WO1992011286A1 - Variantes d'hormone de parathyroide resistantes a l'oxydation - Google Patents

Variantes d'hormone de parathyroide resistantes a l'oxydation Download PDF

Info

Publication number
WO1992011286A1
WO1992011286A1 PCT/CA1991/000451 CA9100451W WO9211286A1 WO 1992011286 A1 WO1992011286 A1 WO 1992011286A1 CA 9100451 W CA9100451 W CA 9100451W WO 9211286 A1 WO9211286 A1 WO 9211286A1
Authority
WO
WIPO (PCT)
Prior art keywords
pth
leu
parathyroid hormone
hormone variant
variant
Prior art date
Application number
PCT/CA1991/000451
Other languages
English (en)
Inventor
Richard P. Bozatto
K. Anne Kronis
Original Assignee
Allelix Biopharmaceuticals Inc.
Glaxo Canada Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Allelix Biopharmaceuticals Inc., Glaxo Canada Inc. filed Critical Allelix Biopharmaceuticals Inc.
Publication of WO1992011286A1 publication Critical patent/WO1992011286A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/635—Parathyroid hormone, i.e. parathormone; Parathyroid hormone-related peptides

Definitions

  • This invention relates to variants of parathyroid hormone, t the production of such variants particularly via recombinant DN technology, and to pharmaceutical compositions containing suc variants.
  • Parathyroid hormone is a protein product of mammalia parathyroid glands that elicits various biological effects. O considerable current interest is the role of PTH as a mediator o the physiologically normal, bone remodelling process. In this regard, PTH acts on osseous tissue to modulate deposition o skeletal calcium, and thus can cause an increase in bone mass. It has been suggested that the administration of PTH, or agonistic analogues thereof, would be useful th ⁇ rapeutically to treat and/or prevent bone-related disorders, such as osteoporosis.
  • PTH exerts a vasorelaxant effect on the cardiovascular system, and may be useful in controlling systemic blood pressure (see for example the article by Tenner et al in Vascular Neuroeffector Mechanisms, 4th International Symposium, Raven Press, 1983, pp289-293) . It has more recently been revealed that PTH is capable also of modulating the growth of keratinocytes, and may be useful therapeutically in the treatment of skin-related disorders such as psoriasis (see 089/03873) .
  • PTH Various forms of PTH, including bovine and human PTH and their analogues, thus hold great promise as therapeutics in the treatment and/or prevention of a number of human disorders. And, current indications are that the supply of PTH in amounts sufficient for its clinical and commercial applications can be met by exploitin recombinant DNA technology for its production. It has bee reported that the bacterial host E. coli, for example, is capabl of expressing DNA coding for human PTH, to produce a bioactive PT product (see Rabbani et al, J. Biol. Chem., 1988, 263(3) :1307) . Production of bioactive PTH in the yeast Saccharomyces cerevisiae has also been.reported (see Gautvik et al, WO88/03165) .
  • PTH is sensitive to oxidation,' to the extent that its biological activity can be eliminated following exposure to certain strong oxidants, especially over time.
  • the oxidative inactivation of PTH can thus be problematical during various stages in its production and purification, can reduce its shelf-life and may reduce half-life and/or bioavailability of the protein in vivo. It would thus be desirable to provide PTH variants having a reduced sensitivity to oxidation.
  • Norleucine- containing analogues of PTH can be produced only by the laboriou route of solution- or solid-phase peptide synthesis.
  • Tha norleucine is not naturally occurring also raises the possibiliti that PTH analogues containing it may stimulate an immune respons following administration.
  • the reduction in bioactivit caused by replacing methionine with norleucine can be undesirabl in a pharmaceutical context, particularly since further reductions in bioactivity are likely to occur during storage, and in vivo. It would accordingly be desirable to provide variants of parathyroi hormone that exhibit both substantial PTH activity and reduced sensitivity to oxidation. It would be particularly desirable to provide an alternative method for preparing PTH variants having such characteristics.
  • variants of parathyroid hormone exhibiting substantial PTH activity and reduced sensitivity to oxidation are obtained by replacing at least one methionine resident in PTH with a genetically encoded amino acid.
  • X and Y is a genetically encoded amino acid other than methionine and cysteine.
  • the parathyroid hormone variants are those in which Y in the above formula is methionine, and X is selected from alanine, valine, leucine, isoleucine, serine and tryptophan.
  • the parathyroid hormone variants are those in which X in the above formula is methionine, and Y is a genetically encoded amino acid other than methionine and cysteine.
  • Y in the above formula is other than methionine and cysteine, and X is selected from alanine, valine, leucine, isoleucine, serine and tryptopha .
  • the present invention provides PTH variants that in addition to having substantial PTH activity and reduced sensitivity to oxidation, are also amenable to production by recombinant DNA techniques. According to another aspect of the present invention, therefore, there is provided a cellular host having incorporated expressibly therein a DNA molecule which codes for a PTH variant of the present invention. In a related aspect of the present invention, there is provided a method for producing a PTH variant having substantial PTH activity
  • SUBSTITUTE SHEET and a reduced sensitivity to oxidation comprising the step o culturing a cellular host in which DNA coding for the PTH varian is expressibly incorporated.
  • the PTH variants of the present invention are suitabl employed as therapeutics. According to another aspect of th present invention, therefore, there is provided a pharmaceutica composition comprising a pharmaceutically acceptable carrier and PTH variant of the present invention.
