WO1994000491A1 - INTERLEUKIN-1β DELETION MUTANT - Google Patents
INTERLEUKIN-1β DELETION MUTANT Download PDFInfo
- Publication number
- WO1994000491A1 WO1994000491A1 PCT/SE1993/000562 SE9300562W WO9400491A1 WO 1994000491 A1 WO1994000491 A1 WO 1994000491A1 SE 9300562 W SE9300562 W SE 9300562W WO 9400491 A1 WO9400491 A1 WO 9400491A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- interleukin
- δsnd
- deletion
- deletion mutant
- human
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/545—IL-1
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to an Interleukin-1 ⁇ deletion mutant which has a quasi conserved sequence of three amino acids deleted from the amino-acid sequence of an endogenous mammalian Interleukin-1 ⁇ .
- said three deleted amino acids are Ser Asn Asp (numbers 52-54 of mature human IL-1 ⁇ ), which mutant is also called ⁇ SND.
- IL-1 ⁇ and IL-1 ⁇ are mediators of a multitude of processes involving the immune endocrine and nervous system (cf for review [1]).
- widespread use of IL-1 ⁇ and IL-1 ⁇ in therapy has been hampered by their high pyrogenicity.
- IL-1 ra an endogenously occuring IL-1 receptor antagonist
- IL-1 ⁇ (numbers 52-54 of the mature protein), yields a mutant, here called ⁇ SND, which binds with the same high affinity to Interleukin-1 receptors (type II) on human Raji cells as does interleukin-1 ⁇ .
- ⁇ SND binds with a tenfold less affinity to Interleukin-1 receptors (type I) on mouse El-4 thyoma cells.
- ⁇ SND exhibits a significantly reduced biological activity in a mouse thymocyte proliferation assay.
- ⁇ SND is shown to have a lower pyrogenic activity than IL-1 ⁇ in a rabbit model. It is now contemplated that the SND motif is an important structural feature of a receptor ligand for its binding-affinity to the two types of interleukin-1 receptors.
- the Il-1 ⁇ deletion mutants of the invention are therefore useful in the development of new therapeutic and/or prophylactic agents, and as carriers and adjuvants for biologically active molecules.
- One aspect of the invention is directed to an Interleukin-1 ⁇ deletion mutant, which has a quasi conserved sequence of three amino acids deleted from the amino-acid sequence of an endogenous mammalian Interleukin-1 ⁇ , said sequence of amino acids being Ser Asn Asp (numbers 52-54 of mature human IL-1 ⁇ ) in the case of human, mouse, rat and rabbit, and Arg Asp Asn in the case of bovine and sheep Interleukin-1 ⁇ .
- the endogenous mammalian Interleukin-1 ⁇ is an endogenous human Interleukin-1 ⁇ .
- the Interleukin-1 ⁇ deletion mutant is an Interleukin-1 receptor ligand which binds to both Interleukin-1 type I receptors (found i.a. on T-lymphocytes) and Interleukin-1 type II receptors (found i.a. on B-lymphocytes) with substantially different binding-affinities.
- the Interleukin-1 ⁇ deletion mutant according to the last mentioned embodiment may have additional amino-acid deletion(s) and/or point mutation(s), as long as the mutant is a ligand to the Interleukin-1 receptor and binds to both Interleukin-1 type I receptors and Interleukin-1 type II receptors with substantially different binding-affinities.
- Another aspect of the invention is directed to a carrier for biologically active molecules which is an Interleukin-1 ⁇ deletion mutant according to the invention.
- Yet another aspect of the invention is directed to an adjuvant for biologically active molecules which is an Interleukin-1 ⁇ deletion mutant according to the invention.
- the carrier and adjuvant according to the invention are to be used in association with biologically active molecules, especially synthetic vaccines.
- Still another aspect of the invention is directed to a therapeutic and/or prophylactic agent which comprises an Interleukin-1 ⁇ deletion mutant according to the invention. It is believed that such a therapeutic and/or prophylactic agent will be used for radiation-protection, as lymphocyte activating factor, anti-inflammatory agent and as IL-1 antagonist in the treatment of sepsis and rheumatoid
- Interleukin-1 ⁇ deletion mutants of the invention can be produced in per se known manner, e.g. by constructing a gene which codes for the desired mutant, followed by insertion of said gene into a suitable vector, which in turn is inserted into a host capable of expressing said gene, propagating said host and finally isolating said desired mutant.
