PT98687A - A novel process for the detection of pathogenic agents using DNA probes - Google Patents

Description

" NEW PROCESS FOR THE DETECTION OF PATOGENIC AGENTS USING DNA PROBES " Malaria is caused by protozoan parasites belonging to the genus Plasmodium. The life cycle of the parasites occurs in two phases: the asexual phase in vertebrates and the sexual phase in the mosquito (generally of the genus Anofeles). The four species of Plasmodium responsible for human malaria are P. falciparum, P. vivax and P. malariae and P, ovale. Among these, the first two species are the most common. P, falciparum gives the form of more severe malaria, which in some cases is fatal. In addition, this parasite also develops resistance to the commonly used antimalarial drugs. The current method for the diagnosis of malaria is the examination of a blood sample. This method is laborious and requires specialists as well. In addition, a microscope specialist examines a maximum of sixty slides a day. Serological diagnosis can also be made, but due to the persistence of antibodies, a distinction can not be made between the current infections of the old infections (1). However, the search for new diagnostic tests included the possibility of detecting nucleic acids from the parasite, as an indication of the presence of the parasite. A very small amount of blood (5-5%), which could be obtained from the puncture of a finger, would be necessary for this test and could be sensitive and rapid. Only 5 5 parasites could be detected in 10 Âμl of blood by nucleic acid hybridization (2). Hundreds of samples could be analyzed at one time with some initial preparation. Λ Test sensitivity makes it possible to use the blood bank test for the blood test to be used for transfusion.

Hybridization of the nucleic acid can also be performed on insect tissue samples, in view of the identification of the vector species as a carrier. This information may aid in the intensification of vector control calculations in order to limit the geographic spread of malaria. As an alternative, chemoprophylaxis can be adopted in such areas, and the effects of this strategy can be evaluated using nucleic acid hybridization. The process described in this application provides an effective means for achieving detection of the parasite using nucleic acid hybridization techniques. The detection method described in the present invention can generally be used to detect the presence of pathogens, especially blood pathogens, in blood, tissues, samples and human body fluids, as well as vertebrates and invertebrates, a such as cattle and insects.

Said pathogens may for example consist of bacteria, viruses and parasites, for example of the gene Plasmodium, especially P. falciparum and P. vivax. As examples of pathogens, gella, for example Shigella flexneri, Shigella desenteriae and Shigella sonnel, and Mycobacterium tuberculosis.

While specific examples of the present application relate to P. falciparum, it should be noted that the method of detection generally applies, as previously noted,

PREVIOUS TECHNIQUE

Nucleic acid (DNA and RNA) hybridization is currently used in a number of clinical diagnoses. Radioactive labeled probes were initially used in this technology. Although the sensitivity of the diagnosis in the radioactive procedure is satisfactory, this method is not popular in clinical studies because of the precautions and regulations that need to be observed when handling radioactive materials. There was therefore a pressing need for non-radioactive detection in the field of detection of pathogens by nucleic acid hybridization. One of the most popular methods of non-isotopic detection is based on the enantiomeric incorporation of biotin or photochemistry (3) into the nucleic acid probes (4). Hybrids which bind the labeled biotin probes can thus be readily detected with avidin or streptavidin complexes and suitable enzymes such as phosphatase or peroxidase. Although the above non-isotopic methods may be attractive, they are still not popular. Some important issues remain unresolved. The major problems relate to the color context and the purity state of the target DNA. Most DNA-based diagnostics are done on filter membranes (nitrocellulose or nylon). Organic fluids such as blood, which are intended to be assayed for screening of pathogenic agents, when placed directly on the filter membrane to immobilize the DNA, leave an indelible color mark which makes the subsequent development of the color after hyperlinking , almost impossible. Thus, the only possible alternative is to stain pure DNA obtained from pathogens present in tissues and organic fluids. Since DNA isolation involves a procedure that includes centrifugation and precipitation, this often reduces the possibility of multiple sample diagnostics. In order to carry out a preferred diagnostic procedure based on nucleic acid hybridization, the following conditions are essential:

ESSENTIAL CONDITIONS FOR CARRYING OUT A GOOD DIAGNOSTIC PROCEDURE FOR MULTIPLE SAMPLING BASED ON DNA 1. It should be based on non-radioactive detection 2. You should use small amounts of blood (one drop, by finger puncture). 3. Most of the components used in the diagnostic kit should be stable at room temperature. 4. Avoid exact micropiptation of individual components. 5. Avoid centrifugation and precipitation steps. 6. You should require minimal training for the operation to be successful.

