absorbed to a lesser extent by the ^ -reducing compounds; therefore, the overall sensitivity of the analytical process is improved.

It is preferred that fluorescence be measured within 45 min. of addition of background reducer; however, if the background reducer is in the solution used for steps (3B) and (3C), one can wait up to 24 hours to do fluorescent measurement. In a particularly preferred embodiment of the process, the process further comprises a wash step between the steps numbered (3A) and (3B) above. A wash step can be performed by centrifuging the cells or viruses out of the solution in which they are suspended, then suspending them in a wash solution, and then centrifuging the cells or viruses out of the wash solution. A wash solution is generally a probe-free solution, it may or may not have the background reducing compound suspended in it.

The cells should remain in the probe-free solution comprising the background-reducing compound for a time great enough to allow them to absorb the background-reducing compound. Five minutes is a convenient time for that purpose, but there is wide latitude as to what length of time is used.

The probe will comprise a fluorescent dye. It can also comprise, covalently attached to the dye, a single-stranded nucleic acid (DNA or RNA) moiety. A moiety is part of a molecule. For example, the portion of a probe that has been contributed by a nucleic add is a nucleic acid moiety; the portion that has been contributed by the fluorescent dye is the fluorescent dye moiety. The covalent attachment may occur via a linker, where the dye and the nucleic acid molecule (or antibody) are linked at different sites to the linker molecule.

Emission and absorption maximum wavelength data have been published for many dyes and other light absorbing compounds (see, for example, the Merck Index or the catalog of Aldrich Chemical Company, Milwaukee, Wisconsin). Such data is suggestive of which compounds can be useful, but not definitive. A scanning fluorimeter will give an entire emission or absorption spectrum. Some background-reducing compounds are listed below for some probe dyes. The efficacy of a background-reducing compound as regards a given probe dye can, however, be tested relatively easily.

Fluorescein, which is frequently used as a fluorescent probe dye, has a maximum absorption wavelength at approximately 488 nm and maximum emission wavelength at approximately 525 nm.

Light-absorbing compounds that are good background reducers include azo dye derivatives that have a polyaromatic conjugate moiety and, on that moiety, have one or more polar groups such as a nitro group (-NO₂), a sulfonyl group (-SO₃), or an amino group (- NH₂). They are probably good because they tend to bind to the same proteins and membranes as the non-specifically bound probes.

A few of the many probe dyes for which this invention is useful are flourescein, FITC, Texas Red, Coumarin, Rhodamine, Phycoerythrin, and .

Some background-reducing compounds for use with the probe dye, fluorescein (or fluorescein isothiocyanate (FITC)) are Azocarmine B, Acid Red 114, Evans Blue, Palatine Fast Black Wan, Trypan Blue, Naphthol Blue Black and Sulforhodamine 101.

Some background-reducing compounds for use with the probe dye, Texas Red are Naphthol Blue Black and Palatine Fast Black WAN. For probe dyes other than fluorescein, the background reducing compounds of value might differ from those used with fluorescein- or FITC-labeled probes. It is preferred that, in the emission wavelength range of the probe dye that will be detected by the fluorimeter, fluorescent microscope or flow cytometer, the background reducing compound have an average molar extinction coefficient at least two percent (more preferably 10 per cent) that of Trypan Blue in the range 520 nm to 560 nm.

For any dye fluorescent probe, there are many compounds that will act as a background reducer. Generally, the background- reducer can be present at a concentration between 0.0002% and 0.10% (w/v). FREE RADICAL SCAVENGERS AS BACKGROUND REDUCERS

In another aspect of the 3SR in situ process, in particular where, a fluorescent reporter group is used to detect probe molecules in the hybrid formed during step (3), a free radical scavenger is present in the reaction mixture used to carry out one or more of steps (1), (2), and (3). In such a case, step (3) comprises exposing the hybridized probe to light of wavelengths that are fluorescent absorption wavelengths of the hybridized probe, and detecting light of a wavelengths that are fluorescent emission wavelengths of the hybridized probe. Preferably the free radical scavenger is present in reaction mixture used to carry out step (2).

It is preferred that the free radical scavenger be chosen to meet the condition that, during step (3) of the process, the amount of light emitted by the scavenger does not exceed the scavenger-caused decrease in autofluorescence. Whether a scavenger meets that condition for a given combination of fluorescent absorption and fluorescent emission wavelengths can be determined by performing the process twice, once without the scavenger and once with the scavenger (in both cases, the probe may be omitted from the process).

Free radical scavengers include compounds in the following four classes: 1) Compounds that are hydrogen donors. Preferred hydrogen donors are compounds with thiol groups, especially those linked to aromatic groups; e,g, thiophenol.

2) Compounds which are not hydrogen donors but which have a free radical that is capable of combining with other free radicals. Examples are the N-hydroxy derivatives such as the dye Tempo, hydrazine derivatives, and azo derivatives in which a nitrogen, linked by a double bond to another nitrogen and by a single bond to a carbon atom, carries the free radical. Optimally these compounds have a structure so that stearic hindrance prevents them from reacting with each other instead of the free radical that has to be scavenged.

3) Parahydroxyaromatic compounds. Vitamin E (a preferred scavenger) is a compound in this class.

4) Compounds with unsaturated carbon atoms that Koelch radicals.

Many free radical scavengers, including ones that belong to the above groups have been identified by others.

A free radical scavenger can be defined by its ability to act as a free radical scavenger under defined conditions. If FRS stands for the compound to be tested as a free radical scavenger, then the following three-step assay can be used to confirm that FRS is a free radical scavenger:

1) FRS and 10 mg trichoroacetyl peroxide are mixed in 5 ml dimethylformamide such that the molar ratio of FRS to trichoroacetyl peroxide is 2:1.

2) The reaction mixture is heated to 80°C for M minutes.

3) The reaction mixture is run on high performance liquid chromatography (HPLC)(if Cl₃C-FSR is not volatile) or on gas chromatography (if Cl₃C-FSR is volatile) and the amounts of Cl₃-FRS is determined. The scavenging activity is defines as the amount of Cl₃C- FRS detected.

The time, M minutes, is chosen so that if Vitamin E is tested in the assay, the percentage of Vitamin E that is converted to Cl₃C-Vitamin E is less than 100. Generally, M is expected to be less than 10 minutes.

The relative scavenging activities of two compounds, (e.g., Vitamin E and another compound), can be calculated by comparing the amounts of Cl₃C-FRS formed when the two compounds are tested in the assay under identical conditions. If the amount of Cl₃-FRS formed with a compound is 20 percent of that formed when vitamin E is added to the assay, then the scavenging activity of the compound is 20 percent of that of vitamin E.

The assay for measuring scavenging activity is based on a series of reactions wherein the treatment at 80 °C causes breakdown of one molecule of trichloroacetyl peroxide to produce two molecules of the free radical, Cl₃C*, which then reacts with the free radical scavenger to produce CI₃C-FRS.

A fluorescent absorption wavelength of a probe or compound (such as a free radical scavenger) is a wavelength of radiation (especially ultraviolet or visible light) that can be absorbed by the probe or compound and, if absorbed, can result in subsequent emission of radiation (especially visible light) by that probe or compound at a wavelength longer than the fluorescent absorption wavelength. The aforementioned longer wavelength is referred to as a "fluorescent emission wavelength." A fluorescent absorption wavelength is preferably in the range of about 420 nm to 460 nm. The fluorescent emission wavelength is preferably in the range of about 450 nm to 690 nm. In practice, the probe population is exposed to a range of absorption wavelengths and the emitted light is monitored at a range of emission wavelengths.

A fluorescent probe or compound is one that has fluorescent absorption wavelengths and fluorescent emission wavelengths.

In the fluorimetric detection process of this invention, free radical scavengers that have a free radical scavenging activity at least 1% of that of Vitamin E are preferred

(scavenging activity per mole of scavenger. If the scavenger molecule is a polymer in which each repeated unit has scavenging activity then the molar concentration of the repeated unit is the pertinent variable); those that have a free radical scavenging activity at least 20 percent that .of Vitamin E are even more preferred; most preferred are those that have a activity at least as great as that of Vitamin E.

As will be evident from the Examples, the fluorimetric process is normally applied substantially simultaneously to a large number of cells.

In one preferred embodiment of the process, step (3C) comprises measuring light emitted at wavelengths between about 520 nm and 560 nm (especially at about 520 nm), most preferably where the absorption wavelengths of step (3B) are less than 520 nm.

A preferred embodiment of the fluorimetric process further comprises a wash step between the steps numbered (2) and (3). A wash step can be performed by centrifuging the cell out of the solution in which it is suspended, then suspending it in a wash solution, and then centrifuging it out of the wash solution. A wash solution is generally a probe-free solution. It is preferred that the free radical scavenger not be a fluorescent molecule that emits light at the fluorescent emission wavelength of the probe. In particular, it is preferred that the free radical scavenger neither absorb light at the fluorescent absorption wavelength of the probe nor emit light at the fluorescent emission wavelength of the probe.

In a particular embodiment of the process, the solution that is used in step (3) comprises a fluorescent probe, a free radical scavenger and a fixative. If a free radical scavenger is added to the cocktail, its preferred concentration is from 0.1% to 10% (v/v).

MULTIPLE REPORTER-LABELED PROBES

In a preferred embodiment of the invention, the probe comprises a single-stranded nucleic acid moiety and a plurality of reporter moieties such that each of the reporter moieties is covalently linked by means of a linker moiety to an intervening atom linked to an internucleoside phosphorus atom of the nucleic add moiety. An internucleoside phosphorous atom is one that is located between two nucleosides as opposed to being attached, at the 5' or 3' end of the oligonucleotide, to only one nucleoside. Preferably the reporter moiety is a dye molecule; especially preferred is that the reporter moiety be a fluorescent dye moiety. A fluorescent dye can be detected in a flow cytometer or under a microscope fitted for detection of fluorescence.

For dyes on probes used to detect the targets in the cell nucleus (e.g., nuclear DNA), it is preferred that the length of the probe be less than about 40 nucleotides. If the probe had seven dye molecules, each with molecular weights between about 500 and 600, and seven linker moieties with a molecular weight similar to that of the acetamido moiety (about 60) and 40 nucleotides with an average molecular weight of about 345, then the molecular weight of the labeled probe would be about 20,000. A probe should normally be at least about 15 bases long for specific hybridization to take place.

For probes used to detect nucleic acids, especially RNA, in the cell cytoplasm, probes of not more than 200 nucleotides in length (molecular weight of not more than about

100,000) are preferred although larger oligonucleotides, for example, 1000 nucleotides long can be used.