- Enzymes, bacterial strains and vectors Restriction enzymes and T4 ligase were obtained from New England Biolabs, T4 polynucleotide kinase from Boehringer Mannheim, Klenow fragment of DNA polymerase I from Pharmacia.
- the M13 in vitro mutagenesis kit was obtained from Bio-Rad, including the E. coli strains CJ236 and MV1190 [15].
- E. coli strains JM101 [16] and JM109 [17] as well as the M13K07 helper phage [18] and the Ml3mpl8 vector [17] were from
- pZ152 phagemid [19] was purchased from Kluwer, England) and ⁇ -[ 35 S]-dATP was obtained from Amersham.
- the oligonucleotides used for mutagenesis, vector construction and for sequencing were synthesized by the phosphoramidite method using PAC-amidites [20] and a Pharmacia Gene Assembler.
- the deprotected oligonucleotides were purified by polyacrylamide gel electrophoresis in the presence of 8 M urea. Recombinant vectors were purified on Qiagen-tips (Diagen, GmbH, Germany) as recommended by the supplier.
- the human IL-1 ⁇ gene was purchased from British Bio-technology (BBG25). [The nucleotide and amino acid sequences are shown in Table 2.] It was subcloned as an EcoRI-HindIII fragment into M13mpl8 and was then subjected to oligonucleotide- directed in vitro mutagenesis [15] using an M13 in vitro mutagenesis kit (Bio-Rad) . Deletion mutagenesis was performed with the following oligonucleotide primer:
- the pPEX E. coli expression vector was constructed from pM23, a pBR322 based expression vector which utilizes the lac repressor controlled rrnB P2 promoter [24], as previously described [25]. It was further modified to obtain the pRIZ' vector as follows. 1; The ribosomal binding site of the ⁇ -galactosidase gene was replaced with the AGGAGGAAATAACCATGG sequence, which contains the consensus Shine-Dalgarno sequence GGAGG and includes the ATG initiation codon as part of the CCATGG Ncol restriction site. 2; The M13 phage intergenic region was introduced by using the Ndel-PstI fragment of pZ152 [19] to obtain a phagemid.
- TGTAGCGGGAAGGCGTATTAT which corresponds to a part of the promoter region (from -28 to -8) and allows checking of the amino terminal half of the IL-1 ⁇ genes.
- the EL-4 mouse thyoma cells, possessing IL-lr type I were grown in RPMI-1640 medium, supplemented with 5% fetal calf serum, 25 ⁇ M ⁇ -mercaptoethanol and 50 ⁇ g/ml gentamycin.
- Human ⁇ -lymphoma cell line Raji (possessing IL-lr type II) was maintained in RPMI-1640, containing 10% fetal calf serum and 50 ⁇ g/ml gentamycin.
- Human recombinant IL-1 ⁇ (hrlL-1 ⁇ ) was radiolabelled with 125 I using the Bolton-Hunter reagent (DuPont, NEN) in accordance with the manufactures instructions and stored as an approx. 50 nM solution in binding medium (RPMI-1640, 25 mM HEPES, pH 7.2, 1% (w/v) BSA, 0.1% (w/v) Na-azide) at -70oC.
- the specific activity was approximately 30 ⁇ Ci/ ⁇ g.
- Displacement assays were performed as follows: cells (EL-4 or Raji) were harvested washed in Hank's balanced salt solution, resuspended in binding medium (10 7 cells/ml) and incubated at room temperature for 1 h with increasing concentrations of hrlL-1 ⁇ , ⁇ SND or IL-ra, and [ 125 I]-IL-1 ⁇ ( ⁇ 2 ⁇ 10 5 cpm/well) in 96-well plates. Each well contained 25 ⁇ l of unlabelled ligand (final concentrations 10 -12 -10 -6 M), 25 ⁇ l [ 125 I]-IL-1 ⁇ ( ⁇ 3 nM) and 50 ⁇ l of cell suspension (10 5 cells/well).
