WO1993020191A1 - Purified thermostable endonuclease - Google Patents

Abstract

The present invention discloses a substantially purified and isolated form of a native or recombinant thermostable class II AP endonuclease. In particular, the invention relates to an AP endonuclease of a thermophilic bacteria and to a method for cloning and expressing the recombinant form of the enzyme in a host cell such as Escherichia coli. The AP endonuclease of the present invention remains stable when subjected to elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids. The recombinant thermostable endonuclease is useful in a ligase chain reaction.

Description

PURIFIED THERMOSTABLE ENDONUCLEASE

Technical Field

The present invention relates to a substantially purified and isolated form of a native or recombinant thermostable AP endonuclease. In particular, the invention relates to an AP endonuclease of a thermophilic bacteria and to a method for cloning and expressing the recombinant form of the enzyme.

Background of the Invention AP endonucleases are a class of DNA repair enzymes that recognize apurinic/apyrimidinic (AP) sites in DNA resulting from oxidative or chemical damage which may be caused by a variety of agents. AP sites, also referred to as "abasic" sites, in DNA may be formed by spontaneous hydrolysis, by exposure to ionizing radiation, and as products of N-glycosylases acting on modified bases in DNA. Two major classes of endonucleases cleave DNA at AP sites. Class I AP endonucleases cleave the DNA on the 3' side of the AP site by a β-elimination mechanism leaving a 3'(4-hydroxy-5-phospho-2- pentenal) residue or a further breakdown product thereof. Class II AP endonucleases cleave the DNA on the 5' side of the AP site by a hydrolysis mechanism producing nucleotide-3'-hydroxyl and 5'-deoxy-5-phosphate (5'- dR5P) residues on opposite sides of the nick. See e.g. Doetsch, P.W. and Cunningham, R. P., Mutation Research, 236:173-201 (1990) or Levin, J.D. and Demple, B. Nucleic Acids Res. 18(17) .5069-5075 (1988).

Extensive research has been conducted on the isolation of Class II AP endonucleases from microorganisms such as Escherichia coli. See, for example, Ljungquist et al. J. Biol. Chem. 252(9) .2808-2814 (1977) and Bailly, V. and Verly, W.G., Biochem. J. 259:761-768 (1989) An endonuclease specific for double-stranded DNA and having no exonuclease activity associated with it was first discovered in Escherichia coli and termed an endonuclease IV. Endonuclease IV represents about five percent of the abasic activity in E. coli. Approximately ninety-five percent of the abasic endonuclease is provided by an endonuclease VI (also called exonuclease III) which has also a 3'-5' exonuclease activity. Another enzyme, endonuclease III, which catalyzes β- elimination at the abasic site, accounts for the remaining one percent. In contrast, relatively little investigation has been made on the isolation and purification of AP endonucleases from thermophiles, such as Thermus . Sako et al., J. Gen. Micro. 130, 1525-1534 (1984) discloses an apurinic endodeoxyribonuclease from Desulfotomaculum nigrificans. Warner, J. Bacteriol. 154 (3) 1451-1454 (1983) discloses a base excision repair activity from the thermophile Thermus sp. strain X-1. Runswick etal., Febs Lett., 94(2) 380-382 (1978) discloses the partial purification of an endonuclease from Thermus aquaticus and Bacillus stearothermoplhilus.

The use of a thermostable class II AP endonuclease in nucleic acid sequence amplification methods has been disclosed by Backman, etal. in European Patent Application 439,182 published July 31 , 1991 , and incorporated herein by reference. In general the amplification process comprises repeated steps of (a) hybridizing the modified probes to the target; (b) correcting the modification in a target dependent manner to render the probes ligatable; (c) ligating the corrected probe to its partner to form a fused or ligated product; and dissociating the fused product from the target and repeating the hybridization, correction, and ligation steps to amplify the desired targeted sequence. The utility of a thermostable class II AP endonuclease resides in the discovery that it can cleave synthetic oligonucleotide probes at an abasic site 3' to the point of ligation on the probe intended to donate its 3' end. The complementary probe should be designed so that when hybridized together the two probes would substantially not allow target-independent cleavage at the abasic site by the enzyme to be used. In addition to its utility as a Class II AP endonuclease, thermostable endonuclease IV is useful because of its stability at temperatures greater than about 70^*C and because of the substantial lack of exonuclease activity which has been associated with other endonucleases.

Accordingly, there is a need in the art to produce a purified stable, thermostable endonuclease that may be used to improve the nucleic acid amplification process described above.

Summary of the Invention

The present invention provides a substantially purified and isolated form of a native or recombinant thermostable abasic class II AP endonuclease which retains activity when subjected to elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids.

The gene encoding class II AP endonuclease from Thermus thermophilus has also been identified and cloned. The present invention also provides for vectors and hosts capable of expressing the thermostable class II AP endonuclease . Finally the invention provides a method for the detection of the thermostable class II AP endonuclease which comprises: (a) providing a DNA sequence forming a hairpin structure having a double stranded region, said sequence having an abasic site located within said double stranded region and a detectable label on its 3' or 5' end, the portion of said sequence between said abasic site and said 3' or 5' uncleaved end capable of being distinguished from the uncleaved sequence;

b) incubating said DNA sequence with a medium suspected of containing class II AP endonuclease activity for a predetermined amount of time; and

c) measuring the amount of label associated with said cleaved 3' or 5' fragment.

Brief Description of the Drawings

FIGURE 1A is the DNA sequence and FIGURE 1 B the predicted amino acid sequence for class II AP endonuclease from T. thermophilus. The amino acid sequence corresponding to the deduced primary translation product underlined in FIGURE 1A.

FIGURE 2 is a schematic diagram of plasmid pCS10 showing restriction sites located on the vector. pCS10 contained no PsA, EcoR\, or HindlW sites. It contained 6 BamH\ sites which together gave an insert size of 10.5 kb.

FIGURE 3 is the restriction site map of plasmid pCS11 that contains approximately 1.4 kb Sau3A\ T. thermophilus insert subcloned into plC20H.

FIGURE 4 is the restriction site map of plasmid pTT7. The insert contains approximately 1115 bp fragment of T. thermophilus DNA (from the ATG start codon of the class II AP endonuclease gene to the Saι/3AI site beyond the 3' end of the gene), an 18 bp sequence upstream of the start codon containing a ribosome binding sequence designed to be functional in E. coli, and a Cla\ site (generated by filling in and religation of the Bam \ site that had been inserted by PCR ) giving a total of 1133 bp.

Detailed Description of the Invention

For the purposes of the present invention, as disclosed and claimed herein, the following terms are defined below.

The term "control sequences" refers to DNA sequences necessary for the expression of an operably-linked coding sequence in a particular host organism. The control sequences that are suitable for procaryotes, for example, include a promoter and a ribosome binding site.

The term "expression system" refers to DNA sequences, included on a vector or integrated into the host chromosome, which contain a desired coding sequence and control sequences in operable linkage, so that hosts transformed with these sequences are capable of producing the encoded proteins.

The term "gene" as used herein refers to a DNA sequence that encodes a recoverable biochemically or biophysically active polypeptide or precursor. The polypeptide can be encoded by a full-length gene sequence or any portion of the coding sequence so long as enzymatic activity is retained.

The term "nfo" as used herein refers to the gene encoding class II AP endonuclease . As used herein, a mutation in the nfo gene would lead to a loss of enzymic activity.

The term "operably-linked" refers to the position of DNA sequences so that the normal function of the sequences can be performed. For example, a coding sequence operably linked to a control sequence refers to the configuration wherein the coding sequence can be expressed under the control of the control sequences.

The term "thermostable class II AP endonuclease " as used herein refers to Class II AP endonuclease which maintains substantial activity at a temperature at or above about 70"C. The thermostable class II AP endonuclease of the present invention cleaves a single strand of DNA at the location of an abasic or other correctable site substantially only when the DNA strand is hybridized to a complementary strand which extends in either direction from the abasic site. Othe correctable sites include, but are not intended to be limited to moieties at the 3' end of DNA strands which result from the action of Class I AP endonucleases, and further breakdown products thereof. The present invention provides a thermostabl class II AP endonuclease which must satisfy the criterion of (1) having essentially no associated exonuclease activity; and (2) maintaining DNA-cleaving activity afte subjection to elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids. The heating conditions necessary for nucleic acid denaturation will depend on the pH of the buffer, salt concentration and composition, length and nucleotide composition of the nucleic acids being denatured, but typically range from 70 ^*C to 110 ^*C. At such temperatures, denaturation will normally occur in less than from about seven to eight minutes. The thermostable class II AP endonuclease herein described has an optimum temperature at which it functions that is at about 40 ° to 50 °C. However, an class II AP endonuclease which is active below 40 'C is also within the scope o the present invention, provided that it is heat-stable. Preferably, the optimum temperature ranges from about 50 ^βC to about 100 'C. More preferably, the optimum temperature is from about 60 ^*C to about 95 ^*C.

The thermostable class II AP endonuclease herein described may be obtained from a variety of sources and may be a native or recombinant protein. Examples of endonucleases herein reported as being resistant to heat include, but are not intended to be limited to endonucleases extracted from the thermophiiic bacteria of the genera Thermus and Sulfolobus.

