WO1992005284A1 - Compositions and methods for inhibiting growth or replication of viruses - Google Patents

Compositions and methods for inhibiting growth or replication of viruses Download PDF

Info

Publication number
WO1992005284A1
WO1992005284A1 PCT/US1991/006646 US9106646W WO9205284A1 WO 1992005284 A1 WO1992005284 A1 WO 1992005284A1 US 9106646 W US9106646 W US 9106646W WO 9205284 A1 WO9205284 A1 WO 9205284A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotides
oligonucleotide
hybridizable
alkyl
nucleoside
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1991/006646
Other languages
English (en)
French (fr)
Inventor
Laure Aurelian
Paul O. P. Ts'o
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
University of Maryland Baltimore
University of Maryland College Park
Original Assignee
Johns Hopkins University
University of Maryland Baltimore
University of Maryland College Park
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University, University of Maryland Baltimore, University of Maryland College Park filed Critical Johns Hopkins University
Priority to EP91918745A priority Critical patent/EP0656942A1/en
Publication of WO1992005284A1 publication Critical patent/WO1992005284A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1133Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against herpetoviridae, e.g. HSV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • C12Q1/703Viruses associated with AIDS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/705Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/312Phosphonates
    • C12N2310/3125Methylphosphonates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification

Definitions

  • the invention relates to oligonucleotides; medicaments and pharmaceutic compositions comprising the oligonucleotides; methods of detecting microbes, viruses and self-replicating nucleic acids using the oligonucleotides; methods of inhibiting growth or replication of microbes, viruses and self-replicating nucleic acids using the oligonucleotides; and therapeutic methods using the oligonucleotides to inhibit homologous and heterologous growth or replication of microbes, viruses or self-replicating nucleic acids.
  • Antisense RNA that can inhibit selectively gene expression at the level of translation or mRNA processing has been proposed as a possible genetic approach for the prevention and treatment of disease.
  • Antisense RNA introduced directly into cells or expressed off transfected DNA has been shown to repress the expression of endogenous eukaryotic genes.
  • the inherent properties of RNA and problems of working with RNA such as the near ubiquitous presence of RNases in cells, reagents and supplies, has stimulated a search for alternative means of genetically repressing the expression of specific genes using antisense oligonucleotides.
  • non-ionic nucleic acid analogues that contain a 3'-5' ethylphosphonate group in place of the negatively charged phosphodiester group found normally in oligonucleotides.
  • the analogues are resistant to nuclease hydrolysis and penetrate the plasma membrane of cells in culture.
  • Other means of improvement include the use of terminal blocking groups, intercalating agents or phosphorothioates.
  • Antisense oligonucleotides have found limited success in inhibiting the growth of Rous sarcoma virus, vesicular stomatitis virus, simian virus 40, influenza virus and human immunodeficiency virus.
  • one object of the instant invention is to provide oligonucleotides that inhibit herpesvirus growth or replication in a superior manner.
  • a second object of the invention is to provide novel compositions and methods for inhibiting growth or replication of microbes, viruses or self- replicating nucleic acids.
  • Another object of the invention relates to the use of multiple oligonucleotides directed to non- overlapping sites in a microbe, virus or self- replicating nucleic acid genome to inhibit growth or replication thereof.
  • a fourth object of the invention is to provide novel compositions and methods for inhibiting growth or replication of a primary microbe, virus or self-replicating nucleic acid, such as a herpesvirus, and of a secondary microbe, virus or self-replicating nucleic acid, such as human immunodeficiency virus, using one or more oligonucleotides hybridizable with nucleic acids of said primary microbe, virus or self-replicating nucleic acid.
  • the invention provides a method of detecting herpesvirus comprising the steps of: (i) obtaining a biologic sample containing nucleic acids; (ii) treating said sample so the nucleic acids contained therein are made single stranded; (i ⁇ ) exposing said treated sample to a labelled oligonucleotide wherein said ol igonucleotide is hybridizable with nucleic acids of herpesvirus; and (iv) detecting hybridized sequences.
  • the invention provides a composition for inhibiting herpesvirus growth or replication comprising an oligonucleotide hybridizable with nucleic acids of said herpesvirus.
  • the invention provides a method for inhibiting herpesvirus growth or replication comprising the step of contacting nucleic acids of herpesvirus with an oligonucleotide hybridizable with said nucleic acids of herpesvirus.
  • the invention provides therapeutic compositions for inhibiting herpesvirus growth or replication comprising an oligonucleotide, or pharmaceutically acceptable salts thereof, hybridizable with nucleic acids of herpesvirus and a pharmaceutically acceptable carrier.
  • the invention provides a therapeutic method for inhibiting herpesvirus growth or replication in a host carrying herpesvirus -comprising administering a pharmaceutically effective amount of a therapeutic composition comprising an oligonucleotide, or pharmaceutically acceptable salts thereof, hybridizable with nucleic acids of herpesvirus.
  • a composition for inhibiting growth or replication of a microbe, virus or self-replicating nucleic acid comprising at least two oligonucleotides hybridizable with non-overlapping sites in nucleic acids of said microbe, virus or self-replicating nucleic acid.
  • the invention provides a method for inhibiting growth or replication of a microbe, virus or self-replicating nucleic acid comprising the step of contacting nucleic acids of a microbe, virus or self-replicating nucleic acid with at least two oligonucleotides hybridizable with non-overlapping sites in nucleic acids of said microbe, virus or self-replicating nucleic acid.
  • the invention provides therapeutic compositions for inhibiting microbe, virus or self-replicating nucleic acid growth or replication comprising at least two oligonucleotides, or pharmaceutically acceptable salts thereof, hybridizable with non-overlapping sites in nucleic acids of said microbe, virus or self-replicating nucleic acid and a pharmaceutically acceptable carrier.
  • the invention provides a therapeutic method for inhibiting microbe, virus or self-replicating nucleic acid growth or replication in a host carrying a microbe, virus or self-replicating nucleic acid comprising administering pharmaceutically effective amounts of at least two oligonucleotides, or pharmaceutically acceptable salts thereof, hybridizable with non- overlapping sites in nucleic acids of said microbe, virus or self-replicating nucleic acid.
  • the invention provides a composition for inhibiting human immunodeficiency virus growth or replication in a specimen containing human immunodeficiency virus and a second virus comprising at least one oligonucleotide hybridizable with nucleic acids of said second virus.
  • the invention further provides a method for inhibiting human immunodeficiency virus growth or replication in a specimen containing human immunodeficiency virus and a second virus comprising the step of contacting nucleic acids of said second .virus with at least one oligonucleotide hybridizable with nucleic acids of said second virus.
  • Another embodiment of the invention is a therapeutic composition for inhibiting human immunodeficiency virus growth or replication in a host carrying human immunodeficiency virus and a second virus comprising at least one oligonucleotide, or pharmaceutically acceptable salts thereof, hybridizable with nucleic acids of said second virus and a pharmacuetically acceptable carrier.