- the cells in each well were collected by centrifugation through a phthalate oil cushion at 12 000 rpm for 0.5 minutes, the supernatants were aspirated and the radioactivity of the sedimented cells was measured in a gamma-counter.
- the displacement of 125 I-IL-1 ⁇ from EL-4 mouse thyoma cells, which have IL-1 type I receptors, by unlabelled IL-1 ⁇ , ⁇ SND and IL-lra, respectively, is shown in Table 4 as IC 50 (nM).
- IC 50 (nM) The displacement of 125 I-IL-1 ⁇ from human Raji cells, which have IL-1 type II receptors, by unlabelled IL-1 ⁇ , ⁇ SND and IL-lra, respectively, is shown in Table 5 as IC 50 (nM).
- ⁇ SND like the endogenously occuring IL-1 ⁇ and IL-lra has high affinity for both IL-1 receptor types.
- the relative affinity for ⁇ SND as compared to that of IL-1 ⁇ is the same with regard to the type II receptor (IC 50 for ⁇ SND ⁇ 6 nM and IC 50 for IL-1 ⁇ ⁇ 4 nM) while it is tenfold lower than that of IL-1 ⁇ at the type I receptor (IC 50 for ⁇ SND ⁇ 17 nM and IC 50 for IL-1 ⁇ ⁇ 1.4 nM).
- the IL-lra shows lower affinity to the type II receptor
- the very low or no intrinsic activity makes the ⁇ SND most interesting as an adjuvant or carrier in association with biologically active molecules e.g for production of vaccines.
- IL-1 ⁇ deletion mutants of the invention will probably be used instead of IL-1 ⁇ in therapeutic and/or prophylactic agents. Additional testing of biological activity:
- IL-1 (recombinant human IL-1 ⁇ , specific activity 1 ⁇ 10 7 U/mg) was a kind gift from Sclavo, Siena, Italy.
- mice Male, adult (25-30 g) CD-1 mice (Charles River, Calco, Italy) were used. Animals were housed five per cage in air-conditioned quarters (60% relative humidity, 22°C) with a 12-h light/dark cycle, and were given standard laboratory chow (Altromin, Rieper, Bolzano, Italy).
- mice were treated with IL-1 ⁇ or ⁇ SND at the doses indicated i.p. in a final volume of 0.2 ml. Control mice received buffer alone. All treatments were performed between 9.00 am and 11.00 am.
- IL-6 Plasma IL-6
- glucose glucose
- corticosterone serum preparated for IL-6
- glucose glucose
- corticosterone serum preparated for IL-6
- SAA serum preparated for IL-6
- glucose glucose
- corticosterone glucose
- SAA serum preparated for IL-6
- serum was collected at 2 h for IL-6, corticosterone and glucose determinations and at 8 h for SAA determination, since previous experiments indicated that, at these times, peak levels were observed.
- Serum IL-6 levels were measured as hybridoma growth factor using 7TD1 cells (a kind gift from Dr. van Snick, Geneva, Belgium) as previously described [30].
- IL-6 is expressed as costimulatory units/ml using a standard curve with human recombinant IL-6 (Immunex Corp., Seattle, WA; specific activity 10 7 U/ml).
- Serum corticosterone was measured by a RIA using a polyclonal antibody to corticosterone
- Serum glucose was measured by the glucose oxidase/peroxidase method with a commercially available kit (Boehringer, Mannheim). Serum amyloid-A (SAA) was measured in sera by an ELISA [31] using a polyclonal rabbit anti mouse SAA (kind gift from Dr. J. Sipe, Boston). icv. injection
- IL-1 was dissolved in pyrogen-free saline containing 0.1% bovine serum albumin or phosphate buffer.
- ⁇ SND was dissolved in phosphate buffer.
- IL-1 ⁇ , ⁇ SND and IL-lra as ligands to Interleukin-1 type I receptor - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
- T re 15 30 45 60 90 120 180 240 hrlL-1 ⁇
- Serum levels of glucose, corticosterone and IL-6 were measured 2 h after the injection. Data are mean + SE (5 mice per group),
- Serum levels of glucose, corticosterone and IL-6 were measured 2 h after the injection, whereas serum amyloid A levels were measured 8 h after the injection at the peak time.