One example of the thermostable class II AP endonuclease of the present invention has the amino acid sequence presented in Figure 1 A. In addition, any thermostable class II AP endonuclease containing at least 50% homology, and preferably 70% homology, to any contiguous stretch of ten or more amino acids presented herein is also intended to be within the scope of the present invention. This homology is determined by any of the available sequence analysis software packages, such as that available from DNAstar, Intelligenetics, the Genetics Computer Group of the University of Wisconsin, and the like.

A preferred thermostable class II AP endonuclease enzyme of the present invention is isolated from Thermus aquaticus or Thermus thermophilus. Various strains thereof are available from the American Type Culture Collection (ATCC), Rockville d. One of the preferred strains is T. thermophilus HB8 ATCC 27634.

For recovering the native protein, the cells are grown using any suitable technique. For example, the technique described by Chien, etal., J. Bacteriol. 127: 1550-1557 (1976) the disclosure of which is incorporated herein by reference, can be used.

After cell growth, the enzyme is isolated and purified by conventional techniques. For example, T. aquaticus cells, if frozen, are thawed, washed in saline, centrifuged, and resuspended in an appropriate buffer. One such buffer includes, but is not intended to be limited to, a buffer comprising 50 mM Tris/ HCI pH 7.4, 5 % glycerol, and 0.5 mM dithiothreitol (DTT). The cells are broken and debris removed by centrifugation. The supernatant is collected and diluted with potassium phosphate buffer, preferably at pH 7.0 and applied to Blue Sepharose column at 4°C. The column is then washed and the enzyme eluted with a linear gradient of buffer containing 0.1 - 1.0 M NaCI. The pooled fractions containing the thermostable class II AP endonuclease are collected and assayed for activity as described herein.

The thermostable class II AP endonuclease of the present invention may also be produced by recombinant DNA techniques, as the gene encoding this enzyme has been cloned from T. thermophilus DNA. The DNA and deduced amino acid sequence of a preferred thermostable class II AP endonuclease is provided in Figure 1A and 1B. In addition to the amino acid sequence shown, any modification of the protein which does not destroy the activity or thermostabilϊty of the enzyme is specifically included. These modifications include, but are not intended to be limited to, oxidation, reduction, and the like. In addition, modifications to the primary structure itself by deletion, addition, or alteration of the amino acids incorporated into the sequence during translation which can be made without destroying the activity and thermostability of the enzyme fall within the contemplated scope of the present invention.

In general terms, the production of a recombinant form of thermostable class II AP endonuclease typically involves (a) isolating a DNA that encodes the mature enzyme from a thermophilic bacteria; (b) placing the recovered coding sequence in operable linkage with suitable control sequences in a replicable expression system; (c) transforming a suitable host with the vector; and (d) culturing the transformed host under conditions to effect the production of the recombinant class II AP endonuclease .

The control sequences, expression systems, and transformation methods are dependent on the type of host cell used to express the gene. Generally, procaryotic hosts are the most efficient and convenient for the production of recombinant proteins, and therefore are preferred for the expression of the thermostable class II AP endonuclease of the present invention. Procaryotes are most frequently represented by various strains of

Escherichia coli. However, other microbial strains may also be used, for example, Bacillus subtilis, various strains of Pseudomonas, or other bacterial strains. In such procaryotic systems, plasmid vectors that contain replication sites and control sequences derived from a species compatible with the host are used. For example E. coli is typically transformed with derivatives of pBR322, a plasmid derived from an E. coli species described by Bolivar, et al., Gene 2: 95 (1977).

One embodiment of the present invention is E. coli strain CS1 (pTT7) which was deposited with the American Type Culture Collection (ATCC) and has the accession number 68950. E. coli CS1 contains a mutation in the resident nfo gene and a copy of the lambda cl857 temperature-sensitive repressor gene (plus a drug resistance marker) inserted into the chromosome. Since the strain is devoid of class II AP endonuclease activity, it is particularly useful in expressing the thermophilic enzyme of the present invention. The construction of CS1 was accomplished in two steps. First, a πfo::kan mutation from E. coli BW528 is transduced into E. coli strain MM294. Next, a gene cassette containing the lambda cl857 temperature-sensitive repressor gene and a selectable spectinomycin/ streptomycin was moved into the strain to give E. coli strain CS1. The construction proceeds by conventional methods, such as those described in Maniatis et al., Molecular Cloning. A Laboratorv Manual New York: Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, (1982) or Silhavy, et al. "Experiments with Gene Fusions" Cold Spring Harbour Press, New York (1984).

The present invention also provides suitable vectors for the expression of the thermostable enzyme. The construction of suitable vectors containing the desired coding and control sequences employs standard ligation and restriction techniques that are well understood in the art. Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme under conditions that are generally well-understood in the art. With reference to a vector of the present invention, any selectable marker may be used which is functional in E. coli or other selected host and allows cells transformed with a vector of the present invention to be distinguished from cells not so transformed. A gene that provides a dominant selectable marker for antibiotic resistance in E. coli is such a selectable marker. The gene for ampicillin resistance is especially preferred. Other DNA segments which confer resistance to other antibiotics, including apramycin, tylosin, picromycin, oleandomycin, viomycin, neomycin, tetracycline, chloramphenicol, hygromycin and the like, can be used either as replacements of, or in addition to, the drug resistance segment described herein.

A transforming DNA according to the present invention may include elements for its selection and replication in bacteria, especially E. coli, whereby production of large quantities of DNA by replication in bacteria will be facilitated. In this regard, a preferred DNA of the present invention is a plasmid which includes a segment comprising the origin of replication and ampicillin resistance gene or fragment thereof of plasmid pBR322. Although plasmid pBR322 is exemplified herein, other plasmids which contain origins of replication for E. coli, include, but are not intended to be limited to, pBR325, pUC8, pUC12, pUC13, pUC18, pUC19, pACYC177, pACYC184 and the like. The present invention further provides a detection method for assaying class II AP endonuclease activity. The assay involves incubation of an enzyme-containing sample with an amount of substrate from 3 nM - 1000 nM in a suitable volume of buffer for a time in which a quantitative amount of substrate is converted to product at a temperature appropriate for the activity of the enzyme. A typical assay contains 4 - 10 nM substrate in a volume of 20 μl and is incubated for 5 -60 min. A preferred buffer will generally comprise 25 mM EPPS, pH 7-8, 50 mM NaCI (or KCI), 100 μg/ml gelatin and 0.5 mM cobalt ion, 10 mM MgCI₂ and 10 mM NH₄CI.

An abasic substrate is required in the detection assay. Endonuclease IV requires a double stranded substrate for cutting at an abasic site. Substrates for assay of class II AP endonuclease activity in the prior art have used release of acid soluble radioactivity from a DNA template (usually phage DNA) containing abasic sites or by cutting of a synthetic DNA oligonucleotide substrate hybridized to a complementary strand. The prior art discloses various methods for generating abasic sites in the templates including acid depurination, depurination of alkylated DNA, and removal of uracil residues by the uracil DNA glycosylase from phage DNA prepared from a ung mutant of E. coli . These methods are unreliable because they may result in the generation of substrates containing varying levels of depurination/ depyrimidination, varying levels of blocking, varying backgrounds due to β-elimination, and a variable level of radioactive incorporation.

Therefore, the present invention further provides synthetic abasic substrates which are suitable in an assay for class II AP endonuclease detection. Synthetic substrates comprising hairpin structures containing a synthetic abasic site in the double stranded region of the hairpin were synthesized by known methods in phosphoramidite chemistry on a DNA synthesizer. The substrates (a) are small in size so that they can easily be synthesized in high yield and efficiency; (b) have a single abasic site incorporated using standard DNA synthesis chemistry; (c) have the abasic site modified by a (reduced) furan ring which precludes cleavage by a general base-catalyzed β-elimination mechanism ( Eritja, et al., Nucleosides and Nucleotides 6 (4): 803-814 (1987); (d) result in an easily resolvable cleavage product; (e) have a free 3' hydroxyl group for labelling using commercially available [32p]- labelled nucleotides and terminal transferase; and (f) contain palindromic sequences which cause the formation of a hairpin.

The hairpin serves two functions. Firstly, it obviates the need for a hybridization step before the oligonucieotide can be used. Secondly, the hairpin also has a high melting temperature, which is generally much higher than two oligonucleotides of equal double stranded region. This is important for use at high temperatures with thermophilic enzymes. Previous synthetic substrates were composed of two obligatorily separate oligonucleotides. The two strands needed to be kept separate by the need to depurinate a single purine residue in a polypyrimidine strand prior forming a double-stranded DNA molecule, with a complementary purine-containing strand. The latter (purine- containing) strand would need to be kept separate from the strand undergoing treatment to depurinate.

Two hairpin substrates of the present invention are exemplified as follows:

Hairpin 1 is a 39-residue oligonucieotide ( wherein X is an abasic residue) having the following structure: * C A

_A CGGCGGGGCCXTHH2L 3'

GCCGCCCCGGTAAAAAA 5 ' C A

^* The 5 underlined thymidines have phosphorothioate bonds between them and the adjacent thymidine 5' to them.