  • the invention provides a therapeutic method for inhibiting human immunodeficiency virus growth or replication in a host carrying human immunodeficiency virus and a second virus comprising administering a pharmaceutically effective amount of at least one oligonucleotide, or pharmaceutically acceptable salts thereof, hybridizable with nucleic acids of said second virus.
  • FIG 1 is a schematic representation of the herpes simplex virus (HSV) genome with several genes preferred as targets for antisense oligonucleotides highlighted.
  • U L denotes the long unique sequence segment flanked by the terminal, TR L , and internal, IR L , repeat sequences.
  • U s denotes the short unique sequence segment flanked by the internal, I j , and terminal, R g , repeat sequences.
  • Figure 2 is another schematic representation of the HSV genome showing other relevant genes. The long region is divided into functional domains as determined by restriction enzymes and denoted as C, F, E and D.
  • ORF size is the predicted open reading frame size in kilobases (K) .
  • K kilobases
  • the solid boxes represent the long segment flanking repeats and the hollow boxes represent the short segment flanking repeats.
  • the genes are identified numerically, such as UL5, or according to function and include dbp which encodes the major DNA binding protein, which is involved in DNA unwinding, and pol which encodes DNA polymerase.
  • Figure 3 depicts dose response curves of HSV-1 growth in cells exposed to antisense oligonucleotides. Vero cells were infected with 10 pfu per cell of HSV-1 and treated with increasing concentrations of oligonucleotide at the time of infection. The cultures were assayed for infectious virus 24 hours later.
  • Results are expressed as the percent inhibition of virus titers compared to untreated HSV-1-infected cells.
  • the solid circles represent the oligonucleotide TTCCTCCTGCGG;
  • the X's represent the oligonucleotide TCCTCCTG;
  • the hollow squares represent the oligonucleotide GCGGGAAGGCAC;
  • the solid squares represent the oligonucleotide TCCTGCGGGAAG;
  • the solid triangles represent the oligonucleotide TTCCTCCT;
  • the hollow triangles represent the oligonucleotide TCCTGCGG.
  • Figure 4 depicts activation of HSV by the IE110 gene product and inhibition of IEllO-induced activation by specific oligonucleotides.
  • Vero cells were transfected with pICPlO-cat, a plasmid carrying an HSV promoter and the CAT structural gene, and activating IE110.
  • the open bar represents cells grown in the absence of an oligonucleotide
  • the hatched bars denoted as (a) represent cells grown in the presence of the oligonucleotide TTCCTCCTGCGC
  • the stippled bars denoted as (b) represent cells grown in the presence of the oligonucleotide GCGGGGCTCCAT
  • the dotted bars denoted as (c) represent cells grown in the presence of the oligonucleotide AGTCTGCTGCAA.
  • Figure 5 depicts dose response and inhibition of HSV-1 growth in cells by antisense oligonucleotides, as in Figure 3.
  • FIG. 6 shows the effect of virus m.o.i. (multiplicity of infection) on dose response inhibition of HSV-1 growth by an oligonucleotide complementary to the translation initiation site of HSV-1 IE mRNA 1 with the sequence GCGGGGCTCCAT, designated IE110.
  • FIG. 7A depicts dose response inhibition of HSV-1 growth in Vero cells exposed to antisense oligonucleotides.
  • FIG. 7A HSV-l growth in Vero cells infected with 0.1 pfu per cell of HSV-l was monitored.
  • X's represent the oligonucleotide GCGGGGCTCCAT (designated as IE110) ; circles represent the oligonucleotide TTCCTCCTGCGG (designated as IE4,5) ; and squares designate the use of both oligonucleotides simultaneously.
  • Figure 7B the synergistic effect of IE110 and IE4,5 oligomers on the inhibition of HSV-2 replication is depicted. The concentration of each oligonucleotide was covaried and inhibition of plaque formation was determined.
  • FIC denotes the ratio of the concentration of IE4,5 required to inhibit plaque formation by 60% in the presence of a fixed concentration of IE110 to the concentration required in the absence of IE110.
  • the units of the X axis are the ratio of the fixed concentration of IE110 to the concentration of IE110 that produced 60% inhibition of plaque formation in the absence of IE4,5.
  • the diagonal line (the X's) shows the theoretical plot for each oligonucleotide used alone.
  • the solid circles represent the synergistic effect of the combination.
  • Figure 8 depicts dose response curves of HSV-l growth in cells exposed to antisense oligonucleotides. In the figure, the small circles represent oligomer specific for the IE5 initiation site and designated IE12 with the sequence GGCCCACGACA . IE12 does not show significant inhibition.
  • Triangles represent the oligonucleotide AATGTCGGCCAT (designated as IE68 and specific for the IE4 initiation site) .
  • the large circles represent inhibition obtained by combining the two oligonucleotides.
  • the combination of oligonucleotides achieves a higher level of inhibition at a lower concentration of oligonucleotides than when either is used alone.
  • the points represent total concentration of both oligonucleotides.
  • Figure 9 depicts inhibition of HIV activation by a herpesvirus-specific oligonucleotide.
  • IE110 a plasmid carrying the HIV promoter upstream of the CAT structural gene and a plasmid encoding the HSV-l IE110 protein.
  • the transformants were then exposed to varying concentrations of oligonucleotides. Oligomer to the initiation site of IE110 is GCGGGGCTCCAT, to the second splice acceptor site of IE110 is AGTCTGCTGCAA and to the splice acceptor site of IE4,5 is TTCCTCCTGCGG.
  • Figure 10 depicts inhibition of HIV activation by a herpesvirus-specific oligonucleotide, GCGGGGCTCCAT (designated as IE110 oligomer) ; and activation by the IE110 protein of HSV-l and the homologous gene product from cytomegalovirus (designated as CMV) .
  • the IE110 protein and the oligonucleotide were combined in one treatment.
  • the curve denoted PBR is a control using pBR322.
  • IFU is infectious forming unit. DETAILED DESCRIPTION OF THE INVENTION
  • the invention relates to inhibiting growth or replication of microbes, viruses or self- replicating nucleic acids, or the translation or expression of microbe, virus or self-replicating nucleic acid genes that are essential for growth and proliferation, by interfering with the normal means of expression of critical genes by using antisense oligonucleotides that are complementary to specific targeted sites in the microbe, virus or self-replicaing nucleic acid genome.
  • the compositions and methods of the instant invention find utility in the detection, diagnosis and manipulation of the herpesviruses and in the treatment of disease caused directly or indirectly by the herpesviruses.
  • oligonucleotide is used herein to include oligo ers comprised of deoxyribose and ribose, the sugars found normally in nucleic acids, and modified analogs thereof, such as 2'-0-methyl ribose.
  • the oligonucleotide may bind to single- stranded nucleic acids or to double-stranded nucleic acids.
  • self-replicating nucleic acids is used herein to include nucleic acids found in organelles, such as chloroplasts and mitochondria, and alone, such as plasmids, viroids and the like.
  • virus is used herein to include intracellular agents that are characterized by a lack of independent metabolism and by the ability to replicate only within living host cells.
  • microbe is used herein to include prokaryotes, such as bacteria, actino ycet ⁇ s, chla ydiae, mycoplasmae and the like; and eukaryotes, such as protozoa, fungi, parasites and the like.
  • the herpesviruses whose natural host is the human species, comprise seven species, herpes simplex type 1 (HSV-l) and type 2 (HSV-2) , varicella zoster (VSV) , Epstein-Barr (EBV) , cytomegalovirus (HCMV) , human herpesvirus 6 (HHV-6) and 7 (HHV-7) .
  • HSV herpes simplex type 1
  • HSV varicella zoster
  • EBV Epstein-Barr
  • HCMV cytomegalovirus