  • Figure 1 is a map of plasmid pX in which DNA coding for huma PTH is linked operably with DNA enabling expression thereof in E. coli;
  • Figure 2 provides the nucleotide sequence of the human PTH encoding region of the plasmid shown in Figure 1, and also provides for reference the amino acid sequence of human PTH. Methionine residues at positions 8 and 18 are highlighted using boxes;
  • Figure 3 illustrates graphically the relative activities of human PTH and human PTH variants, before oxidation
  • Figure 4 illustrates graphically the relative activities of human PTH and human PTH variants, after oxidation.
  • the present invention relates to PTH variants that exhibit substantial PTH activity and a reduced sensitivity to oxidation.
  • PTH activity is defined in th context of the osetosarco a-based adenylate cyclase assay employe conventionally in the art. Briefly, this assay provides an i vitro determination of the extent to which PTH stimulates adenylate cyclase activity in rat osteosarcoma cells of the DMR' lineage, and thus provides an indication of PTH effects on bone tissue in vivo. Protocols for conducting the assay have been described by Rodan et al, 1983, J. Clin.
  • PTH variants that exhibit, in the UMR-based assay, an EC K , of at least 2,000 nM i.e. 2,000 nM or lower, are herein characterized as having "substantial" PTH activity.
  • the PTH variants of the present invention are also characterized by a sensitivity to oxidation that is reduced, relative to a methionine- containing PTH counterpart.
  • a PTH variant having a "reduced sensitivity to oxidation" will exhibit, following exposure to an oxidant, an activity as measured in the osteosarcoma-based assay which exceeds the activity exhibited by a similarly treated PTH control.
  • An assay suitable for determining sensitivity to oxidation entails a two step procedure, in which the PTH variant is first exposed to oxidizing conditions, for example using hydrogen peroxide as oxidant, and is then assayed for activity in the osteosarcoma-based assay just described.
  • Protocols suitable for assaying oxidation sensitivity are described by O'Riordan et al, 1974, J. Endocrinol., 63:117, and are outlined in the examples herein.
  • Human PTH variants having a reduced sensitivity to oxidation will exhibit in the osteosarcoma-based assay an activity that is at least greater than a similarly treated human PTH control.
  • X and Y is a genetically encoded amin acid other than methionine and cysteine.
  • th numerals identify the location of the amino acids X and Y withi the PTH molecule, relative to the N-terminal amino acid thereof.
  • X and Y are assigned the same positional number when present in the context of N-terminally truncated or extended forms of PTH, such as analogues or fragments of PTH.
  • PTH refers to any genetically encodable form of PTH in which a methionine is resident at one or both of positions 8 and 18.
  • Such forms include, but are not limited to, porcine PTH which has a single methionine resident at position 8, as well as human PTH and bovine PTH, both of which have methionines resident at position 8 and position 18.
  • PTH also embraces rat PTH, which has a methionine residue at positions 8, 21 and 41, and chicken PTH which has a methionine residue at positions 5, 8, 26 and 80.
  • human PTH refers to the mature form of the hormone, which consists of 84 amino acids arranged in the sequence reported by Kimura et al, 1983, Biochem. Biophys. Res. Comm., 114(2):493.
  • the terms "human PTH”, “hPTH” and “hPTH(l-84)" are used interchangeably herein.
  • bovine PTH bovine PTH
  • rat PTH rat PTH
  • porcine PTH refer also to the mature form of the hormone, each of which consists of 84 amino acids arranged in the sequences reported by Keutmann et al in Current Research on Calcium Regulating Hormones, Cooper, C.W. (Ed.) , 1987, University of Texas Press, Austin, pp.57-63.
  • PTH refers unless otherwise stated to the mature form of a given mammalian PTH species, it will be appreciated that the strategy herein described can be applied also to genetically encodable, methionine-containing analogues and fragments of PTH which exhibit PTH activity, in order to generat variants thereof exhibiting reduced sensitivity to oxidation.
  • Th term "PTH analogue” is used herein with reference to methionine containing forms of PTH having an altered amino acid sequence, suc as an amino acid substitution at a non-methionine site.
  • the ter “PTH fragment” is used herein with reference to methionine containing peptides having PTH activity and comprising at least th first 27 amino acids of PTH, and more desirably the first 34 amin acids of PTH.
  • the oxidation sensitivity exhibited by PTH can be reduced by replacing at least one methionine resident in PTH with virtually any genetically encoded amino acid.
  • cysteine is an oxidizable amino acid, and should not be used as a methionine replacement.
  • methionines are resident at two positions, such as human PTH and bovine PTH, it has been found that the amino acid used as a methionine replacement must be carefully selected in order to preserve substantial PTH activity.
  • the site at which replacement is effected also affects both oxidation sensitivity and PTH activity of the resulting variant.
  • Y is a genetically encoded amino acid other than methionine and cysteine.
  • Y is selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and
  • Y is selected from among the group consisting of alanine, valine, leucine and isoleucine.
  • Y is leucine.
  • Specific compounds conforming to the formula [Y 1S ]PTH include human PTH variants such as [Leu”]hPTH, [Ile l ⁇ ]hPTH, [Ala”]hPTH, and [Val l ⁇ ]hPTH, as well as bovine PTH equivalents thereof.
  • X is an amino acid selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and tryptophan. Desirably, X is selected from alanine, valine, leucine and isoleucine. Most suitably, X is selected from valine, leucine and isoleucine. Preferably, X is leucine.
  • Specific compounds conforming to the above formula include human PTH variants, such as [Leu 8 ]hPTH, [Ile 8 ]hPTH and [Val 8 ]hPTH, as well as bovine PTH and porcine PTH equivalents thereof.
