WO1993002215A1

WO1993002215A1 - Quantitative nucleic acid amplification

Info

Publication number: WO1993002215A1
Application number: PCT/GB1992/001355
Authority: WO
Inventors: Paul Griffiths; Vincent Emery; Jayne Fox
Original assignee: Royal Free Hospital School Of Medicine
Priority date: 1991-07-24
Filing date: 1992-07-23
Publication date: 1993-02-04
Also published as: GB9116042D0

Abstract

The invention provides a method to determine the amount of a target nucleic acid in a sample which comprises (i) mixing the sample with a predetermined amount of a control nucleic acid, the control nucleic acid having a control region which includes at least one primer binding region homologous to a primer binding region in a selected region of the target nucleic acid; (ii) bringing the mixture formed in (i) into contact with at least one nucleic acid primer capable of binding to the primer binding region of the target and control nucleic acids; (iii) performing a nucleic acid amplification reaction, said reaction requiring the presence of the primer to amplify the selected region of the target nucleic acid and the control region of the control nucleic acid; (iv) determining the relative quantities of the amplified control region and selected region nucleic acids; and (v) calculating from the determination of (iv) the amount of target nucleic acid in the sample. The method can be used for the quantitation of a PCR, e.g. using a control nucleic acid which has a centrally located unique restriction site not present in the target nucleic acid. Target nucleic acids may include viral genomes of e.g. CMV.

Description

QUANTITATIVE NUCLEIC ACID AMPLIFICATION

The polymerase chain reaction (PCR) has established itself as a powerful method to amplify any specific DNA and RNA sequences of interest (Saiki et al 1988, Science 239,487-491) . The basis of the PCR relies upon unique oligonucleotide primers that span the region of interest and the use of a thermostable DNA polymerase. The reaction sequence of denaturation, primer annealing and polymerisation is repeated over many cycles to produce an amplified product equivalent in size to the region bounded by the oligonucleotide primers. Initially, amplification of target nucleic acid occurs in an exponential fashion but eventually reaches a plateau due to a number of factors e.g. limiting reagents, inefficiency of primer binding in the later cycles etc. However, PCR amplification usually produces some 10⁶ to 10⁸ copies of the original target sequence. The end result of these procedures is that potentially a single molecule of the sequence of interest may be detected in a large excess of non-target nucleic acid. At present, the PCR is essentially a qualitative assay i.e. the presence of the target sequence in the sample will yield an amplified DNA fragment and hence a positive result. In the case of infectious agents, oncogenic products etc. there are diagnostic and prognostic implications of being able to quantify the amount of target sequence present in the particular clinical specimen. Thus, in the case of cyto egalovirus the prognosis of neonates infected with CMV is directly related to the amount of virus present in the urine at the time of presentation. In such situations conventional cell culture and TCID₅₀ determinations are of great benefit and cannot be replaced by existing qualitative PCR technology.

One methodology exists to quantify the PCR. This involves end-point dilution of the sample with multiple replicas at each dilution followed by PCR of each individual replica. By using the mathematical formulae developed by Poisson the amount of target nucleic acid in the original sampl-. can be calculated. Such a method is time-consuming and expensive to perform and is unlikely to allow a large throughput of samples such as that required in a diagnostic laboratory.