Upon cleavage by class II AP endonuclease , the substrate yields a 7-residue nucleotide product (one nucleotide is actually the abasic residue).

Hairpin 2 is a 45-residue oligonucieotide ( wherein X is an abasic residue) having the following structure:

C A ACGGATCCGGCTXTTTTTGGGG 3'

TGCCTAGGCCGAAAAAAA 5' C A

Upon cleavage by class II AP endonuclease , the substrate yields a 10- residue nucleotide product . The melting temperatures of the hairpin substrates of the present invention at 3 μM in 25 mM EPPS pH 7.6, 0.1 M NaCI, 10 mM EDTA were determined to be approximately 81° C (hairpin 1 ) and approximately 74° C (hairpin 2).

Both hairpins have design features to minimize 3' exonuclease activity of the type exhibited by E. coli exonuclease III. Endonuclease IV activity in E. coli is heat stable at 65°C, whereas exonuclease III activity is not, and this property is exploited to assay the former in the presence of the latter. Hairpin 1 has 5 phosphorothioate linkages between the six 3' terminal thymidines. These linkages have been shown to resist the action of exonuclease III. Hairpin 2 has a 4 nucleotide extension at the 3' end. It has been shown that exonuclease III, which requires double stranded DNA, will not act on a substrate with a 4 nucleotide overhang at the 3' end. Cleavage of these substrates was not observed on treatment with 0.2 M NaOH for 15 min at 37°C indicating that the synthetic abasic site was stable as predicted. The hairpin oligonucleotides are used as substrates in the assay described herein for the thermophilic class II AP endonuclease of the present invention. An aliquot of the EPPS-containing buffer, along with the hairpin substrate, is warmed 50°C for > 1 min prior to starting the assay by addition of enzyme. The enzyme is incubated for a pre-determined time ranging from about 5 - 30 min for crude and partially purified extracts and up to 19 h for screening of clone banks, and the assa stopped by addition of 20 μl of formamide-dye mix. After heating for about 2 min a - 100°C, aliquots of about 10 -16 μl are loaded on a 20 % acrylamide/ 50% w/v ure TBE gel (15 cm H X 17 cm W X 0.7 mm thick) and substrates and products localize electrophoresis at 55 V/ cm (800 V for 15 cm gel) until the Bromophenol blue dye i approximately at the bottom of the gel (about 30 - 45 min). An aluminum plate is fastened to the exposed glass plate to uniformly spread and dissipate heat genera during electrophoresis.

When the gel is finished, it is removed from the plates onto a used piece of fi and covered with plastic film, e.g. Saran wrap. The enzyme is then localized by autoradiography. For example, the gel is placed on Kodak X-OMAT AR film, matc up the film with one of the corners of the gel to allow subsequent superimposition f excising bands for counting. The film is exposed for 20 - 100 min at 22°C (no scre or 30 min - 4 h with intensifying screen at -80°C, with the actual time depending on amount of the radioactive label.

For quantitation, the radioactive bands is excised and radioactivity determin by scintillation counting. The exposed film is taped to a light-box and the gel place over the film and taped in place. The position of dyes aids alignment. The substra and product bands are excised and placed in 4 ml of scintillation fluid (e.g. Ecolum ICN Biomedicals, Radiochemical Division. Irvine. CA, US. ) in a mini-vial and coun for 2 minutes or until 40,000 counts have been recorded in the ³²P channel of a scintillation counter.

The assay provides a sensitive, reliable, and rapid manner of detecting clas AP endonuclease activity.

The endonuclease of the present invention as described above has a unique utility in a modified version of the ligase chain reaction (LCR) first described by Backman, etal., in EP-A-320,308 and later modified in Backman, et al., EP-A-439,182, the entire disclosures of which are incorporated herein by reference.

Briefly, the endonuclease is used to "correct" the ends of probes that have been modified to prevent or reduce blunt end ligation in the absence of target. The modification is often as simple as adding a phosphate or an abasic residue to the 3' terminus of the probes whose 3' end participates in the ligation reaction. However, as mentioned, the endonuclease works to correct the modified end substantially only when the probe is hybridized to the target strand. Thus, the "correction" is template or target dependent. When the probe is merely hybridized to the complementary probe, the endonuclease fails to recognize it as a substrate.

The present invention will now be illustrated, but is not intended to be limited by the following Examples:

Materials and Methods

Reagents & Enzvmes

Media for the growth of bacteria were purchased from Difco (Detroit,

Michigan, USA) or Gibco (Madison, Wisconsin USA). Restriction enzymes, T4 DNA ligase, T4 DNA polymerase, large fragment of the enzyme E. £0_N DNA polymerase I and Polynucleotide kinase were purchased from Bethesda

Research Laboratories (BRL, Gaithersburg, Maryland USA); New England

Biolabs (Beverley, Massachusetts USA); Boehringer Mannheim (Indianapolis,

Indiana USA) or PL Laboratories (Milwaukee, Wisconsin USA). Agarose was from international Biotechnology, Inc. Kanamycin was purchased from Sigma.

X-gal (5-bromo-4-chloro-3-indoyl- D-galactoside) was purchased from BRL.

E. £2ϋ K12 strains HB101 , DH5α , E. £QJi K12/pUC9, E. £Qϋ K12/pUCI9, and E. coli K12/pBR322 are obtainable from BRL or PL Laboratories. Buffers are defined as follows: TAE (Tris-acetate) defined as 40 mM Tris, 20 mM acetic acid, 2 mM EDTA;

LB broth defined per litre as 10g BactoTryptone, 5 g yeast extract, 5 g NaCI; TB top agar defined as LB broth, defined supra, containing 0.75 % w/v agar, 5 mM calcium chloride, 0.2% glucose, 10 mM magnesium sulfate; TE defined as 10

5 X LCR buffer defined as 50 mM EPPS/ K⁺ pH 7.6, 10 mM NH4CI, 10 mM MgCl2,

80 mM KCI, 100 μg/ml gelatin, and 0.5 mM C0CI2; and

SOC media defined as 20 g bactotryptone, 5 g yeast extract, 0.5 g NaCI, 2.5 mM

KCI, 10 mM MgCl2, 20 mM glucose, pH 7.0 Example 1 Transduction of nfor.kan mutation from E. coli BW528 into E. coli

MM294

E. coli BW528 cells (Cunningham, etal. J. BacteriolΛ 68: 1120-1127 (1986) were grown overnight (about 16 hours) in LB broth at 37°. Fifty microliters (50 μl) was subcultured into 5 ml LB containing 0.2% w/v glucose and 5 mM calcium chloride. The cultures were incubated for 30 min at 37° with aeration, and 0.1 ml bacteriophage P1 vir was added to give ca. 5 X 10⁸ phage/ml. The cells were then shaken 3 h for phage development and cell lysis. Chloroform (0.1 ml) was added and the culture vortexed. The cell debris was pelleted by centrifugation at 4500 X g for 10 min, and the supernatants were transferred to fresh sterile tubes containing 0.1 ml chloroform. After mixing, the phage preparations were stored at 4°.

Titre (number of viable phage/ml) of the phage preparations was determined as follows: the phage preparations were serially diluted 10³, 10⁵, and 10⁶ fold in 10 mM magnesium sulfate and 5 mM calcium chloride and 5 μl of each dilution spread as a patch of approximately 1 cm diameter on a lawn of E. coli MM294 (Meselson, etal., Nature 271 : 1110 -1114 (1968)cells in TB top agar on a LA plate (LB solidified with 1.5 % agar). The lawn was made by adding 0.1 ml suspension of E. coli MM294 cells in 10 mM magnesium sulfate , 5 mM calcium chloride (approximately. 10⁹/ml) to 3 ml molten TB top agar cooled to 45°. The mixture was then poured onto the surface of a LB plate. The plates were incubated at 37° overnight and the number of plaques counted at a suitable dilution to calculate the titre. The resulting preparation of P1 vir had a titre of 4 X 10⁸ plaque forming units/ ml.

A 5 ml LB culture of E. coli MM294 was grown overnight, and the cells collected by centrifugation at 1500 X g for 10 min. The cells were resuspended in 2.5 ml 10 mM magnesium sulfate and 5 mM calcium chloride. Aliquots (0.1 ml) of the cells were placed in test tubes with 0.01 , 0.05, 0.1 ml P1 vir lysate described above, and incubated 30 min at 30° for infection. Sodium citrate (0.1 ml of 1 M solution) and 1 ml LB were added. Cells were grown 1 h at 37° to express the drug resistance before 2.5 ml molten (45°) LB top agar (LB with 0.7 % agar) was added, and the mixture plated on LA plates containing 25 mg/ 1 kanamycin sulfate (LA Km₂s). The plates were incubated at 37° for 2 days. Two kanamycin resistant colonies were obtained from the tube with 0.01 ml phage. These colonies were streaked out on LA K1TI25 plates and a single colony tested for loss of class II AP endonuclease activity by assay with an abasic substrate. No cutting of the abasic substrate was observed, confirming the loss of class II AP endonuclease . This strain was named E. coli MM294 nfov.kan.