  • X and Y are independently selected, Y is a genetically encoded amino acid other than methionine and cysteine, and X is an amino acid selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and tryptophan.
  • X is an amino acid selected from among the group consisting of alanine, valine, leucine, isoleucine, serine and tryptophan.
  • Specific PTH variants conforming to the above formula, i.e., having two-site methionine replacement, include human PTH variants such as [Leu 8 Leu l ⁇ ]hPTH, [Ile 8 Leu 18 ]hPTH, [Val 8 Leu 18 ]hPTH, [Ser 8 Leu 18 ]hPTH, [Ala ⁇ L ⁇ u 18 ]hPTH, [Trp 8 Leu 18 ]hPTH, [Leu 8 Ile 18 ]hPTH, [Leu ⁇ Val 18 ]hPTH and £Ile 8 Ile l8 ]hPTH and bovine PTH equivalents thereof.
  • human PTH variants such as [Leu 8 Leu l ⁇ ]hPTH, [Ile 8 Leu 18 ]hPTH, [Val 8 Leu 18 ]hPTH, [Ser 8 Leu 18 ]hPTH, [Ala ⁇ L ⁇ u 18 ]hPTH, [Trp 8 Leu 18 ]
  • the PTH variants of the present invention are genetically encodable proteins, and may therefore be produced either by chemical synthesis or, more desirably, using recombinant DNA-based production techniques.
  • the solid phase peptide synthesis technique has been successfully applied in the production of human PTH and can be used for the production of the PTH variants of the present invention (for guidance, see Kimura et al, supra, and see Fairwell et al, Biochem., 1983, 22:2691) .
  • Success with producing human PTH on a relatively large scale has been reported by Goud et al in J. Bone Min. Res., 1991, 6(8):781, incorporated herein by reference.
  • This production approach generally entails the use of automated synthesizers and appropriate resin as solid phase, to which is attached the C-terminal amino acid of the desired PTH variant. Extension of the peptide in the N-terminal direction is then achieved by successively coupling a suitably protected form of the next desired amino acid, using either FMOC- or BOC-based chemical protocols typically, until synthesis is complete.
  • SUBSTITUTE SHEET groups are then cleaved from the peptide, usually simultaneousl with cleavage of peptide from the resin, and the peptide is the isolated and purified using conventional techniques. Suc procedures are generally described in numerous publications an reference may be made, for example, to Stewart and Young, Soli Phase Peptide Synthesis. 2nd Edition, 1984, Pierce Chemica Company, Rockford, Illinois.
  • the PTH variants are produced by culturing cellular host in which DNA coding for the desired PTH variant i expressibly incorporated. Incorporation of the desired DNA, i expressible form, can be achieved using the now conventiona recombinant DNA-based approach, wherein DNA coding for the PT variant is linked operably with DNA enabling expression of the PT variant-encoding DNA, to form a recombinant DNA expressio construct which is then introduced into the selected cellular host by DNA-mediated transformation, ⁇ lectroperation or the like.
  • cellular host having DNA coding for a PTH variant incorporated "expressibly” therein is characterized by the ability to yield the desired expression product, when cultured appropriately.
  • a cellular host having DNA coding for a PTH variant incorporated "stably” is able to retain such DNA during culturing, and to transmit such DNA to its progeny through at least several generations.
  • stability is typically conferred by genomic integration of the PTH variant- encoding DNA.
  • bacteria which typically harbour transforming DNA in the form of autonomously replicating plasmids, such stability is usually ensured by culturing a strain carrying plasmid-conferred antibotic resistance in the presence of the antibiotic.
  • DNA coding for a selected PTH variant may be obtained using techniques that are well established in the art.
  • a DNA sequence coding for a given PTH variant may be synthesized d ⁇ novo in accordance wit methods standard in the gene synthesis azrt. Briefly, this entails the successive 3' to 5' coupling of suitably protected nucleotide reagents in an automated synthesizer such as the Applied " Biosystems Inc. model 380B DNA synthesizer, and then the recovery by gel purification of the deprotectedpolynucleotide.
  • the block ligation approach may be employed, whereby "blocks" of oligonucleotide pairs, up to about 80 nucleotides in length, are prepared and ligated in correct succession by overhang complementarity, as described for example by Wosnick et al in Gene, 1989, 76:153.
  • the desired DNA may be synthesized in toto, and then amplified by polymerase chain reaction (PCR), using the approach described by Barnett et al in Nucl. Acids Res., 1990, 18(10):3094.
  • DNA coding for human PTH may be obtained and then used as a template e.g. mutagenized site-specifically, to introduce the desired amino acid change at the genetic level.
  • DNA coding for human PTH may be obtained from an appropriate human cDNA library, from a commercial source or by de novo synthesis according to the procedures outlined above, and in accordance with the PTH-encoding nucleotide sequence reported for example by Hendy et al, Proc. Natl. Acad. Sci. USA, 1981, 78:7365, incorporated herein by reference, or a PTH-encoding equivalent thereof.
  • the PTH-encoding DNA template may be converted to DNA coding for a PTH variant using the well established oligonucleotide-directed mutagenesis technique, as generally described for example by Kunkel et al, 1985, Proc. Natl. Acad. Sci. USA, 82:488. This technique is conveniently accomplished with high efficiency using the E. coli- based system for synthesis and propogation of the altered gene in an appropriate vector, such as M13mpl8. Kits useful for performing such procedures in vitro are available commercially. Also suitable for obtaining PTH variant-encoding DNA from a PTH-encoding template is the related, technique in which site-directed mutagenesis is achieved using a PCR-based approach.
  • recombinant PCR is described by Higuchi et al, Nucl. Acids. Res., 1988, 16:7351, and a modified “megaprimer” PCR approach is described in Biotechniques, 1990, 8(1):404.