More recently, other nucleic acid amplification systems have been developed, including the nucleic acid sequence based amplification (NASBA) technique and the ligase chain reaction (LCR) technique. As with PCR, these also provide qualitative results and can be difficult to quantify. The NASBA technique (Compton J (1991) ature 350 91-92) uses a primer which incorporates an RNA polymerase promoter, eg. the T7 promoter. The primer also includes a specific target sequence. This allows production of a region of target DNA which has, at its 5' end an RNA polymerase binding site. This allows production of specific RNA transcripts of the target region. Because single stranded RNA is produced, the reaction requires no successive rounds of heating and may be performed at 37°C. LCR involves the use of two pairs of primers (Engleberg N.C. (1991) American Society of Microbiology News 52,183-186). A first pair of primers, X and Y, are designed to bind to adjacent regions of a target nucleic acid. Complementary primers, X' and Y' bind to the complement to the target nucleic acid. To determine whether a target nucleic acid is present in a sample, the primers X, X*^*, Y, Y' are added to the sample under conditions in which they will bind to their target sequences. Binding to their sequences will bring each member of the pairs of XY and X'Y' into direct apposition to one another which allows them to be linked by DNA ligase, thus forming a template of further hybridization and ligation of other nucleotides. Each member of the pair may be labelled with different labels, thus allowing the presence of reacted products to be identified by the presence of a single molecule carrying both types of labels.

The present invention provides a rapid, simple methodology that allows nucleic acid amplification systems such as PCR, NASBA or LCR to be quantified. This is achieved by the use of a predetermined amount of a control nucleic acid which is introduced into a sample containing an unknown amount of a nucleic acid which is to be analysed - A - by nucleic acid amplification. A nucleic acid amplification reaction can be used to amplify part, or in some cases all, of the target nucleic acid. The region of the target nucleic acid which is to be amplified is referred to below as the selected region. Likewise, the control nucleic acid can be chosen so that either all or part of the control nucleic acid will be amplified. That part of the control nucleic acid which is amplified is referred to below as the control region. The control nucleic acid is chosen so that it will undergo amplification at a substantially identical rate to that of the nucleic acid in the sample which is to be analysed. Following amplification, measurement of the amount of amplified control region relative to the amount of amplified selected region from the sample will allow the quantity of nucleic acid originally present in the sample to be determined.

Thus for example the method may be used to detect and quantitate the number of viral genomes present in a sample. In such a case, the viral genomes represent the target nucleic acid. However, not all of the genome will normally be amplified in a nucleic acid amplification reaction. Instead, those of skill in the art will select a region of the target genome for amplification. This selected region only will be amplified. Similarly, the control region may be a nucleic acid fragment, a cloned fragment carried by a plas id or even an entire viral genome which is an altered version of the target nucleic acid. Whatever the nature of the control nucleic acid, it will carry a control region.

Thus, the present invention provides a method to determine the amount of a target nucleic acid in a sample which comprises

(i) mixing the sample with a predetermined amount of a control nucleic acid, the control nucleic acid having a control region which includes at least one primer binding region homologous to a primer binding region in a selected region of the target nucleic acid;

(ii) bringing the mixture formed in (i) into contact with at least one nucleic acid pr± er capable of binding to the primer binding region of the target and control nucleic acids;

(iii) performing a nucleic acid amplification reaction, said reaction requiring the presence of the primer to amplify the selected region of the target nucleic acid and the control region of the control nucleic acid; (iv) determining the relative quantities of the amplified control region and selected region nucleic acids; and

(v) calculating from the determination of (iv) the amount of target nucleic acid in the sample. The primer binding region of the selected region will be a short stretch of nucleic acid suitable for a primer of a corresponding (i.e. same) length used in nucleic acid amplification reactions to bind to a sufficient degree suitable for the nucleic acid amplification reaction to proceed. Typically, the primer binding region will be from 10 to 40, eg. from 12 to 30 and preferably from 15 to 25 nucleotides in length. The homologous region in the control nucleic acid will preferably be 100% homologous. This will ensure that the amplification of the control and selected regions will be performed with equal efficiency. However, small differences which do not affect primer binding to any significant degree would still allow the invention to be performed and such differences are included within the present invention. Typically, this would allow a difference of up to 10% between the primer binding regions of the control region and selected region.