Example 2 Subcloninα of the αene from Thermus thermophilus Step A: Isolation of lasmid pCS10 from T. thermophilus The clone bank of T. thermophilus of Lauer, etal., J. Bacteriol. 173:

5047 - 5053 was used. It had been constructed in E. coli strain HB101 by cloning 7- to 30-kb DNA fragments generated by partial Saϋ3A\ digestion of T. thermophilus chromosomal DNA into pTR264 digested with Bch and treated with calf intestinal phosphatase. Plasmid DNA of the Thermus thermophilus clone bank consisting of 4 pools of -400 clones per pool with an average insert size of 10 kb of chromosomal DNA, (DNA concentration ca. 0.5 mg/ ml) was diluted 10 fold with ^* T5E₀.₅. and added to the competent E. coli MM294 nfonkan cells prepared as described in Example 1. After 30 min on ice, the tubes were heat shocked for 90 sec at 42°C followed by cooling on ice for about 1 min. One ml of SOC medium was added, and the cells shaken for 1 h at 37° for expression of the tetracycline resistance gene on the plasmid. A 50 μl aliquot was plated onto LA tetracycline (5 μg/ ml) and the remainder spun down and plated on a single plate. The plates were incubated at 37° overnight. The dilute plates contained roughly 200 colonies, and the concentrated plate contained over 1000 colonies in the case of all four pools. The colonies on the concentrated plate were scraped up in 3 ml LB, and another 1 ml LB used to wash the surface of the plate. The final recovered volume was approx 3 ml. One ml of the resuspended cells was used to inoculate 250 ml LB Tc5 and cultures grown at 37° for about 3 h. Cells were collected by centrifugation, resuspended in crushing buffer (50 mM Tris/ HCI pH 7.4, 10 mM MgSθ4, 80 μM CoC.2,5% v/v glycerol), and respun. Cells were finally resuspended in 6 ml crushing buffer and cells broken at 14,000 - 16, 000 psi in a French Press. Cell debris was removed by centrifugation at 15,000 rpm (26,900 X g) for 15 min. A 200 μl aliquot of the cleared supernatant was made 50 mM in NaCI, and heat treated at 90° for 5 min, followed by cooling on ice for 1 min. Precipitated protein was removed by centrifugation in a microfuge at room temp for 5 min. A 10 μl aliquot was then assayed for class II AP endonuclease activity against both hairpin substrates #1 , and #2. Assays were done with and without the addition of herring sperm DNA with 3' labelled hairpin and 5X LCR buffer. A 10 μl sample was removed after 1 h into an equal volume of 98% formamide-dye mix and the remainder stopped after 17 h as above. A 15 μl sample of the stopped assays was run on a 20% polyacrylamide/ urea/ TBE gel (45 min, 800 V), and exposed to film for 100 min. Class II AP endonuclease activity was obtained from Pool #1 and #3 on hairpin 2. Pool #1 was chosen for further work.

A second transformation of the DNA of the Thermus thermophilus clone bank, prepared above, was performed with competent E. coli MM294 πfo::kan cells. Eleven plates (labelled A - K) of 50 patches each were made, in duplicate, by patching out colonies from the transformation onto LA TC5. Horizontal rows of each plate (6 - 10 patches) were scraped into 500 μl 0.85% saline, 10% glycerol, and resuspended. A 125 μl aliquot of each of the pools from a single plate were inoculated into a single 250 ml LB Tcs culture, such that each culture represented a single plate of 50 patches. These cultures were grown 16.5 h at 37° with shaking and harvested by centrifugation (5 min, 5000 φm, 6 X 250 ml rotor). The cell pellets were washed in 20 ml 0.85% saline, 50 μM C0CI2, and resuspended in 6 ml crushing buffer. Cells were crushed, spun, heat-treated and assayed for 1 h as described above. Plates A, B, and I showed a product band indicative of class II AP endonuclease activity. Plate I was chosen for further investigation. Pools of 6 - 10 patches from plate I of clone bank were screened in the following manner. Six 250 ml LB Tcs cultures were set up and inoculated with pools of 6 - 10 clones from plate I as for experiment with pools of 50. Cultures were grown and extracts made, heat treated and assayed as for previous experiment with pools of 50. A 30 min time sample (10 μl) was removed from the assay and electrophoresed on polyacrylamide as before. Class II AP endonuclease -like activity was observed in the culture corresponding to ten patches from rows 1 and 2 of plate I.

Further analysis of these 10 clones indicated that patch #9 was responsible for the class II AP endonuclease activity. Patch #9 was streaked out for single colonies, and two singles retested for class II AP endonuclease activity. Both were positive for cutting of the abasic haiφin #2 in a 30 min assay. One was chosen for storage. The plasmid was called pCS10, and the strain E ∞li MM294 nfo an (pCS10).

DNA of pCS10 was purified by alkaline lysis, followed by cesium chloride gradient centrifugation from a 250 ml LB Tcs culture using standard procedures known to those skilled in the art such as is found in Maniatis, supra. The DNA preparation had a concentration of 420 μg/ ml.

Step B: Sa u3AI digest of PCS10 to prepare pCS11

Plasmid vector pIC20H was cut with Bam HI and dephosphorylated with bacterial alkaline phosphatase (BAP). plC20H has a polylinker in the α fragment of β galactosidase such that inserts into the polylinker cause loss of the β galactosidase activity and loss of color formation on β galactosidase indicator plates. This allows the identification of inserts in the vector. Digestion was done at 37° for 90 min, followed by phenol extraction and ethanol precipitation. The plasmid DNA was resuspended in 20 μl T₅E₀.₅, and 15 μl treated with the phosphatase according to manufacturers instructions.^' The reaction was incubated 1 h at 65°. 30 μl of H₂0 and 1 μl 0.25 μl EDTA were added and the reaction heated 10 min at 50°. The digest was phenol-extracted and ethanol-precipitated. The plasmid DNA pellet was resuspended in 10 μl T5E0.5.

Next, plasmid pCS10 was partially digested with Sau3M 37° for 20 minutes and stopped by heating 10 minutes at 68°. A 1 μl aliquot was run on an agarose gel to determine degree of cutting. Digestions 3, 4, and 5 were not significantly digested, so they were redigested by addition of 2 μl 1 :20 Satv3AI to each tube for 20 min followed by heat inactivation at 65° for 10 min. The whole digest was run on a 1% agarose gel in TAE. After staining, agarose slices were cut out under long wave uv, corresponding to 1 - 1.5 kb, 1.5 - 2 kb, 2 - 3 kb and 3 - 4 kb. The DNA was isolated using the Geneclean kit (BIO-101 , La Jolla, CA) and resuspended in approximately 15 μl T₅E₀.₅. These fractions were then ligated to plasmid plC20H prepared above. (Marsh, et al, Gene 32, 481 - 485, 1984).

Ligations (10 μl) were set up containing 0.3 μg plC20H (1 μl) and 2 μl of one of the size fractions isolated from agarose. After overnight ligation at 16°, 1 μl of the ligations was transformed into 50 μl DH5αF according to manufacturers instructions, except that the cells were grown out for 1 h in 2 ml SOC before spreading onto LA Amp-joo X-Gal plates. For the 1 - 1.5 kb size range, approximately 205 white and 7 blue colonies appeared in total. A second transformation was done with the ligation of 1 - 1.5 kb fragments for more transformants. Plasmid DNA minipreparations were done on 10 transformants. HindlW digestions showed that the insertion was in the selected size range in all cases.

Eight plates of 50 colonies each of the 1 - 1.5 kb size range (total = 400 colonies) were patched out on LA Ampioo X-Gal in duplicate. Plates were incubated overnight at 37°. Groups of 10 patches from one of the duplicate plates was scraped up and resuspended in 0.5 ml 0.85% saline, 10% glycerol. 0.25 ml of each of the five pools from the same plate were inoculated into LB Amp₁₀o, and grown for 4 h at 37°. Cells were harvested and extracts made and assayed as for the previous screening of the clone bank. Assays were stopped at 40 min and samples electrophoresed as before. Plates #1 and #2 both showed activity. Subpools of 10 colonies from both these plates were grown and extracts tested for class II AP endonuclease activity. Pool D (#Patches 31 - 40) from plate #1 and pool B (#Patches 11 - 20) from plate #2 were identified as giving activity . These colonies were individually tested and #36 (plate #1) and patch #20 (plate #2) were identified. These were purified through single colonies on LA Amp-ioo. and DNA preps made by CsCI-gradient centrifugation Restriction mapping indicated identical 1.4 kb inserts in the two plasmids The plasmid from plate# 1 , patch #36 was named pCS11.

The 1.4 kb insert in pCS11 (see Figure 3) was restriction mapped with Bam HI, Bgl\\, Pst , Sac\, Sma\, Sal\, Xba\ and Xho\. The insert contained sites for Bgh\, Sad and Xho\, but no sites for the other enzymes. The sites for BglU, Sad and Xho\ were roughly equally spaced 0.3 - 0.4 kb apart and this was exploited for subcloning into M13 for sequencing.

Step C: Subcloninα of pCS11 into M13mo18 for seαuencinα.