If as, in the case of a dye, the dye ring nearest the linker moiety will be separated from the phosphorus atom by at least two atoms (i.e., the "separation length" will be at least two atoms. Generally, separation lengths of 3 to 30 atoms are preferred. Separation lengths of 3 to 10 atoms are particularly preferred.

In order to minimize potential anti-hybridization and quenching effects, it is preferred that the average number of nucleosides separating a dye-bound phosphorous atom from the next phosphorus atom along the oligonucleotide backbone be at least four atoms. More preferably, each phosphorous atom is separated from the next phosphorus atom along the oligonucleotide by at least six atoms.

The intervening atom between the linker moiety and the internucleoside phosphorous atom can, for example, be an oxygen atom, a sulfur atom, or a nitrogen atom. If the intervening atom is an oxygen atom, one has an internucleoside phosphotriester linkage. If the intervening atom is a sulfur atom, one has a an internucleoside phosphorothioate triester linkage. If the intervening atom is a nitrogen atom, one has an internucleotide phosphoroamidate triester internucleoside linkage. (See Agrawal and Jamecnik, Nucleic Acids Research vol 18: 5419 (1990)) for examples of the phosphorothioate triester and phosphoroamidate triester linkages. The triester linkage involve the diester linkage found along the backbone of naturally occurring nucleic acids plus a third ester linkage between the phosphorus atom and the intervening atom (the atom intervening between the phosphorus atom and the linker moiety).

If the intervening atom is a sulfur atom, then the linker moiety can be an acetamido moiety. In that case, if the dye is fluorescein, the number of atoms separating the dye molecule ring from the internucleoside phosphorus atom will be four (the nitrogen and two carbon atoms of the acetamido moiety plus the intervening sulfur atom).

If the intervening atom is a nitrogen atom, then the linker moiety can be an aminohexyl moiety. In that case, if the dye is fluorescein, the number of atoms separating the dye molecule ring nearest the linker from the internucleoside phosphorus atom will be eight, the nitrogen and six carbon atoms of the linker moiety plus the intervening nitrogen atom. If the dye molecule is fluorescein isothiocyanate, an additional two atoms, the nitrogen and carbon atoms contributed by the isothiocyanate moiety, will separate the dye molecule ring nearest the linker from the phosphorus atom.

It is understood that the hybrid molecule will be formed because the nucleic acid strand of the probe hybridizes to a nucleic acid strand of the target as a result of the fact that those two strands have a nucleoside sequence complementary to each other (e.g., the nucleoside's base, adenine complementary to either uracil or thymine in the other nucleoside, guanine complementary to cytosine), it not being necessary, however, that the entire nucleoside sequence of the probe be complementary to the entire nucleoside sequence of the target.

The fluorescent dye can be chosen as desired. Commonly used fluorescent dyes (noted with a convenient linker moiety) are 5-(2-(iodoacetyl)amino)ethyl)amino) naphthalene-1-sulfonic add, 5-iodoacetamidofiuorescein, 6-iodoacetamidofluorescein, tetramethylrhodamine-5-iodoacetamide, tetramethyIrhodamine-6-iodoacetamide, monobromobimane, erythrosin-5-iodoacetamide, 7-diethylamino-3-((4'-iodoacetylamino) phenyl)-4-methylcoumarin, 4'-((iodoacetylamino)methyl)fluorescein, erythrosin-5- iodoacetamide, biotin iodoacetamide, N-(1-pyrene)iodoacetate, biotin iodoacetamide, N-(1- pyrene)iodoacetate, N-((2-(iodoacetoxy)ethyl)-N-memyl)amino-7-nitrobenz-2-oxa-1,3-diazole.

One of many alternatives to iodoacetamide is maleimide.

7-diethylamino-3-((4'-iodoacetylamino)phenyl)-4-methylcoumarin, and especially, 5- iodoacetamidofluorescein, 6-iodoacetamidofluorescein, tetramethylrhodamine-5- iodoacetamide, tetramethylrhodamine-6-iodoacetamide, and N-((2-(iodoacetoxy)ethyl)-N- methyl)amino-7-nitrobenz-2-oxa-1,3-diazole are preferred dyes for purposes of the present processes.

Monobromobiimine is a poor choice for in situ hybridization of eukaryotes, possibly because it does not efficiently pass through the cellular membranes.

It is important that the reporter moiety be stably linked to the nucleic acid probe moiety under conditions of the hybridization assay, give an adequate signal and, if it is a fluorescent dye, have usable excitation and emission wavelengths.

A REPORTER DYE MOL ECULE WILL PREFERA BLY HAVE A MOL ECUL AR WEIGHT I N THE RANG E, 400 TO 700, BUT DYES WITH MOLECULAR WEIGHTS BETWEEN 700 AND 1500 CAN BE USE D.

Patent Application of Reading et al. USE OF REPORTER GROUP ANALOGUES AS BACKGROUND REDUCERS

In a further embodiment of the 3SR in situ process for detecting an analyte RNA molecule in a cell, during step (2) an aromatic reporter group is part of the probe molecule, and before step (3) is completed, the cell is incubated with a structural analogue of the reporter group. Preferably, during step (2) the analogue is present in the same solution used to hybridize probe molecules to the amplification molecules in the cell; furthermore step (3) is performed in a manner that will detect the reporter group but not the analogue (e.g., with a fluorescent probe, by using excitation and/or emission wavelengths that will lead to detection of the reporter group but not the analogue).

In a subgeneric aspect of the invention, the reporter group is a cyclic compound. In a further subgeneric aspect of the invention, the cyclic group comprises an unsaturated bond. In a still narrower subgeneric aspect of the invention, the cyclic group is an aromatic compound (one or more benzene rings).

It is preferred that, on a molar basis, the analogue is in excess as regards the reporter group; it is highly preferred that there be at least 10 times as much analogue as reporter group.

It is hypothesized that the invention works because the analogue competes with the reporter group for nonspecific binding sites. In the case of aurin, or a derivative thereof, used in conjunction with a nucleic add probe, an additional mechanism may involve aurin binding to the active site of proteins that would bind the reporter group. It is preferred that the analogue is selected so that it retains most or all of the structural features of the reporter group. The analogue may additionally have structural features not present in the probe.

Preferably, the analogue should be able to permeate a cell or virus. In the case of analogues that are aurin derivatives (rosolic add derivatives), it is preferred that the analogues have a polar functional group such as a -CO₂, -NH₂, -OH, or -SO₃ group, on an aromatic group; examples are chromoxane cyanine R and Chrome Azurol S. A subgroup of preferred analogues are those that block the NH₂ groups on lysines. Fluorescent reporter groups are detected by allowing the reporter group to absorb energy and then emit some of the absorbed energy; the emitted energy is then detected.

Chemiluminescent reporter groups are detected by allowing them to enter into a reaction, e.g., an enzymatic reaction, that results in energy in the form of light being emitted.

Other reporter groups, e.g., biotin are detected because they can bind to groups such as streptavidin which are bound, directly or indirectly to enzymes, e.g. (alkaline phosphatase or horse radish peroxidase that can catalyze a detectable reaction.)

Fluorescent groups with which this invention can be used include fluorescein (or FTTC), Texas Red, Coumarin, Rhodamine, Rhodamine derivatives, Phycoerythrin, and Perci-P.

Chemiluminescent groups with which this invention can be used include isoluminol (or 4-aminophthalihydrazide; See catalogues of Aldrich Chemical Co. for 1990-91, or see Molecular Probes, Inc. catalogue) In one preferred embodiment of the process, when the reporter group is fluorescein, step (4) comprises measuring light emitted at wavelengths between about 520 nm and 560 nm (especially at about 520 nm), most preferably where the absorption wavelengths of step (3) are less than 520 nm.

A preferred embodiment of the fluorimetric process further comprises a wash step between the steps numbered (2) and (3). A wash step can be performed by centrifuging the cell out of the solution in which it is suspended, then suspending it in a wash solution, and then centrifuging it out of the wash solution. A wash solution is generally a probe-free solution.

In a particular embodiment of the process, the solution that is used in step (2) comprises a probe (comprising a reporter group), an analogue of the reporter group, a and a fixative. Such a probe solution is itself an invention.

If an analogue is added to the solution used for step (2) its preferred concentration is from 0.01 to 0.5% w/v (especially about 0.05 to 0.01%).

Preferred combinations are fluorescein or a rhodamine derivative in combination with aurin, a derivative thereof or Napachrome Green.

Probes

The nucleic acid probe may be DNA, RNA, or oligonucleotides or polynucleotides comprised of DNA or RNA. The DNA or RNA may be composed of the bases adenosine, uridine, thymidine, guanine, cytosine, or any natural or artificial chemical derivatives thereof. The probe is capable of binding to a complementary or mirror image target cellular genetic sequence through one or more types of chemical bonds, usually through hydrogen bond formation.

Nucleic add probes may be detectably labeled prior to addition to the hybridization solution. Alternatively, a detectable label may be selected which binds to the hybridization product. Probes may be labeled with any detectable group for use in practicing the invention. Such detectable group can be any material having a detectable physical or chemical property. Particularly useful are enzymatically active groups, such as enzymes (see

Clin. Chem., 22:1243 (1976)), enzyme substrates (see British Pat. Spec. 1,548,741), coenzymes

(see U.S. Patents Nos. 4,230,797 and 4,238,565) and enzyme inhibitors (see U.S. Patent No.

4,134,792); fluorescers (see Clin. Chem., 25:353 (1979); chromophores; lurninescers such as chemiluminescers and bioluminescers (see Clin. Chem., 25:512 (1979)); specifically bindable ligands; proximal interacting pairs; and radioisotopes such as ³H, ³⁵S, ³²P, ¹²⁵I and ¹⁴C.

Biotin labeled nucleotides can be incorporated into DNA or RNA by nick translation, enzymatic, or chemical means. The biotinylated probes are detected after hybridization using avidin/streptavidin, fluorescent, enzymatic or colloidal gold conjugates. Nucleic adds may also be labeled with other fluorescent compounds, with immunodetectable fluorescent OR haptenated digoxigenin Reacta ble wirh an antibody

derivatives or with biotin analogues. Nucleic adds may also be labeled by means of attaching a protein. Nucleic adds cross-linked to radioactive or fluorescent histone HI, enzymes (alkaline phosphatase and peroxidases), or single-stranded binding (SSBP) protein may also be used. To increase the sensitivity of detecting the colloidal gold or peroxidase products, a number of enhancement or amplification procedures using silver solutions may be used. An indirect fluorescent immunocytochemical procedure may also be utilized (Rudkin and Stollar (1977) Nature 265: 472; Van Prooijen, et al (1982) Exp. Cell. Res. 141: 397). Polyclonal antibodies are raised against RNA-DNA hybrids by injecting animals with poly(rA)-poly(dT). DNA probes were hybridized to cells in situ and hybrids were detected by incubation with the antibody to RNA-DNA hybrids.

