WO1991016927A1 - Anticorps anti-molecule 1 d'adherence intercellulaire a greffe de regions determinantes complementaires adaptes au modele humain, leur procede de preparation et d'utilisation - Google Patents

Anticorps anti-molecule 1 d'adherence intercellulaire a greffe de regions determinantes complementaires adaptes au modele humain, leur procede de preparation et d'utilisation Download PDF

Info

Publication number
WO1991016927A1
WO1991016927A1 PCT/US1991/002942 US9102942W WO9116927A1 WO 1991016927 A1 WO1991016927 A1 WO 1991016927A1 US 9102942 W US9102942 W US 9102942W WO 9116927 A1 WO9116927 A1 WO 9116927A1
Authority
WO
WIPO (PCT)
Prior art keywords
icam
antibody
ham
binding
ram
Prior art date
Application number
PCT/US1991/002942
Other languages
English (en)
Inventor
John Robert Adair
Diljeet Singh Athwal
Robert A. Rothlein
Original Assignee
Celltech Limited
Boehringer Ingelheim Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Celltech Limited, Boehringer Ingelheim Pharmaceuticals, Inc. filed Critical Celltech Limited
Priority to BR919106392A priority Critical patent/BR9106392A/pt
Publication of WO1991016927A1 publication Critical patent/WO1991016927A1/fr
Priority to NO92924087A priority patent/NO924087L/no
Priority to FI924818A priority patent/FI924818A/fi