  • HHV-6 human herpesvirus 6
  • HHV-7 human herpesvirus 6
  • HHV-7 human herpesvirus
  • the oligonucleotides can be produced in any of a variety of art-recognized methods, for example the commonly used solid phase triester or phosphoramidite chemistry. Nucleic acid synthesis jLn vitro has become highly automated using equipment that is readily available to the artisan. Furthermore, customized oligonucleotides can be obtained under contract from a variety of commercial sources. Alternatively, the antisense nucleotides can be synthesized .in situ by transfecting cells with an appropriate cloned sequence. The oligonucleotides must be capable of bypassing membranous barriers, of resisting the degradative means present in the milieu and hybridizing the nucleic acids of the microbe, virus or self-replicating nucleic acid.
  • unmodified oligodeoxyribonucleotidesandoligoribonucleotides, and other oligonucleotides can be used if introduced directly into cells by methods including electroporation, microimmunization, liposome fusion, precipitation and microparticle bombardment.
  • the antisense oligonucleotides also can be produced endogenously in host cells following transfeetion by an appropriate recombinant. Sequences encoding the antisense molecule are cloned into an appropriate site in an expression cassette carrying the necessary host RNA polymerase binding sites of a vector. The recombinant is then introduced into cells using standard techniques, such as those described above.
  • oligonucleotides may be used, for example, oligonucleoside methylphosphonates as described in U.S. Patent No. 4,469,863 or 4,511,713; phosphorothioate analogs as described in Matsukura et al. (PNAS 84, 7706-7710, 1987) ; oligonucleotides carrying terminal groups and oligomers that are dervitized, such as with psoralen.
  • Modified nucleotides offer the advantages of increased hydrophobicity or nuclease resistance or both.
  • oligonucleotides carrying certain modified bases are capable of penetrating the mammalian cell plasma membrane.
  • the termini of the oligonucleotide can be modified to render the oligomer resistant to intracellular exonucleases.
  • the use of chemically modified oligonucleotides is preferred in practicing the instant invention, and especially perferred is the use of oligonucleoside alkyl or aryl phosphonates.
  • the oligonucleotides can vary in size depending upon the specificity desired, expected intracellular stability and technical considerations. Generally, the longer the oligonucleotide the greater the specificity, at least in the range of 8 to 20 nucleotides.
  • the effective concentration of the driver DNA, that is the microbe, virus or self- replicating nucleic acid genome, in the hybridization reaction between genome target site and oligonucleotide is high thereby enabling one to achieve adequate specificity using shorter oligonucleotides.
  • Oligonucleotides of 8 to 20 bases are preferred, and those of 12-20 bases are particularly preferred.
  • the oligonucleotides can be as large as 50 to 60 bases, if not larger.
  • oligonucleotides that hybridize to adjacent sites, for example two 15mers to span a 30 base pair site in situ.
  • Any means of contacting oligonucleotides with nucleic acids of a microbe, virus or self- replicating nucleic acid is suitable for practicing the instant invention.
  • a preferred means is to use oligonucleotides that alone or in a composition are stable in the peripheral circulation and can penetrate the cell membrane.
  • the means of introducing the oligonucleotides in a therapeutically effective concentration can be any of those used currently for delivering biologicals, such as immunoglobulin, peptides and enzymes, for example, intravenous administration, intramuscular immunization, implants, intranasal administration, contained in liposomes, attached to a cell-binding agent, such as an antibody, attached to ribozy es and other parenteral routes.
  • a cell-binding agent such as an antibody
  • the oligonucleotide may be delivered in a vehicle comprising a cream or an ointment.
  • Suitable concentrations of oligonucleotides needed to inhibit growth or replication of a microbe, virus or self-replicating nucleic acid can be determined readily by the skilled artisan.
  • the animal studies disclosed herein provide a basis for extrapolating dosage in other species based on weight comparisons between the mouse and other species.
  • the amounts used herein can provide a reference point for use in other species.
  • the concentration required will depend in part, for example, on the chemistry of the oligonucleotides; having to traverse physiologic barriers, such as the blood-brain or blood-testis barrier; toxicity; route of administration, such as oral, transdermal and nasal; the disease requiring treatment, such as a verruca, an outbreak of shingles, an intestinal ascaritic infestation and,bacteremia; and half life in the peripheral circulation.
  • suitable therapeutic doses in terms of internal doses are between 10 nM and 10 ⁇ M.
  • the oligonucleotides can be delivered in a variety of pharmaceutically accepted ways.
  • compositions may be in the form of a solid or semisolid, but it is most likely that the oligomers will be admininistered in liquid form.
  • the compositions will include the oligomers, or pharmaceutically acceptable salts thereof, conventional excipients, such as a sterile buffered saline solution, and other agents, carriers, adjuvants, diluents etc. for increasing the stability, enhancing wettability and the like of the composition.
  • excipients such as a sterile buffered saline solution
  • agents such as a sterile buffered saline solution
  • other agents, carriers, adjuvants, diluents etc. for increasing the stability, enhancing wettability and the like of the composition.
  • Actual methods and doses are known, or will be apparent to those skilled in the art, for example see Remington's Pharmaceutical Sciences. Mack Publ. Co., Easton, PA.
  • the invention also contemplates the use of at least two oligonucleotides directed to non- overlapping sites in the microbe, virus or self- replicating nucleic acid genome. Because targeted sites are not overlapping and the three-dimensional folding of the microbe, virus or self-replicating nucleic acid genome in a host cell or .in situ may not be predictable, each oligonucleotide of a plurality of oligonucleotides contains sequences that are complementary to a single site.
  • An unexpected enhanced inhibition of microbe, virus or self-replicating nucleic acid growth or replication is obtained when more than one oligonucleotide is used, the oligonucleotides being hybridizable to different sites in a single gene or in separate genes.
  • targets for antisense oligonucleotides there are certain regions of the microbe, virus or self- replicating nucleic acid genome that are preferred as targets for antisense oligonucleotides.
  • Preferred targets are those that have direct or indirect control over basic mechanisms in microbe, virus or self-replicating nucleic acid growth.
  • regulatory genes expressed early in development that trigger major developmental pathways are suitable (known as master regulatory genes) as are other regulatory genes that control the expression of a smaller number of genes, as in an operon.
  • suitable targets are genes involved with microbe, virus or self-replicating nucleic acid replication, such as DNA polymerase and reverse transcriptase.
  • Another set of suitable targets are genes that are involved in pathogenesis per se such as those that confer tissue or cell specificity, virulence and latency.
  • transcription initiation sites also known as promoter or polymerase binding site
  • translation initiation sites such as 5'-ATATCAATGTCAGTCGCCAT-3' (hereinafter all the sequences are in the 5' to 3' orientation)
  • oligonucleotide hybridizable to the IE5 translation initiation site such as GGCCCACGACAT
  • oligonucleotides hybridizable to the IE4 mRNA cap site such as GCGGGCGTCGGT, GGCGCCGTCTGC and GTGGCCGGCGCC
  • oligonucleotides hybridizable to the IE5 mRNA cap site such as GCGGGCGTCGGT, GGCGCCGTCTGC and GTGGCCGGCGCC
