WO1992003576A1

WO1992003576A1 - A novel procedure for the detection of pathogens using dna probes

Info

Publication number: WO1992003576A1
Application number: PCT/SE1991/000533
Authority: WO
Inventors: Ayyanathan Kasirajan; Datta Santanu
Original assignee: Aktiebolaget Astra
Priority date: 1990-08-15
Filing date: 1991-08-13
Publication date: 1992-03-05
Also published as: CN1059910A; AU8409991A; IL99025A0; PT98687A; MX9100627A; JPH05501961A; EP0495075A1; IS3742A7; BR9105861A

Abstract

Disclosed are novel methods by which a rapid, multisample, non-radiactive procedure to detect pathogens, such as Plasmodium falciparum parasites, in biological fluids including human blood samples is achieved. The detection is based on the use of parasite specific DNA probes and sandwich hybridization technique employing microtitre plates. The high sensitivity and specificity of these assays and the ease with which they can be performed enables one to use them for routine analyses of a large number of blood and other coloured tissue samples of vertebrates and invertebrates. Especially, these assays can be used to detect the presence of P. falciparum. The procedure described is amenable for application in a wide variety of DNA detection analysis using non radioactive DNA probes. In regard to detection of P. falciparum, the invention also relates to novel DNA fragments and hybridisation probes based on such fragments. The invention provides a diagnostic kit on the basis of the novel methods.

Description

A NOVEL PROCEDURE FOR THE DETECTION OF PATHOGENS USJLKG DNA £r^'. £?,3

Summary of the invention:

Disclosed are novel methods by which a rapid, multisample, non-radioactive procedure to detect pathogens, such as Plasmodiu falciparum parasites, in biological fluids including human blood samples is achieved. The detection is based on the use of parasite specific DNA probes and sandwich hybridization technique employing microtitre plates. The high sensitivity and specificity of these assays and the ease with which they can be performed enables one to use them for routine analyses of a large number of blood and other coloured tissue samples of vertebrates and invertebrates. Especially, these assays can be used to detect the presence of P.falciparum. The procedure described is amenable for application in a wide variety of DNA detection analysis using non radioactive DNA probes. In regard to detection of P.falicaprum, the invention also relates to novel DNA fragments and hybridisation probes based on such fragments.

The invention provides a diagnostic kit on the basis of the novel methods.

SUBSTITUTESHEET BACKGROUND OF THE INVENTION

Malaria is caused by protozoan parasites belonging to the genus Plasmodiu . The life cycle of the parasite occurs in two phases - the asexual phase in vertebrates and the sexual phase in mosquito (usually of the genus Anopheles) . The four species of Plasmodium responsible for human malaria are P.falciparum, P.vivax, P.malariae and P.ovale. Among these, the first two are the most common. P.falciparum causes the most severe form of malaria which in some instances is fatal. Furthermore, this parasite also develops resistance to the commonly used antimalarial drugs.

The current method of diagnosis of malaria is by blood smear examination. This method is laborious and also requires expertise. Further, a skilled microscopist is allowed to examine a maximum of sixty slides a day. Diagnosis by serology may also be done, but because of the persistence of antibodies current infections cannot be distinguished from past infections (1). Hence, the search for a new generation of diagnostic tests has included the possibility of detecting parasite nucleic acids as indicative of the presence of the parasite. Theoretically such a test should require very little blood (5-50 μl) that can be obtained from a finger prick, and should be sensitive and rapid. As few as 50 parasites in 10 μl of blood can be detected by nucleic acid hybridization (2). Hundreds of samples can be analyzed in a day with some initial training. The sensitivity of the assay enables the test to be used in blood banks for the screening of blood to be used for transfusion.

Nucleic acid hybridization could also be performed on insect tissue samples in order to identify the vector species as a carrier. Such information would help to intensify vector control measures in order to limit the

SUBSTITUTE SHEET geographic spread of malaria. Alternatively, chcmo rophylaxι.3 κ.ay be adopted u; sucr, .-irsi-- and evaluation of this strategy may be accomplished using nucleic acid hybridization. The procedure described in this patent application provides an efficient means of accomplishing parasite detection using nucleic acid hybridization techniques.