Four micrograms of pCS11 was digested with 10 - 15 units of the appropriate restriction enzyme in a 20 μl reaction using the recommended buffer at 37° for 2.5 h. Digests were stopped with 2 μl gel loading buffer, and 10 μl electrophoresed on a 1.2% agarose gel in TAE. Bands corresponding to the desired fragment (see Table below) were excised and the DNA isolated using the Prep-a-Gene Kit (BioRad). The DNA was resuspended in 15 μl T₅E₀.₅. Ligations were set up with 13 μl DNA fragment (approx. 0.15 μg) and 0.1 μg M13 cut as shown in table below. The M13 (0.5 μg) was cut with the appropriate enzymes at 37° for 1.5 h, phenol extracted and ethanol precipitated, and the pellet resuspended in 10 μl T₅E₀.₅. It was then 5' dephosphorylated with bacterial alkaline phosphatase (30 Units) in a 15 μl reaction for 1 h at 65°. Phosphatase was removed by phenol extraction and the DNA recovered by ethanol precipitation as above. The DNA was resuspended in 10 μl T₅E₀.₅.)

Sequencing of M13 clones was done using the method of Sanger et. al., 1977. Nat. Acad. Sci. USA 74:5463-5467, employing M13 templates prepared as described by Messing, 1983. Methods in Enzvmol. 101 :20-78. Sequencing of double stranded templates was performed as described by Zhang et al., 1988. Nucleic Acids Res. 16:1220.

The DNA sequence of the inset in pCS11 was 1469 base pairs. Translation of the sequence in all reading frames was done. A single reading frame of 813 base pairs (including TAA stop codon) encoding a 270 amino acid polypeptide was deduced from the sequence. The ATG start codon was preceded by a weak Shine-Dalgarno (ribosome binding) site for E. coli. The protein had a predicted mol. wt. of 29,088 and a predided isoelectric point of 6.17. The G-C content of the coding region was 71.1 %. A series of 10 synthetic DNA sequencing primers, spaced roughly 200 - 250 base pairs apart, were designed and used to re-sequence the coding region. This sequence is shown in Figure 1A. Example 3

Insertion of a Ribosome Binding Sequence 5' to the T. thermophilus Class II AP endonuclease Coding Sequence for

Efficient Expression in E. coli The polymerase chain readion (PCR) was used to insert a ribosome binding sequence (i.e., Shine-Dalgarno sequence) particularly effective in £ coli at the 5'-end of the class II AP endonuclease gene. The PCR product was about 151 base pairs, and contained about 122 nucleotides of the 5'-end of the coding sequence. The intact class II AP endonuclease gene was then reassembled in vitro prior to overexpression in a suitable vector.

A 46-mer oligonucieotide PCR primer having the sequence GGCTAGCCCGGGATCCAGGAGGTATAAAAATGCCGCGCTACGGGTT 3' (ribosome binding sequence and start codon are underlined) contained in order from the 5' end: Nhel, Smal and BamH\ restriction sites followed by a Shine- Dalgamo sequence (AGGAGGT) placed six base pairs from the ATG start codon and followed by seventeen nucleotides homologous to the T. thermophilus class II AP endonuclease gene. An internal leftward reading sequencing primer having the sequence 5'-CAGCTCCGCGGGGCTπT-3' was used as the other PCR primer. PCR was done using standard methodology (McConlogue, et al., Nucleic Acids Res., 16: 9869 (1988)) except that a mixture of 7-deaza-dGTP and dGTP (in a 3:1 ratio) was used. A gel- purified fragment of plasmid pCS11 (8 ng) which had been restricted with Haell and Xmalll was used as the target for PCR. This resulted in a fragment of about 150 bases which included the restriction sites and the ribosome binding sites (the Shine-Dalgarno sequence). This PCR product was re-amplified by a second round of PCR and then treated with mung bean nuclease (to give DNA blunt ends) for 35 min at 30°, extracted with phenol, and precipitated with ethanol. The DNA was resuspended in 10 μl H₂0, heated 5 min at 60° to inactivate the nuclease, and 4 μl used for ligation. The product was then ligated into pUC19 (see Yanisch-Perron et al.,

1985, su^pra: Roberts, 1986, supra) and transformed into competent E. coli DH5αF cells according to manufacturers instructions up to the heat shock step. Cells were then grown in SOC medium for 1 h at 37° prior to plating on LA Ampi oo X-Gal IPTG plates. After overnight incubation, 3 white and 1 light blue colony were obtained together with 76 blue (non-recombinant) colonies.

DNA plasmid minipreparations were done and the results showed the expected size in two of the clones, designated PCR#2 and PCR #4. DNA sequence analysis demonstrated that the clones contained the ribosome binding site upstream of the ATG start codon.

Example 4 Reassembly of the Intact T. thermophilus αene and Construction of

Plasmid PTT1

Plasmid pCS11 (2.5 μg) was restrided with Bglll and Hindlll and the digests electrophoresed on agarose. An approximately 1.1 kb fragment was isolated and the DNA recovered using the Prep-a-Gene kit (BioRad) in a final volume of 15 μl. A 6 μl aliquot of this was ligated into PCR#2 and PCR#4 which had been restricted with Bglll and Hindlll and dephosphorylated with phosphatase. The ligations were transformed into DH5α cells; plasmid DNA mmipreparations were made for ten of the transformants from each cloning and the DNA cut with Bam l and Hindlll. One ligation product into pPCR#4 contained the correct 1.1 kb insertion and was designated pPCR#4-8. This construct was then digested with Ba Hl and Hindlll. An approximate 1.3 kb band was isolated and ligated into plasmid pGL516x (pGL516 of Lauer, et al., supra, modified by addition of Xhol linker at Bst X site in the lambda promoter) which had been restricted with BamHl and Hindlll and dephosphorylated.

The ligation was electroporated into E. coli CS1 and the transformants selected for ampicillin resistance. Resultant clones were tested for the insert. Some transformants seemed to have a double insertion. Candidates were grown and extracts from the clones tested for class II AP endonuclease activity. A clone, pTT1 , identified as an oveφroducer, contained an insertion of the intact class II AP endonuclease gene followed downstream by a tandem copy of a portion of the gene from the Bglll site to the 3' end, similar to the tandem insertion in pPCR#4-8.

Example 5

Reassembly of the Intact T. thermophilus αene and Construction of

Overexpressinα Plasmids pTT2. pTT3. pTT4. and PTT5

Plasmid pCS11 was restricted with Bgl ll and a 1.1 kb fragment isolated. This fragment was then ligated to pPCR#2 and pPCR#4 which had been cut with Bgl II to yield plasmids pPM2010 and pPM2020, respectively which now contain the reassembled intact class II AP endonuclease gene.

The class II AP endonuclease fragments in pPM2010 and pPM2020 were excised with BamHI and isolated from an agarose gel. Plasmid DNA minipreparation was used for isolation of the approximately 1 kb fragment. pGL516 (1.5 μg) and pGL516X (1.4 μg) were cut with Ba HI, dephosphorylated, and phenol extracted/ ethanol precipitated. The DNA was resuspended in a final volume of 15 μl, and 1.2 μl used in each ligation.

The 1 kb fragments from pPM2010 and pPM2020 were ligated into both pGL516 and pGL516X (a total of 4 ligations). A 2 μl aliquot was electroporated into CS1 electrocompetent cells. Cells were made electrocompetent according to a procedure published by BioRad and provided with their electroporation device. The only modification was that the cells were grown at 30° rather than 37°. After electroporation and outgrowth in SOC medium, the cells were plated on LA Ampioo- Transformants were patched onto LA Ampioo and also grown in 2 ml LA

Ampi oo or DNA minipreparation. The miniprep DNA was double digested with Bglll and EcoRI, and run on an agarose gel. The enzymes cut in the class II AP endonuclease gene and in the vector at the promoter-distal end of the insert to give a 1050 base pair insert piece joined to an approximately 375 base pair vector fragment yielding a diagnostic fragment of approx. 1425 bp. Several corred candidates were present for each of the four ligations.

One candidate from each cloning was seleded and named as follows: pTT2: reassembled class II AP endonuclease from pPM2010 in pGL516 pTT3: reassembled class II AP endonuclease from pPM2020 in pGL516 pTT4: reassembled class II AP endonuclease from pPM2010 in pGL516X pTT5: reassembled class II AP endonuclease from pPM2020 in pGL516X.

Example 6 Construction of Plasmids PTT7. pTT8. pTT9. and pTT10 The class II AP endonuclease gene in pTT3 and pTT5 was partially digested with BamHI and samples removed at 5, 10, 15, and 20 min into loading buffer. Samples were electrophoresed in an agarose gel and the approx. 6.7 kb singly cut product excised. The DNA was isolated with the Prep- a Gene (BioRad) kit, and digested with Nhel for 10 min at 37°. Deoxynucleotide triphosphates were added to about 32 μM and Klenow fragment was added to fill in the overhangs. After 10 min at 30°, the reaction was stopped with loading buffer, and the DNA run on a 0.7% agarose gel. The upper band corresponding to DNA cut at the promoter proximal BamHI site and Nhel, was excised and the

DNA isolated from the gel slice as above.