According to the present invention, there is provided a detection process which obeys all of these criteria.

The present invention is summarized by the following clauses; A single stranded DNA fragment (f63), characterized by having the following sequence; AGGTCTTAACATGACTAACTAAGGTCTTAACTTAACTMCTTAGGTCTTACTTTAACTAAACT or its complementary strand or strand hybridizable variants or their complementary strand or corresponding double strand sequences. It is preferred to use single stranded DNA. 2. A DNA fragment as defined in clause 1 or a contiguous segment thereof having a length of at least 20 bases or 20 base pairs and especially AGGTCTTAACATGACTAACTA. A DNA fragment according to clauses 1 or 2, characterized in that it is in the form of a single strand. A hybridization probe, characterized in that it comprises a DNA fragment as defined in clauses 1 and 2. A hybridization probe according to clause 4, characterized in that it is marked by a group likely to be colorimetrically detected. The nature of this group is not critical to the present invention. A hybridization probe according to clause 5, characterized in that the group labeled for colorimetric detection consists of biotin. Biotin is a preferred reference group.

A hybridization probe according to clause 5, wherein the labeled group is colorimetric detectable consists of a chromophoric reference group. A method for the detection of a pathogenic agent present in blood or other body fluids characterized by the following steps: a) Lysis of a blood sample in a solution containing guanidine hydrochloride (GuHCl), lauryl sarcosine (b) denaturation of the DNA present in said blood sample, suitably by heating and effecting the hybridization solution in the presence of a hybridization probe, which hybridizes with DNA of said pathogenic agent. c) Capturing the hybrids formed in step 8 b) on the microtiter plate coated with a hybridization probe having a nucleotide sequence capable of hybridizing to the same strand of genomic DNA to which the hybridization probe used in step 8b). According to a preferred aspect, especially for the detection of P, falciparum, the nucleotide sequence used to cover the microtiter plate is identical to the sequence of the hybridization probe used in step 8 b). d) Washing of the microtiter plate with a solution comprising Standard Citrate Saline (SSC), sodium dodecyl sulfate (SDS) and Triton-X-100, e) Detection of the presence of hybrids by colorimetric methods, A method according to clause 8, wherein the hybridization probe is in accordance with that defined in clauses 2 and 3. According to a preferred aspect, use the present invention in the detection of plasmid species, A method according to clauses 8 and 9, wherein the final concentration of the reactants in step 8 (a) is as follows;

a) Guanidine hydrochloride; between 1.0 M and 3.0 M b) sodium lauryl sarcosine; between 0.2% and 0.5% w / v c) Triton-X-100; between 0.2% and 0.5%, v / v

The abovementioned ranges are those which are considered preferential. 11. Method according to clauses 8 and 9, characterized in that the final concentrations in step 8 e)

as follows: a) Standard Citrate Saline -0.5X -2.5 X SSC b) Triton-X-100 -0.2% -0.5% V / V c) Sodium Dodecyl Sulfate -0 , 2% -0.5% P / V

The preferred ranges are those discussed above. 12, Method according to clause 8-1, characterized in that the lysis solution is used both as a solubility agent and as a hybridization solution. A method according to clauses 8 to 12, characterized in that using 2 x SSC to remove nonspecific hybrids, 14, Method according to clauses 8 and 14, characterized in that Triton-X-IQQ and SDS are used to remove staining material from blood, Method according to clauses 8 to 14, characterized in that the pathogen is P, falciparum. A method according to the claims 8 to 14, characterized in that the pathogen is P. vivax. 17, Method according to clauses 8 to 14, characterized in that the pathogen is Shigella, 18. A method according to clauses 8 to 14, characterized in that the pathogen is Mycobacterium tuberculosis. A diagnostic set for detecting a given nucleotide sequence in a target polynucleotide sequence, based on methods according to clauses 8 to 18.