  • an oligonucleotide hybridizable to the IE5 mRNA cap site such as GCGGGCGTCGGT, GGCGCCGTCTGC and GTGGCCGGCGCC
  • the size of the oligonucleotide may vary and the oligonucleotide may include bases complementary to the target genomic site that flank the sequences recited herein or lack bases of the sequences recited herein.
  • the IE4 translation initiation site sequence AATGTCGGCCAT may be extended with complementary, and thus hybridizable bases in either the 5' or 3 ' direction to obtain an oligonucleotide of more than 12 bases; may be truncated by one or more bases to yield an effective oligonucleotide of fewer than 12 bases; may be extended in either the 5' or 3• direction with a concommitant deletion of one or more bases from the non-extended end to yield an oligonucleotide containing only part of the recited sequence etc. , so long as the oligonucleotide is capable of interfering with the normal transcription or translation of IE4.
  • Ideal targeting about a splice site can be achieved with an oligonucleotide that, as equally as possible, spans the exon/intron junction.
  • Ideal targeting about a translation initiation site can be achieved with an oligonucleotide that in the complementary 3' to 5' orientation, begins at the ATG initiation codon and extends into the coding region (thus the oligonucleotide in the 5' to 3* orientation will have as the last three bases CAT) .
  • Genes that are essential for synthesizing nucleic acids of a microbe, virus or self- replicating nucleic acid are preferred targets for antisense oligonucleotides (Figure 2) .
  • genes examples include those that encode DNA binding proteins, gyrases, enzymes that relate to the synthesis of nucleotide triphosphates, DNA nucleases required for DNA replication and polymerases. Also included are transcrition initiation sites or promoter sequences.
  • suitable genes include the DNA polymerase gene, thymidine kinase gene (TK) , ribonucleotide reductase gene (RR1 locus. also known as 1CP6, and RR2 locus, also known as 38K) and genes encoding enzyme stabilizing proteins such as the 18OK for ribonucletide reductase.
  • An oligonucleotide hybridizable to the polymerase gene is CCGCCGCCACCGGAAAAGAT; an oligonucleotide hybridizable to TK is TGGCAGGGGTACGAAGCCAT; and an oligonucleotide hybridizable to RR1 is GCGGCTGGGCGGCTGGCCAT.
  • sequences which are crucial to transcription such as promoter sequences.
  • promoter sequences for example, in HSV there is a consensus sequence common to the promoters of the IE genes with the sequence TAATGARAT, wherein R can be any base including A, T, G, C, U or functional equivalents thereof, wherein a functional equivalent is a nitrogenous base that can be substituted and retain complementarity.
  • regulatory genes many of which are not translated, that govern the orderly expression of downstream genes are especially suitable as targets for antisense oligonucleotides. Many of these early expressed regulatory genes are termed master genes. In the HSV-l genome, the VmW65 locus is one such master gene.
  • An oligonucleotide hybridizable to the VmW65 initiation site would be suitable, such as TCGTCGACCAAGAGGTCCAT, CAAACAGCTCGT, CCATGTCGGCAA, GTCCGCGTCCAT, GCCGTCCGCGTC and TGGCGAAGCGCC; and an oligonucleotide hybridizable to the VmW65 mRNA cap site would suffice, such as ACAGCCCGTGGT, CCGAGGAATGAC and CCGTTCCCGAGG.
  • Another set of genes that are preferred for targeting are those that are essential for pathogenesis. In a virus, for example, such genes are those involved in latency, cell tropism, the choice of specific cell to infect or determining virulence.
  • LAT latency-associated transcript
  • suitable oligonucleotides are those hybridizable to the initiation site of LAT ORF-1, such as CACTGGCATGGA, GCATCCTGCCAC, CCCCGAAAGCAT, GATCCCCGAAAG and CTGACCACCGAT; and those hybridizable to the initiation site of LAT ORF-2, such as GCAGGCTCTGGT, CCATGTTGGGCA, TGGGGGTGCCAT, GAGTGGGGGTGC and GGTGCGTGGGAG.
  • IE genes are not restricted to HSV-l and are a feature common to the herpesviruses.
  • IE gene homologues in related herpesviruses are suitable targets for antisense oligonucleotides.
  • oligonucleotides hybridizable to the HCMV IE2 initiation site are suitable, such as CAAGGACGGTGA, CCATCGTGTCAA, AGAGGACTCCAT, GGCAGAGGACTC and CTTTCTCTTGGC; as are those hybridizable to the IE2 homologue mRNA cap site, such as GACGGTTCACTA, CAGGCGATCTGA and CGTCTCCAGGCG.
  • the HSV-l IE110 gene homologue is known as gene 61.
  • Oligonucleotides which are suitable are those that are hybridizable to the 61 translation initiation site, such as CAACTGGCTGTA, CCATGGTAACAA, TATGGTATCCAT, TAATATGGTATC and ACCGCCCGCTAA.
  • the VZV 62 gene is the homologue of the HSV-l IE3 gene.
  • Oligonucleotides which are suitable are those that are hybridizable to the 62 translation initiation site, such as TGGGGTGAATTT, CCATCGCACTGG, CGGCGTATCCAT, CGGCGGCGTATC and GCGCTGCATCGG.
  • oligonucleotide target two genes that complement the expression and/or function of each other, for example two genes that encode proteins of a metabolic pathway, two genes of a developmental pathway or two master regulatory genes that each control the expression of different developmental programs, or combinations thereof. Knowing the strategy, the skilled artisan can determine readily suitable portions of the microbe, virus or self-replicating nucleic acid to target and hence suitable combinations of oligonucleotides. Although in a preferred embodiment the invention contemplates the use of two or more oligonucleotides, there are instances where a single oligonucleotide is more than 90% effective.
  • the oligonucleotides TTCCTCCTGCGG, GCTTACCCGTGC, GCGGGGCTCCAT and AATGTCGGCCAT each are effective in inhibiting HSV-l growth when used alone.
  • the activity of the oligonucleotides is enhanced, that is additive or synergistic, when used in combination with another oligonucleotide.
  • the phenomenon is manifest as higher level of inhibition or effectiveness at a lower dose or both.
  • an oligonucleotide can influence normal gene expression includes binding to existing single-stranded regions in the nucleic acids of a microbe, virus or self-replicating nucleic acid, which includes naturally occurring single-stranded nucleic acids and regions of double-stranded nucleic acids that are melted partially, and binding to double-stranded nucleic acids to form a nucleic acid triplex structure, which includes binding to cloverleaf and stem-loop structures commonly found amongst single-stranded nucleic acids that self base pair or fold back upon themselves.
  • HIV human immunodeficiency virus
  • AIDS immunodeficiency syndrome
  • factors other than HIV are essential for activation of HIV thereby enhancing its replication to the levels required to cause AIDS.
  • viruses including JC, adenoviruses and the herpesviruses including HSV-l, HSV-2, HCMV, VZV, EBV, HHV6 and HHV7.
  • Specific genes of those viruses activate the expression of HIV either directly at the level of virus replication or indirectly by activating expression of a reporter gene driven by the HIV promoter.
  • HSV-l genes involved in HIV activation include IE110 (encoded by IE1) .
  • Vero African green monkey kidney cells were grown in Eagle's minimal essential medium (MEM) supplemented with 25 M HEPES and 10% (v/v) fetal bovine serum.
  • HEp-2 human epidermoid carcinoma No. 2 cells were grown in medium 199 with 10% calf serum.
  • U937 human histiocytic lymphoma cells were grown in RPMI 1640 with heat-inactivated fetal calf serum.
  • Oligo(nucleoside-methylphosphonate)s were synthesized, for example, as described in either of Miller et al. (Biochem 18, 5134-5143, 1979), Miller et al.
  • the process is a solid phase technique using, for example polystyrene as a support.
  • the process consists of esterifying a 5•-O-protected nucleoside having a 3'-hydroxyl group with an alkyl or arylphosphonic acid in the presence of a condensing agent, such as mesitylenesulfonyl tetrazolide.
  • a condensing agent such as mesitylenesulfonyl tetrazolide.
  • the result is a 5'-O-protected nucleoside-3'-O-alkyl or arylphosphonate.