  • DNA coding for the desired PTH variant is incorporated stably and expressibly into a cellular host selected to serve in production of the PTH variant.
  • a variety of organisms are suitable as hosts for production of the PTH variants. These include eukaryotic hosts including yeasts such as Saccharomyces, Pichia and Kluveromyces, filamentous fungus hosts including Aspergillus species such as nidulans, niger (or awamori) and oryzae, insect cell hosts, and mammalian cell hosts including the CHO and COS cell lines.
  • the PTH variants are not dependent on glycosylation for activity, and thus can suitably be produced in bacterial hosts including Streptomyces , Bacillus and, preferably, in E.
  • E. coli production of PTH variants may be achieved, for example, using expression systems based on the lac promoter (see Rabbani et al, Biochem., 1990, 29:10080) and expression/secretion systems based on the tac promoter (see Wong et al, EP 357,391) .
  • Yeast expression may be achieved using expression systems based for example on the expression controlling regions of the alpha-1 mating factor gene as described by Gautvik et al in WO88/03165.
  • Production in Aspergillus may be achieved using secretion systems based on expression controlling regions of the A. nidulans alcA gene or the A. niger glucoamylase gene, as described for example by Gwynne et al in WO86/06097.
  • the PTH variant produced upon culturing of the production host is extracted and purified using techniques that are also
  • the human PTH variants hav characteristics that are similar generically to those exhibited b human PTH, and may therefore be extracted and purified i substantially the same manner.
  • the variants have a ne positive charge at neutral pH (pi of about 9.3) and can be purifie therefore by ion exchange chromatography, e.g. using cation exchange columns.
  • the PTH variants are also, like PTH, hydrophobic in nature, and may therefore be purified by hydrophobic interaction chromatography e.g. on columns having a phenyl-Sepharose matrix.
  • molecular sieves may be used to separate PTH variants from other proteins unrelated by size, and affinity columns may be employed which comprise PTH affinity agents such as hydroxyapatite or PTH antibody.
  • purification of the PTH variant is achieved by applying the protein mixture to a cation exchange column e.g. S-Sepharose, and then applying the eluted retentate to a column having a hydrophobic matrix e.g. a column having a phenyl, octyl or butyl side chain such as phenyl- Sepharose, phenyl-Superose, octyl-Sepharos ⁇ or butyl 650M.
  • the retentate eluted from the hydrophobic matrix is then subjected to final purification using reversed phase high performance liquid chromatography ( ⁇ PLC) .
  • ⁇ PLC reversed phase high performance liquid chromatography
  • purification of the PTH variants of the invention requires less stringent control during purification and handling.
  • anti-oxidants are not required during purification of human PTH variants in which both Met 8 and Met 18 are replaced, but may be employed if desired.
  • a PTH variant is desirably purified to the extent that it migrates as a single peak on reversed phase HPLC, and exhibits a single band on polyacrylamide gel
  • the PT variant may be formulated to provide pharmaceutical composition suitable for treating the various clinical ' conditions for which PT replacement therapy is indicated.
  • Compositions containing PT variant may, for example, be delivered systemically to treat bon disorders such as osteoporosis and cardiovascular conditions, an for these purposes are suitably formulated either as injectables o ingestibles or for nasal insufflation.
  • Sterile injectabl compositions are preferred, and will generally comprise a effective dose of the PTH variant, in admixutre with normal salin and suitable solubilizing agent e.g. dilute acetic acid.
  • the PT variant may alternatively be applied topically, as a cream, lotion, ointment or as an aerosol, to treat psoriasis and related ski disorders.
  • a suitable cream will comprise an effective dose of th PTH variant, in combination with carriers of standard compositio e.g. in a triglyceride base.
  • the dose of PTH variant effective to treat a given clinical condition will depend of course on the nature and severity of the condition, and on such other factors as are normally considered and evaluated in clinical trials and by the attending physician.
  • the PTH variant is administred in amounts large enough to stimulate bone remodelling, but not so large as to cause net bone resorption or sustained increase in serum calcium levels.
  • the dose of PTH variant required to elicit a similar effect can be calculated based on the relative activity of the PTH variant.
  • [Leu 18 ]hPTH(1-84) , [Leu 8 ]hPTH(1-84) and hPTH(l-84) are substantially equipotent, and effective doses of these PTH variants are thus similar to those of hPTH. It is expected that the greater oxidative stability of the PTH variants will provide for extended in vivo half-life, and thus somewhat smaller doses may be used or simular doses may be administered less frequently.
  • the PTH variants may be administered in combinatio with other agents useful in treating a given clinical condition.
  • the PTH variants may be administered in conjunction with a dietary calcium supplement or with a vitamin D analogue (see US 4,698,328).
  • the PTH variant may be administered, preferably using a cyclic therapeutic regimen, in combination with bisphosphonates,as described for example in US 4,761,406, or in combination with one or more bone therapeutic agents such as calcitonin and estrogen.
  • the excretion cassette is human PTH- encoding DNA that was synthesized using the block ligation technique reported by Wosnick et al, supra, and in accordance with the PTH-encoding nucleotide sequence reported by Hendy et al, supra.
  • Fused 5' of, and precisely to, the PTH-encoding DNA is the signal sequence of the E. coli ompA gene, which is capable of directing the PTH portion of the expression product across the host inner membrane, and ultimately to the culturing medium.