A preferred embodiment of the invention is an amplification using the polymerase chain reaction. In such a reaction, the control nucleic acid will comprise a control region substantially homologous to the selected region of the target nucleic acid, the control region differing by a sufficient degree to allow resolution of the amplified selected and control nucleic acids. Further, the PCR will require a pair of oligonucleotide primers suitable for performing a PCR on both the selected region of the target nucleic acid and the control region of the control nucleic acid. The pair of primers will comprise a first primer which will bind to a primer binding region in accordance with the invention. The second primer and its primer binding region will also have the properties described above in connection with the first primer. It is not necessary for the two primers in a pair to be of the same size or same degree of homology to their respective binding regions.

Preferably, the PCR amplified selected and control nucleic acids are resolved by electrophoresis though other methods, eg. other types of size-fractionation may be used if appropriate.

Following resolution of the amplified and control nucleic acids, the relative amounts of these nucleic acids may be measured by any means known per se. Preferably, the amplified nucleic acids will contain a radiolabel or fluorescent label which can be measured by, for example, autoradiography followed by scanning densitometry or laser detection of the amplified products. The radiolabel may be present in the primers, or incorporated in the nucleotides incorporated in nucleic acid synthesis during amplification reaction.

When the amplification reaction is PCR, a particularly preferred embodiment of the invention involves the use of a control nucleic acid which differs from the selected region of the target nucleic acid by the presence of at least one predetermined restriction enzyme recognition sequence. Such a control region can be generated using a copy of the original target sequence which is altered by site directed mutagenesis or by using oligonucleotide primers complimentary to the target sequence at all residues except those which need changing to construct the desired restriction site. Following the PCR of-the selected and control regions, the reaction mixture (or a portion thereof) is brought into contact with a restriction enzyme capable of cutting the predetermined restriction site or sites. In this way, the uncut amplified selected region can be resolved, eg. by electrophoresis, from the two or more fragments of the cut amplified control region.

Preferably, besides the presence of the said at least one restriction site, the control region will be identical to the original selected region of the target DNA. This will ensure that during the PCR, the control and selected nucleic acids will be amplified to the same degree since other variables, eg. the priming sites and the sequence composition will be substantially unaltered. In this way, when the relative proportions of amplified control and selected nucleic acids are measured, the amount of original target nucleic acid can be determined since the quantity of control nucleic acid originally provided is known.

It is preferred that the predetermined restriction site in the control nucleic acid is a unique restriction site to the control region, i.e. only two fragments of DNA will be produced upon digestion of the control fragment. Desirably, the predetermined restriction site is centrally located in order that the two fragments produced by digestion are of the same or of a similar size, eg. within 15, preferably 5, nucleotides in length of each other. This will mean that the two fragments produced will appear as a single band on a gel following electrophoresis. Measurement of the band will provide a determination of the total amount of amplified control DNA. Other configurations of restriction sites are also possible. For example, the control DNA may contain, for example, 2, 3, 4 or more restriction sites which can be cut following PCR. These multiple restriction sites may be recognition sites for the same enzyme or for two or more different enzymes. They may be located in a manner such that digestion with the appropriate enzymes produces fragments of a substantially similar size or of different sizes. Such configurations could be used to provide an internal control for the efficiency of the restriction digest or to provide fragments of a convenient size for resolution. For example, a restriction site unique to the selected region of the target nucleic acid which, when cut, will divide the selected region into two unequal fragments could be eliminated from a substantially homologous control region and the same restriction site introduced at a central location in the said control region. Following PCR and digestion with an enzyme capable of cutting this centrally located site in the control region followed by resolution by electrophoresis, three different size fragment will be seen. The smallest and largest will correspond to DNA from the selected region and the middle fragment will be digested control region. The amount of DNA in all three fragments may be measured and the amount of target DNA quantified. If for any reason the restriction digest is incomplete, a further amplified fragment will be seen, corresponding to a mixture of control and selected DNA. However, this will not affect the quantitation of target nucleic acid, which can be determined simply by the ratio of digested fragments.