Photobiotin™ labeling of probes is preferable to biotin labeling.

Targets in cells, tissue, and fluids

The analyte RNA can be located in a biological entity that is either a cell or a virus. The cell or virus may be suspended in solution and not immobilized on a solid support. On the other hand, the cell or virus may be immobilized on a solid support. The cell or virus may be part of a tissue section (histologic section).

In one embodiment of the process, the target cell is immobilized on a solid surface during hybridization. In another embodiment, the target cell is suspended in liquid during the entire process and not immobilized on a solid surface. Use of conventional flow cytometry instruments is especially facilitated with the present inventions.

The cells containing the analyte nucleic acid molecules may be eukaryotic cells (e.g., human cells), prokaryotic cells (e.g., bacteria), plant cells, or any other type of cell. They can be simple eukaryotes such as yeast or derived from complex eukaryotes such as humans.

The analyte RNA may be in a non-enveloped virus or an enveloped virus (having a non-enveloped membrane such as a lipid protein membrane). The analyte RNA may be viral RNA. In the case of some viruses (e.g., human immunodeficiency virus) complementary analyte RNA strands can exist simultaneously in a single cell.

A viral nucleic acid target can be part of a virus, in which case the virus may or may not be inside a cell. Alternatively, a viral nucleic add target may not be part of a virus, but may be inside a cell.

The hybridization assay can be done for targets in biological entities in liquid suspension, in cells on slides or other solid supports, in tissue culture cells, and in tissue bone marr ow, sections. When the biological entity is a cell, it can come from solid tissue (e.g.,^ nerves, muscle, heart, skin, lungs, kidneys, pancreas, spleen, lymph nodes, testes, cervix, and brain) or cells present in membranes lining various tracts, conduits and cavities (such as the gastrointestinal tract, urinary tract, vas deferens, uterine cavity, uterine tube, vagina, respiratory tract, nasal cavity, oral cavity, pharynx, larynx, trachea, bronchi and lungs) or cells in an organism's fluids (e.g., urine, stomach fluid, sputum, blood and lymph fluid) or stool.

Hybridization Fixatives and Solutions

Fixatives and hybridization of fixed cells are discussed in PCT applications WO 90/02173 and WO 90/02204. Fixatives should provide good preservation of cellular morphology and both accessibility and hybridizability of hybridization targets (and, if desired, accessibility and immunoreactivity of antigens.) Predpitation fixatives include ethanol, acetic acid, methanol, acetone, and combinations thereof. Cross-linking fixatives include paraformaldehyde, glutaraldehyde and formaldehyde. Cross-linking fixatives, must be used under conditions where they do not form networks that trap nucleic acids or modify them covalently so as to destroy their hybridizability.

A fixative may be selected from the group consisting of any precipitating agent or cross-linking agent used alone or in combination, and may be aqueous or non-aqueous. The fixative may be selected from the group consisting of formaldehyde solutions, alcohols, salt solutions, mercuric chloride sodium chloride, sodium sulfate, potassium dichromate, potassium phosphate, ammonium bromide, calcium chloride, sodium acetate, lithium chloride, cesium acetate, calcium or magnesium acetate, potassium nitrate, potassium dichromate, sodium chromate, potassium iodide, sodium iodate, sodium thiosulfate, picric acid, acetic add, paraformaldehyde, sodium hydroxide, acetones, chloroform, glycerin, thymol, etc. Preferably, the fixative will comprise an agent which fixes the cellular constituents through a precipitating action and has the following characteristics: the effect is reversible, the cellular (or viral) morphology is maintained, the antigenicity of desired cellular constituents is maintained, the nucleic acids are retained in the appropriate location in the cell, the nucleic acids are not modified in such a way that they become unable to form double or triple stranded hybrids, and cellular constituents are not affected in such a way so as to inhibit the process of nucleic acid hybridization to all resident target sequences.

The cross linking agents when used are preferably less than 10% (v/v). T h e hybridization solution used for step (2) of the process of detecting an analyte RNA molecule may typically comprise a chaotropic denaturing agent, a buffer, a pore forming agent, a hybrid stabilizing agent. The chaotropic denaturing agents (Robinson, D. W. and Grant, M. E. (1966), J. Biol. Chem. 241: 4030; Hamaguchi, K. and Geiduscheck, E. P. (1962), J. tri fluoroacetate,

Am. Chem. Soc.84: 1329) include formamide, urea, thiocyanate, guanidine,^ trichloroacetate, tetramethylamine, perchlorate, and sodium iodide. Any buffer which maintains pH at least between 7.0 and 8.0 is preferred. The pore-forming agent is for instance, a detergent such as Brij 35, Brij 58, sodium dodecyl sulfate, CHAPS or Triton X-100. 0.05% Brij 35 or 0.1% Triton X-100 appear to permit probe entry through the plasma membrane but not the nuclear membrane. Alternatively, sodium desoxycholate will allow probes to traverse the nuclear membrane. Thus, in order to restrict hybridization to the cytoplasmic biopolymer targets, nuclear membrane pore-forining agents are avoided. Such selective subcellular localization contributes to the specificity and sensitivity of the assay by decreasing or eliminating probe hybridization to complimentary nuclear sequences when the target Wopolymer is located in the cytoplasm. Hybrid stabilizing agents such as salts of mono- and di-valent cations are included in the hybridization solution to promote formation of hydrogen bonds between complimentary sequences of the probe and its target biopolymer. Preferably sodium chloride at a concentration from 0.15 M to 1 M is used. In order to prevent non-specific binding of nucleic add probes, nucleic acids unrelated to the target biopolymers are added to the hybridization solution.

Solid supports which may be utilized include, but are not limited to, glass, Scotch tape (3M), nylon, Gene Screen Plus (New England Nuclear) and nitrocellulose. Most preferably glass microscope slides are used.

KITS Kits for performing the various inventions herein can be constructed by packaging and/or bottling various compounds and reagents for the inventions and placing the package(s) and/or bottle(s) in a single container, preferably with instructions on how to perform the process of the invention.

Basic kits would have reagents useful for the 3SR process, such as the necessary enzymes and preferably also the deoxyribonucleosides and ribonucleosides. Reagents for hybridization would be included, such as a formamide-containing buffer. The hybridization reagents would preferably include one or more of the following: a permeation enhancer of the present inventions, a free radical scavenger, and a reporter group analogue. A preferred kit would also have a background reducer, such as Evans Blue, for use during fluorimetric measurements. Another embodiment of the kit would include a signal enhancer. Specialized kits would contain primers and probes for specific diagnostic purposes, such as a translocation or infecting viral RNA.

REAGENTS

Reagents can be purchased from any of a variety of sources including Aldrich Chemical Co., Milwaukee, Wisconsin; Sigma Chemical Co., St. Louis, Missouri; Molecular Probes, Inc., Eugene, Oregon; Clontech, Palo Alto, California; Kodak, Rochester, NY; and Spectrum Chemical Manufacturing Corp., Gardenea, California.

Further information about certain substances referred to herein is shown in Table 1. Table 1. Abbreviations and Common Names of Compounds and Dyes

Abbreviation

or

common name Compound

Tempo 2,2,6,6-tetramethylpiperidine-N-oxyI {CAS # 2564-83-2}

EDTA ethylene diamine tetraacetic add

DMSO dimethyl sulfoxide

DTT dithiothreitol

PVP polyvinylpyrrolidone

PEG 4000 polyethylene glycol (ca. 4000 Mol. Wt.)

PBS phosphate-buffered saline solution

CHAPS 3-((3-cholam dopropyl)-dimethylammonio)-1-propane-sulfonate {CAS

# 75621-03-3}

photobiotin N-(4-azido-2-nitrophenyl)-N^,-(3-biotinylaminopropyl)-N'-methyl-1,3- propanediamine {CAS # 96087-37-5}

Ficoll nonionic polysucrose (Pharmada)

Percoll colhodal PVP-coated silica {CAS # 65455-52-9}

Triton X-100 octyl phenoxy polyethylene glycol (a polyoxyethylene ether){CAS #

9002 -93-1; see also Aldrich Chemical Co. Catalogue for 1990-91}

Brij 35 polyoxyethylene 23 lauryl ether {CAS # 9002-92-0}

Brij 58 polyoxyethylene 20 cetyl ether {CAS # 9004-95-9}

Hoechst 33258 2'-[4-hydroxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5'-bi-1H- benzamidazole trihydrochloride [CAS # 23491-52-3]

Dye abbreviations

Dye Number Actual Dye Name Abbreviation

12 Naphthol Blue Black Naphthol Bl. Blk.

13 Palatine Fast Black WAN Palatine F-B WAN

20 Sulforhodamine 101 hydrate Sulforhodamine 101

Fluorescein isothiocyanate FTTC

Solutions

SSC has the following composition: 0.15 M NaCl, 0.15 M sodium citrate, pH 7.0.

2x SSC is composed so that upon a 1:1 dilution with water, SSC would be produced; 10x SSC is composed so that upon a 1:10 dilution with water, SSC would be produced. 0.1 × SSC is SSC diluted 1:10 with water.

Fixation solution F, used in flow cytometry, has the following ingredients: 4 volumes ("vol") of ethanol plus 5 vol of 1 × PBS solution plus 1 vol of glacial acetic add.

Wash solution #1 has the following composition: 0.4 M guanidinium

isothiocyanate, 0.1% Triton X-100, 0.1 X SSC, in deionized water. Wash solution #2 has the following composition: 0.1% Triton X-100, 0.1% SSC, in deionized water.

PBS is phosphate-buffered saline and has the formula, 0.136 M NaCl, 0.003M KCl, 0.008M Na₂HPO₄.7H₂O, 0.001 M KH₂PO₄.

EXAMPLES OF DISEASES AND TRANSLOCATIONS DETECTABLE BY THE PRESENT INVENTION

Table 2 is illustrative of the types of diseases that can be detected by using the present inventions. It is not intended to place a limit on the types of diseases or translocations that can be detected by the present inventions.