The detection method described by the present invention can be used generally to detect the presence of pathogens, especially blood pathogens, in blood, tissues, samples and body fluids of humans as well as of vertebrates and invertebrates in general such as catties and insects.

The said pathogens may be e.g. bacteria, virus and parasites such as of the Plasmodium genus especially P.falciparum and P.vivax. As further examples of pathogens can be mentioned Shigella, e.g. Shigella flexneri, Shigella dysenteriae, Shigella sonnei, and Mycobacteriuπ. tuberculosis.

Although the specific examples in the present application relate to P.falciparum, it will be understood that the detection method is generally applicable as outlined above.

PRIOR ART

Nucleic acid (DNA and RNA) based hybridisation is now being used in a number of clinical diagnosis. Initially this technology utilised radioactively labelled probes. Though the sensitivity of the diagnosis in the radioactive format is satisfactory this method is not popular in the clinical laboratories owing to the precautions and regulations necessary in radioactive material handling. Pence there is an u ^gent need f zr r.on radioactⁱve detection in this field of pathogen detection by nucleic

SUBSTITUTE SHEET acid hybridisation. One of the most popular method of non isotopic detection is based on the incorporation of biotin enzymatically (3) or photochemically into the nucleic acid probes (4) . The hybrids that bind the biotin labelled probes can then be easily detected with complexes of avidin or streptavidin and suitable enzymes like phosphatase or peroxidase. Though the above mentioned non isotopic method looks attractive it has not been yet popular. A few important problems remain to be solved. The major problems relate to the coloured background and the state of purity of the target DNA. Most DNA based diagnostics are done on membrane filters (either nitrocellulose or nylon) . Body fluids like blood which are to be tested for the presence of pathogens when spotted directly on the membrane filter to immobilise the DNA leave an indelible coloured mark which makes the subsequent colour development after hybridisation almost impossible. Thus the only alternative left is spotting pure DNA obtained from the pathogens that are present in the tissue or body fluid. Since isolation of DNA involves a procedure which includes centrifugation and precipitation, it severely curtails the feasibility of a rapid multisample diagnosis. For a preferable diagnostic procedure based on nucleic acid hybridisation the following conditions are essential.

ESSENTIALS OF A GOOD DNA BASED MULTISAMPLE DIAGNOSTIC PROCEDURE.

1. It should be based on non radioactive detection

2. It should use small amount of blood (a drop from a finger prick) .

3. Most of the components used in the diagnostic kit should be stable at room temperature. 4. Exact micropipeting of individual components should be avoided. 5. Centrifugation and precipitation steps should be

SUBSTITUTE SHEET avoided, fi. It should tequire minimum trairiiiy f.>.r sv-c csε ul operation. By the present invention a detection method is provided which fulfills all these criteria.

The present invention is summarised in the following clauses:

1. A single stranded DNA fragment (f63) having the sequence given below:

AGGTCTTAACATGACTAACTAAGGTCTTAACTTAACTAACTTAGGTCTTACTTTAACTAA or its complementary strand or variants thereof hybridisable to f63 or its complementary strand, or the corresponding double stranded sequence. It is preferred to use the single stranded DNA.

2. A DNA fragment as defined by clause 1 or contiguous segment thereof which is at least greater than 20 bases or base pairs in length and more particularly AGGTCTTAACATGACTAACTA.

3.A DNA fragment according to clauses 1 or 2 in single stranded form.

4. A hybridization probe comprising a DNA fragment as defined in clause 1 and 2.

5. A hybridization probe according to clause 4 which is labelled by a group capable of colourimetric detection. The nature of this group is not critical for this invention.

6. A hybridization probe according to clause 5 wherein the labelled group for colourimetric detection is biotin. Biotin is a preferred reporter group.

7. A hybridization probe according to clause 5 wherein the

SUBSTITUTE SHEET labelled group for colourimetric detection is a σhromophoric reporter group.