  • the plasmid operably incorporates the tac promoter, the lac operator and a consensus ribosomal binding site. Transcriptional termination is controlled by the E. coli trpA gene terminator, and translational stop codons
  • SUBSTITUTE SHEET are provided in all three reading frames, immediately 3' of the PTH-encoding DNA.
  • the pX expression vector used for the production of human PTH and PTH variants, is substantially the same as that described by Wong and Sutherland, supra, except that the multiple cloning site downstream of the PTH gene contains cleavage sites for the restriction enzymes Clal, BamHI, Xbal, StuI and PstI, in the order indicated on Figure 1.
  • the precise nucleotide sequence of the PTH-encoding region of the excretion cassette is illustrated in Figure 2.
  • the plasmid pX may thus be contructed by incorporating into pUC18 at any suitable site therein (1) an excretion cassette having the functional components described by Wong et al, supra; (2) the lacl q gene from pMMB22, and (3) the par element excised from pSClOl.
  • Plasmid pX was transformed into competent E. coli JM101 using standard procedures. Positive transformants were indentified following growth overnight at 30°C on plates containing 2YT/agar and 70 ⁇ g/ml ampicillin. PTH-producing transformants were then examined for PTH activity, following growth in shake flasks, by IRMA analysis of conditioned medium, and frozen stocks of the selected transformants were subsequently prepared by mixing an equal volume of the shake flask culture with sterile glycerol to yield 50%(v/v) glycerol stocks. These stocks were subsequently stored at -80°C. When needed, transformants were recovered from the frozen stock by scraping, and were then streaked on ampicillin- containing plates of 2 T/agar.
  • EET ampicillin in the standard mixture. Following overnight growt with shaking at 30°C, the cultures were diluted 20— old with fres medium, and then grown for three hours at 30°C with shaking. Expression of the PTH-encoding DNA was then de-repressed b addition of l.OmM IPTG. After growth for four hours in the presence of IPTG, the culture was cooled to 4°C and centrifuged. The supernatant was then harvested and human PTH contained therein was recovered and assayed for PTH activity.
  • plasmid RX was first recovered in single stranded form and about l ⁇ g thereof was incubated, at 85°C in Hin buffer, with about lOOng of a mutagenic oligonucleotide capable of hybridizing specifically to that region of the PTH gene containing the Met18 codon.
  • the specific sequence of the oligonucleotide, designated M2 is shown below where underlining indicates the codon change relative to the PTH-encoding template:
  • M2 oligo 5' CTCTCTCCAGCGAGTTC 3' template: 3' GAGAGAGGTAGCTCAAG 5'
  • the annealed fragment was treated with DNA polymerase I (Klenow) in the presence of all four dNTPs, for about 2 hours at 37°C and then for 4 hours at room temperature, in order to form the full length double-stranded plasmid, designated pRXM2.
  • Competent host JM101 was then transformed by pRXM2, and plaques were screened by restriction digest analysis and by DNA sequencing to select those carrying the desired mutation.
  • pRXM2 is then digested with Nrul and Xbal and the resulting small fragment is isolated by low melting point agarose. Plasmid pX is similarly digested, and the large Nrul/Xbal fragment is isolated. The relevant isolated fragments are then ligated, to form plasmid pXM2, which carries DNA coding for [Leu 18 ]hPTH. This was confirmed by restriction digest analysis and DNA sequencing.
  • Competent E. coli M101 was transformed with pXM2 and the transformants were then selected in accordance with the procedures outlined in Example 1.
  • Supernatant containing the [Leu 18 ]PTH for subsequent purification was then obtained by culturing the ⁇ XM2 transformant, in the manner described by example 1.
  • a double stranded plasmid carrying the Leu ⁇ codon, designated pRXMl, is -then cut with Nrul/Xbal and the isolated small fragment is ligated with the large fragment of Nrul/Xbal-digested pX.
  • E. coli was then transformed by the resulting plasmid pXMl, and the transformant was cultured in the manner outlined in Example 1 to yield supernatant containing [Leu 8 ]hPTH.
  • Example 3 DNA coding for a human PTH variant in which both Met 8 and Met 18 are replaced by leucine. This was achieved by incubating pRXM2, which already bears the Leu 18 codon, with the Ml oligo (example 3) which introduces the Leu 8 codon, to yield plasmid pRXCl. Following sequencing which confirmed incorporation of the Leu 8 and Leu 18 codons, the Nrul/Xbal fragment was cloned as described in example 2, and the resulting plasmid was transformed into E. coli JM101.
  • M3 oligo 5' CCCAGGTTATGAGCAAGCTGTATTTCAC 3' template: 3' GGGTCCAATACGTATTCGACATAAAGTG 5'
  • E. coli M101 was then transformed with pXM3, and th transformants were cultured to provide supematants containin [Ala 8 ]hPTH, in the manner described in Example 1.
  • E. coli transformants were obtained and cultured, and supe atants containing the variant were collected individually as described in example 1, for analysis as now described in example 7.
  • the conditioned medium collected from the transformants of Examples 1-6 was, in each case, adjusted to about pH 4 with glacial acetic acid. In some but not all cases, mercaptoethanol was then added to a final concentration of lOmM and the solution was centrifuged. It was found that mercaptoethanol was unnecessary in the PTH variant purification process.
  • the supernatant was harvested and then passed through a column containing the cation exchange resin S-Sepharose FastFlow (Pharmacia, bed volume 50ml) pre- equilibrated with 0.04M ammonium acetate/1OmM B-mercaptoethano ( ⁇ B4.0) .
  • PTH or the PTH variant, bound to the resin was eluted b applying a concentration gradient of ammonium acetate as eluant o from 0.04M - 1.0M ammonium acetate/1OmM B-mercaptoethanol (pH4.0) .
  • PTH or the PTH variant eluted from the resin at about 0.6M ammoniu acetate.