TABLE 2

Examples of known translocations t (2;8) (p11; q24) Burkitt lymphoma (Fujino et ah, Jpn. J. Cancer Res., vol 77, pp 24-77 (1986)

t (11;14) (q13; q32) Chromic lymphocytic leukemia (Y. Tsujimoto et al., NAture, vol 315, pp 340-343 (1985)) t (7;9) (q34; q34.3) acute T cell lymphoblastic lymphoma (T. C. Reynolds et al., Cell, vol 50, 107-117 (1987)) t (14;14) (q11; q32) T cell chronic lymphocytic leukemia (M. P. Davey et al., Proc. Natl. Acad. Sci. USA vol 85, pp 9287-9291 (1988))

t (8; 14) (q24; q32) Burkitt lymphoma (F. G. Haluska et al., Proc. Natl. Acad.Sd., USA, vol 84, pp 6835-6839 (1987))

t (10; 14) (q24; q11) T cell acute lymphoblastic leukemia (M. Zutter et al., Proc. Natl. Acad. Sci. USA vol 87, pp 3161-3165 (1990)

t (9; 14) (p13; q32) Diffuse large cell lymphoma (H. Ohno et al., Proc. Natl. Acad. Sci. USA, vol 87, pp 628-632 (1990))

t (1;14) (p33; q11) leukemia cells (8) (C. G. Begley et al., Proc. Natl. Acad. Sci. USA, vol 86, pp 2031-2035 (1989))

t(X;18)(p11.2;q11.2) synovial sarcoma

(X-Y translocation) X-linked recessive chondrodysplasia punctata

(47,XY,+del(5)(q12q34),t(15;21)(q21;q22) acute myeloblastic leukemia (AML)

47,XY,+del(5)(q12q34) acute nonlymphocytic leukemia (ANLL)

t(8;14)(q24;q11) acute lymphoblastic leukemia (T-ALL)

t(8;14)(q24;q11) leukemia/lymphoma

13(q11) other ALLs

(proximal del15q) Prader-Willi syndrome

t(1;15)(p36.2;p11.2) generalized muscular hypotonia

(X;5)(p11.2;q35.2) Incontinentia pigmenti

(2q13) rhabdomyosarcoma t(16;21)(q11;p11) Trisomy 16p

t(1:19) Pre-B cell acute lymphoblastic leukemias

t(15;17) Acute promyelocytic leukemia (APL)

t(1;7)(p11;p11) acute myeloid leukemia or myelodysplasia

(8q24 14q32) Burkitt's lymphoma

Bcl-2 t(11;14)(q13;q32) Bcl-1

t(14;18)(q32;q21) Hodgkin lymphoma (NHL)

t(8;14)(q24;q32) follicular histologic pattern

t(3:22)(q27;q11)) Burkitt-like lymphoma t(11;14)(q13;q32) diffuse large cell lymphoma

t(9;22)(q34;q11) chronic myelomonocytic leukemia w/ (Ph)

t(4;6)(p15;p12) chronic myelomonocytic leukemia w/(Ph)

inv(3)(q21q26) refractory anemia

t(3;3)(q21;q26) RAEB-T

inv(3)(q21q26) myelofibrosis with myeloid metaplasia (MMM) lesions on the 3p renal cell carcinoma (RCC)

(3;21)(q26;q22) secondary leukemia

t(3;21)(q26.3;q22) acute myeloid leukemia

5q35 Malignant histiocytosis in childhood

t(5;6)(q35;p21)

t(2;13)(q37;q14) rhabdomyosarcoma (RMS)

(Y;11)(q11.2;q24) Jacobsen syndrome

t(X;18)(p11;q11) biphasic and monophasic synovial sarcoma

t(X;15;18)(p11;q15;q11) "

t(X;7)(q11-12;q32) "

14q32 (28%) or 14q11(14%) adult T-cell leukemia/lymphoma

t(19;22)(q13.3;p11.2) distal 19q

*translocation* between

chromosomes* 11 and 22 Neuroepitheliomas

+der(1q9p) myeloproliferative disorders

break points at Xp22 and Xq28 balanced X-autosome

11q23 adult acute myeloid leukemia

aberrations of 13q or trisomy 13

7q and 1q

trisomy 11q

t(8;14)(q24;q32) Burkitt type of leukemia

t(9;22)(q34;q11) Philadelphia-positive ALL (Phi + ALL)

X;6 q15-16 congenital acute lymphoblastic leukemia (ALL)

(8;21) refractory anemia

46,XY,der(5)t(5;11)(p15.2;p14)[11p15] Beckwith-Wiedemann syndrome (BWS) 11p15,fus(14p;21p),and fus (15p;21p) Giant cell tumor of bone (GCT)

11q 13 multiple endocrine neoplasia type 1 (MEN1)

t(7;22)(p22;q13), in association with inv(16)(p13q22) acute nonlymphocytic leukemia (M4)

46,XY/46,XY,t(7;19)(q22;p13.3) acute myelomonocytic leukemia (FAB M4) 46,XY/46,XY,t(7;19)(q11;q13) childhood ALL

6,XY,t(3q;11q),t(7q;19p),t(15;17)(q26;q22) ANLL (FAB M3) '2 (End Table 2)

EXAMPLES

Example 1 3SR Detection of a translocation in situ

Cells from the K562 human chrome myelogenous leukemia-blast crisis cell line in used.

medium plus 10% fetal bovine serum were^ 3 × 10⁷ cells were centrifuged at 5 minutes at 250 X g. The supernatant fluid was aspirated and the cells were resuspended in phosphate-buffered saline after 3 minutes at room temperature. The cells were centrifuged for 5 minutes, the supernatant fluid was aspirated and the cells were resuspended in 4% paraformaldehyde. After incubation for 3 minutes at room

temperature the cells were dehydrated through graded alcohol.

The cells were centrifuged for 5 minutes, the 4% paraformaldehyde was aspirated, and resuspended in 1 ml DEPC-treated 30% ethanol. (DEPC is diethylpyrocarbonate). After 3 minutes at room temperature 0.8 ml of 100% ethanol was added to adjust the ethanol concentration to 60%. After a further 3 minutes, 1.8 ml of 100% ethanol was added to bring the concentration to 80% ethanol. Finally, after 3 minutes, 11.4 ml 100% ethanol was added to produce 95% ethanol. The cells were then centrifuged for 5 minutes, the ethanol aspirated and they were resuspended in 4.5 ml 100% ethanol, After 3 minutes at room temperature, the cells were serially rehydrated. 250 ul of DEPC-treated water was added to reduce the ethanol concentration to 95% after 3 minutes, 1.15 ml DEPC-treated water was added to achieve 80%. ethanol. After 3 minutes, 1.9 ml DEPC-treated water was added to achieve 60% ethanol. Finally, 7.5 ml DEPC-treated water was added to produce 30% ethanol. The cells were spun 5 minutes, the supernatant fluid aspirated and the cells were resuspended in 1 ml DEPC- treated 2X SCC solution. The cells were transferred to 1.5 ml miCTOcentrifuge tubes and incubated for 3 minutes prior to proteinase K digestion and 3SR reaction.

The cells were spun in a microcentrifuge for 2 minutes at 1500 rpm, the

supernatant fluid aspirated, and the cells resuspended in ml Proteinase K (10 ug/ml) in DEPC-treated 2 mM CaCl₂, 20 mM Tris-Cl pH 7. After 15 minutes digestion at 42°, the cells were centrifuged 2 minutes at 1500 rpm and resuspended in 1 ml DEPC-treated PBS. The cells were spun 2 rninutes at 1500 rpm, the supernatant fluid aspirated, and resuspended in 1 ml DEPC-treated PBS. The cells were centrifuged 2 minutes at 1500 rpm, the supernatant aspirated, and 100 microliters 3SR solution containing bcr- and abl- 3SR primers (each at 250 ng/100 ul) and the enzymes and buffers for the 3SR reaction were added.

The 3SR reaction solution had Tris-HCl (40 mM, pH 8.1), MgCI₂ (30 mM), KCl (20 mM), DTT (10 mM), spermidine (4 mM), ATP (7 mM), CTP (7 mM), GTP (7 mM), UTP (7 mM), dATP (1 mM), dCTP (1 mM), dGTP (1 mM), TTP (1 mM).

The 5':bcr primer had the nucleotide sequence:

AATTTAATACGACTCACTATAGGGATCAGGGTGCACAGCCGCAACGGC

The 3':abl primer had the nucleotide sequence: AATTTAATACGACTCACTATAGGGATCGGCTTCACTCAGACCCTGAGG

The enzymes in the 3SR reaction were AMV reverse transcriptase (30 units/100ul) and T7 RNA polymerase (100 units/100 ul), and E. coli RNase H (3 units/100 ul). After 2 hours at 42°C, 1.4 ml DEPC-treated PBS was added, and 0.5 ml aliquots were transferred to each of three microcentrifuge tubes. The cells were spun 2 minutes at 1500 rpm, the solution aspirated, and the hybridization probes were added.

The negative probe, designated NR, was derived from the nitrogen reductase gene found in bacteria and was known to not hybridize to nucleic add within eucaryotic cells.

The L6-26 probe had the sequence: CGCTGAAGGGC-TTCTTCCTTATTGAT The K28-26 probe had the sequence: CGCTGAAGGGCTTTTGAACTCTGCTT The oligodeoxynucleotides were synthesized (Applied Biosystems DNA Synthesizer Model 380 B using the recommended AB.I. reagents), and in the last stage an

aminohexyl phosphate linker was attached to the 5' end. The 5 ' -aminohexyl

oligodeoxynucleotides were then coupled to a fluorescein dye (FITC) as described elsewhere herein and purified by Waters HPCL using a baseline 810 chromatography work station.

For the hybridization procedure, to the pelleted cells was added 50 ul of a hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4 1 ug/ul sheared DNA, 3% (v/v) Triton X-100, 5% PEG 4000, 25mM DTT, 4M guanidinium isothiocyanate, 15X FicoI/PVP, and the probe (NR, 28S, or a combination of K28-26 and L6-26, the combination being referred to here as the K28+L6 probe) added at a concentration of 2.5 ug/ml. The cells were incubated 1 minute at 95° to denature the 3SR products and the probes were annealed at 42° for 30 min. Proper washing after the hybridization reaction is essential to eliminate background due to nonspecific binding of the probes. The cells were incubated at 42° in ml of Wash A solution, consisting of 0.1X SSC, 0.4M guanidinium isothiocyanate, and 0.1% Triton X- 100. The tubes were mixed on a vortex mixer, and spun in a microcentrifuge for 2 min at 1500 rpm. The supernatant was removed, and to the pellet was added 1 ml of Wash B solution at 42° consisting of 0.1X SSC, 0.2% Triton X-100. The cells were mixed on a vortex mixer and spun 2 min at 1500 rpm. After aspiration of Wash B, the cells were suspended in 250 ul of 0.0025% Evans Blue (added as a background reducer) in PBS, mixed on a vortex mixer, and analyzed on a Coulter Profile flow cytometer.