The DNA was then self-ligated to reseal the blunted ends, and electroporated into CS1 as for construction of pTT3 above. Eight minipreps of each cloning were made, double digested with BamHI + Sail, and electrophoresed on a 0.8 % agarose gel.

Two different plasmid derivatives resulted from this experiment. pTT7 and pTT8 (from pTT3 and pTT5, respectively) both contained a filled-in promoter-proximal BamHI site as the only modification. pTT9 and pTT10 (from pTT3 and pTT5, respectively) contained a deletion of approximately 180 base pairs between the promoter proximal BamHI and Nhel sites.

The relative adivity of the various class II AP endonuclease producing plasmids was tested in a semiquantitative assay with haiφin #2. The class II AP endonuclease activity of extracts of CS1 (pTT1 ) was more than 300 times higher than extracts of E. coli nfo:kan (pCS11 ). The relative activities of the pTT series of oveφroducing plasmids was as follows:

Purification of Recombinant T. thermophilus Class II AP endonuclease from E. coli CS1 (oTT7)

Cell paste (70.6 g) of E. coli CS1 (pTT7) was thawed and resuspended in 211.8 ml (3 vol.) Buffer A (25 mM Tris/ HCI pH 7.4, 1 mM MgS0 , 50 μM CoC1₂, 5% glycerol) containing 0.1 M NaCI at room temperature (22°C). Cells were broken at 14,000 psi in a French Press in 45 ml aliquots and the resulting extract centrifuged at 14,000 φm (23,420 X g) for 20 min to remove cell debris. The supernatant was incubated at 37 °C for 1 h during which time precipitation of some contaminating proteins occurred. After centrifugation as above, the extract was cooled 2 hours on ice, recentrifuged as above, and the supernatant filtered through a 5 μm filter. This yielded 196 ml of extract, which was stored at -80^*C.

The filtered extract (196 ml) was thawed, diluted to 500 ml with buffer A, and centrifuged at 14,000 rpm for 30 min to remove precipitated protein. A 100 ml aliquot was loaded onto a 100 ml Blue Sephrose (Pharmacia) radial flow column equilibrated in Buffer A at room temperature at a flow rate of about 5 ml/ min. (The remainder was frozen as 100 ml aliquots at -80^°C). The column was then washed with Buffer A until the OD returned to nearly baseline. A 500 ml gradient was run from 0 - 1.0 KCI at 5 ml/min. Twenty eight 20 ml fradions were collected. Class II AP endonuclease eluted mainly in fractions #8 - 26 which were pooled and stored at -80'C.

The other four 100 ml aliquots of the diluted crude extract were similarly chromatographed on Blue Sepharose, and fractions #8 - 26 pooled. The pools from the 5 columns were then pooled and concentrated by ultrafiltration (YM1 membrane, Amincon) to about 120 ml and dialysed overnight against 4L Buffer A at 4°C. The pool was then centrifuged at 12,000 rpm (17,210 X g) for 20 min to remove precipitated protein and column material, and filtered through a 1.2 micron filter. The pool was then divided into three 40 ml portions and one portion was loaded onto a 50 ml Heparin agarose (Sigma) radial flow column prepared in Buffer A at approx. 1.5 ml/min. After washing unbound protein from the column, 150 ml gradient was run from 0.0 - 1 M KCI at 1.5 ml/min. Fractions (3.75 ml) were collected. A major peak of uv-absorbing material with a shoulder was observed. Fractions 15 - 54 contained class II AP endonuclease activity, and these were pooled. The other two aliquots were similarly processed except that Heparin Sepharose CL-6B was used with similar results. Fradions 18 - 48 contained class II AP endonuclease activity, and these were pooled.

The pooled fractions (about. 266 ml) were concentrated by ultrafiltration (YM1 membrane, Amincon) to approx. 50 ml and then heat-treated at 75'C in a 50 ml polypropylene tube, by placing in a boiling water bath, with constant stirring. The temperature was monitored, and the tube removed to ice when the temperature reached 75 ^°C (6.5 min). After 4 h on ice, the preparation was centrifuged to remove precipitated protein as before, and the supernatant filtered through a 0.8 urn filter. The pool was then further concentrated to 4.3 ml by ultrafiltration (YM5 membrane, Amincon) and filtered through a 0.8 urn filter. 230 ul samples were subjected to HPLC size exclusion chromatography on a TSK-G3000SW column (7.5 mm dia. X 250 mm, BioRad) in 50 mM MES, 200 mM NaC1 pH 6.8 at 1 ml/min. One-ml fractions were collected. Activity was found in the major 280 nm-absorbing peak (frac. 13 - 20).

A total of 19 such runs were done, and the class II AP endonuclease fractions pooled. The pool (about 140 ml) was then concentrated to 14.5 ml by ultrafiltration (YM5 membrane, Amincon). The final yield of class II AP endonuclease was 14.5 ml at 4.45 mg/ml. The enzyme was analyzed for purity by SDS-polyacryfamide gel electrophoresis. After staining with Coomassie Blue, a major band was visible at about. 29,000 daltons, corresponding to the molecular weight predided for endonuclease IV from the DNA sequence (29,088). The purity was approximately 95%.

Example 8 Growth of E. coli CS1fpTT7) for Overproduction of Cloned

Thermostable Class II AP endonuclease

The same medium was used throughout, and was composed of a 1 :1 mixture of "2 X seed medium" and LB, and included 100 mg per litre ampicillin. The "2 X seed medium" contained (per litre): 20 g glucose, 2 mM MgSθ4, 0.2 mM CaCI₂, 2 ml micronutrients, 44 mM KH₂P0 , 138 M K₂HPO₄, 3.4 mM NaCI, 76 mM (NH )₂Sθ4, 0.001% vitamin B1 , 20 ml Fe citrate solution. [Micronutrient solution contained per liter: 0.15 g Na₂MO4.2H₂0, 2.5 g H3BO₃, 0.7 g CoCI₂.6H₂0, 0.25 g CuSO₄.5H₂0, 1.6 g MnCI₂, and 0.3 g ZnSO₄.7H₂0. Fe citrate solution contained per liter: 0.2 g FeSθ₄.7H₂0, 100 g Na3 Citrate.2H₂0.]

A 1 ml frozen stock of CS1 (ρTT7) (a stationary phase LB culture that had been made 5% in glycerol and frozen at -80°C) was thawed and added to 25 ml fermentation medium. The culture was grown 12h at 30O, then a 4 ml aliquot added to 950 ml of the same medium and grown 12h at 30^*C. This was then added to 10 L of medium in a Chemap CF 2000 fermentor and grown for 7h at 30°C (optical density at 600nm approx. 9.5) During growth in the fermentor, the pH was monitored constantly and automatically adjusted to 7 with H2SO4 or NH3. The culture was also stirred rapidly and bubbled vigorously with air. After 7h at 30^°C, the temperature was raised to 42°C for 2h to induce production of the class II AP endonuclease , during which the optical density did not change appreciably. The culture was then placed in a container on ice and the cells collected by centrifugation at 8,000 rpm (10,800 X g) for 15 min in 500 ml bottles. The bottles were filled and spun several times to give an accumulated cell pellet of roughly 70 g per bottle. The total yield was 285 g wet weight. The cell paste was frozen in the centrifuge bottles at - 80"C. Example 9 Identification of Class II AP endonuclease from T. thermo^philus

T thermophilus HB8 ATCC 27634 was grown and an extrad tested for class II AP endonuclease activity using haiφin #1 (defined, supra) as substrate in an assay buffer consisting of 25 mM EPPS, pH 7.6, 50 mM NaCI, 1 mM DTT,

I mM EDTA and 50 μg/mL bovine serum albumin. The extract gave several bands from hairpin #1. However, none corresponded to that expected of class

II AP endonuclease activity. It appeared that there was rapid destruction of the substrate by nuclease activity to give the observed bands, despite the presence of EDTA. Crude extracts showed no definitive class II AP endonuclease but results indicated the presence of an EDTA-resistant nuclease activity, herein defined as endonuclease X.

Therefore, in order to separate the class II AP endonuclease from endonuclease X, the crude extracts were treated with protamine sulfate to precipitate the DNA, followed by chromatography over a size exclusion column (Ultrogel Ac54, 13 cm X 1 cm dia.) at 0.5 ml/ min at room temperature (about 22°C). Forty 0.2 ml fractions collected and the fractions were assayed with hairpin #1 as substrate. The endonuclease X activity was recovered in fradions 12 - 28. In the assay only a single band of about 13 nucleotides was obtained from the abasic hairpin #1 rather than the seven nucleotide fragment expected from the class II AP endonuclease activity. This result differed from the crude extract in that the crude extract gave multiple bands, but still no class II AP endonuclease activity was evident in any of the fractions.