  • Eluant fractions, containing PTH or the PTH variant (a measured by the Allegro two-site IRMA purchased form Jolda Diagnostics, California, catalogue #40-2170, or by absorbance a 280nm) , were combined to provide PTH or the PTH variant at about 60-70% purity.
  • Samples of greater purity were obtained by subjecting the combined fractions to a chromatographic separation using the resin phenyl-Sepharose FastFlow (Pharmacia) . More particularly, the pH of the combined S-Sepharose fractions was adjusted to pH 8 with 5N NaOH. This solution was then applied to a column containing phenyl-Sepharose (6ml bed volume) , pre-equilibrated with the buffer (6 volumes of 1.0M ammonium acetate (pH4.0) and 4 volumes of 4OmM ammonium acetate (pH4.0), then adjusted to pH 8.0 with 5N NaOH). PTH or the PTH variant, adsorbed to the column, was then eluted using as eluant a concentration gradient of buffer to 0.6M ammonium acetate (pH8.0) .
  • Fractions containing PTH activity were combined and then desalted by passage through a cartridge containing reversed phase C-18 resin e.g. Sep-Pak (Waters Inc.) or Amberchrom CG71 resin (Toso Haas) pre-equilibrated with 0.1% TFA. PTH or the PTH variant bound to the resin was eluted with 0.1% TFA/80% acetronitrile. The desalted preparations were then frozen in liquid nitrogen, lyophilized and stored at -20°C.
  • reversed phase C-18 resin e.g. Sep-Pak (Waters Inc.) or Amberchrom CG71 resin (Toso Haas) pre-equilibrated with 0.1% TFA.
  • PTH or the PTH variant bound to the resin was eluted with 0.1% TFA/80% acetronitrile.
  • the desalted preparations were then frozen in liquid nitrogen, lyophilized and stored at -20°C.
  • SUBSTITUTE SHEET variants Activity substantially comparable to PTH itself is retained by PTH variants in which the methionine at position 18 is replaced with virtually any genetically encoded amino acid. Replacement of methionine by cysteine, though an oxidizable amino acid and unsuitable for achieving reduced oxidation sensitivity, gave a PTH variant having an EC 50 of about 5.0nM. Variants in which methionine at position 8 was replaced either alone or in the context of Leu 18 gave variable EC 50 results depending on the identity of the replacement amino acid.
  • Met8 was replaced with amino acids having either (i) an amide side chain, such as asparagine and glutamine; (ii) an acidic side chain, such as aspartic acid and glutamic acid; (iii) a basic side chain, such as lysine and arginine; (iv) a small bulky aromatic side chain such as tyrosine, or (v) an amino acid having no side chain at all i.e. glycine.
  • an amide side chain such as asparagine and glutamine
  • an acidic side chain such as aspartic acid and glutamic acid
  • a basic side chain such as lysine and arginine
  • a small bulky aromatic side chain such as tyrosine
  • Substantial PTH activity as indicated by an EC_ o of less than 2,000nM, was seen however when the Met* residue was replaced by an amino acid having a hydrophobic side chain, such as isoleucine, valine, alanine and leucine, and was also seen when Met 8 is replaced by serine and tryptophan.
  • an amino acid having a hydrophobic side chain such as isoleucine, valine, alanine and leucine
  • Oxidation was effected by exposing samples of the various PTH compounds, obtained as described above, to the oxidant hydrogen peroxide according to the protocol reported by O'Riordan et al, 1974, J. Endocrinol., 63:117 which is incorporated herein by reference. In general, this oxidation procedure entails admixing the PTH sample with hydrogen peroxide for a selected period of time, and then halting the oxidative reaction by quick freezing in liquid nitrogen and lyophilization. For subsequent bioassay, the
  • Analogues of the PTH variants specifically contemplated herei include those having amino acids replaced at positions other tha 8 and 18.
  • Analogues of this class include those in which th phenylalanine at position 34 is replaced a tyrosine residue o other amino acid residue which is receptive to radiolabe conjugation.
  • Specific such analogues include [Leu l ⁇ Tyr 34 ]hPTH [Leu*Tyr 34 ]hPTH, [Ile 8 Leu 18 Tyr 34 ]hPTH and [Le ⁇ Leu ⁇ Tyr ⁇ JhPTH. T produce such analogues, DNA coding for a PTH variant is site specifically mutagenized to effect the desired amino aci replacement at the genetic level, and then expressed in a microbia host in the manner exemplified in example 9 hereinbelow.
  • Analogues of this class include V- terminal fragments of the PTH variants, which consist of at least the first 27 N-terminal residues.
  • Specific such analogues include those comprising the first 34 N-terminal residues, such as [Leu 18 ]hPTH(1-34), [Leu 8 ]hPTH(1-34), [Leu 8 Leu 18 ]hPTH(1-34), and Tyr 34 analogues thereof. It is reasonably expected that in addition to reduced oxidation sensitivity, these fragments will exhibit a biological activity comparable to their full length counterparts, as measured in the osteosarcoma assay.
  • N-terminal fragments may be used in a manner similar to human PTH(1-84) .
  • the N-terminal fragments may also be produced by recombinant DNA approach, using PTH variant-encoding DNA that has been mutagenized site specifically to introduce a translational stop codon immediately downstream of the residue 34 codon.
  • pRXC2 The resulting plasmid pRXC2 is then cut with Nrul and BamHI and the small fragment is ligated to the large fragment of similarly cut pX, thereby generating pXC2.
  • Transformants harbouring pXC2 were then cultured, and [Leu 8 Leu 18 Tyr 3 ]hPTH(l-84) contained in the conditioned medium was purified and assayed as described in Example 7. The results are included in Table 1 and Figures 3 and 4, and show that the variant exhibits reduced sensitivity to oxidation and retains substantial PTH activity.
  • a substrate amenable to radiolabelling such as with I 123 in the manner reported in US 4,409,141, and which is useful for imaging studies and for in vitro binding analyses.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Endocrinology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