The cells were analyzed on Profile II™ made by Coulter Instruments. The instrument uses a 488nm argon laser, a 525nm band pass filter for FL1 and a 635nm band pass filter for the counterstain. For each sample analyzed the sample containing the negative probe was analyzed first and the quad-stats were set so that a small percentage of the cells fell in the upper-right quadrant. Next, the sample analyzed with the positive probe was analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats were set correctly and the two samples had been handled identically, any number of cells (above the control level) that were recorded in the upper right quadrant were scored as positive. Using a light scatter gate #2 including all of the cells and excluding the majority of the debris, 88% of the events were in region 2 of the lower left histogram. The mean channel of fluorescence of log fluorescence 1 (FITC) was 0.899 with NR probe and was 8.7 for 100% of the events with the K28+L6 probe. This represents about a 10-fold signal-to-noise ratio. This ratio was significantly higher than in the absence of 3SR amplification.

Additionally, The list mode data was later reanalyzed using USTVTEW software and the light scatter gate was adjusted to include 100% of the cellular events. A cursor was selected so that 93.5% were lower than the selected level when the NR probe was used, and 99% were higher than that level when the K28+L6 probe was used.

K562 cells can be obtained from the American Type Culture Collection, Rockville Maryland, listed as K-562 cells, ATCC CCL 243.

Example 2

Demonstration that 25-base oligomers hybridize while 6- to 12-base oligomers do not under the hybridization conditions of the Example

The H9 cell line was used in the following experiment. Cultured cells were washed with nuclease-free Phosphate Buffered Saline (PBS) and placed in a single cell

suspension at a concentration that resulted in clearly separated cells. The cells were spun down to a pellet and the supernatant, drained off. The cells were resuspended in 40% ethanol, 50% PBS, and 10% glacial acetic acid and left for 12-16 hours at 4°C. After fixation, the cells were spun to remove the fixative and then washed once in IX PBS and resuspend in 2X SSC. The cells should be used immediately.

For a positive control probe, a conserved segment of the eukaryotic 28S rRNA was designed and utilized; it was designated 28S-25-AL and it served as a positive probe for the experiment described herein. The negative probe, designated NR 25-AL, was derived from the nitrogen reductase gene found in bacteria and was known to not hybridize to nucleic add within eukaryotic cells. The DNA sequences for these two probes used are shown in Table 4 below. Twelve base, ten base, eight base, and six base oligomers, derived from these 25-base oligomers were also prepared with the sequences shown in the Table 4 below. All sequences displayed in the Examples have the 5' end as the left end of the sequence.

Table 4

Probe Sequence

28S-25-AL ATCAGAGTAGTGGTATTTCACCGGC

28S-21-AL ATCAGAGTAGTGGTATTTCAC

28S-18-AL ATCAGAGTAGTGGTATTT

28S-15-AL ATCAGAGTAGTGGTA

28S-12-AL ATCAGAGTAGTG

28S-10-AL ATCAGAGTAG

28S-8-AL ATCAGAGT

28S-6-AL ATCAGA NR 25-AL TACGCTCGATCCAGCTATCAGCCGT

NR 12-AL TACGCTCGATCC

NR 10-AL TACGCTCGAT

NR 8-AL TACGCTCG

NR 6-AL TACGCT

(In all sequences described herein, the 5' end is at the left end.)

The oligodeoxynucleotides were synthesized (Applied Biosystems DNA Synthesizer Model 380 B using the recommended A.B.I. reagents), and in the last stage an aminohexyl linker was attached to the 5' end phosphate. The 5'-aminohexyl

oligodeoxynucleotides were purified and coupled to a rhodamine derivative from

Molecular Probes and purified by Waters HPLC using a baseline 810 chromatography work station.

For the hybridization procedure, to pelleted cells was added 50 μl of an hybridization cocktail consisting of 30% formamide, 5X SSC, 0.16M sodium phosphate buffer, pH 7.4, 1 μg/μl sheared DNA, 3% (v/v) Triton X-100 (alcohol derivative of polyoxylene ether, see Aldrich Chemical Co. catalogue for 1990-91), 5% PEG 4000 (polyethylene glycol), 25 mM DTT (dithiothreitol), 0.4 M guanidinium isothiocyanate, 15X Ficoll/PVP, and the probe added at a concentration of 2.5 μg/ml. Hybridizations were carried out at 42°C for 30 minutes. In the foregoing, 500X Ficoll/PVP is 5g of Ficoll type 400 (polysucrose 400,000 mol wt) plus 5 g of PVP (polyvinylpyrollidone) dissolved in water to a total volume of 100 ml; 15X Ficoll/PVP is 500X Ficoll/PVP diluted with water by a factor of 15/500.

Proper washing after the hybridization reaction is essential to eliminate background due to non-specific binding of probe. Post-hybridization the cells were placed in a 15 ml conical tube to which was added 10 ml of a wash solution preheated to 42°C, consisting of 0.1X SSC, 0.4M guanidinium isothiocyanate, and 0.1% Triton. The solution was agitated until the cells were a single cell suspension and then spun at 250 X g for 5 minutes. The supernatant was removed and to the pellet was added 10 ml of a wash solution preheated to 42°C, consisting of 0.1X SSC, 0.1% Triton. The solution was agitated until the cells were a single cell suspension. The cells were spun at 250 X g for 5 minutes. The supernatant was removed and the cell pellet resuspended in 0.2 ml solution consisting of 0.0025% Evans Blue in 1X PBS.

The cells were analyzed on a Profile II™ made by Coulter Instruments. The

Instrument uses a 488nm argon laser, a 525nm band pass filter for FL1 and a 635nm band pass filter for the counterstain. For each sample analyzed the sample containing the negative probe was analyzed first and the quad-stats were set so that less than 0.01% of the cells fell in the upper-right quadrant. Next the sample analyzed with the positive probe was analyzed under the exact same parameters as the sample analyzed with the negative probe. Since the quad-stats were set correctly and the two samples had been handled identically, any number of cells (above 0.01%) that were recorded in the upper right quadrant were scored as positive. Approximately 500,000 H9 cells were equally divided into two tubes and fixed as described above. For one of these sample aliquots was added a hybridization solution containing a positive probe (28S) and to the other a negative probe (NR), corresponding to the same size as the positive probe as in the list in Table 4 above. Following hybridization and washing, flow cytometry was performed.

Using flow cytometry, the following results were obtained: >99% of the cells were positive when probe 28S-25-AL was used, between 0.01% and 99% of the cells were positive when the 28S-21-AL probe was used, and <.01% were positive when any of the other probes were used. Furthermore if the mean LFL1 was measured, the results were as in Table 5.

Table 5

Signal (Mean LFL1 )

Length NR 28S Fold Diff.

6 .322 .370 1.1

8 6.4 .441 Neg

10 .422 .3 .70

12 .321 .231 .72

15 .327 .373 1.1

18 .407 .339 .83

21 .281 .616 2.2

25 .3 50.0 168

Example 3

Permeation Enhancers and Signal Enhancers

Flow cytometry A Coulter Profile II flow cytometer is used for flow cytometry. With FTTC as the probe dye, the filter for LFL3 is a 635 nm long pass filter and the filter for LFL1 is a 540 bp filter; the excitation wavelength is 488 nm. PMT1 and PMT3 settings are adjusted as required. A typical useful setting when fluorescein is the dye moiety is to have a PMT1 setting of 1100, a PMT3 setting of 900, and color compensation (PMT1, PMT3) of 15 percent.

A hybridization cocktail "HC" is a solution with the following composition: 5X SSC, 15X Ficoll/PVP, 0.16 M sodium phosphate buffer (pH6), 1 mg/ml sheared salmon sperm DNA, 10% Triton X-100, 0.4 M guanidinium isothiocyanate, 30% (v/v) formamide, 10 mM ethylene diamine tetraacetic acid ("EDTA"), 1.5% polyethylene glycol ("PEG"), 25 mM DTT (dithiothreitol), and 5 to 10 ug/ml (microgram/ml) probe.

A hybridization cocktail "HC-DMSO" is a solution with the following composition: 5X SSC, 15X Ficoll/PVP, 0.16 M sodium phosphate buffer (pH6), 1 mg/ml sheared salmon sperm DNA, 10% Triton X-100, 0.4 M guanidinium isothiocyanate, 30% (v/v) formamide, 10 mM ethylene diamine tetraacetic acid (" EDTA"), 1.5% polyethylene glycol ("PEG"), 25 mM DTT (dithiothreitol), 10% (v/v) DMSO, and 5 to 10 ug/ml probe. In the foregoing, 500X Ficoll/PVP is 5 g of Ficoll type 400 (polysucrose, 400,000 mol wt) plus 5 g of PVP (polyvinylpyrrolidone) diluted to a total volume of 100 ml with water; 15X Ficoll/PVP is 500X Ficoll/PVP diluted with water by a factor of 15/500.

For fluorimetric measurements in the flow cytometer, cells were suspended in 1 × PBS solution. The 28S RNA probe is specific for ribosomal RNA and has the nucleoitde sequence of the 28S-25-AL probe described herein. The NR probe is specific for the nitrogen reductase gene found in bacteria and not eukaryotic cells. It has the nucleotide sequence of the NR-25-AL probe described herein.

"Slide in situ preparation and hybridization protocol":

1) Cells are suspended in a fixative (3 vol ethanol plus 1 vol methanol) and transferred to glass slides by centrifugation using a Cytospin apparatus.

2) The assay solution (consisting of the hybridization cocktail HC alone or mixed with a compound or compounds being tested as an enhancer) with the DNA probe (25 ul) is placed over the cells and covered with a coverslip.

3) The slide is heated at 90 °C for 5 minutes for DNA denaturation, then incubated at 46 °C for 30 minutes for hybridization.

4) Cells are washed once with the wash solution #1, which was equilibrated at 42 °C. Then cells are washed ten times with wash solution #2, which was equilibrated at 42 °C.

5) Mounting solution (50% glycerol (v/v) in 1 × PBS plus the nuclear stain Hoechst,

(#33258; 1 ug/ml) is placed on the cells and covered with a coverslip.

6) The hybridization signal is observed under an Olympus BH10 microscope with fluorescent capabilities using a rhodamine derivative filters (excitation wavelength of 567 nm, emission wavelength of 584 nm).

"Liquid in situ Cell Preparation and Hybridization Protocol" (steps 1-6):

1. Cells are fixed in solution F, then resuspended in 2x SSC. 2. The cells are spun out of solution and resuspended in an assay solution (consisting of the hybridization cocktail HC alone or in combination with a compound or compounds being tested as an enhancer.)

3. After 30 min. at 42°C, the cells are washed in wash solution #1 preheated to 42 °C by centrifuging them out of the assay solution.