* 8, A method for detecting a pathogen present in blood or other body fluid comprising of the following steps: a) Lysing a blood sample in a solution containing Guanidine hydroσhloride (GuHCl), Sodium lauryl sareosine (SLS) and Triton-X-100. b) Denaturing the DNA present in the said blood sample suitably by heating and performing solution hybridization in presence of a hybridization probe which hybridizes with DNA of the said pathogen. c) Capturing the hybrids formed in step 8 (b) in a microtitre plate coated with a hybridization probe which has a nucleotide sequence capable of hybridizing to the same strand of genomic DNA that the hybridzation probe used in step 8 (b) binds. In a preferred embodiment, especially for detection of P.falciparum, the nucleotide sequence used in coating the microtiter plate is identical to the sequence of the hybridization probe used in step 8 (b). d) Washing the microtitre plate with a solution comprising Standard Saline Citrate (SSC), Sodium dodecyl Sulfate (SDS) and Triton-X-100. e) Detection of the presence of the hybrids by colourimetric methods.

9. A method according to clause 8 wherein the hybridization probe is as defined in Clause 2 and 3. In a preferred aspect the invention is used in the detection of plasmodial species.

10. A method according to clauses 8 and 9 wherein the final concentration of the reagents in step 8 (a) are as follows: a) Guanidine hydrochloride: Between 1.0M - 3.0M b) Sodium lauryl sareosine: Between 0.2% - 0.5% W/v / N/v

SUBSTITUTESHEET c) Triton-X-100: Between 0.2% - 0.5% v/v / v/v The above repie^e^t isferred intervals.

11. A method according to clauses 8 and 9 wherein the final concentration in step 8 (e) are as follows: a) Standard Saline Citrate - 0.5 X - 2.5 X SSC b) Triton-X-100 - 0.2% - 0.5% V/V c) Sodium dodecyl Sulphate - 0.2% - 0.5% W/V The above represent preferred intervals.

12. A method according to claus 8-1 wherein the lysing solution is used both as a solubilising agent and as hybridization solution.

13. A method according to clauses 8 to 12 wherein 2X SSC is used to remove nonspecific hybrids.

14. A method according to clauses 8 and 14 wherein Triton- X-100 and SDS are used for the removal of the colouring material originating from the blood.

15. A method according to clauses 8 to 14 wherein the pathogen is P.falciparum.

16. A method according to clauses 8 to 14 wherein the pathogen is P.vivax.

17. A method according to clauses 8 to 14 wherein the pathogen is Shigella.

18. A method according to clauses 8 to 14 wherein the pathogen is Mycobacterium tuberculosis.

19. A diagnostic kit for the detection of a given nucleotide sequence present in a target polynucleotide

^•sequence on the basis of t^e rr thcd a'-COT-ling to c^lauses 8 to 18.

SUBSTITUTE SHEET PRINCIPLE OF DNA BASED SANDWICH HYBRIDISATION

Background:

In the non radioactive format the final mode of detection is the development of a colour either soluble or insoluble depending on the nature of the substrate used in the reaction catalysed by either alkaline phosphatase or horse radish peroxidase. Therefore it is essential to remove the residual coloured material from the target DNA as well as inactivating the endogenous enzyme. This makes spotting blood directly onto membrane filters (as is done in the radioactive hybridisation format) useless since the removal of residual blood stains from the filter is almost impossible. To cirumvent this problem we have used the microtitre plate format coupled with sandwich hybridisation, the basic principle of which is described below.

It has been shown earlier that one of the characteristics of P.falciparum genome is that it contains a 21 base pair repeat that is present in tandem in a large region of the genome (5-6). The fraction of the genome represented by this repeated sequence is about 1%. Comparisons of several clones containing this repeat sequence have indicated a consensus 21 base pair repeat sequence. Based on this concensus sequence we have designed and constructed a 63 mer oligonucleotide probe (designated f63 hereafter). It consists of three 21 mers in tandem which are maximally represented in the repeated sequences of the P.falciparum DNA (Fig. 1). The preferred use of single stranded DNA as a probe and its said length is based on the following reasoning. Single stranded DNA is superior to double stranded as a probe because it hybridises only to the target DNA. In case of double stranded DNA there is a greater probability of self hybridisation thus reducing the effective concentration of the probe that is required

SUBSTITUTESHEET to bind the target DNA. This clearly establishes the superiority of the single stranded probe in its cost effectiveness as it is required in a much lower amount for hybridisation. Of the several methods that are available to make single stranded DNA, oligonucleotide synthesis is most convenient.