On décrit des variantes d'hormone de parathyroïde substituées par de la méthionine, et qui présentent, par rapport à leurs équivalents naturels, une sensibilité réduite à l'oxydation et une activité d'hormone parathyroïde sensible. Leur préparation, selon des techniques de recombinaison à base d'ADN est aussi décrite, ainsi que leur utilisation, notamment pour le traitement d'ostéoporose.
PCT/CA1991/000451 1990-12-21 1991-12-18 Variantes d'hormone de parathyroide resistantes a l'oxydation WO1992011286A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US63096990A 1990-12-21 1990-12-21
US630,969 1990-12-21
US80627191A 1991-12-13 1991-12-13
US806,271 1991-12-13

Publications (1)

Publication Number Publication Date
WO1992011286A1 true WO1992011286A1 (fr) 1992-07-09

Family

ID=27091273

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA1991/000451 WO1992011286A1 (fr) 1990-12-21 1991-12-18 Variantes d'hormone de parathyroide resistantes a l'oxydation

Country Status (5)

Country Link
AU (1) AU9103791A (fr)
CA (1) CA2098283A1 (fr)
IE (1) IE914484A1 (fr)
PT (1) PT99904A (fr)
WO (1) WO1992011286A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2269176A (en) * 1992-07-15 1994-02-02 Sandoz Ltd Parathyroid hormone variants
EP0730661A1 (fr) * 1993-10-25 1996-09-11 Affymax Technologies N.V. Composes a activite de parathormone et vecteurs d'adn recombine les codant
US5589452A (en) * 1992-07-14 1996-12-31 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5824532A (en) * 1993-02-11 1998-10-20 Genencor International, Inc. Oxidativley stable alpha-amylase
US5977070A (en) * 1992-07-14 1999-11-02 Piazza; Christin Teresa Pharmaceutical compositions for the nasal delivery of compounds useful for the treatment of osteoporosis
WO1999057139A2 (fr) * 1998-05-05 1999-11-11 Societe De Conseils De Recherches Et D'applications Scientifiques Sas Composes se liant selectivement au recepteur pth2
US7015195B2 (en) 2002-01-10 2006-03-21 Osteotrophin, Llc Treatment of bone disorders with skeletal anabolic drugs
US20210283227A1 (en) * 2016-11-30 2021-09-16 Purdue Research Foundation Fracture targeted bone regeneration through parathyroid hormone receptor stimulation

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0260350A1 (fr) * 1986-09-05 1988-03-23 Cetus Oncology Corporation Mutéines d'interféron-bêta résistant à l'oxydation, leur production; préparations contenant ces mutéines
EP0301485A1 (fr) * 1987-07-30 1989-02-01 Gesellschaft für Biotechnologische Forschung mbH (GBF) Vecteurs d'expression et procédé les utilisant pour la production de protéines de fusion de cro/bêta-galactosidase/PTH et de PTH

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0260350A1 (fr) * 1986-09-05 1988-03-23 Cetus Oncology Corporation Mutéines d'interféron-bêta résistant à l'oxydation, leur production; préparations contenant ces mutéines
EP0301485A1 (fr) * 1987-07-30 1989-02-01 Gesellschaft für Biotechnologische Forschung mbH (GBF) Vecteurs d'expression et procédé les utilisant pour la production de protéines de fusion de cro/bêta-galactosidase/PTH et de PTH

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BIOCHEMISTRY vol. 13, 1974, WASHINGTON pages 1994 - 1999; SAUER ET AL: 'The amino acid sequence of porcine parathyroid hormone' *
EDITOR: RIVIER ET AL // AUTHOR: CHOREV ET AL 'Proceedings of the 11th American Peptide Symposium ( La Jolla, USA, 1989 ) // Second generation of potent parathyroid hormone (PTH) antagonists' , ESCOM , LEIDEN, HOLLAND *
JOURNAL OF CLINICAL INVESTIGATION vol. 80, 1987, NEW YORK pages 1803 - 1807; STREWLER ET AL: 'Parathyroid hormonelike protein from human renal carcinoma cells' *