PRINCIPLE OF DNA BASED ON HYBRIDIZATION IN SANDUICH

Background

In the non-radioactive process, the final mode of detection resided in the development of a soluble or insoluble color, depending on the nature of the substrate used in the reaction catalyzed either by alkaline phosphatase or horseradish peroxidase. Thus, it is essential to remove the residual chromatic material from the target DNA as well as inactivate the endogenous enzyme. In this situation, it is impractical to use blood spots directly on the membrane filter (as in the case of radioactive hybridization) , since it would be practically impossible to remove the residual blood dyes. To overcome this problem, a microtiter plate associated with sandwich hybridization was used, the base principle of which is described below;

It has previously been shown that one of the characteristics of the P falciparum genome lies in the fact that it contains a 21 base pair repeat that was present in series in a large region of the genome 5-6, The fraction of the genome represented by this repeated sequence is approximately 1%. Comparisons made between several clones containing this repeated sequence indicated a consensus sequence of 21 base pairs. Based on this consensus sequence, a 63-mer oligonucleotide probe (hereinafter referred to as f63) was designed and constructed. It consists of three 23 mer serial oligonucleotides which are represented at their maximum exponent in repeat sequences of P. falciparum DNA (Fig. 1). The preferred use of single stranded DNA as a probe and the length thereof already referred to is based on the following ratios; Single stranded DNA is superior to double stranded DNA as a probe, due to the fact that it hybridizes only to the target DNA. In the case of double stranded DNA, there is a greater likelihood of self-hybridization, which thus reduces the effective concentration of the probe, required to bind to the target DNA. These facts clearly demonstrate the superiority of the single stranded probe, since a much smaller probe amount is required for hybridization, its cost is much lower. Among the various methods available for the production of single stranded DNA, the most convenient is the synthesis of oligonucleotides.

For detection of parogenic agents other than P, falciparum, an optimal DNA probe must be designed that is repeated in the DNA of the pathogen. This hybridization probe may then be used, according to a protocol identical to that of sandwich hybridization, which is provided below, specifically for the falciparurru -10-

Cr

Provide below the basic protocol of sandwich hybridization. (Also indicated pictorially in Fig. 2) «

Flowchart for non-radioactive diagnosis of P. falciparum infection in human blood by sandwich hybridization.

Add one drop of the blood sample (50 μl) from a finger puncture into a small plastic tube containing lysis solution and bio-f63 probe

Step 1 i) stir well ii) heat in a boiling water bath for two minutes iii) leave at room temperature for a minimum of four hours

DNA hybrid of the parasite-probe bio-f63 See Fig. 1 Plate A

Phase 2 (i) Transfer the tube mixture from tube stage 1 into microtiter plates previously coated with unlabeled f-63 probe (See Fig. 1, Plate B) ii) allow to stand at room temperature overnight at hybrid (see Fig. 1, plate C) i) washing the tubes of the phase 2 microtiter plate with 2 x SSC containing 0.2% SDS and Q, 2% Triton x 100 ii) repeating the washing procedure four times, leaving each time to remain in the lavatory cap for 5 minutes iii) leave in each of the APB-1 solution tubes for 30 minutes at room temperature. iv) adding one drop of APB-1 containing streptavidin conjugated to alkaline phosphatase. v) allowed to stand at room temperature for 30 minutes. vi) Discard the solution of the tubes. vii) Leave the APB-1 solution (without BSA) in each of the tubes for 5 minutes and discard the solution. viii) Repeat the previous operation four times.

The captured hybrid is ready for de-calorimetry

Fig. 1 Plate D ix) x) xi) xii)

Wash each of the tubes with APB-2 solution.

Add enzymatic substrate to APB-2 solution,

Allow to stand at room temperature for at least 120 minutes.

Absorbance read at 410 nm on a microtiter plate reader.

Phase 5 With absorbance values greater than 0.2, they reveal the presence of parasite DNA

Analysis of test results The absence of parasite DNA provides an absorbance value of less than 0.1. The success of this method depends on the fact that P. falcipa rum DNA remains practically undegradable during the process. Na-13-

solution of the hybridization phase the biotinylated β-strand binds to the DNA of p. falciparum and may proceed until it is complete, the hybridization rate of the solution being much faster compared to the immobilized target DNA. The efficacy of the capture hybridization is directly proportional to the length of the falciparum DNA. As an extreme limit it can be seen that the DNA of the falciparum plasmodium is totally undegraded, whereby a small amount of 0.03% capture hybridization can cause the hybrid complex to rupture.

In the case of other pathogens, the efficacy of capture hybridization will depend on the number of times the virus is repeated in the genome of the pathogen.