A further method of controlling the digest is to add to the sample, prior to digesting, a further DNA fragment containing a restriction site for the restriction enzyme which is to be used for digesting of the target DNA which is of a size such that it will not, either as a complete fragment or following digesting, be superimposed over digested or undigested control or selected nucleic acid in the resolution step of the invention. This can be used to monitor the efficiency of the digest. The ratio of undigested to digested further DNA can be used to correct for any incomplete restriction digests. Although the embodiments of the invention discussed above envisage that the control region will be altered to introduce a predetermined restriction site, the invention also includes altering the control DNA to eliminate a restriction site, should a convenient restriction site occur in the selected region of the target nucleic acid. Where a suitable restriction site occurs in the natural target nucleic acid, primers equidistant from this site can be selected in order that the predetermined restriction site is centrally located in the selected region. The control nucleic acid containing the control region may be any suitable nucleic acid, eg. a single or double stranded fragment or contained within a plasmid vector.

For the analysis and quanti ication of any target nucleic acid sequence, the predetermined amount of control sequence added is preferably an amount within a factor of 10³-fold of the amount of target nucleic acid suspected to be contained within the sample. Using a range of concentrations of target DNA (from 1 genome equivalent to 10⁹ genome equivalents) we have determined that the dynamic range of the method of the present invention is approximately 10⁷, i.e. the signal obtained from the addition of 1,000 molecules of the control sequence can be used to quantitate from 10 molecules to 10⁸ molecules of target DNA. Therefore, in a typical reaction it is likely that between 100 and 10⁵ molecules of control sequence, eg. 1,000, will be used although those of skill in the art will appreciate that this may vary, depending, for example, on the concentration of nucleic acid in the sample being analysed. In order to achieve a more accurate result, a series of reactions each using a different amount of control sequence may be performed and the results compared.

In a further embodiment of the invention, the control region and selected region may differ in length, eg. by the insertion of an additional sequence of DNA into the control nucleic acid not normally associated with the selected region of the target nucleic acid. If this embodiment of the invention is used, it is desirable that the difference in length between the control and selected nucleic acids is such that they may be resolved, eg. by electrophoresis but the difference is not significant enough to affect the relative efficiency of PCR on the two different DNA's. Typically, a difference of from 10 to 40, eg. 20, nucleotides between control and selected regions in a size range from 100 to 200 nucleotides will be suitable to achieve sufficient resolution.

Although the above paragraph envisages insertion of additional sequence into the control nucleic acid, it is equally possible to delete a region of the control nucleic acid in order to achieve a difference in length between the control region and selected region.

In a further embodiment of the invention, the amplified selected and control nucleic acids can be resolved by use of oligonucleotide probes which are specific for one or the other, but not both, products. If for example the control nucleic acid is made via the use of site directed mutagenesis with an oligonucleotide primer then this primer will be specific for the amplified control nucleic acid but will not, under conditions of high stringency, hybridise to the selected region of the target nucleic acid. A second probe specific for the selected region could be used to quantify the amount of amplified selected nucleic acid present. Alternatively, a first probe specific for the selected or controlled nucleic acid could be used to determine the quantity of one or other of these products and then a second probe specific to both products used on the same sample to measure the total amount of nucleic acid produced. The difference between the measurement with the first probe and measurement with the probe common to both products will provide an indication of the amount of whichever of the selected and control products was not measured in the first measurement. In a further embodiment, where the difference between the control and selected regions is small, a single oligonucleotide probe encompassing the region of difference and 100% homologous to one or other of the regions could be used. At low stringency, the probe will hybridise to both the control and selected regions although at high stringency it will only hybridise to a region of 100% homology.

When amplification by PCR is used, the control region and selected region of the control nucleic acid and target^"nucleic acid will be substantially homologous. In general, this will mean that besides the differences mentioned above which allow resolution of the amplified selected and control nucleic acids, there will be no other differences between the sequences. This will ensure equal efficiency of the reaction on both control and selected regions. However, minor alterations to the sequences may be possible without detriment to the present invention. Thus, excluding the differences between the control and selected regions introduced for resolution, the remaining nucleic acid will preferably be at least 85%, eg. at least 90% homologous.