For detection of pathogens other than P.falciparum, one has to design an optimal DNA probe which is repeated in the pathogen DNA. This hybridization probe can then be used in a similar detection protocol of sandwich hybridization which is given below specifically for P.falciparum.

The basic protocol for the sandwich hybridisation is given below. (Also explained pictorially in Fig. 2)

FLOW CHART FOR NON RADIOACTIVE DIAGNOSIS OF P.FALCIPARUM INFECTION IN HUMAN BLOOD BY SANDWICH HYBRIDISATION

Add one drop of blood sample (50 μl) from a finger prick in a small plastic tube containing Lysing solution and bio-f63 probe

Phase 1 (i) Mix well

(ii) Heat in Boiling water bath for two minutes (iii) Leave at room temperature for a minimum of four hours Parasite DNA- bio-f63 probe hybrid See Fig. 1 Plate A

SUBSTITUTE SHEET (i) Transfer the mixture from the

Phase 2 tube in Phase 1 to wells in microtitre plates precoated with unlabelled f-63 probe (See Fig. 1. Plate B)

(ii) Allow to stand at room temperature for overnight.

CAPTURED HYBRID See Fig.l Plate C

(i) Wash microtitre plate wells from phase 2 with 2 x SSC

Phase 3 containing 0.2% SDS and 0.2% Triton x 100

(ii) Repeat wash procedure four times each time let stand wash buffer for 5 minutes.

( iii) Let stand in each well APB-1 solution for 30 minutes at room temperature.

( iv) Add one drop of ABD-1 containing streptavidin Alkaline phosphatase conjugate

( v) Let stand for 30 minutes at room temperature.

(vi) Discard solution in the wells

Phase 4 ( vii) Let stand APB-1 solution (without BSA) in each well for 5 minutes and discard solution (viii) Repeat above operation four times

(ix) Rinse each well with APB-2

Captured hybrid solution ready for (x) Add enzyme substrate in APB-2 detection by solution

SUBSTITUTE SHEET colorimetry (xi) Let stand at room temperature Fig . 1 Plate for at least 120 minutes (xii) Read absorbancy at 410 ran in a microtitre plate reader Phase 5 Colour with absorbancy values higher than 0.2

s ou g ve an a sor ancy value of less than 0.1

The success of this method depends on the fact that P.falicparum DNA remains nearly undegraded during the process. In the solution hybridisation step biotinylated f63 binds to P.falciparum DNA and would proceed to near completion, the rate of solution hybridisation being much faster when compared to immobilized target DNA. The efficiency of capture hybridisation is directly proportional to the lengt of the P.falciparum DNA. In the extreme limit it can be seen that if the P.falciparum DNA is totally undegraded then even a meagre 0.03% of capture hybridisation can bring down all the hybrid complex.

In the case of other pathogens, the efficiency of capture hybridization will depend on the number of times the probe is repeated in the pathogen genome.

SUBSTITUTE SHEET PROTOCOL FOR NON-ISOTOPIC DETECTION OF P.FALCIPARUM DNA IN BLOOD SAMPLES

* 1. Preparation of the probe: The probe., for coating the microtitre plates: The 63 er obligonucleotide (f63) was synthesised using the automated DNA synthesizer (Applied biosyste s 340A) .

Labeled probe for detecting the hybrids: Biotinylation of f63 was done by photobiotinylation using photobiotin acetate according to published procedures.

2. Coating of microtitre plates:

All the wells in the microtitre plate (Dynatech, Polyvinul chloride) are coated with varying amounts (lμg to lOng) of f63 in 50 ul volume containing 0.1 M MgC12. The coating is done overnight following which the microtitre plate is exposed under germicidal UV lamp (40 Watts) at a distance of 10 cms, for 5 minutes to immobilise DNA. The contents of the wells are discarded subsequently and the wells are washed with 2X SSC buffer. Unoccupied sites in each of the wells are blocked by carrying out prehybridisation in a buffer (200 ul/well) containing 2X SSC, 5X Denhardts, 0.5% Triton-X-100, 0.5% SDS and 50 ug/ml salmon sperm DNA. The prehybridisation is carried out for 4-6 hours at room temperature. The coated plates can be stored at this stage in room temperature.