Protocol for non-isotopic detection of P. falciparum DNA in blood samples 1. Preparation of the probe;

Probe for coating the microtiter plates; the 63-mer oligonucleotide (f63) was synthesized using an automated DNA synthesizer (Applied Biosystems 34QA),

Probe marked for detection of hybrids; biotinylation of β63 by photobiotinylation using photobiotin acetate was performed according to published procedures, 2. Coating of the microtiter plates;

All tubes of the microtiter plates (Dynatech, polyvinyl chloride) were coated with varying amounts (1 .mu.g to 10 ng) of f63 in a volume of 50 μl containing 0.1 M MgCl 2. overnight and following this procedure the microtiter plate was exposed to a germicidal (40 watt) XJV lamp at a distance of 10 cm for 5 minutes to immobilize the DNA. The contents of the tubes were removed, and the tubes were washed with 2 x SSC buffer. The unoccupied sites of each of the tubes were blocked by prehybridization in a buffer (200æl / well) containing 2x SSC, 5X Denhardts, 0.5% Triton-X-100, 5% SDS and 50æg / ml salmon sperm DNA. Prehybridisation was carried out for 4 to 6 hours at room temperature. The coated plates may be stored at this stage at room temperature, collecting blood samples and hybridizing the solution;

Blood samples (50 Âμl aliquots) were collected from a finger puncture directly into 50 Âμl of a solution containing 4M guanidine hydrochloride (GuCl.HCl), 0.5% lauryl sarcosine sodium (SLS) and 0.5% Triton X-100. This solution also contained 5 ng of oligonucleotide probe (biotinylated β-63). This mixture was heated for 5 minutes at 95 ° C and then stored at room temperature for 4-6 hours to result in hybridization of the solution. 4, capture hybridization;

After. Once the hybridization of the solution occurred, the contents of the Eppendorf tubes were transferred to the microtiter plate tubes which had been precoated with unlabeled f-63. This hybridization was allowed to sandwich (capture) for 24 h. hours. During this phase, hybridization occurred between the plaque-f-63 and the remaining complementary sites available in the hybrid. The hybrid consists of a long piece of target DNA carrying biotinylated β-63 in certain locations, leaving behind other complementary sites (see Fig. 2). 5, Color Development;

After sandwich hybridization was completed, the contents of the microtiter plate were removed and the tubes were washed four times with a solution containing 2 x SSC, 0.2% SDS and 0.1% 2% Triton-X-100, each for five minutes at room temperature. During this post-hybridization wash, all colored materials located by hybrid hybrid detris were removed. The tubes were then blocked with A.P. 7.5. consisting of a solution containing 1M sodium chloride, 100 nM Tris-HCl, pH 7.5, 2 mM magnesium chloride, 0.05% Triton-X-100 and 3% BSA for 30 minutes, at room temperature.

The sandwich hybrids were then detected using, for example, the streptavidin-alkaline phosphatase conjugate. The streptavidin-alkaline phosphatase conjugate

to

solution (A.A. 7.5 buffer containing the streptavidin-alkaline phosphatase conjugate) was added to each of the tubes and the incubation period was continued for an additional 30 minutes at room temperature. The excess unbound conjugate was removed by washing four times each, for five minutes at room temperature, with a buffer, δ, 7.5. without BSA,

Finally, the tubes were washed with A, P, 9.5 (substrate incubation buffer containing 100 mM Tris-Cl, pH 9.5, 100 mM sodium chloride and 50 mM magnesium chloride), Additive -

50 æl of p-nitrophenyl phosphate substrate was added to the A, P. 9.5 at a concentration of 1 mg / ml and 50 Âμl of this solution was added to each of the tubes, color development took place over a period of from 6 to 12 hours. Absorbance (at 410 nm) using a suitable card reader (such as a Dynatech card reader),

In the table below, the results of the test are indicated. RESULTS: TABLE 1 - HYBRIDIZATION DATA OF f-63 (Absorbance at 410 nm)

Quantity of DNA Quantity of f63 coating the parasite DNA T9 / 1061. microbacterial plaques 1 500 ng 100 ng 10 ng 500 ng upper superior upper 250 ng II ng II II II ng II ng II ng II ng II II ng II ng II II II II ng ng Ff II II 1,524 ng ng 1.511 1.242 1.373 0.929 1/1 ^ 0.291 0.295 0.263 0.214 Human DNA 1 T9 / 106 represents a clo-roquine resistant P. falciparum clone.

Note; In human samples, 50æl of blood has about 50æg of parasite (P, falciparum) DNA if the infection is approximately 1%, the term " higher " indicates an optical density greater than 2.0.

LEGEND OF FIGURES; FIG. 1 shows oligo f-63 which was designed from the repeated consensus sequence (21 repeated bases) of P, falciparum.