Subsequentially.T thermophilus extract (70 ml which had been treated with protamine sulfate to precipitate DNA which tends to interfere with the chromatography stationary phase) was chromatographed on a DEAE Sepharose Fast Flow column (7 cm X 4.4 cm dia.) equilibrated with 50 mM Tris/ HCI pH 7.4 , 1 mM DTT, 5% v/v glycerol, 25 mM benzamidine Cl using a 800 ml gradient from 0 - 1 M KCI at 4°C. A total of 32 X 12 ml fractions followed by 8 X 28 ml fractions were collected. No class II AP endonuclease activity was evident in any of the fractions. Endonuclease X activity eluted immediately after the flowthrough fraction. The endonuclease X fradions (# 11 -17, 84 ml) were pooled, concentrated to 3 ml and chromatographed on a size exclusion column (Sephacryl S100HR, 55 cm X 2.2 cm dia.) in order to test the possibility that there was class II AP endonuclease in this strain but that it had co-eluted with the endonuclease X . Fractions off the column were assayed. High endonuclease X was recovered in fractions 23 through 41. In addition, fractions 41-47 showed a band that corresponded to one expected from an class II AP endonuclease adivity. In conclusion, class II AP endonuclease activity was identified in T. thermophilus after two purification steps which separated class II AP endonuclease activity from the endonuclease X adivity.

EXAMPLE 10 Demonstration of Class II AP endonuclease Activity in Thermophiles Sulfolobus solfataricus and Thermus aαuaticus

Three Thermus strains, 7. flavus (ATCC 33923), T. sp (ATCC 31674), 7. aquaticus (ATCC 25104) and the archebaderium Sulfolobus solfataricus (ATCC 35091) were obtained from the American Type Culture Colledion (ATCC) and grown using standard culture media recommended by the ATCC, and extrads tested with haiφin #1 as defined in Example 9.

Class II AP endonuclease was clearly seen in the T aquaticus and in the S. solfataricus crude extracts. However, its activity was masked by the presence of endonuclease X in T. flavus and T. sp.

EXAMPLE 11

Purification of Native Class II AP endonuclease from T. aαuaticus

T. aquaticus ATCC 25104 frozen cell paste (38 g) was thawed, washed in 100 ml saline (0.85 %w/ v NaCI), centrifuged, and resuspended in 2 volumes buffer (80 ml; 50 mM Tris/ HCI pH 7.4, 5 % glycerol, 0.5 mM DTT). The cells were broken and debris removed by centrifugation. The supernatant (93 ml) was made 0.4 % w/ v in Polymin P/ HCI pH 7.9 (3.9 ml of 10 % w/ v stock) with stirring on ice. Comparison of the activity of the supernatant before and after Polymin P treatment indicated that significant activity was lost.

An aliquot (20 ml) of the extrad was diluted with 50 ml buffer (20 mM potassium phosphate pH 7.0, 1 mM DTT, 10 % v/v glycerol) and loaded onto a Blue sepharose column at 4°C, and washed with 15 ml buffer. Over 90% of the protein did not bind to the column as judged by the optical density of the material that did not bind. A 2 X 150 ml gradient of 0.1 - 1.0 M NaCI was then used to develop the column. Fradions (80 drops, about 4 ml, 74 fradions total) were colleded, and 2 μl aliquots assayed to locate the endonuclease IV peak. Endonuclease IV eluted broadly between fractions # 4 - 48 . Fradions. #16 - 40, (roughly 0.3 - 0.6 M NaCI) contained most of the adivity. Significant adivity was also present in the flowthrough fradion, indicating that all of the class II AP endonuclease -like adivity did not bind. Fradions were made roughly 33 % in glycerol and frozen at -20°C. Pools of fradions # 14 - 19, 20 - 25, 26 - 31 , and 32 - 37 were used to demonstrate that this adivity yielded ligatable ends with abasic substrate and a target . Pools of 26 - 31 , and 32 - 37 were concentrated roughly 3-fold and used for heat stability studies resulting in the discovery of the need for a divalent metal for stability.

EXAMPLE 12 Heat Stability of Partially Purified Cloned T. thermophilus Class II

AP endonuclease :

Cloned T. thermophilus class II AP endonuclease from the chromosomal clone [MM294 t7fσ::kan (pCS10)] was partially purified on a Blue Sepharose column. Two class II AP endonuclease -containing fradions were eluted in 1 M NaCI and concentrated and used to demonstrate heat stability. Heat cycling (20 μl) was done in LCR buffer. Fifty cycles were done of heating to 90° (max. rate), holding for 30 sec; cooling to 50° (max. rate); and holding at 50° for 45 sec. An aliquot of the reaction was then diluted 10-fold and assayed in a modified assay buffer containing 50 mM EPPS/ KOH pH 7.6, 80 mM KCI, 1 mM MgCl2, 10 mg/ 1 gelatin, 0.1 mM C0CI2 for 10 min at 50°. In all cases, the degree of cutting of the substrate was essentially equal to or greater than the activity of the control kept on ice, thus demonstrating the T. thermophilus preparation was substantially stable to heat cycling.

EXAMPLE 13 Effect of Divalent Cation on Class II AP endonuclease Activity

The activity of class II AP endonuclease partially purified from T. aquaticus and S. solfataricus by chromatography on Blue Sepharose column was tested in the presence of a variety of cations. The enzyme was diluted with a modified ten-fold concentrated magnesium-free LCR buffer containing one of the following salts at 1 mM: CaCl2, C0CI2, CUSO4, Fe³⁺ citrate, NiSθ4, MgSθ4, MnCl2, ZnSθ4. The presence of 1 mM DTT in addition to the metal, was also tested in the case of T. aquaticus..

In the case of T. aquaticus, most activity was lost in LCR buffer with no added metal. However, nearly complete activity was recovered when cobalt ion was present. Significant activity was also recovered when Fe³+, Ni²⁺, Mg ⁺, Mn²⁺, or Zn²⁺ was present. Ca²⁺ and Cu²⁺ had activities equivalent to or lower than the heated control with no metal. The order of effectiveness of maintaining activity in T. aquaticus was Co²⁺ > Mn²⁺, ~Fe³⁺, ~ Mg²⁺ > Ni²⁺,

In the presence of DTT the protection was diminished, in particular the protection by Fe³⁺ was almost abolished.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: ABBOTT LABORATORIES (ii) TITLE OF INVENTION: PURIFIED THERMOSTABLE ENDONUCLEASE (iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: ABBOTT LABORATORIES

(B) STREET: D-377 AP6D, ONE ABBOTT PARK ROAD

(C) CITY: ABBOTT PARK

(D) STATE: ILLINOIS

(E) COUNTRY: USA

(F) ZIP: 60064-3500

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(vi) PRIOR APPLICATION DATA:

(A) DOCUMENT NUMBER: US 07/869,306

(B) COUNTRY: US

(C) FILING DATE: 16-APR-1992

(vii) PRIOR APPLICATION DATA:

(A) DOCUMENT NUMBER: US 07/860,702

(B) COUNTRY: US

(C) FILING DATE: 31-MAR-1992

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: BRAINARD, THOMAS D

(B) REGISTRATION NUMBER: 32,459

(C) REFERENCE/DOCKET NUMBER: 5145.PC.01

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 708-937-4884

(B) TELEFAX: 708-937-2623

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1108 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 114..926

(xi) SEQUENCE DESCRIPTION: SEQ ID NOil:

TGCGCCTGCC CCAGGAGAGC CTGAAGCGGG CTTCGCCCTC TTCCTGGTGG CCATGGGGGT 60

CTTCATCGTG GCCCAGAACC TAGGCTAAGC GCCCCTGTGG TAGGCTTCGG GGG ATG 116

Met

1

CCG CGC TAC GGG TTC CAC CTT TCC ATC GCC GGG AAA AAG GGC GTG GCC 164 Pro Arg Tyr Gly Phe His Leu Ser lie Ala Gly Lys Lys Gly Val Ala 5 10 15

GGG GCG GTG GAG GAA GCC ACC GCC CTC GGC CTC ACC GCT TTC CAG ATC 212 Gly Ala Val Glu Glu Ala Thr Ala Leu Gly Leu Thr Ala Phe Gin lie 20 25 30

TTC GCC AAA AGC CCG CGG AGC TGG CGC CCA AGG GCC CTC TCC CCG GCC 260 Phe Ala Lys Ser Pro Arg Ser Trp Arg Pro Arg Ala Leu Ser Pro Ala 35 40 45

GAG GTG GAG GCC TTC CGC GCC TTA AGG GAG GCC TCC GGG GGC CTC CCC 308 Glu Val Glu Ala Phe Arg Ala Leu Arg Glu Ala Ser Gly Gly Leu Pro 50 55 60 65

GCC GTG ATC CAC GCC TCC TAC CTG GTC AAC CTG GGG GCG GAG GGG GAG 356 Ala Val lie His Ala Ser Tyr Leu Val Asn Leu Gly Ala Glu Gly Glu 70 75 80

CTT TGG GAG AAG AGC GTG GCG AGC CTG GCG GAC GAC CTG GAG AAG GCC 404 Leu Trp Glu Lys Ser Val Ala Ser Leu Ala Asp Asp Leu Glu Lys Ala 85 90 95

GCC CTC CTC GGG GTG GAG TAC GTG GTC GTC CAC CCC GGC TCG GGC CGC 452 Ala Leu Leu Gly Val Glu Tyr Val Val Val His Pro Gly Ser Gly Arg 100 105 110