- the food-intake was evaluated 1 day after the ip. injection. Data are mean ⁇ SE (5 mice per group).
- ⁇ SND has an effect on the serum levels of glucose, corticosterone, IL-6 and SAA, whereas only a small effect was observed on food-intake. At this dose ⁇ SND induces significally lower IL-6 and SAA serum levels if compared with IL-1.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pain & Pain Management (AREA)
- Rheumatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU45191/93A AU4519193A (en) | 1992-06-25 | 1993-06-23 | Interleukin-1beta deletion mutant |
JP6502266A JPH07508408A (en) | 1992-06-25 | 1993-06-23 | Interleukin-1β deletion mutant |
EP93915072A EP0647238A1 (en) | 1992-06-25 | 1993-06-23 | INTERLEUKIN-1$g(b) DELETION MUTANT |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
SE9201966A SE9201966D0 (en) | 1992-06-25 | 1992-06-25 | INTERLEUKIN-1BETA DELETION MUTANT |
SE9201966-0 | 1992-06-25 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1994000491A1 true WO1994000491A1 (en) | 1994-01-06 |
Family
ID=20386611
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/SE1993/000562 WO1994000491A1 (en) | 1992-06-25 | 1993-06-23 | INTERLEUKIN-1β DELETION MUTANT |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP0647238A1 (en) |
JP (1) | JPH07508408A (en) |
AU (1) | AU4519193A (en) |
SE (1) | SE9201966D0 (en) |
WO (1) | WO1994000491A1 (en) |
Cited By (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0677532A1 (en) * | 1994-03-16 | 1995-10-18 | Knoll Aktiengesellschaft | Use of Il-1-antagonists as medicaments for treating diseases with increased Interleukin-6 serum levels |
US5978749A (en) * | 1997-06-30 | 1999-11-02 | Pile Dynamics, Inc. | Pile installation recording system |
US5986059A (en) * | 1996-06-14 | 1999-11-16 | Bayer Corporation | T-cell selective interleukin-4 agonists |
US6028176A (en) * | 1996-07-19 | 2000-02-22 | Bayer Corporation | High-affinity interleukin-4 muteins |
US6270758B1 (en) | 1998-10-08 | 2001-08-07 | Duke University | Substantially non-toxic biologically active mucosal adjuvants in vertebrate subjects |
US6335426B1 (en) | 1996-06-14 | 2002-01-01 | Bayer Corporation | T-cell selective interleukin-4 agonists |
WO2017077382A1 (en) | 2015-11-06 | 2017-05-11 | Orionis Biosciences Nv | Bi-functional chimeric proteins and uses thereof |
WO2017134302A2 (en) | 2016-02-05 | 2017-08-10 | Orionis Biosciences Nv | Targeted therapeutic agents and uses thereof |
WO2017153402A1 (en) | 2016-03-07 | 2017-09-14 | Vib Vzw | Cd20 binding single domain antibodies |
WO2017194782A2 (en) | 2016-05-13 | 2017-11-16 | Orionis Biosciences Nv | Therapeutic targeting of non-cellular structures |
WO2017194783A1 (en) | 2016-05-13 | 2017-11-16 | Orionis Biosciences Nv | Targeted mutant interferon-beta and uses thereof |
WO2018077893A1 (en) | 2016-10-24 | 2018-05-03 | Orionis Biosciences Nv | Targeted mutant interferon-gamma and uses thereof |
WO2018144999A1 (en) | 2017-02-06 | 2018-08-09 | Orionis Biosciences, Inc. | Targeted engineered interferon and uses thereof |
WO2018141964A1 (en) | 2017-02-06 | 2018-08-09 | Orionis Biosciences Nv | Targeted chimeric proteins and uses thereof |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114163514B (en) * | 2021-12-13 | 2023-05-26 | 青岛瑞斯凯尔生物科技有限公司 | IL-10 mutants and uses thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0237967A2 (en) * | 1986-03-14 | 1987-09-23 | Otsuka Pharmaceutical Co., Ltd. | IL-1 beta derivatives and drugs |