Legend of figure 2; A: Hybridization of solution B: Microtiter tube coated with probe E63, C: Capture hybridization, D: Capture of hybrids after washing and chromatic development reading. Figure 3 shows: A: biotinylated f-63 DNA B: P. falciparum genomic DNA C: f-63 DNA

References? 1, Seroepidimiology of Euman Malaria: A Multicenter Study, Malaria Research Center (ICMR) (.1987) 2t BarkerfR * H, Jr, Suehsaens, L., Rooney, W, Alecrin, G.C.,

(1981), Proc. Natl. Chem., 23, 1434, 3, Langer P, R., Waldrop A, A and Waran, D, Acad, Sci, USA 78, 6633. 4, Forster A, C, McXnnes, J, L, Skingle, D, C, and Symons, R, H, (1985) Mucleic Acids Res, 13, 745-5. , Aslund, L., Franzen, L., Westin, G., Persson, T.,

Wigzell, H., and Pettersson, U. (1985) J. Mol. 185, 509, 6. Francis, V.S., Ayyanathan. K., Bhat.P, Srinivasa.H, and

Padmanaban.G, (1988). Indian J Biochem. Biophys 25,

Claims (22)

A single stranded DNA fragment (£ 63), characterized in that it has the following sequence: aggtcttaacatgactaactacttacttaacttaacttacttaggtcttacttatatact or its complementary strands or variants thereof hybridizable with λ 63 or its complementary strands, or the corresponding double strand sequence. 2. A DNA fragment as defined in claim 1 or a contiguous segment thereof, characterized in that it has at least more than 20 bases or base pairs in length, and more particularly AGGTCTTAACATGACTAACTA. 2 % 3. A DNA fragment according to claim 1 or 2, characterized in that it is in the form of a single strand. 4. A hybridization probe, characterized in that it comprises a DNA fragment as defined in claims 1 and 2. Hybridization probe according to claim 4, characterized in that it is marked by a group capable of being detected colorimetrically. The hybridization probe according to claim 5, wherein the labeled and detectable group is colorimetrically consisting of biotin. 7. The hybridization probe according to claim 5, wherein the labeled and colorimetrically detectable group consists of a chromophoric group. 8. A method for the detection of a pathogen present in blood or other body fluids, characterized by the following steps: a) lysis of a blood sample in a solution containing GuHCl, SLS and Triton-X-100. b) denaturation of the DNA present in said blood sample 3 and preparation of a hybridization solution in the presence of a hybridization probe that hybridizes to the DNA of said potogenic agent. c) capturing the hybrids formed in step 8 (b) in said microtiter plate covered with a hybridization probe having a nucleotide sequence capable of hybridizing to the same strand of genomic DNA to which the hybridization probe binds, used in step 8 (b). d) washing the microtiter plate with a solution consisting of SSC, SDS and Triton-x-100. (e) detection of the presence of hybrids by colorimetric methods. A method according to claim 8, characterized in that the denaturing step 8 (b) is carried out by heating. 10. A method according to claims 8 and 9, wherein the hybridization probe used in the coating of the microtiter plate has the same nucleotide sequence as the hybridization probe used in step 8 (b). A method according to claim 8, characterized in that the hybridization probe used is as defined in claims 2 and 3. 12. A method according to claims 8 to 11, characterized in that the final concentrations of the reactants in step 8 (a) are as follows: a) guadine hydrochloride: between 1.0 M - 3.0 M b) sodium lauryl sarcosine: 0.2% - 0.5%, P / V c) Triton-x-100: between 0.2% - 0.5%, V / V 13. A method according to claims 8 and 12, final concentrations in step 8 (e) are as follows: a) Standard citrate salt solution - 0.5 X 2.5 X SSC b) Triton-x-100 -0.2% - 0.5% V / V c ) sodium dodecyl sulphate - 0.2% - 0.5% P / V 14. A method according to claims 8 to 13, characterized in that the lysis solution is used as a solubilising agent and as a hybridization solution. 15. A method according to claims 8 to 14, characterized in that 2X SSC is used to remove non-specific hybrids. 16. A method according to claims 8 to 15, characterized in that Triton-x-100 and SDS are used to remove staining material originating from the blood. 17. A method according to claims 8 to 16, characterized in that the pathogen is P. falciparum. 18. A method according to claims 8 to 16, characterized in that the pathogen is P. vivax. 19. A method according to claims 8 to 16, characterized in that the pathogen is Shigella. 20. A method according to claims 8 to 16, characterized in that the pathogen is Mycobacterium tuberculosis. 21. A method according to claims 8 to 16, characterized in that the pathogen consists of a blood pathogen 22. A diagnostic set for the detection of a given nucleotide sequence in a target polynucleotide sequence, characterized in that it is based on methods according to claims 8 to 21,