CCC GAG CGG GTC AAG GAA GGG GCC CTC AAG GCC CTG CGC CTC GCC GGC 500 Pro Glu Arg Val Lys Glu Gly Ala Leu Lys Ala Leu Arg Leu Ala Gly 115 120 125

GTC CGC TCC CGC CCC GTC CTC CTC GTG GAG AAC ACC GCT GGG GGT GGG 548 Val Arg Ser Arg Pro Val Leu Leu Val Glu Asn Thr Ala Gly Gly Gly 130 135 140 145 GAG AAG GTG GGG GCG CGG TTT GAG GAG CTC GCC TGG CTC GTG GCG GAC 596 Glu Lys Val Gly Ala Arg Phe Glu Glu Leu Ala Trp Leu Val Ala Asp 150 155 160

ACC CCC CTC CAG GTC TGC CTG GAC ACC TGC CAC GCC TAC GCC GCC GGG 644 Thr Pro Leu Gin Val Cys Leu Asp Thr Cys His Ala Tyr Ala Ala Gly 165 170 175

TAC GAC GTG GCC GAG GAC CCC TTG GGG GTC CTG GAC GCC TTG GAC CGG 692 Tyr Asp Val Ala Glu Asp Pro Leu Gly Val Leu Asp Ala Leu Asp Arg 180 185 190

GCC GTG GGC CTG GAG CGG GTG CCC GTG GTC CAC CTC AAC GAC TCC GTG 740 Ala Val Gly Leu Glu Arg Val Pro Val Val His Leu Asn Asp Ser Val 195 200 205

GGC GGC CTC GGA AGC CGC GTG GAC CAC CAC GCC CAC CTC CTC CAG GGA 788 Gly Gly Leu Gly Ser Arg Val Asp His His Ala His Leu Leu Gin Gly 210 215 220 225

AAG ATC GGG GAG GGG CTC AAG CGC. GTC TTT TTG GAC CCG AGG CTC AAG 836 Lys lie Gly Glu Gly Leu Lys Arg Val Phe Leu Asp Pro Arg Leu Lys 230 235 240

GAC CGG GTC TTC ATC CTG GAA ACC CCC AGG GGA CCG GAG GAG GAC GCC 884 Asp Arg Val Phe lie Leu Glu Thr Pro Arg Gly Pro Glu Glu Asp Ala 245 250 255

TGG AAC CTC CGG GTC TTT AGG GCC TGG CTC GAG GAG GCC TAAGCGCCCC . 933 Trp Asn Leu Arg Val Phe Arg Ala Trp Leu Glu Glu Ala 260 265 270

ACCCTGGCCT TGGGCCGAAG GGGAGGCCCC TAAGTATCCC ACCGCGGCTT TCGCCGCGTG 993

GGGCCCCAAA TTAGCTTCCC AAGCCTTATT CCGCGCACCT CATGCTGCGA AGCCGACGTG 1053

CGGACACTTA GCCCAAAAGG AGGGTGAAGA AGACCCGGCG GGCGAAGGCC AAGAC 1108

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 270 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Pro Arg Tyr Gly Phe His Leu Ser lie Ala Gly Lys Lys Gly Val 1 5 10 15

Ala Gly Ala Val Glu Glu Ala Thr Ala Leu Gly Leu Thr Ala Phe Gin 20 25 30 lie Phe Ala Lys Ser Pro Arg Ser Trp Arg Pro Arg Ala Leu Ser Pro 35 40 45

Ala Glu Val Glu Ala Phe Arg Ala Leu Arg Glu Ala Ser Gly Gly Leu 50 55 60

Pro Ala Val ie His Ala Ser Tyr Leu Val Asn Leu Gly Ala Glu Gly 65 70 75 80

Glu Leu Trp Glu Lys Ser Val Ala Ser Leu Ala Asp Asp Leu Glu Lys 85 90 95

Ala Ala Leu Leu Gly Val Glu Tyr Val Val Val His Pro Gly Ser Gly 100 105 110

Arg Pro Glu Arg Val Lys Glu Gly Ala Leu Lys Ala Leu Arg Leu Ala 115 120 125

Gly Val Arg Ser Arg Pro Val Leu Leu Val Glu Asn Thr Ala Gly Gly 130 135 140

Gly Glu Lys Val Gly Ala Arg Phe Glu Glu Leu Ala Trp Leu Val Ala 145 150 155 160

Asp Thr Pro Leu Gin Val Cys Leu Asp Thr Cys His Ala Tyr Ala Ala 165 170 175

Gly Tyr Asp Val Ala Glu Asp Pro Leu Gly Val Leu Asp Ala Leu Asp 180 185 190

Arg Ala Val Gly Leu Glu Arg Val Pro Val Val His Leu Asn Asp Ser 195 200 205

Val Gly Gly Leu Gly Ser Arg Val Asp His His Ala His Leu Leu Gin 210 215 220

Gly Lys lie Gly Glu Gly Leu Lys Arg Val Phe Leu Asp Pro Arg Leu 225 230 235 240

Lys Asp Arg Val Phe lie Leu Glu Thr Pro Arg Gly Pro Glu Glu Asp 245 250 255

Ala Trp Asn Leu Arg Val Phe Arg Ala Trp Leu Glu Glu Ala 260 265 270

Claims

What is claimed is:

1. A recombinant DNA sequence that encodes a class II AP endonuclease having substantially no exonuclease activity and which retains adivity when subjeded to elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids.

2. The recombinant DNA sequence of Claim 1 , wherein the elevated temperatures are from 70 ^*C to 105 ^*C.

3. The recombinant DNA sequence of Claim 1 which is essentially homologous to the endonuclease IV of E. coli.

4. The recombinant DNA sequence of Claim 1 shown in Figure 1A.

5. The recombinant DNA sequence of Claim 1 which encodes the protein sequence shown in Figure 1 B.

6. The recombinant DNA sequence of Claim 1 which is isolated and purified from a thermophilic bacteria.

7. The recombinant DNA sequence of Claim 1 which is isolated and purified from Thermus thermophilus, Thermus aquaticus, or Sulfolobus solfataricus.

8. A recombinant DNA vedor that comprises the DNA sequence of Claim 1 operably-linked to control sequences and that can be used to drive efficient expression of endonuclease IV activity in a host cell transformed with the vector.

9. The recombinant vector of Claim 8 that is seleded from the group consisting of plasmid pTT1 , plasmid pTT2, plasmid pTT3, plasmid pTT4, plasmid pTT5, plasmid pTT8, plasmid pTT7, plasmid pTT9 and plasmid pTT10.

10. A recombinant DNA vector that comprises the DNA of Claim 4 and can be used to drive expression of a protein that has class II AP endonuclease adivity in a host cell transformed with the vedor.

11. The recombinant vector of Claim 9 that is plasmid pTT3.

12. The recombinant vector of Claim 9 that is plasmid pTT7.

13. A host cell transformed with the vector of Claim 8.

14. The host cell of claim 13 that is E. coli transformed with plasmid pTT3.

15. The host cell of claim 13 that is E. coli transformed with plasmid pTT7.

16. A substantially purified and isolated class II AP endonuclease which retains activity when subjected to elevated temperatures for the time necessary to effect denaturation of double-stranded nucleic acids.

17. The class II AP endonuclease of Claim 16 which is isolated and purified from a thermophilic bacteria.

18. The class II AP endonucleaseof Claim 16 which is isolated and purified from Thermus thermophilus, Thermus aquaticus, or Sulfolobussolfataricus.

19. The class II AP endonuclease of Claim 16 which is isolated and purified from the host cell of Claim 13.

20. The class II AP endonuclease of Claim 16 wherein the elevated temperatures are from about 70° to 105^*C.

21. The class II AP endonuclease of Claim 16 which is further stabilized at elevated temperatures by the presence of divalent cations.

22. The class II AP endonuclease of Claim 16 wherein the divalent cation is manganese or cobalt.

23. The purified and isolated class II AP endonuclease of Claim 16 which is substantially free of exonuclease activity.

24. A stable enzyme composition comprising a substantially purified, thermostable class II AP endonuclease in a buffer of about pH 5 to about pH 8.5 containing one or more divalent cations.

25. The stable enzyme composition of Claim 24 wherein the divalent cation is manganese or cobalt.

26. A method for assaying for the presence of class II AP endonuclease adivity, comprising: a) providing a DNA sequence forming a hairpin structure having a double stranded region, said sequence having an abasic site located within said double stranded region and a detectable label on its 3' or 5' end, the portion of said sequence between said abasic site and said 3' or 5' end being sufficiently short that a cleaved end fragment can be distinguished from the uncleaved sequence; b) incubating said DNA sequence with a medium suspected of containing class II AP endonuclease activity for a predetermined amount of time; and c) measuring the amount of label associated with said cleaved 3' or 5' fragment.

27. A method for assaying for the presence of endonuclease IV adivity, comprising: a) providing a DNA sequence forming a hairpin strudure having a double stranded region, said sequence having an abasic site located within said double stranded region; b) incubating said DNA sequence with a medium suspeded of containing class II AP endonuclease activity for a predetermined amount of time; and c) measuring the amount of cleaved or uncleaved hairpin structure.