4. Cells are next washed in wash solution #2 preheated to 42°C.

5. Cells are resuspended in a 1X PBS solution containing 0.002% trypan blue as a counterstain.

6. Cells are run on a flow cytometer and a "Count vs. LFL1" histogram was generated. ("Count" refers to cell count.) This histogram is used as the basis for determining the mean LFL1.

The following four subparts (a), (b), (c) and (d) of this example can be done by using the probes and cells (after RNA amplification and hybridization) of Example 1, or any similarly sized probes with cells that have sufficient RNA to be detected (if the cells have sufficient RNA in the absence of amplification, then the subparts can also be performed

(see, for example, subpart (b).)

(a) The effect of adding both an alkane (squalane) and an additional compound is demonstrated as follows:

The Slide In Situ Cell Preparation and hybridization is followed. The hybridization cocktail consists of 8 volumes of HC-DMSO, one volume of squalane, and one volume of squalane and one volume of additional compound. The additional compound is one of the following: dodecyl alcohol (an alcohol), beta-cyclodextrin (a sugar), isopropyl palmitate (a fatty acid ester), 1,2-propanediol (an alcohol), pyrrolidinone (a lactam), hexamethyldisiloxane (an organic silane), or oleyl alcohol (an alcohol). In the control sample, one volume of water is used instead of one volume of additional compound. As a result, in all samples, the concentrations of DMSO and squalane are 8 percent and 10 percent (v/v), respectively.

A signal intensity of 2 is assigned to the slide observed for the control sample. All other slides are rated 1,2,3 or 4 in comparison to the control sample slide, depending on whether the intensity was 0.5, 1.0, 1.5, or 2 times that of the control sample slide, respectively.

(b) The effect on probe signal intensity of adding, in addition to DMSO, additional compounds to the assay solution was determined in an in situ liquid hybridization assay. The data was analyzed by flow cytometry.

The Liquid In Situ Cell Preparation and Hybridization Protocol was followed. The cells used were Hela cells. The probes used were a 28S RNA probe and an NR probe.

Each probe had an FITC moiety linked to its 5' end by an Aminolink crosslinker molecule

(aminohexyl; purchased from Applied Biosystems, Inc.).

The 28S RNA probe is a target-specific probe specific for ribosomal RNA fluorescence obtained with it represents the sum of fluorescence from target-bound probe, non-specifically bound probe and autofluorescence from cellular molecules. The NR probe is specific for a plant nucleic acid sequence and, in the current Example, the fluorescence obtained with it represent the sum of fluorescence from non-specifically bound probe and autofluorescence. In this experiment, the hybridization cocktail consisted of nine volumes of HC-DMSO plus one volume of additional compound. In the control sample, one volume of water replaced the one volume of additional compound. As a result, in all samples, the concentration of DMSO was 9 percent (v/v).

Table 6

Additional compound in Ratio

Hybridization cocktail 28S RNA Probe NR Probe 28S RNA/NR water 6.070 0.137 44

10% pyrrolidinone 10.19 0.133 77

10% B cyclodextrin 9.593 0.135 71

10% hexamethyldisiloxane 7.426 0.126 59

10% isopropyl palmitate 8.057 0.140 58

10% propanediol 8.227 0.148 56

10% dodecyl alcohol 4.804 0.142 34

10% oleic add 3.643 0.142 26

10% oleyl alcohol 0.731 0.136 - - -

10% squalane 0.611 0.123 - - -

The ratio, 28S/NR, is the ratio of the mean LFL1 observed with the 28S RNA probe to the mean LFL1 observed with the NR probe. The results in the "28S RNA probe" and "NR probe" columns give the mean LFL1 observed with the 28S RNA and NR probes, respectively.

These results are from an average of four independent experiments. The results in Table 6 show that pyrrolidinone, β -cyclodextrin, hexamethyldisiloxane, isopropyl palmitate and propanediol, in combination with nine percent DMSO, increased the signal brightness compared to those obtained with nine percent DMSO alone. Nine percent is at or close to the optimal DMSO concentration for signal brightness if DMSO alone is used.

The use of either 10 percent squalane or 10 percent oleyl alcohol, lead to their precipitation from solution and resulting biphasic mixture in both cases. As a result, in both cases the signal intensity was markedly decreased.

(c) The Liquid In Situ Cell Preparation and Hybridization Protocol is followed. The effect of a combination of DMSO and squalane on the fluorescent probe signal is measured as is that combination further enhanced with a third compound.

In all but two cases, the hybridization cocktail consists of 9 volumes of HC-DMSO, a half volume of squalane, and a half volume of an additional compound. The additional compound is one of the following: dodecyl alcohol (an alcohol), beta-cyclodextrin (a sugar), isopropyl palmitate (a fatty add ester), 1,2-propanedioI (an alcohol), pyrrolidinone (a lactam), hexamethyldisiloxane (an organic silane), or oleyl alcohol (an alcohol).In one case, the additional compound is replaced by water, so that the hybridization compound consisted of 9 volumes of HC-DMSO, a half volume of squalane, and a half volume of water. In the control sample, the cocktail consists of nine volumes of HC-DMSO and one volume of water. As a result, in all samples, there is 9 percent DMSO (v/v). When present, squalane is present at 5 percent. When present, the additional compound is present at 5%.

The ratio of the mean LFL1 for signal obtained using the probe specific for the analyte RNA molecules to the mean LFL1 for signal obtained using the NR probe is measured. (d) The effectiveness of various compounds as signal enhancers is demonstrated by including them in the mounting solution but not solutions that the cell were suspended in prior to being suspended in the mounting solution. After the in situ hybridization step, the cells are washed and then modified mounting solution was added and cells are observed under the microscope for fluorescence signal. Modified mounting solution is 9 volumes of mounting solution and one volume of additional compound, which is the compound being tested for its ability to be a signal enhancer. The additional compound is selected from one of the following: water (control), 1,2 propanediol, hydroxypropylcyclodextrin, hexamethyldisiloxane, dodecyl alcohol, pyrrolidinone, isopropyl palmitate, oleyl alcohol, squalane, and squalene (an alkene). Mounting solution consists of 0.1% 1,4 diphenylamine (antifade) in 50% glycerol (v/v), and nuclear stain Hoechst (#33258; 1 ug/ml).

Example 4

Examples of Background Reducers

A purpose of this Example was to determine whether a compound functioned as a background reducer; i.e., whether it decreased the amount of light emitted by non-specifically bound probe molecules and autofluorescing molecules without causing a similar decrease in the amount of light emitted by specifically bound probe molecules.

Table 7: Dye abbreviations used Dye Number Actual Dye Name Abbreviation

12 Naphthol Blue Black Naphthol Bl. Blk.

13 Palatine Fast Black WAN Palatine F-B WAN

20 Sulforhodamine 101 hydrate Sulforhodamine 101

Fluorescein isothiocyanate FITC

The NR probe was a DNA 25-mer that binds to part of the bacterial nitrogen reductase gene; its nucleic add moiety has the nucloeotide sequence of probe NR-25-AL described herein. The 28S RNA probe was a DNA 25-mer that binds to 28s ribosomal RNA; its nucleic acid moiety has the nucleotide sequence of probe 28S-25-AL described herein. The probes were synthesized and in the last stage an aminohexyl linker was attached to the 5' end phosphate. The 5' aminohexyl oligodeoxynucleotides were then coupled to a FITC dye molecule (from Molecular Probes) and purified by HPLC.

A Coulter Profile II flow cytometer was used as in Example 3.

Hybridization cocktail HC was as in Example 3 except for the following changes: 3%

Triton X-100 (v/v), 5% PEG.

The staining dye solution had the following composition:

0.002 % staining dye (w/v) in 1 × PBS. Generally, the staining dye, if useful as and used as a background-reducer, can be present at a concentration between 0.0002% and 0.10% (w/v). The cells are preferably incubated with the background reducing compound between 20° C and 46° and from 2 min up to 8 hours. Some staining dyes are also background-reducing compounds. Most also function as a counterstain. The staining dye solution had the same composition as the flow buffer for the FAScan.

H9 cells are a human-derived lymphoma cell line (ATCC No. CRL 8543).

As a test for non-specific binding, an "NR" probe was used.

As a test for specific binding, a "28S" probe was used.

When the NR probe is used, the amount of light emitted will be the sum of the amoimt of light emitted by two sources: nonspecifically bound probe molecules and autofluorescing molecules. In other words, the amount of light emitted is background light.

When the 28S probe is used, the amount of light emitted is the sum of light emitted from three sources: specifically bound probe, nonspecifically bound probe and autofluorescing molecules. In other words, the amount of light emitted is target-specific light plus background light.

One seeks a compound that acts to reduce background light. Therefore one seeks a compound that maximizes the ratio, A/B, where A is the amount of light emitted when the 28S probe is used and B is the amount of light emitted when the NR probe is used. As a reference point, the ratio A/B is measured when no compound is added as a background reducer.

It is not sufficient, however, that the ratio A/B be maximized. Additionally, the amount of probe-specific light must be sufficiently high to be useful. The amount of probe specific light is (A - B). It can be seen that there is still an appreciable amount of probe specific light when the background reducing compound is used.

The experiments were conducted as follows: 1. Uninfected H9 cells were fixed in solution F, then resuspended in 2x SSC.

2. The cells were spun out of solution and resuspended in hybridization cocktail HC. The HC cocktail varied from sample to sample only as regards the probe used. Three types of probes were used: an NR probe, an HTV probe and a 28S RNA probe. Each probe had fluorescein linked to the probe's oligonucleotide.

3. After 30 min. at 42° C, the cells were washed in wash solution #1 preheated to 42°C by centrifuging them out of the hybridization cocktail at 250 × g for about 5 min.

4. Cells. were next washed in wash solution #2 preheated to 42°C.

5. Cells were resuspended in a IX PBS solution or PBS solution containing a compound to be tested for its effectiveness as a background reducer (that compound is also referred to in this Example as a staining dye).

6. Cells were run on a flow cytometer and histograms were generated which displayed the staining dye fluorescence in one axis (LFL2 or LFL3) and the probe fluorescence on the other axis (LFL1).

In step (6) a "Count vs. LFL1" histogram was generated. ("Count" refers to cell count.) This histogram was used as the basis for determining whether the compound tested was an effective background reducer. Additional histograms and an FS/SS plot were also generated but were not used as the basis for determining background reduction; they are not shown or summarized here.