3. Collection of blood samples and solution hybridisation: Blood samples (50 ul aliquots) are collected from a finger prick, directly into 50 ul of a solution containing 4M guanidine hydrochloride (Gu HC1), 0.5% sodium lauryl sareosine (SLS) and 0.5% Triton-X-100. This solution also contains 5 ng of oligonucleotide probe (biotinylated f- 63). This mixture is heated for 5 minutes at 95 deg C and then kept at room temperature for 4-6 hours for the solution hybridisation to occur.

SUBSTITUTE SHEET 4. Capture hybridisation:

After solution hybridisation is e:, the con nts of the eppendorf tubes are transferred into the wells of the microtitre plate that are precoated with unlabelled f-63. This sandwich hybridisation (capture) is allowed to go for 24 hours. During this phase, hybridisation occurs between the f-63 coated onto the plate and the rest of the complementary sites available in the hybrid. The hybrid is a long piece of target DNA carrying the biotinylated f-63 in certain locations leaving behind other complementary sites. (See Fig. 2).

5. Colour development:

After the sandwich hybridisation is over, the contents of the wells of the microtitre plate are discarded and wells are washed with a solution containing 2X SSC, 0.2% SDS and 0.2% Triton-X-100, four times, five minutes each at room temperature. During this post hybridisation wash, all the coloured materials are removed leaving behind the sandwich hybrid. The wells are then blocked with A.P 7.5 which is a solution containing 1M NaCl, 100 mM Tris-cl pH 7.5, 2nM MgC12, 0.05% Trition-X-100 and 3% BSA, for 30 minutes at room temperature.

The sandwich hybrids are then detected by using for example, Streptavidin-alkaline phosphatase conjugate. The Streptavidin alkaline phosphatase conjugate (1 ug/ml) is added to A.P 7.5 buffer. 50 ul of this solution (AP 7.5 buffer containing streptavidin alkaline phosphatase) is added to each well and incubation continued for another 30 minutes at room temperature. The excess unbound conjugate is removed by washing four times, five minutes each, at room temperature with A.P 7.5 buffer without BSA.

Finally the wells are rinsed with A.P 9.5 (substrate incubation buffer containing lOOm Triε-Cl pH 9.5, 100 mil NaCl and 50 mM MgCl2). 50 ul of the substrate

SUBSTITUTE SHEET p-nitrophenyl phosphate is added to A.P 9.5 at a concentration of lmg/ml and 50 ul of this solution is added to each well. The color development is allowed to take place for 6-12 hours. The absorbance (at 410 n.m. ) are recorded, using a suitable plate reader (e.g. Dynatech plate reader) .

The test results are given in the following table.

RESULTS:

Table 1 f63 SENSITIVITY DATA (Absorbance at 410 mm)

* T9/106 represent a chloroquine resistant P.falciparum clone.

Note: In human samples 50 ul of blood has about 50ng of parasite (P.falciparum) DNA if the infection is about 1%,

The term "over" indicates an optical density above 2.0.

SUBSTITUTESHEET FIGURE LEGENDS:

Fig. 1 shows the oligo f63 that was designed from the consensus repeated sequence (21 base repeat) of P.falciparum.

Legend to Fig. 2

A Solution hybridization. B Depicts Microtitre well coated with the probe f63, C Capture hybridization. D Capture hybrids after washing and ready for colour development.