The present invention may also be used with other amplification reactions, eg. NASBA and LCR.

When NASBA is used, the primer capable of binding to the primer binding region will additionally include an RNA polymerase promoter, eg. the T3 or T7 promoter. This is used in conjunction with a second primer to produce a short stretch of DNA which is used as template to make RNA. As with the PCR, the control region is preferably substantially homologous in order to ensure equal efficiency of transcription of both the selected and control regions. The control and selected regions may differ in the same way as the control and selected regions used in PCR amplification described above. These differences include, for example: (a) A change of a small number, eg. from 1 to

15 nucleic acids within the transcribed regions. This is comparable to the changes used in PCR amplification when it is desired to introduce a restriction enzyme recognition site. Obviously, it is not necessary to introduce a sequence which forms such a site since it will not normally be possible to analyse RNA by this digestion method. Instead, these differences can be used to differentiate the control and selected regions via the use of suitable oligonucleotide primers, as discussed above in connection with PCR;

(b) The length of the control region may be altered to be different from that of the selected region. This may be achieved by insertion of additional sequence into the control region (or alternatively by deletion) .

The sequence may be introduced between the primer binding regions which are required to produce a DNA template. Alternatively, if the control region contains inserted nucleic acid which is not present in the selected region, part of this inserted nucleic acid may be used as a second primer binding site in the production of a DNA template. That is, the amplification reaction will be performed using the sample to be analysed, the control nucleic acid, a first primer which will bind to both the target and control nucleic acids, and second and third primers which are specific for the selected and control nucleic acids respectively.

If amplification by LCR is required, the invention may be performed using a control nucleic acid which contains a control region (X) which is homologous to a primer binding region of the selected region. This region is immediately adjacent to a second primer binding region (Yl) . The selected region of the target nucleic acid contains a second primer binding region (Y2) which differs from Yl. Yl and Y2 will differ for example in either length or sequence composition and this difference will allow the amplification of the control and selected regions to be measured. As described above with PCR, the relative amounts of Yl and Y2 may be detected using oligonucleotide probes specific for these regions. The primers X, Yl and Y2 may be labelled if desired. As described above, the primer X may be labelled with a label which is different from a label used on the primers Yl and Y2.

The target nucleic acid may be DNA. This includes viral DNA such as DNA from genome of human cytomegalovirus (CMV) or a species of human papilloma virus (HPV), eg. HPV6, HPV16 or HPV18, or hepatitis B virus (HBV) or HIV proviral DNA.

The nucleic acid which may be analysed also includes RNA. When RNA is being analysed by PCR, an initial reaction using a first primer and reverse transcriptase is required. The efficiency of reverse transcription can vary very significantly depending upon reaction conditions. Therefore, when the target nucleic acid is RNA, it is preferred that the control nucleic acid is also RNA. Such control RNA can be generated using a control DNA sequence cloned into an RNA transcription vector which generates an RNA species using a suitable RNA polymerase in conjunction with a suitable promoter, eg a T3 or T7 promoter. The control RNA generated can be quantified using standard spectrophotometric assays. The advantage of such a system is that the efficiency of both the reverse transcription and PCR steps are controlled for.

RNA which may be analysed includes viral RNA, eg. from the genome of HIVl, HIV2, or hepatitis C virus (HCV) . Other RNA which may be analysed includes messenger RNA (mRNA) , eg. that produced in a cell by an oncogene.

The following figures illustrate the invention.

Figure l

This illustrates schematically an embodiment of the present invention showing amplification with primers PI and P2 of a target and control DNA, the control DNA differing only from the target DNA by a restriction site indicated with an asterisk. FIGURE 2 Representative densitometric analysis of a nucleic acid sample containing an unknown amount of target CMV DNA. The relative proportion of signal in the target versus control sequence (1,000 copies) is used to calculate the quantity of target DNA. present in the original sample- In this case the ratio is 43.5:56.5 which equates to 770 copies of the target sequence.