WO1992006114A1 (en) * | 1990-10-05 | 1992-04-16 | Rhone-Poulenc Rorer S.A. | Polypeptides derived from interleukin-1 beta, method for the preparation and utilisation thereof, particularly for osteoarticular pathologies |
-
1992
- 1992-06-25 SE SE9201966A patent/SE9201966D0/en unknown
-
1993
- 1993-06-23 JP JP6502266A patent/JPH07508408A/en not_active Withdrawn
- 1993-06-23 EP EP93915072A patent/EP0647238A1/en not_active Withdrawn
- 1993-06-23 AU AU45191/93A patent/AU4519193A/en not_active Abandoned
- 1993-06-23 WO PCT/SE1993/000562 patent/WO1994000491A1/en not_active Application Discontinuation
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0237967A2 (en) * | 1986-03-14 | 1987-09-23 | Otsuka Pharmaceutical Co., Ltd. | IL-1 beta derivatives and drugs |
WO1992006114A1 (en) * | 1990-10-05 | 1992-04-16 | Rhone-Poulenc Rorer S.A. | Polypeptides derived from interleukin-1 beta, method for the preparation and utilisation thereof, particularly for osteoarticular pathologies |
Non-Patent Citations (1)
Title |
---|
Dialog Information Services, file 5, BIOSIS, Dialog Accession No. 6987536, BIOSIS Number 87048057, KAMOGASHIRA T. et al.: "Site-Specific Mutagenesis of the Human Interleukin-I-Beta Gene the Role of Arginine Residue at the Amino-Terminal Region", J Biochem (Tokyo) 104 (5), 1988, 837-840. * |
Cited By (22)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0677532A1 (en) * | 1994-03-16 | 1995-10-18 | Knoll Aktiengesellschaft | Use of Il-1-antagonists as medicaments for treating diseases with increased Interleukin-6 serum levels |
US5986059A (en) * | 1996-06-14 | 1999-11-16 | Bayer Corporation | T-cell selective interleukin-4 agonists |
US6335426B1 (en) | 1996-06-14 | 2002-01-01 | Bayer Corporation | T-cell selective interleukin-4 agonists |
US6433157B1 (en) | 1996-06-14 | 2002-08-13 | Bayer Corporation | Polynucleotides encoding T-cell selective interleukin-4 agonists |
US6028176A (en) * | 1996-07-19 | 2000-02-22 | Bayer Corporation | High-affinity interleukin-4 muteins |
US6313272B1 (en) | 1996-07-19 | 2001-11-06 | Bayer Corporation | DNA encoding high affinity interleukin-4 muteins |
US5978749A (en) * | 1997-06-30 | 1999-11-02 | Pile Dynamics, Inc. | Pile installation recording system |
US6270758B1 (en) | 1998-10-08 | 2001-08-07 | Duke University | Substantially non-toxic biologically active mucosal adjuvants in vertebrate subjects |
US7041294B2 (en) | 1998-10-08 | 2006-05-09 | Duke University | Substantially non-toxic biologically active mucosal adjuvants in vertebrate subjects |
WO2017077382A1 (en) | 2015-11-06 | 2017-05-11 | Orionis Biosciences Nv | Bi-functional chimeric proteins and uses thereof |
WO2017134302A2 (en) | 2016-02-05 | 2017-08-10 | Orionis Biosciences Nv | Targeted therapeutic agents and uses thereof |
WO2017134305A1 (en) | 2016-02-05 | 2017-08-10 | Orionis Biosciences Nv | Bispecific signaling agents and uses thereof |
EP3909978A1 (en) | 2016-02-05 | 2021-11-17 | Orionis Biosciences BV | Clec9a binding agents and use thereof |
EP3998281A1 (en) | 2016-02-05 | 2022-05-18 | Orionis Biosciences BV | Cd8 binding agents |
EP4059957A1 (en) | 2016-02-05 | 2022-09-21 | Orionis Biosciences BV | Bispecific signaling agents and uses thereof |
WO2017153402A1 (en) | 2016-03-07 | 2017-09-14 | Vib Vzw | Cd20 binding single domain antibodies |
EP4276114A2 (en) | 2016-03-07 | 2023-11-15 | Vib Vzw | Cd20 binding single domain antibodies |
WO2017194782A2 (en) | 2016-05-13 | 2017-11-16 | Orionis Biosciences Nv | Therapeutic targeting of non-cellular structures |
WO2017194783A1 (en) | 2016-05-13 | 2017-11-16 | Orionis Biosciences Nv | Targeted mutant interferon-beta and uses thereof |