Examples of Count vs. LFL1 histograms that were generated using sulforhodamine

101 hydrate as a staining dye and either the NR probe or the 28S probe. Tables 8 and 9 summarize the results. Table 8: Summary of results of Count vs. LFL1 histogram in Fig. 1

Cell Cell Mean

Set Count Pet LFL1

1 4917 100.0 0.1560

2 4587 93.3 0.126

3 309 6.3 2.966

4 4 0.1 41.66

Table 9: Summary of results of Count vs. LFL1 histogram

Cell Cell Mean

Set Count Pct LFL1

1 5034 100.0 101.0

2 2 0 0.218

3 31 0.6 6.535

4 4999 99.3 103.0

In Tables 8 and 9, the columns "Pct Count" gives the percentage of the total cell count; "LFL" stands for "Log fluorescence".

The results for the staining dyes tested are summed up in the following table:

Table 10: Summary of results

Mean Mean Mean Ratio

for for for of means

Dye NR HIV 28S 28S/NR

No. Staining dye probe probe probe ratio

12 Naphthol Bl. Blk. 1.159 1.301 73.43 63.66

13 Palatine F-B WA. 0.726 1.030 63.76 87.82

14 Trypan Blue 0.266 0.259 77.56 291.6

20 Sulforhodamine 101 0.156 0.143 101.0 647.4

PBS Phosph. Buffered Sal. 64.5 38.73 246.1 3.82

"Ratio of means, 28S/NR" is the ratio of the mean for the NR probe to the mean for the 28S probe. It can be seen from the right hand column in Table 10, which is a measure of the ratio A/B noted above, that all four staining dyes tested increased the ratio A/B. Furthermore the amount of probe specific light (A - B) was still substantial. Therefore all the staining dyes listed in Table 4 are useful as background reducers.

Example 5

Free Radical Scavengers

Table 11: Abbreviations

Compound Abbreviation

vitamin E (α-tocopherol) Vit. E.

2,2-diphenyl-1-picrylhydrazyl hydrate 2,2,DIPH

2,2,6,6-tetramethylpiperidine-N-oxyl Tempo

fluorescein isothiocyanate FTTC

ethylene diamine tetraacetic add EDTA

dimethyl sulfoxide DMSO

dithiothreitol DTT

polyvinylpyrrolidone PVP

polyethylene glycol (circa 4000 Mol. Wt.) PEG 4000 A Coulter Profile II flow cytometer was used as described herein, noting that, for

LFL1 measurement, a 540 bp (40) filter was used; i.e., only light with a wavelength between 520 nm and 560 nm is allowed to pass. The filter for LFL3 was a 635 long pass filter; i.e., it allows any light over 635 nm wavelength to pass.

The following solutions were those used in me Example:

Hybridization cocktail HC had the ingredients described elsewhere herein with the following modifications: 3% Triton X-100 (v/v, Triton X-100 is an alcohol derivative of polyoxyethylene ether, see Aldrich Chemical Co. catalogue for 1990-91) and 5% PEG 4000 were used.

If a free radical scavenger is added to the cocktail its preferred concentration is from 0.1% to 10% (v/v).

For hybridization cocktails used with a nucleic add probe, the temperature for the hybridization reaction preferably between 30° C and 46° C; the time preferably is between 5 minutes and 16 hours.

ALEX cells are a human cell line.

The NR probe was a fluorescein-labeled NR-25-AL probe described elsewhere herein. The 28S RNA probe was a fluorescein labeled DNA oligomer specific for a human

28S RNA nucleotide sequence and described elsewhere herein. In both cases, an aminohexyl linker was attached to the 5' end phosphate and that linker was then coupled to an FITC molecule.

The first experiment was conducted as follows:

1. ALEX cells were fixed in solution F, then resuspended in 2 × SSC. 2. The cells were spun out of solution and resuspended in hybridization cocktail HC. The HC cocktail varied from sample to sample only as regards to the free radical scavenger present (if any was added at all).

3. After 30 min. at 42° C, the cells were washed in wash solution #1 preheated to 42°C by centrifuging out of the hybridization cocktail at 250 × g for 5 minutes.

4. Cells were next washed in wash solution #2 preheated to 42°C.

5. Cells were resuspended in a 1X PBS solution.

6. Cells were run on a flow cytometer and histograms were generated which displayed the autofluorescence on one axis (LFL3) and the probe fluorescence on the other axis (LFL1).

In step (6) a "Count vs. LFL1" histogram was generated. ("Count" refers to cell count.) This histogram was used as the basis for determining whether the compound tested was an effective autofluorescence reducer. Additional histograms and an FS/SS plot were also generated but were not used as the basis for determining autofluorescence reduction; they are not shown or summarized here.

Table 11: Mean LFL1 & LFL3 using free radical scavengers

Added Mean Mean

Compound LFL1 LFL3 none 7.92 0.22

vit. E 0.501 0.119

2,2,DIPH 17.27 0.863

Tempo 3.23 0.181

Thiophenol 1.69 0.138 In Table 11, "Added Compound" is the compound added (at 5% v/v for liquids such, as Vitamin E, at 5g/100 ml for solids) to the assay cocktail.

An indicator of autofluorescence reduction due to a free radical scavenger is the difference between the mean LFL1 intensity using just cocktail and the mean LFL1 intensity using cocktail plus a free-radical scavenger. Another indicator is the difference between the mean LFL3 intensity using just cocktail and the mean LFL3 intensity using cocktail plus a free radical scavenger. The results, show that.Tempo, thiophenol, and vitamin E are free radical scavengers that are effective autofluorescence reducers for the combination of fluorescent absorption emission wavelengths utilized in this Example. On the other hand, the results show that 2,2 D1PH can not be an used as an autofluorescence reducer under those conditions. The ineffectiveness of 2,2,DIPH was probably not due to the fact that it did not reduce the autofluorescence, but rather to the fact that it is a fluorescent compound that emits light at the wavelengths monitored in this Example. A similar problem was observed with the free radical scavenger, Vitamin K.

In a second experiment the procedure of the first experiment was followed except that uninfected H9 cells were used instead of ALEX cells, and either the NR probe or the 28S RNA probe was present in the HC cocktail at a concentration of 10 ug/ml (microgram/ml). The NR probe was specific for a bacterial nitrogen reductase gene not present in human cells. It was used as a negative control.

The 28S RNA probe was specific for a human 28S RNA sequence.

The results are shown in Table 13. Table 13

Probe Vitamin E in HC cocktail? LFL1

NR No 13.27

NR Yes 8.86

28S No 251

28S Yes 231

The results showed that the presence of Vitamin E in the hybridization cocktail resulted in an approximately 33 percent decrease in the undesirable background level (NR results) but only an 8 percent decrease in the signal level seen with the target specific probe of interest (28S RNA).

The protocols of Examples herein can be followed with one or more of the following changes: 5 μl of 1 M (1 molar) DTT and 5 μl of Proteinase K (1 mg/ml) solution are added to 100 μl of cocktail and the hybridization reaction is run, for example, at 42°C for 5 min, then at 95°C for 5 min, and then at 42°C for 2 min.

Example 6

Use of Probe Analgoues

Table B and C show results obtained with an FITC-labeled DNA probe specific for HIV sequences in H9- (uninfected) and H9+ (HIV infected) cells. In Table 4, the results were done with and without Evans Blue in the solution containing the cells during flow cytometry.

The results show ATCA was effective at concentrations 0.05% and 0.1% for reducing background. The results also show increased signal when napachrome green and ATCA were used with Evans Blue present during flow cytometry. Example 7

Reaction of monosulfurized oligonucleotides in phosphate buffer

200 ug of dried oligonucleotide is dissolved in 100 ul of 50 mM phosphate buffer, pH 7.0, to form a first solution. Then one mg of iodoacetamido-fluorescein is combined with 100 ul of dry DMF (i.e., 100 percent DMF) in a second solution. The two solutions are mixed together and shaken overnight. This results in an oligonucleotide to iodoacetamido-fluorescein ratio of 1:5. After the overnight incubation, the labeled oligonucleotide is precipitated with ethanol and 3 M sodium acetate. This crude material is then loaded on to a PD-10 column to remove free dye. The desired fractions are collected. The liquid phase is then removed under vacuum. The crude material is then purified with HPLC.

Example 8

Synthesis of polysulfurized oligo nucleotides in phosphate buffer 200 ug of dried oligonucleotide are dissolved in 100 ul of 50 mM phosphate buffer pH 7.0, to form a first solution. One mg of iodoacetamido-fluorescein is

combined with 100 ul of dry DMF to create a 200 ul reaction mixture. The two solutions are mixed together and shaken overnight. This results in an oligonucleotide to acetamido-fluorescein ratio of 1:5 in the reaction mixture. One mg of iodoacetamido-fluorescein was again combined with 100 ul of dry DMF and this 100 ul is combined with the 200 ul of reaction mixture. Another 100 ul of 50 mM phosphate buffer is added to the 400 ul of reaction mixture and the reaction is allowed to continue for another 6 hours. The product was isolated as in Example 7. SEQUENCE LISTING

GENERAL INFORMATION:

(i) APPLICANT:

(ii): TITLE OF INVENTION: In Situ Detection of Nucleic Acids Using

3SR Amplification

(iii) NUMBER OF SEQUENCES: 17

(iv) CORRESPONDING ADDRESS:

(A) ADDRESSEE: Elman Wilf & Fried

(B) STREET: 20 West Third Street

(C) CITY: Media

(D) STATE: PA

(E) COUNTRY: USA.