Fig. 3 depticts; biotinylated f63 DNA genomic P.falciparum DNA £63 DNA

SUBSTITUTE SHEET References:

1. Seroepidimiology of Human Malaria : A multicentric study. Malaria Research Centre (ICMR) (1987).

2. Barker, R.H.Jr., Suebsaens, L., Rooney, W. , Alecrin, G.C., Dourado, H.V. and Wirth, D.F. (1986) Science 231, 1434.

3. Langer P.R., Waldrop A.A. and Ward, D.C. (1981), Proc.Natl, Acad. Sci. USA 78, 6633.

4. Forster, A.C., Mclnnes, J.L. , Skingle, D.C. and Symons, R.H. (1985) Nucleic Acids Res, ,13, 745.

5. Aslund, L. Franzen. L. , Westin, G. , Persson. T. , Wigzell, H. , and Pettersson. U. (1985) J.Mol.Biol. 185, 509.

6. Francis, V.S., Ayyanathan, K. , Bhat, P., Srinivasa, H. and Padmanaban, G. (1988). Indian J Biochem. Biophys 25_, 537.

SUBSTITUTE SHEET

Claims

CLAIMS :

1. A single ctrandv-.d DNA r-igmcnt (f63) having the

given below: AGGTCTTAACATGACTAACTAAGGTCTTAACTTAACTAACTTAGGTCTTACTTTAACTAA or its complementary strand or variants thereof hybridisable to f 63 or its complementary strand, or the corresponding double stranded sequence.

2. A DNA fragment as defined by claim 1 or contiguous segmen thereof which is at least greater than 20 bases or base pair in length, and more particularly AGGTCTTAACATGACTAACTA.

3. A DNA fragment according to claims 1 or 2 in single stranded form.

4. A hybridization probe comprising a DNA fragment as define in claims 1 and 2.

5. A hybridization probe according to claim 4 which is labelled by a group capable of colourimetric detection.

6. a hybridization probe according to claim 5 wherein the labelled group for colourimetric detection is biotin.

7. A hybridization probe according to claim 5 wherein the labelled group for colourimetric detection is a chromophoric reporter group.

8. A method for detecting a pathogen present in blood or oth body fluid comprising of the following steps: a) Lysing a blood sample in a solution containing GuHCl, SLS and Triton-X-100, b) Denaturing the DNA present in the said blood sample and performing solution hybridization in presence of a hybridization probe which hybridizes with DNA of the said pathogen, c) Capturing the hybrids formed step in 8 (b) in the said microtiter plate coated with a hybridization probe which has nucleotide suequence capable of hybridizing to the same stran of genomic DNA that the hybridization probe used in step 8 b binds, d) Washing the microtitre plate with a solution comprising SSC, SDS and Triton-X-100, e) Detection of the presence of the hybrids by colourimetric methods.

9. A method according to claim 8 wherein the denaturing steps 8b is carried out by heating.

10. A method according to claims 8 and 9 wherein the hybridization probe used in coating the microtiter plate has the same nucleotide sequence as the hybridization probe used in step 8b.

11. A method according to claim 8 wherein the hybridization probe is as defined in claims 2 and 3.

12. A method according to claims 8 to 11 wherein the final concentration of the reagents in step 8 (a) are as follows:

a) Guanidine hydrochloride: Between 1.0M - 3.0M b) Sodium lauryl sareosine: Between 0.2% - 0.5% W/V c) Triton-X-100: Between 0.2% - 0.5% V/V

13. A method according to claims 8 and 12 wherein the final concentration in step 8 (e) are as follows: a) Standard Saline Citrate - 0.5% - 2.5 X SSC b) Triton-X-100 -0.2% - 0.5% V/V c) Sodium dodecyl Sulphate - 0.2% - 0.5% W/V

14. A method according to claim 8 to 13 wherein the lysing solution is used both as a solubilising agent and as hybridization solution.

15. A method according to claims 8 to 14 wherein 2X SSC is used to remove nonspecific hybrids.

16. A method according to claims 8 to 15 wherein Triton-X-100 and SDS are used for the removal of the colouring material originating from the blood.

17. A method according to claims 8 to 16 wherein the pathogen is P.falciparum.

18. A method according to claims 8 to 16 wherein the pathogen is P.vivax.

19. A method according to claims 8 to 16 wherein the pathogen is Shigella.

20. A method according to claims 8 to 16 wherein the pathogen is Mycobacterium tuberculosis.

21. A method according to claims 8 to 16 wherein the pathogen is a blood pathogen.

22. A diagnostic kit for the detection of a given nucleotide sequence in a target polynucleotide sequence on the basis of the methods according to claims 8 to 21.