  • That resulting compound is then esterified with a 3'-0- protected nucleoside having a 5'-hydroxyl group in the presence of a condensing agent to form a fully protected dinucleoside alkyl or arylphosphonate.
  • the protecting groups are removed from the dinucleoside compound to form the dinucleoside alkyl or arylphosphonate.
  • the protected dinucleoside was treated with hydrazine.
  • the 3'-0-acetyl and 5'-0- dimethoxytrityl protecting groups were removed by sequential treatment with ammonium hydroxide and 80% acetic acid.
  • the process is repeated the requisite number of steps using the appropriate protected nucleosides to form an oligonucleotide of defined length and sequence.
  • the process can also be carried out by esterifying a 3*-O-protected nucleoside having a 5'-hydroxyl group with an alkyl or arylphosphonate in the presence of an activating agent to form a 3'-O-protected nucleoside-5'-O- alkyl or arylphosphonate. That compound is then esterified with a 5'-O-protected nucleoside having a 3'-hydroxyl group in the presence of an activating agent to form a fully protected dinucleoside alkyl or arylphosphonate.
  • HSV-l was grown and titered on Vero or HEp-2 cells as described in Strnad & Aurelian (Virol 87, 401-415, 1978). Cytoplasmic RNA was extracted from virus- infected cells. In some cases, infected cells were treated with cycloheximide (50 ⁇ g/ml) to enhance mRNA production. At six hours postinfection, cells were washed and harvested in 100 mM tris/HCl (pH 7.4) with 150 mM NaCl.
  • the cells at a concentration of 2 x 10 per ml were resuspended in lysis buffer comprising 10 mM tris/HCl (pH 7.5)/150 mM NaCl/1.5 mM MgCl 2 /0.5% Nonidet P-40/20 mM vanadyl ribonucleoside complex.
  • the suspension was vortexed gently and placed on ice for 10 minutes. After lysis, the suspension was centrifuged at 400 x g for 5 minutes, the supernatant was removed and added to 3 volumes of buffer containing 10 mM tris/HCl (pH 7.5), 5 mM EDTA and 0.5% sodium dodecyl sulphate.
  • the solution was extracted with phenol/chloroform followed by chloroform, made 0.3 M in sodium acetate (pH 5.0) and precipitated with 2.5 volumes of cold ethanol.
  • SI nuclease analysis was performed by co- precipitating a labelled viral genomic probe (Kulka et al. PNAS 86, 6868-6872, 1989) with 10 ⁇ g of cytoplasmic RNA obtained as described above.
  • the virus-infected cells were either treated or not treated with one or more oligonucleotides.
  • the DNA/RNA pellet was resuspended in 20 ⁇ l of 90% (v/v) formamide in 0.4 M NaCl/40 mM PIPES, pH 6.8/1 mM EDTA.
  • the mixture was heated at 90 * C for 3 minutes, incubated at 57.5°C for 16 hours and then rapidly chilled on ice.
  • Nuclease SI digestion was performed at 28 ⁇ C for 1 hour in 300 ⁇ l of 0.25 M NaCl/30 mM sodium acetate, pH 4.5/2 mM ZnS0 4 with 60 units of SI nuclease.
  • the Sl-digested hybrids were extracted with phenol/chloroform and precipitated with ethanol.
  • the products were analyzed by electrophoresis (room temperature, 16 hours, 50V) on 1.5% agarose gels under nondenaturing (90 mM tris/90 mM boric acid, pH 8.3/1 mM EDTA) or alkaline (30 mM NaOH/2 mM EDTA) conditions. Gels were dried on DE-18 paper and radioactivity visualized by autoradiography (at room temperature) using Kodak X-Omat-S film. Relative proportions of spliced and unspliced mRNA were determined by densitometric scanning on a UV/visible spectrophotometer.
  • Cell proteins were metabolically labelled with [ 35S] methi.onine (150 ⁇ Ci/per ml) from 6 to 7 hours post-infection.
  • the cells were harvested, washed in cold PBS (phosphate-buffered saline) and resuspended in lysis buffer (10 mM tris, pH 8.0/150 mM NaCl/1% Nonidet P-40/1% deoxycholate/0.1% sodium dodecyl sulphate/1 mM phenylmethylsulfonyl fluoride) at a concentration of 1 x 10 cells per 25 ⁇ l.
  • lysis buffer (10 mM tris, pH 8.0/150 mM NaCl/1% Nonidet P-40/1% deoxycholate/0.1% sodium dodecyl sulphate/1 mM phenylmethylsulfonyl fluoride
  • the suspensions were cleared of cell debris _ by centrifugation at 5000 x g for 10 minutes. Electrophoresis was carried out under reducing conditions in 8.5% polyacryla ide gels. For in vivo assays the antiviral activity of an oligonucleotide was examined in the mouse. Mice were anesthetized using, for example, ether or intraperitoneal injection of sodium pentobarbital. Animals were infected with about 2 x 10 3 to 1 x 10 pfu of HSV-l. Animals were ear injected with a volume of approximately 10 ⁇ l or in the foot pad with about the same volume.
  • mice in experimental groups were treated dermally with oligomer in a PEG base at the site of injection on day 0 or on days 0-5 after infection or injected with oligomer at infection. Tissues were examined for virus titer on day 6 after infection. Virus titers were determined on Vero cells.
  • CAT chloramphenicol acetyl transferase
  • the construct pICPlO-cat contains a 649 base pair fragment of HSV-2 DNA, the ICP10 promoter, inserted 5' to the CAT structural gene.
  • a plasmid carrying the HIV promoter (HIV-LTR) driving the CAT gene was also used. With the appropriate transcription signals, the CAT mRNA is produced and translation of the bacterial CAT occurs.
  • CAT activity was monitored using an art- recognized assay. Briefly, 0.2 ⁇ Ci of [ 14C] chloramphenicol substrate is mixed with the test solution and incubated for 1 hour. Radioactivity was monitored in a liquid scintillation counter.
  • Vero cells were cotransfected with the target plasmid pICPlO-cat and a transactivating IE110 containing plasmid (pIGA-15) as described in Wymer et al., supra.
  • the transfection mixtures contain 1 mg of target plasmid and 0.1 g of transactivator DNA.
  • Parallel cotransfeetions employ pBR322 as non-specific DNA to equalize concentration effects.
  • the recombinant plasmid pSV2CAT was used as a positive control and the plasmid pCATB 1 was used as a negative control.
  • Transfected cells were incubated in the presence or absence of increasing concentrations (0-250 ⁇ M) of oligomer added immediately after transfection (0 hours) and harvested 40-44 hours later.
  • HIV titers were determined by a syncytium formation assay. Briefly AA2 cells (2 x 10 4 ) were grown in 96-well flat bottom microliter plates in RPMI 1640 with 10% heat-inactivated fetal calf serum, non-essential amino acids, 1 mM pyruvate and 1.5 ⁇ g/ml polybrene (Sigma) .
  • HTLV-III B was obtained by clarifying the supernatant of an infected MOLT-3 cell line grown in RPMI 1640 with 10% heat- inactivated fetal calf serum. Two-fold dilutions of MOLT-3 supernatant in 100 ⁇ l volumes were added to the AA2 cultures and incubated for 5-8 days. Titers, expressed as infectious units, represent the reciprocal of the highest dilution that gives rise to syncytium formation.
  • Vero cells were exposed to the dodecamer, TTCCTCCTGCGG (0-100 ⁇ M) at the time of infection with HSV-l (10 pfu per cell) and virus titers were determined 24 hours lat ⁇ r. Other oligomers were used in similar fashion. The results of those experiments are shown in Figure 3 and summarized in Table 1 on the following page. Cultures exposed to the octomer TCCTCCTG and dodecamer showed a dose dependent decrease in HSV-l titer. Significant reduction in virus growth (90- 98%) was seen in cultures exposed to the dodecamer in a concentration of 100 ⁇ M.
  • IE mRNA's 4 and 5 are colinear on the HSV-l and HSV-2 genomes with 65% base sequence homology at the splice acceptor type. As shown in Table 1, some of the oligonucleotides were effective in both strains whereas other oligonucleotides were specific for HSV-l.
  • HSV-l- or HSV-2-infected Vero cells were treated with the respective oligomers (100 ⁇ M) at 0 hour postinfection. Infectious virus was determined by plaque assay at 24 hour postinfection. Results are the average of three to six experiments for each oligomer. They are expressed as the percent inhibition of virus titers compared to the appropriate control (no oligomer) .
  • HSV-l IE mRNA 4 acceptor splice site is shown in parentheses.
  • the HSV-2 IE mRNA 4 acceptor splice Site is GGGCCG GACGCT.