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6051686A (en) * 1992-07-14 2000-04-18 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5840837A (en) * 1992-07-14 1998-11-24 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone relate peptide synthesis and use for the treatment of osteoporosis
US5589452A (en) * 1992-07-14 1996-12-31 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5693616A (en) * 1992-07-14 1997-12-02 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5695955A (en) * 1992-07-14 1997-12-09 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5798225A (en) * 1992-07-14 1998-08-25 Syntex (U.S.A.) Inc. Process for recombinant production of PTH and PTHrp analogs
US5807823A (en) * 1992-07-14 1998-09-15 Syntex (U.S.A.) Inc. Analogs of parathyroid hormone and parathyroid hormone related peptide: synthesis and use for the treatment of osteoporosis
US5977070A (en) * 1992-07-14 1999-11-02 Piazza; Christin Teresa Pharmaceutical compositions for the nasal delivery of compounds useful for the treatment of osteoporosis
EP0672057A1 (fr) * 1992-07-15 1995-09-20 Novartis AG Analogues de parathormone
GB2269176B (en) * 1992-07-15 1997-01-08 Sandoz Ltd Peptides
GB2269176A (en) * 1992-07-15 1994-02-02 Sandoz Ltd Parathyroid hormone variants
US5824532A (en) * 1993-02-11 1998-10-20 Genencor International, Inc. Oxidativley stable alpha-amylase
EP0730661A4 (fr) * 1993-10-25 1998-08-05 Affymax Tech Nv Composes a activite de parathormone et vecteurs d'adn recombine les codant
EP0730661A1 (fr) * 1993-10-25 1996-09-11 Affymax Technologies N.V. Composes a activite de parathormone et vecteurs d'adn recombine les codant
WO1999057139A2 (fr) * 1998-05-05 1999-11-11 Societe De Conseils De Recherches Et D'applications Scientifiques Sas Composes se liant selectivement au recepteur pth2
WO1999057139A3 (fr) * 1998-05-05 2000-02-03 Sod Conseils Rech Applic Composes se liant selectivement au recepteur pth2
US7531621B1 (en) 1998-05-05 2009-05-12 Societe De Conseils De Recherches Et D'applications Scientifiques S.A.S. PTH2 receptor selective compounds
US7015195B2 (en) 2002-01-10 2006-03-21 Osteotrophin, Llc Treatment of bone disorders with skeletal anabolic drugs
US7384912B2 (en) 2002-01-10 2008-06-10 Osteotrophin, Llc Treatment of bone disorders with skeletal anabolic drugs
US20210283227A1 (en) * 2016-11-30 2021-09-16 Purdue Research Foundation Fracture targeted bone regeneration through parathyroid hormone receptor stimulation

Also Published As

Publication number Publication date
CA2098283A1 (fr) 1992-06-22
PT99904A (pt) 1992-12-31
IE914484A1 (en) 1992-07-01
AU9103791A (en) 1992-07-22

Similar Documents

Publication Publication Date Title
US5382658A (en) Stability-enhanced variants of parathyroid hormone
CA2033176C (fr) Proteines de fusion d'hormones de croissance
EP0309050B1 (fr) Facteurs de croissance analogues à l'insuline présentant une faible capacité de liaison avec les protéines sériques porteuses; production par la levure.
EP0234888B1 (fr) Procédé de production du facteur de croissance épidermique humain et de ses analogues
US5304473A (en) A-C-B proinsulin, method of manufacturing and using same, and intermediates in insulin production
EP0235205B1 (fr) Analogues peptidiques du facteur de croissance 1 similaire a l'insuline chez les mammiferes
JP3129722B2 (ja) 新規インスリン誘導体
US20100210815A1 (en) Insulin production methods and pro-insulin constructs
CA2223272A1 (fr) Insuline monocatenaire a bioactivite elevee
EP0748817A2 (fr) Dérivés de l'hormone parathyrodienne et leur utilisation
US5599792A (en) Bone-stimulating, non-vasoactive parathyroid hormone variants
EP0871474B1 (fr) Production d'insuline humaine
US5089473A (en) Somatotropin variants and their use
WO1992011286A1 (fr) Variantes d'hormone de parathyroide resistantes a l'oxydation
EP0379338A2 (fr) Facteur de croissance analogue à l'insuline et sa production par une levure
EP0222591A2 (fr) Procédé et acide nucléique pour la préparation de la lécithine: cholestérolacyltransférase
Chunxiao et al. Study on preparation and activity of a novel recombinant human parathyroid hormone (1–34) analog with N-terminal Pro–Pro extension
WO1988007084A1 (fr) Analogues de somathormone bovine
EP0528271B1 (fr) Mutéines de l'hormone parathyroidienne humaine et leur production
AU614956B2 (en) Porcine growth hormone analogs
US5130422A (en) Variant somatotropin-encoding DNA
Ishikawa et al. Production of human calcitonin in Escherichia coli from multimeric fusion protein
Smith et al. Production and biological activity of hybrid growth hormone-releasing hormone propeptides
CA2089143C (fr) Compositions de facteur de croissance, leur preparation et leur utilisation
US5759816A (en) Expression vectors containing λPL promoter and T1 T2 rRNA termination sequence plasmids containing the vectors hosts containing the plasmids and related methods

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU BB BG BR CA CS FI HU JP KP KR LK MG MN MW NO PL RO SD SU

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BF BJ CF CG CH CI CM DE DK ES FR GA GB GN GR IT LU MC ML MR NL SE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2098283

Country of ref document: CA

122 Ep: pct application non-entry in european phase