FIGURE 3

Correlation of the percentage of signal due to the target - DNA with the logarithm of the copies of target DNA. In this analysis 1,000 copies of the control sequence were added and varying quantities of the target sequence from 10° to 10⁹ genome equivalents. The response of the system is effectively linear over this range (r=0.93). FIGURE 4

Shows primer sequences and the construction of control sequences used in an experiment performed in accordance with the invention.

FIGURES 5 & 6

Show the determination of CMV in two immunocompromised patients. In figure 6 the patient was prescribed ganciclovir from the 12th day of monitoring.

The following Examples illustrate the invention.

EXAMPLE 1

A unique 149 bp length of the glycoprotein B (gB) coding sequence of cytomegalovirus was selected as a suitable target for PCR amplification. The principle behind our method of quantification required the construction of a control target sequence, identical to the 149 bp gB sequence found in human CMV in all but one distinguishing aspect, and the use of this altered sequence as an internal control from which the efficiency of amplification could be gauged. The primer sequences, construction of the control sequence etc. are described diagrammatically in Figure 4. In essence the difference between the control sequence and the CMV gB sequence is a simple 2bp change at bases 77 and 78. This change resulted in a sequence unique restriction site for Hpal. The construction of this control sequence was performed as follows; two overlapping primers coding for opposite strands of the central 23 bases of the gB sequence were synthesised. These primers carried the two base changes need to code for a Hpal restriction site. PCRs were then carried out using 1) primers gBl and gB3 and 2) primers gB2 and gB4 (see figure 4) . The resultant 75 bp products of these PCRs were extracted once with buffered phenol and combined. This PCR product mixture was heated to 95°C for 10 minutes then cooled to room temperature over a 30 minute period. The possible products of this procedure are shown in figure 4 step b. To the mixture of reannealed species was added lOx Klenow polymerase buffer, 2mM dNTPs and Klenow polymerase. Since Klenow polymerase works only in a 5' to 3' direction only species 1 and not species 2 became completely double-stranded during the 30 minutes incubation at room temperature, to which this reaction cocktail was exposed. A lμl aliquot from this reaction was subsequently used as the target for a PCR which employed primers gBl and gB2. After 35 cycles the PCR product was purified from a 1.2% low melting point agarose gel, cloned into the vector pUC13, used to transform and amplified in competent E. coli. The crude vector isolated from this bacterium was finally purified by CsCl isopycnic centrifugation. The preceedings steps were all performed using standard molecular biological techniques (Sambrook et al, 1989) .

The original 149bp sequence from which the control DNA was synthesized was initially PCR amplified from the Hindlll F fragment of the Adl69 strain of CMV. This sequence was also cloned into pUC13, amplified and purified as described above. PCRs were performed as described previously (Fox et al, 1991) . The primers gBl and gB2 used in these reactions were however end labelled with ³²P ATP (Sambrook et al. 1989) , to allow subsequent detection of the amplified products. For purposes of quantification each PCR included, in addition to standard target DNA cloned into pUC13, 1000 copies of the control sequence containing plasmid. A range of concentrations of standard target DNA were used in the initial experiments carried out in order to investigate the sensitivity of the technique. This range spanned 10⁹ to 1 copy of standard target. After amplification the PCR products were phenol extracted and ethanol precipitated prior to digestion with the enzyme Hpal for 1 hour at 37°C. The digested products were then separated using polyacrylamide gel electrophoresis on a 20% gel run at 40mA using lx TBE buffer. The gels were then carefully removed from the apparatus, wrapped in clingfilm and exposed to Hyperfilm-MP (Trade Mark, Amersham) overnight at -70°C. Since only the product of control sequence amplification was susceptible to digestion with Hpal, when the films were developed, the further migrated of the two bands visible represented the product of the Hpal site containing sequence only. The slower band represented the 149bp uncut product of the target DNA amplification. If the amplification procedure was not influenced by the presence of the restriction site in the 1000 copies of control target DNA, then the products of the reactions should be a true reflection of the amount of either type of target DNA initially present. This was indeed shown to be true when the relative intensities of the two bands visible on the exposed films were measured by scanning densitometry (Gelman Sciences Inc.), an example of which is shown in Figure 2. This was carried out for each of the PCRs containing 10⁹ to 1 copy of non restriction site containing target. The relative intensities of the two bands changed as did the ratio of control to target DNA. A graphical representation of the pooled data obtained from 2 experiments is shown in Figure 3. From this figure it can be seen that the range over which quantitative data can be obtained, when a given PCR includes 1000 copies of the control DNA, spans 10 to 10⁷ copies of non-control target sequence in this particular example. By additionally performing PCRs at the upper and lower ends of the target range with 10² or 10⁴ copies of control sequence DNA it should be possible to extend the sensitivity range of this system, if this is required.