  • Cytoplasmic RNA (10 ⁇ g) extracted from HSV-1- infected HEp-2 cells untreated or treated with 100 ⁇ M of the dodecamer TTCCTCCTGCGG at the time of infection was hybridized with a labelled HSV probe and then digested with SI nuclease.
  • the band pattern of nuclease- resistant products from untreated cells consisted of two major bands which were interpreted to represent the 5' leader to the Hindlll site (1200 base pairs, bp) and the splice junction to the Hindlll site (930 bp) .
  • Nuclease-resistant products from the oligomer- treated cells consisted of three bands.
  • the nuclease-resistant products from oligomer- treated cells revealed two bands including the 900 bp band and an additional 1300 bp band that probably corresponded to an RNA transcript extending from the 5 1 leader through the intron to the 3' Hindlll site.
  • Approximately 16-20% of the IE mRNA 4 from oligomer-treated cells was present as unspliced message, as determined by densitometric scanning. The result was about a 20% decrease in the levels of spliced mRNA.
  • HEp-2 cells were infected with HSV-l (25 pfu per cell) or mock infected with PBS in the presence of 2.8 mM L-canavanine. (L-canavanine restricts gene expression to IE( ⁇ ) and a subclass of E ( ⁇ ) proteins.)
  • the cells were then treated with 100 mM of the dodecamer, TTCCTCCTGCGG.
  • the cells were labelled with [ 35 S] methionine (150 ⁇ Ci/ml) at 6-7 hours postinfection.
  • Cell extracts were adjusted to the same protein concentration and analyzed on sodium dodecyl sulphate polyacrylamide gels. The gel analysis revealed that the synthesis of viral but not cellular proteins was reduced significantly by oligomer treatment.
  • the effect of an oligomer to the donor splice site of IE mRNA4,5 on HSV-l growth was determined in comparison to the effect of the oligomer to the acceptor splice site shown in Example 1.
  • Vero cells were infected with 10 pfu per cell of HSV-l and treated with four different dodecamers at a concentration of 0-200 ⁇ M.
  • the dodecamers included the two of Example 4, the dodecamer of Example 1, and the dodecamer complementary to the IE4,5 mRNA splice donor site, GCTTACCCGTGC. Virus titers were determined 24 hours later.
  • both of the dodecamers complementary to the IE mRNA4,5 acceptor and donor splice sites resulted in 85-98% inhibition of virus growth in the concentration range of 100-200 mM.
  • the dodecamer complementary to the IE mRNAl translation initiation site resulted in a maximum of about 15-20% inhibition of virus growth and the dodecamer complementary to the IE mRNA 1 second splice acceptor site resulted in no inhibition.
  • Example 4 Although the dodecamers of Example 4 showed a dose dependent inhibition of IEllO-mediated transactivation of CAT activity, the oligomers had minimal or no affect on HSV-l growth at a m.o.i. of 10.
  • the role of virus concentration and ability of the IE110 oligomers to inhibit HSV-l growth were examined. Vero cells infected with either 10 pfu or 0.1 pfu per cell of HSV-l were exposed to the oligomer GCGGGGCTCCAT in a concentration range of 0-200 mM at the time of infection. Virus titers were determined 24 hours later. The results are summarized in Figure 6 for two independent experiments. The dodecamer resulted in significant inhibition of virus growth in Vero cells infected at a low m.o.i * .
  • oligonucleotide complementary to the initiation site of IE4 (designated in Figure 8 as IE68) and oligonucleotide complementary to the IE5 initiation site (designated in Figure 8 as IE12) were tested as described above.
  • the data summarized in Figure 8 reveal that the IE12 oligonucleotide was ineffective in inhibiting virus growth whereas the other nucleotides resulted in a 85-95% inhibition of viral growth over a range of 25-200 mM of the oligonucleotides. Mixing the two oligonucleotides did not diminish the binding and inhibitory activity of the IE5 initiation site oligonucleotide.
  • mice were infected with HSV-l (2000 pfu) , treated with oligomer on day 0 or on days 0-5 postinfection and the tissues were examined for virus titers on day 6 postinfection. While single treatment with oligomer (500 ⁇ M) had little effect on virus growth (27% inhibition) , daily application resulted in 82% inhibition of virus titers. With a higher concentration of virus per dose, 2 x 10 pfu, animals treated twice daily (receiving a total amount of 1000 ⁇ M per day) with TTCCTCCTGCGG did not develop lesions (0/5 as compared to 5/5 in untreated animals) .
  • viruses including JC, adenoviruses and the herpesviruses including HSV-l, HSV-2, HCMV, VZV, EBV, HHV-6 and HHV-7.
  • viruses including JC, adenoviruses and the herpesviruses including HSV-l, HSV-2, HCMV, VZV, EBV, HHV-6 and HHV-7.
  • Specific genes of the herpesviruses activate the expression of HIV either directly at the level of viral replication or by activating expression of a reporter gene driven by the HIV promoter.
  • U937 cells were cotransfected with a construct carrying the HIV-LTR promoter upstream to the CAT structural gene and a construct carrying sequences encoding HSV-l IE110.
  • Those same transfected cells were then treated with oligomers complementary to the initiation or splice sites of the IE110 gene. After 40 hours of culture, the presence or absence of CAT was determined. Results of a representative experiment are presented in Figure 9. In the experiment, three different oligomers were tested, two are complementary to IE110 sequences and the oligomer denoted as IE4,5 is complementary to an unrelated gene. The oligomers were used at two different concentrations. The two oligomers complementary to IE110 sequences resulted in a dose-related inhibition of the HIV promoter with the oligomer complementary to the initiation site showing a higher level of activity than the oligomer complementary to the second splice site.
  • the level of virus growth did not differ however from the degree of HIV activation obtained when the cells were exposed to the control plasmid pBR322.
  • U937 cells were exposed also to the homologue IE gene product of cytomegalovirus.
  • the degree of activation was not as great as that found with the HSV gene product, there was a significant enhancement of HIV growth by the CMV gene product.
  • oligonucleotides were infected with HSV-l and injected interdermally with the oligonucleotide TTCCTCCTGCGG at the time of infection. Then once daily thereafter the oligonucleotide suspended in a PEG (polyethylene glycol) cream was applied to the site of infection. The concentration of oligonucleotide in the cream was 500 ⁇ M which is 5-fold higher than used for parenteral administration. The results are summarized in Table 2.
  • Virus dose (1 x 10 6 PFU) Vehicle (no oligomer) 2 x 10 Oligomer (500 ⁇ M) 5.0 x 10 75 Virus dose (1 x 10 4 PFU) Vehicle (no oligomer) 8 x 10 Oligomer (500 ⁇ M) 6.8 x 10 91.5
  • virus titers were reduced significantly, however, somewhat better inhibition was obtained at an initial low virus dose of 1 x 10 pfu. All publications cited in the specification are herein incorporated by reference.
  • compositions and methods of the instant invention are capable of being incorporated in the form of variety of embodiments, only a few of which have been illustrated and described above.
  • the invention may be embodied in other specific forms without departing from the spirit or the central characteristics of said invention.
  • the described embodiments are to be considered in all respects only as illustrative and not restrictive. All changes that come within the meaning and range of equivalency of the claims are to be embraced within the scope of the claims in view of the teachings in the specification.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Plant Pathology (AREA)
  • AIDS & HIV (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US1991/006646 1990-09-21 1991-09-18 Compositions and methods for inhibiting growth or replication of viruses Ceased WO1992005284A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP91918745A EP0656942A1 (en) 1990-09-21 1991-09-18 Compositions and methods for inhibiting growth or replication of viruses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US58618590A 1990-09-21 1990-09-21
US586,185 1990-09-21