(F) ZIP: 19063

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 5.25 inch Diskette

(B) COMPUTER: IBM PC Compatible

(C) OPERATING SYSTEM: MS-DOS

(D) SOFTWARE: WordPerfect

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vii) Prior Application Data:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Gerry J. Elman

(B) REGISTRATION NUMBER: 24,404

(C) REFERENCE/DOCKET NUMBER: M19-031-PCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 215 892 9580

(B) TELEFAX: 215 892 9577

(2) INFORMATION FOR SEQ ID NO:1 :

(i) SEQUENCE CHARACTERISICS:

(A) LENGTH:48

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE:

(iii) HYPOTHETICAL: M

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:

AATTTAATAC GACTCACTAT AGGGATCAGG GTGCACAGCC GCAACGGC 48

(2) INFORMATION FOR SEQ ID NO:2 :

(i) SEQUENCE CHARACTERISICS: (A) LENGTH: 48

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE:

(iii) HYPOTHETICAL: M

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

AATTTAATAC GACTCACTAT AGGGATCGGC TTCACTCAGA CCCTGAGG 48

(2) INFORMATION FOR SEQ ID NO: 3 :

(i) SEQUENCE CHARACTERISICS:

(A) LENGTH: 26

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE:

(iii) HYPOTHETICAL: M

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

CGCTGAAGGG CTTCTTCCTT ATTGAT 26

(2) INFORMATION FOR SEQ ID NO: 4 :

(i) SEQUENCE CHARACTERISICS:

(A) LENGTH: 26

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE:

(iii) HYPOTHETICAL: M

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

CGCTGAAGGG CTTTTGAACT CTGCTT 26

(2) INFORMATION FOR SEQ ID NO: 5 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

ATCAGAGTAG TGGTATTTCA CCGGC 25

(2) INFORMATION FOR SEQ ID NO: 6 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

ATCAGAGTAG TGGTATTTCA C 21

(2) INFORMATION FOR SEQ ID NO: 7 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

ATCAGAGTAG TGGTATTT 18

(2) INFORMATION FOR SEQ ID NO: 8 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

ATCAGAGTAG TGGTA 15

(2) INFORMATION FOR SEQ ID NO: 9 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 12 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

ATCAGAGTAG TG 12

(2) INFORMATION FOR SEQ ID NO: 10 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 base pairs

(B) TYPE: nucleic acid (C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

ATCAGAGTAG 10

(2) INFORMATION FOR SEQ ID NO: 11 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 8 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

ATCAGAGT 8

(2) INFORMATION FOR SEQ ID NO: 12 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 6 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: cDNA to rRNA

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

ATCAGA 6

(2) INFORMATION FOR SEQ ID NO: 13 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

TACGCTCGAT CCAGCTATCA GCCGT 25

(2) INFORMATION FOR SEQ ID NO: 14 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 12 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

TACGCTCGAT CC 12

(2) INFORMATION FOR SEQ ID NO: 15 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:

TACGCTCGAT 10

(2) INFORMATION FOR SEQ ID NO: 16 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 8 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:

TACGCTCG 8

(2) INFORMATION FOR SEQ ID NO: 17 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 6 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: Linear

(ii) MOLECULE TYPE: DNA (genomic)

(iii) HYPOTHETICAL: N

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17.

TACGCT 6

Claims

CLAIMS WE CLAIM:

1. A process of detecting an analyte RNA molecule in a biological entity which process comprises the steps of:

1) incubating the biological entity in the presence of a reverse transcriptase, a DNA- dependent RNA polymerase, an RNase H, and a first primer and a second primer each a DNA oligonucleotide, so as to generate amplification molecules that have a nucleotide sequence complementary or identical to a sequence of nucleotides in said analyte RNA molecule,

2) forming hybrids between probe molecules and said amplification molecules in said biological entity, and

3) detecting the probe molecules in said hybrids,

wherein the first primer comprises a nucleotide sequence complementary to a first nucleotide sequence of the analyte RNA molecule,

wherein the second primer comprises a nucleotide sequence equivalent to a second nucleotide sequence the analyte RNA molecule,

wherein said first nucleotide sequence is positioned in the analyte RNA molecule at a location between said second nucleotide sequence and the 3' end of the analyte molecule, wherein at least one of said two primers comprises a promoter nucleotide sequenceor said polymerase, and wherein the probe comprises an oligonucleotide with a nucleotide sequence complementary to an nucleotide sequence in one of said amplification molecules, said biological entity being either a cell or a virus.

2. A process of Claim 2 wherein the biological entity is a cell.

3. A process of Claim 2 wherein the cell is a cell with an abnormal chromosomeCO MPR ISIN G first chromosome segment and a second chromosome segment joined at a

AT A JUN CTION P OINT

junction point, said first and second segments not joined in normal cells, and wherein the analyte RNA molecule is a translocation junction-spanning RNA molecule.

4. A process of Claim 2 wherein the first primers comprises a promoter nucleotide sequence and the second primer comprises a promoter nucleotide sequence.

5. A process of Claim 3 wherein either a primer or a probe, or both of them, are junction-spanning molecules as to a cellular RNA molecule or an amplification RNA molecule.

6. A process of Claim 5 wherein a translocation junction-spanning primer or probe is between 2-0 and 50 nucleotides in length.

7. A process of Claim 6 wherein about one half of the junction-spanning segment to which the probe or primer is complementary is on one side of the translocation junction containing that segment and wherein the other half of said segment is on the other side of that junction.

8. A process of Claim 6 wherein a probe is a translocation junction-spanning probe.

9. A process of Claim 7 wherein a probe is a translocation junction-spanning probe.

10. A process of Claim 3 wherein the translocation junction of the analyte RNA molecule is, within said analyte molecule, between a nucleotide sequence complementary to part or all of the first primer and a nucleotide sequence equivalent to part or all of the second primer.

11. A process of Claim 2 wherein the probe comprises reporter groups that are fluorescent moieties and are detectable on the basis of energy light emitted by said moie ties.

12. A process of Claim 11 wherein step (3) is done with the cells in solution and not on slides.

13. A process of Claim 2 wherein step (2) is done in a solution comprising a compound selected from the group dimethyl sulfoxide (DMSO), an alcohol, an ahphatic alkane, an alkene, a cyclodextrin, a fatty add ester, an amide or lactam, and an organic sflane.

14. A process of Claim 13 wherein the assay solution used in step (2) comprises a nucleic add probe and DMSO (2 to 20 percent) and one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty acid ester (2 to 20 percent) of the formula R₁(COO)R₂, an amide or lactam (2 to 15 percent) of the formula R₃(NH)(CO)R₄, and an organic silane (2 to 20 percent) of the formula (SiR₅R₆R₇)N(SiR₈R₉R₁₀), (SiR₅R₆R₇)-(SiR₈R₉R₁₀), (SiR₅R₆R₇)O(SiR₈R₉R₁₀), or (SiR₅R₆O)(SiR₇R₈O)(SiR₉R₁₀O) and the combined volumes of DMSO and the compounds selected from the group not being more than 30 percent of the assay solution (v/v).

15. A process of Claim 13 wherein the assay solution used in step (2) comprises a nucleic acid probe and DMSO (2 to 20 percent) and one or more compounds selected from the group, an alcohol (2 to 20 percent), an aliphatic alkane (2 to 20 percent), an alkene (2 to 20 percent), a cyclodextrin (2 to 20 percent), a fatty add ester (2 to 20 percent) of the formula R₁(COO)R₂, an amide or lactam (2 to 15 percent) of the formula R₃(NH)(CO)R₄, and an organic silane (2 to 20 percent) of the formula (SiR₅R₆R₇)N(SiR₈R₉R₁₀), (SiR₅R₆R₇)- (SiR₈R₉R₁₀), (SiR₅R₆R₇)O(SiR₈R₉R₁₀), or (SiR₅R₆O)(SiR₇R₈O)(SiR₉R₁₀O), the combined volumes of DMSO and the compounds selected from the group not being more than 30 percent of the assay solution (v/v).

16. A process of Claim 13 wherein, in addition to DMSO, an alkene or an alkane, and at least one other compound is selected from the group.

17. A process of Claim 2 wherein step (3) comprises at least three steps 3A, 3B, and 3C, such that 3A is performed prior to step 3B, and 3B is performed before or almost simultaneously with step 3C, as follows:

(3A) removing the cell from the assay solution,

(3B) adding a signal enhancing compound to the solution in which the cell is suspended,

(3C) detecting, as the signal, light quanta generated directly or indirectly by the target-bound probe molecule,

the signal enhancing compound selected from the group, an alcohol, an ahphatic alkane, a sugar, a fatty acid ester, an amide or lactam, and an organic silane.

18. A process of Claim 3 wherein step 3 comprises at least three steps 3A, 3B, and 3C, wherein step 3A takes place before step 3B and step 3B is performed prior to or essentially simultaneously with step 3C, as follows:

(3A) removing the cells from the solution in which step (2) is performed,

(3B) exposing the cells to light at absorption wavelengths of the fluorescent probe molecules, and

(3C) measuring the amount of light emitted at emission wavelengths of the fluorescent probe;

wherein at a time after the commencement of step (1) and prior to the termination of step (3C), a background-reducing compound is present in the solution within which the cells are suspended;

the background-reducing compound comprising a light absorbing moiety with a structure different than, that of the fluorescent dye moiety of the fluorescent probe;

the background-reducing compound having an absorption wavelength range (the range of wavelengths over which it absorbs light when the process is performed) that overlaps that part of the emission wavelength range of the fluorescent probe (the range of wavelengths over which light is emitted by the probe) in which the amount of light is measured in step (3C).

19. A process of Claim 18 wherein the background-reducing compound is in the solution in which the cells are suspended in steps (3B) and (3C).

20. A process of Claim 2 wherein a fluorescent reporter group is used to detect probe molecules in the hybrid formed during step (3), and a free radical scavenger is present in the reaction mixture used to carry out one or more of steps (1), (2), and (3).

21. A process of Claim 20 wherein a free radical scavenger is present in reaction mixture used to carry out step (2).

22. A process of claim 2 wherein the free radical scavenger is selected from the group, Vitamin E, thiophenol, and 2,2,6,6-tetramethylpiperidine-N-oxyl.

23. A process of Claim 2 wherein during step (2) an aromatic reporter group is part of the probe molecule, and before step (3) is completed, the cell is incubated with a structural analogue of the reporter group.

24. A process of Claim 23 wherein, during step (2) the analogue is present in the same solution used to hybridize probe molecules to the amplification molecules in the cell and, furthermore, step (3) is performed in a manner that will detect the reporter group but not the analogue compound.

25. A process of Claim 2 wherein the probe comprises a single-stranded nucleic add moiety and a plurality of reporter moieties such that each of the reporter moieties is covalently linked by means of a linker moiety to an intervening atom linked to an internucleoside phosphorus atom of the nucleic acid moiety.

26. A kit comprising a reverse transcriptase, an RNA polymerase, and an RNAse H and instructions for performing a 3SR reaction in situ.

27. A process of Claim 1 wherein the probe comprises reporter groups that are fluorescent moieties and are detectable on the basis of energy light emitted by said moieties, and wherein wherein step (3) comprises a fluorimetric measurement done with the cells in solution and not on slides.

28. A process of Claim 8 wherein the probe comprises reporter groups that are fluorescent moieties and are detectable on the basis of energy light emitted by said moieties, and wherein wherein step (3) comprises a fluorimetric measurement done with the cells in solution and not on slides.

29. A process of Claim 9 wherein the probe comprises reporter groups that are fluorescent moieties and are detectable on the basis of energy light emitted by said moieties, and wherein wherein step (3) comprises a fluorimetric measurement done with the cells in solution and not on slides.

30. A process of Claim 1 wherein the probe is 15 to 50 nucleotides in length.

31. A process of Claim 2 wherein the cell is a cell with a chromosome that comprises a point mutation and wherein the analyte RNA molecule is a point mutation-spanning RNA molecule as regards said point mutation.

32. A process of Claim 31 wherein the probe is a point mutation-spanning probe as to the point mutation and is 15 to 50 nucleotides in length.

33. A process of Claim 32 wherein the primer is a point mutation spanning primer as to the point mutation.