References.

1, Fox, J.C., Ait-Khaled, M. , Webster, A. and Emery, V.C. (1991) Eliminating PCR contamination: is UV irradiation the answer ? Journal of Virological Methods (in press) .

2. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning; A laboratory manual, 2nd edition. Cold Spring Harbour Laboratory Press. EXAMPLE 2

Application of quantitative CMV PCR to assess urine from congenitally infected neonates.

The present invention was used to screen two urine samples derived from neonates that were congenitally infected with CMV. The urine (2μl) was analysed directly by PCR as previously described except that a 94"C incubation for 10 minutes prior to the first PCR cycle was used. The same urine samples were analysed by the conventional TCID₅₀ assay and the results of the two assays compared. The data obtained are shown in the table below.

Two conclusions can be drawn:

1) There is an approximately 1000:1 ratio between the number of CMV genome equivalents in urine and the number of infectious units determined by TCID₅₀ titration in human embryo lung fibroblast cells. 2) The sensitivity of the quantitative PCR assay is approximately 1000 times more sensitive at providing quantitative information than the currently available assays.

Since the prognosis of neonates congenitally infected with CMV is known to be related to the amount of CMV excreted i.e. degree of active replication, during the first three months of life, the utility of the present invention to provide prognostic information rapidly (within 2 days) rather than the current 3 weeks is manifest.

EXAMPLE 3

CMV viral load in immxinocomprximisea patients

The assay of the present invention was used in the longitudinal monitoring of immunocompromised patients especially renal transplant recipients. To date 12 patients have ben analysed and the amount of CMV present in the urine correlated with disease attributable to CMV eg. pyrexial debilitating disease, gastrointestinal disease, retinitis or pneumonitis and to the influence of antiviral therapeutic intervention. The sequentially profile of CMV in the urine of two patients are shown in Figures 5 and 6. In Figure 6 the patient was prescribed ganciclovir from day 12. The cumulative results for ^"urine CMV quantification in these 12 patients are shown below.

P = 0.053 Fisher Exact test

Two conclusions can be drawn from these data.

1) In general terms the more CMV that is present in the urine the more likely that the patient has disease.

2) The effectiveness of antiviral therapy against CMV can be assessed using quantitative analysis of CMV in the urine.

EXAMPLE 3

Quantification of Human immunodeficiency virus

The present invention as described for quantification of CMV has been modified to all the quantification of HIV. The oligonucleotide primers chosen for the amplification of a region of the HIV gag gene were as follows: Primer A: 5'GAAGGAGCCACCCCACAAGATT Primer B: 5*^*TAGGTGGATTATTTGTCATCCA and amplified a 220 base pair product. Using the methods described in this invention a control sequence was generated that contained a site for the restriction endonuclease Sma 1 in the central portion of the amplimer. The following primers were used to perform the PCR mutagenesis experiment.