Publications (1)

Publication Number Publication Date
WO1992005284A1 true WO1992005284A1 (en) 1992-04-02

Family

ID=24344663

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/006646 Ceased WO1992005284A1 (en) 1990-09-21 1991-09-18 Compositions and methods for inhibiting growth or replication of viruses

Country Status (8)

Country Link
EP (1) EP0656942A1 (enExample)
JP (1) JPH06501162A (enExample)
AU (2) AU8756691A (enExample)
CA (1) CA2092711A1 (enExample)
IE (1) IE913321A1 (enExample)
IL (1) IL99543A0 (enExample)
NZ (1) NZ239883A (enExample)
WO (1) WO1992005284A1 (enExample)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0547149A4 (en) * 1990-08-15 1993-09-01 Genta Incorporated Inhibition of herpesviridae infection by antisense oligonucleotides
WO1994001551A1 (en) * 1992-07-02 1994-01-20 United States Of America, Represented By The Secretary, Department Of Health And Human Services Method of inhibiting viral replication
FR2708270A1 (fr) * 1993-07-28 1995-02-03 Genset Sa Oligonucléotides antisens dirigés contre les virus Herpès Simplex de types 1 & 2.
WO1995032986A1 (en) * 1994-06-01 1995-12-07 Hybridon, Inc. Branched oligonucleotides as pathogen-inhibitory agents
US5563050A (en) * 1993-09-17 1996-10-08 Hoechst Aktiengesellschaft Antisense oligonucleotides against HSV 1, and their preparation
US5591840A (en) * 1992-09-23 1997-01-07 Hoffmann-La Roche Inc. Antisense oligonucleotides directed against nucleic acids encoding NFKB transcription factor
US7176303B2 (en) * 2003-11-06 2007-02-13 Isis Pharmaceuticals, Inc. Modulation of STAT5 expression
WO2024113302A1 (zh) * 2022-12-01 2024-06-06 深圳先进技术研究院 靶向HSV必需基因的gRNA、CRISPR/Cas基因编辑系统、递送系统及应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5004810A (en) * 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NZ209840A (en) * 1983-10-17 1988-11-29 Kaji Akira A method of inhibiting viral propagation by hybridising dna with the viral rna thus blocking its action
EP0402402B1 (en) * 1988-02-26 1995-12-27 Worcester Foundation For Biomedical Research, Inc. Inhibition of htlv-iii by exogenous oligonucleotides