WO2018077893A1 (en) | 2016-10-24 | 2018-05-03 | Orionis Biosciences Nv | Targeted mutant interferon-gamma and uses thereof |
WO2018144999A1 (en) | 2017-02-06 | 2018-08-09 | Orionis Biosciences, Inc. | Targeted engineered interferon and uses thereof |
WO2018141964A1 (en) | 2017-02-06 | 2018-08-09 | Orionis Biosciences Nv | Targeted chimeric proteins and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
SE9201966D0 (en) | 1992-06-25 |
EP0647238A1 (en) | 1995-04-12 |
JPH07508408A (en) | 1995-09-21 |
AU4519193A (en) | 1994-01-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Esch et al. | Primary structure of bovine brain acidic fibroblast growth factor (FGF) | |
AU590543B2 (en) | Purification of native colony stimulating factor-1 | |
US5591827A (en) | Interleukin-6 receptor antagonists | |
WO1994000491A1 (en) | INTERLEUKIN-1β DELETION MUTANT | |
US4847201A (en) | DNA encoding for CSF-1 and accompanying recombinant systems | |
SIMPSON et al. | Murine hybridoma/plasmacytoma growth factor: Complete amino‐acidsequence and relation to human interleukin‐6 | |
US5591718A (en) | Neutrophil activating factors | |
JPH08503706A (en) | Interleukin-3 (IL-3) multiple mutant polypeptide | |
EP0209601A1 (en) | Recombinant colony stimulating factor-1. | |
US6214584B1 (en) | Human Interferon-γinducing factor | |
CA1341461C (en) | T helper cell growth factor | |
Wolf et al. | Neurotrophin Binding to Human. alpha. 2-Macroglobulin under Apparent Equilibrium Conditions | |
US5792450A (en) | Purified human CSF-1 | |
JPH05503512A (en) | [ALA IL-8] as a leukocyte adhesion inhibitor ↓7↓7 | |
US7402303B2 (en) | Chemokine mutants in the treatment of multiple sclerosis | |
Simoncsits et al. | Deletion mutants of human interleukin 1β with significantly reduced agonist properties: search for the agonist/antagonist switch in ligands to the interleukin 1 receptors | |
US5317011A (en) | Cloning and expression of a variant gene of platelet factor 4 and compositions thereof to modulate immune responses | |
WO1997010338A9 (en) | Improved interleukin-6 receptor antagonist | |
KR20000067914A (en) | High-Affinity Interleukin-4 Muteins | |
KR20000075749A (en) | Novel polypeptide, dna encoding the same and use thereof | |
EP0936919B1 (en) | VARIANTS OF HUMAN CILIARY NEUROTROPHIC FACTOR (hCNTF) WITH A RANGE OF ACTION DIFFERENT FROM THAT OF THE WILD-TYPE MOLECULE | |
EA000852B1 (en) | Il-6 mutein of a human and its inner fragment, a dna sequence coding for it, methods for preparing same, comprising pharmaceutical compositions thereof, comprising their vectors, and lines of host cells | |
Wang et al. | A structure-function analysis of glial cell-linederived neurotrophic factor receptor alpha1 | |
US6235884B1 (en) | Heparin binding mitogen with homology to epidermal growth factor (EGF) | |
WO1992008473A1 (en) | Therapeutic use of fibroblast growth factor |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AU BB BG BR BY CA CZ FI HU JP KP KR KZ LK MG MN MW NO NZ PL RO RU SD SK UA US VN |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1993915072 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref country code: US Ref document number: 1995 362591 Date of ref document: 19950221 Kind code of ref document: A Format of ref document f/p: F |
|
WWP | Wipo information: published in national office |
Ref document number: 1993915072 Country of ref document: EP |
|
NENP | Non-entry into the national phase |
Ref country code: CA |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1993915072 Country of ref document: EP |