Primer 1: 5'AGAGTACATCCCGGGCATGCAGGG Primer 2: 5'CCCTGCATGCCCGGGATGTACTCT

Following digestion with Sma 1 the control sequence produces fragments of equal sizes. The derived control sequence has been used to quantify known amounts of a molecular clone of HIV (strain BH10) and the data assimilated to produce standard curve relating the percentage product uncut and the log ratio of target over control sequence as shown for CMV in figure 3. The HIV quantitative assay has the same dynamic range as the CMV assay i.e. 100 000, when 1000 copies of the control sequence are added.

Claims

1. A method to determine the amount of a target nucleic acid in a sample which comprises

(ii) bringing the mixture formed in (i) into contact with at least one nucleic acid primer capable of binding to the primer binding region of the target and control nucleic acids;

(iii) performing a nucleic acid amplification reaction, said reaction requiring the presence of the primer to amplify the selected region of the target nucleic acid and the control region of the control nucleic acid?

(iv) determining the relative quantities of the amplified control region and selected region nucleic acids; and

(v) calculating from the determination of (iv) the amount of target nucleic acid in the sample.

2. A method according to claim 1 wherein

(a) the control nucleic acid comprises a control region substantially homologous to the selected region of the target nucleic acid, the control region differing by a sufficient degree to allow resolution of the amplified selected and control nucleic acids; (b) a pair of oligonucleotide primers suitable for performing a polymerase chain reaction (PCR) on both the selected region of the target nucleic acid and the control region of the control nucleic acid are used; and (c) the amplification reaction is a PCR.

3. A method according to claim 2 wherein the amplified selected and control nucleic acids are resolved by electrophoresis following the amplification reaction.

4. A method according to claim 3 wherein the relative quantities of amplified selected and control nucleic acids are determined by autoradiography to produce an autoradiograph followed by scanning densitometry of the autoradiograph.

5. A method according to any one of claims 2 to 4 wherein the reaction is performed using radiolabelled or fluorescently labelled nucleotides.

6. A method according to any one of claims 2 to 5 wherein the PCR is performed using a radiolabelled primer.

7. A method according to any one of claims 2 to 6 wherein the control region of the control nucleic acid differs from the selected region of the target nucleic acid by the presence of at least one predetermined restriction enzyme recognition sequence (restriction site) in the control region which is not present in the corresponding portion of the selected region, and resolution of the selected and control nucleic acids is achieved by a restriction digest of the predetermined restriction site of the control nucleic acid.

8. A method according to claim 7 wherein the control region contains a unique predetermined restriction site which is centrally located.

9. A process according to claim 7 or 8 wherein the digest is performed in the presence of a further DNA fragment containing at least one said predetermined restriction site to monitor the efficiency of the digest.

10. A process according to claim 1 wherein the nucleic acid amplification is NASBA or a ligase chain reaction.

11. A process according to any one of claims 1 to 10 wherein the target nucleic acid is DNA.

12. A process according to claim 11 wherein the DNA is viral DNA.

13. A process according to claim 12 wherein the viral DNA is the genome of human cytomegalovirus or a species of human papilloma virus.

14. A process according to any one of claims 1 to 10 wherein the target nucleic acid is RNA.

15. A process according to claim 14 where the RNA is viral RNA.

1-6. A process according to claim 15 where the viral RNA is the genome of human immunodeficiency virus 1 or 2.

17. A process according to any one of claims 1 to 6 or 10 to 16 where the control region of the control nucleic acid differs in length from the selected region.

18. A kit for quantifying a PCR of a target nucleic acid comprising

(i) a control nucleic acid comprising a control region substantially homologous to a selected region of the target nucleic acid but which differs by a sufficient degree to allow resolution of the selected region and control region nucleic acids, and

(ii) a pair of oligonucleotide primers suitable for performing a nucleic acid amplification reaction or the control and selected nucleic acid.

19. A kit according to claim 20 where the target nucleic acid is as defined in any one of claims 11 to 16.