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5004810A (en) * 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Biochimie, Volume 67, issued 1985, P.S. MILLER et al., "Control of Ribonucleic Acid Function by Oligonucleoside Methyl Phosphonates", pages 769-776, see entire document. *
Cancer Research, Volume 48, issued 15 May 1988, A. STEIN et al., "Oligodeoxynucleotides as Inhibitors of Gene Expression: A Review", pages 2659-2668, see entire document. *
Proceedings National Academy of Science, Volume 83, issued May 1986, C.C. SMITH et al., "Antiviral Effect of an Alyol Nucleoside Methylphosphmate) Complementary to the Splice Junction of Herpes Simplex Virus Type 1 Immediate Early pre-m RPAs 4+5", pages 2787-2791, see entire document. *
Proceedings Natural Academy of Science, Volume 85, issued August 1988, GOODCHILD et al., "Inhibition of Human Immunodeficiency Virus Replication by Antisense Oligodeoxynucleotides", pages 5507-5511, see entire document. *
See also references of EP0656942A4 *

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0547149A4 (en) * 1990-08-15 1993-09-01 Genta Incorporated Inhibition of herpesviridae infection by antisense oligonucleotides
WO1994001551A1 (en) * 1992-07-02 1994-01-20 United States Of America, Represented By The Secretary, Department Of Health And Human Services Method of inhibiting viral replication
US5591840A (en) * 1992-09-23 1997-01-07 Hoffmann-La Roche Inc. Antisense oligonucleotides directed against nucleic acids encoding NFKB transcription factor
FR2708270A1 (fr) * 1993-07-28 1995-02-03 Genset Sa Oligonucléotides antisens dirigés contre les virus Herpès Simplex de types 1 & 2.
WO1995004141A1 (fr) * 1993-07-28 1995-02-09 Genset Oligonucleotides antisens diriges contre les virus herpes simplex de types 1 et 2
EP0666317A3 (de) * 1993-09-17 1996-12-11 Hoechst Ag Neue Antisense-Oligonucleotide gegen HSV-1 sowie deren Herstellung.
US5563050A (en) * 1993-09-17 1996-10-08 Hoechst Aktiengesellschaft Antisense oligonucleotides against HSV 1, and their preparation
WO1995032986A1 (en) * 1994-06-01 1995-12-07 Hybridon, Inc. Branched oligonucleotides as pathogen-inhibitory agents
US6489464B1 (en) 1994-06-01 2002-12-03 Hybridon, Inc. Branched oligonucleotides as pathogen-inhibitory agents
US7176303B2 (en) * 2003-11-06 2007-02-13 Isis Pharmaceuticals, Inc. Modulation of STAT5 expression
US7709628B2 (en) 2003-11-06 2010-05-04 Isis Pharmaceuticals, Inc. Modulation of STAT5 expression
US8722873B2 (en) 2003-11-06 2014-05-13 Isis Pharmaceuticals, Inc. Modulation of stat5 expression
WO2024113302A1 (zh) * 2022-12-01 2024-06-06 深圳先进技术研究院 靶向HSV必需基因的gRNA、CRISPR/Cas基因编辑系统、递送系统及应用

Also Published As

Publication number Publication date
NZ239883A (en) 1993-10-26
AU2491095A (en) 1995-11-02
AU8756691A (en) 1992-04-15
IE913321A1 (en) 1992-02-25
JPH06501162A (ja) 1994-02-10
EP0656942A1 (en) 1995-06-14
IL99543A0 (en) 1992-08-18
EP0656942A4 (enExample) 1998-04-15
CA2092711A1 (en) 1992-03-22

Similar Documents

Publication Publication Date Title
Zabolotny et al. The herpes simplex virus type 1 2.0-kilobase latency-associated transcript is a stable intron which branches at a guanosine
US6265167B1 (en) Targeted RNA degradation using nuclear ribozyme RNA
Ambinder et al. Definition of the sequence requirements for binding of the EBNA-1 protein to its palindromic target sites in Epstein-Barr virus DNA
Boldogh et al. Transcriptional activation of cellular oncogenes fos, jun, and myc by human cytomegalovirus
US6150339A (en) Anti-viral guanosine-rich oligonucleotides
AU678628B2 (en) Oligonucleotide modulation of multidrug resistance-associated protein
US5442049A (en) Oligonucleotides for modulating the effects of cytomegalovirus infections
US5004810A (en) Antiviral oligomers
US20090311788A1 (en) Multiple-compartment eukaryotic expression systems
AU2003202376A1 (en) Oligonucleotides comprising alternating segments and uses thereof
JPH02276577A (ja) HIV Iからのトランスアクチベーター標的配列(TAR)およびトランスアクチベータータンパク質(Tat)の合成の阻害のためのアンチセンスオリゴヌクレオチド類およびそれらの使用
JP5010466B2 (ja) Dnaウイルスのマイクロrna及びそれを阻害する医薬品
CN101426535B (zh) Dna病毒微小rna及其抑制方法
AU662040B2 (en) Pseudorabies virus (PRV) polynucleotides and their use for preparing virus-resistant eukaryotic cells
EP0656942A1 (en) Compositions and methods for inhibiting growth or replication of viruses
US7704965B2 (en) Methods and materials for treating human papillomavirus infections
US5990298A (en) CIS-acting cellular nucleic acid molecules
AU698089B2 (en) Oligonucleotides with anti-cytomegalovirus activity
US6403302B1 (en) Methods and compositions for triple helix formation
Adami et al. The length but not the sequence of the polyoma virus late leader exon is important for both late RNA splicing and stability
CA2211877A1 (en) Human immunodeficiency virus transcription inhibitors and methods of their use
WO1995022554A1 (en) Oligonucleotides with anti-epstein-barr virus activity
US5837854A (en) Oligonucleotides with anti-Epstein-Barr virus activity
NZ239372A (en) Inhibition of herpes virus infection by antisense oligomers
Remenick et al. Inhibition of adenovirus DNA replication by vesicular stomatitis virus leader RNA

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA FI JP KR NO SU

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 2092711

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1991918745

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1991918745

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1991918745

Country of ref document: EP