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2821—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against ICAM molecules, e.g. CD50, CD54, CD102
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/02—Nutrients, e.g. vitamins, minerals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a recombinant antibody molecule (RAM), and especially a CDR-grafted humanized antibody molecule
  • Adhesion Molecule 1 (ICAM-1), to a process for its production using recombinant DNA technology and to its therapeutic use.
  • recombinant antibody molecule (RAM) is used to describe an antibody produced by a process involving the use of recombinant DNA technology, including any analogues of natural immunoglobulins or their fragments.
  • RAM recombinant antibody molecule
  • CDR-grafted humanized antibody molecule (HAM) is used to describe a molecule having an antigen binding site derived from an immunoglobulin from a non-human species, the remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin, wherein the antigen binding site comprises complimentarity determining regions derived from an immunoglobulin from a non-human species grafted into appropriate human variable domain framework regions.
  • the abbreviation "MAb” is used to indicate a monoclonal antibody.
  • the present invention also relates to the use of HAMs and RAMs capable of binding to ICAM-1 to inhibit intercellular adhesion of cells of granulocyte or macrophage lineage.
  • the use of such molecules provides a method for the treatment of specific and non-specific inflammation.
  • the present invention also relates to RAMs and HAMs capable of binding ICAM-1 in the treatment of viral, and particularly rhinoviral disease.
  • the invention also relates to therapeutic and prophylactic methods for suppressing the infection of leukocytes with HIV, and particularly with HIV-1, in an individual who is exposed to HIV or effected by HIV, and is thus in need of such suppression through the administration of RAMs and HAMs capable of binding ICAM-1 . It therefore provides a therapy for diseases, such as AIDS (Acquired Immunodeficiency Syndrome) which are caused by the HIV virus.
  • the invention also relates to a therapeutic method for suppressing the migration of HIV-1 infected cells from the circulatory system using RAMs and HAMs capable of binding ICAM-1 . It therefore provides a therapy for diseases, such as AIDS (Acquired Immunodeficiency Syndrome) which are caused by the HIV-1 virus.
  • the present invention relates to the use of RAMs and HAMs capable of binding ICAM-1 in the treatment of asthma.
  • Natural immunoglobulins have been known for many years, as have the various fragments thereof, such as the Fab, (Fab') 2 and Fc fragments, which can be derived by enzymatic cleavage. Natural immunoglobulins comprise generally Y-shaped molecule having an antigen-binding site towards the free end of each upper arm. The remainder of the structure, and particularly the stem of the Y, mediates the effector functions associated with immunoglobulins.
  • HAMA Human Anti-Mouse Antibody
  • Such humanized chimeric antibodies still contain a significant proportion of non-human amino acid sequence, i.e., the complete non-human variable domains, and thus may still elicit some HAMA response, particularly if administered over a prolonged period (Begent et al Br. J. Cancer 62:487 (1990)).
  • the complementarity determining regions (CDRs) of a mouse MAb have been grafted into the framework regions of the variable domains of a human immunoglobulin by site directed mutagenesis using long oligonucleotides.
  • the present invention relates, inter alia, to humanized antibody molecules prepared according to this alternative approach, i.e.,
  • CDR-grafted humanized antibody molecules Such CDR-grafted humanized antibodies are much less likely to give rise to a HAMA response than humanized chimeric antibodies in view of the much lower proportion of non-human amino acid sequence which they contain.
  • the earliest work on humanizing MAbs by CDR-grafting was carried out on MAbs recognizing synthetic antigens, such as the NP or NEP antigens.
  • MAbs recognizing synthetic antigens such as the NP or NEP antigens.
  • a mouse MAb recognizing lysozyme and a rat MAb recognizing an antigen on human T-cells respectively were humanized by CDR-grafting have been described by Verhoeyen et al Verhoeyen et al, Science 239:1534-1536 (1988) and
  • Queen et al propose four criteria for designing humanized immunoglobulins.
  • the first criterion is to use as the human acceptor the framework from a particular human immunoglobulin that is unusually homologous to the non-human donor immunoglobulin to be humanized, or to use a consensus framework from many human antibodies.
  • the second criterion is to use the donor amino acid rather than the acceptor if the human acceptor residue is unusual and the donor residue is typical for human sequences at a specific residue of the framework.
  • the third criterion is to use the donor framework amino acid residue rather than the acceptor at positions immediately adjacent to the CDRs.
  • the fourth criterion is to use the donor amino acid residue at framework positions at which the amino acid is predicted to have a side chain atom within about 3 A of the CDRs in a three-dimensional immunoglobulin model and to be capable of interacting with the antigen or with the CDRs of the humanized immunoglobulin. It is proposed that criteria two, three or four may be applied in addition or alternatively to criterion one, and may be applied singly or in any combination.
  • WO 90/07861 describes in detail the preparation of a single CDR- grafted humanized antibody, a humanized antibody having specificity for the p55 Tac protein of the IL-2 receptor.
  • the donor CDRs were as defined by Kabat et al (Kabat et al, in Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, NIH (1987); and Wu et al, J.
  • mice donor residues were used in place of the human acceptor residues, at positions 27, 30, 48, 66, 67, 89, 91, 94, 103, 104, 105 and 107 in the heavy chain and at positions 48, 60 and 63 in the light chain, of the variable region frameworks.
  • the humanized anti-Tac antibody obtained is reported to have an affinity for p55 of 3 x 10 9 M '1 , about one-third of that of the murine MAb.
  • PCT/GB 90/02017 Celltech Limited
  • the disclosure of which is incorporated herein by reference which describes, inter alia, the CDR- grafting of murine anti-ICAM-1 monoclonal antibodies.
  • Leukocytes and granulocytes must be able to adhere to cellular substrates in order for an inflammatory response to occur and to properly defend the host against foreign invaders such as "viruses, bacteria, and allergens. This fact has become evident from two converging lines of research.
  • the first line of research involves studies of leukocyte membrane proteins (Wallis, W.J., et al, J. Immunol 135:2323-2330 (1985); Mentzer, S.J., et al, I. Cell Physiol 126:285-290 (1986); Haskard, D.O., et al.. Immunol.
  • CD18 leukocyte membrane proteins
  • Mac-1 common subunit
  • LFA-1 unique subunit
  • Monoclonal antibodies against the CD 18 family of leukocyte membrane proteins by acting as antagonists of these proteins, inhibit a multitude of leukocyte adhesion dependent events in vitro. This includes the ability of granulocytes to aggregate in response to appropriate stimuli, the ability of granulocytes to attach to protein coated plastic, the ability of granulocytes to migrate in 2-dimensional agarose assays, and the ability of granulocytes to attach to endothelial cells.
  • LAD leukocyte adherence deficiency disease
  • Characteristic features of LAD patients include necrotic soft tissue lesions, impaired pus formation and wound healing, as well as abnormalities of adhesion-dependent leukocyte functions in vitro, and susceptibility to chronic and recurring bacterial infections.
  • Granulocytes from these LAD patients behave in the same defective manner in vitro as do their normal counterparts in the presence of anti-CD18 monoclonal antibody. That is, they are unable to perform adhesion related functions such as aggregation or attachment to endothelial cells. More importantly, however, is the observation that these patients are unable to mount a normal inflammatory response because of the inability of their granulo ⁇ cytes to attach to cellular substrates.
  • lymphocytes and granulocytes to maintain the health and viability of an animal requires that they be capable of adhering to other cells (such as endothelial cells).
  • Granulocyte-endothelial cell adherence has been found to require cell-cell contacts which involve specific receptor molecules present on the granulocyte cell surface. These receptors enable the leukocyte to adhere to other leukocytes or to endothelial, and other non-vascular cells.
  • the cell surface receptor molecules of leukocytes have been found to be highly related to one another. Humans whose leukocytes lack these cell surface receptor molecules exhibit chronic and recurring infections, as well as other clinical symptoms. Inflammation reactions are mitigated when leukocytes are unable to adhere in a normal fashion due to the lack of functional adhesion molecules of the CD 18 complex. Because leukocyte adhesion is involved in the process through which tissue inflammation arises, an understanding of the process of leukocyte adhesion is of significant value in defining a treatment for specific and non-specific inflammation.
  • lymphocyte adhesion is involved in the process through which foreign body or tissue is identified and rejected, an understanding of this process is of significant value in the fields of organ transplantation, tissue grafting, allergy and oncology.
  • intercellular adhesion molecule ICAM-1 was first identified and partially characterized according to the procedure of Rothlein, R. et al (I. Immunol 157:1270-1274 (1986)), which reference is herein incorporated by reference. ICAM-1, its preparation, purification, and characteristics are disclosed in WO 90/03400 which application is herein incorporated by reference in its entirety.
  • ICAM-1 was initially realized as being involved in the process of cellular adhesion between endothelial cells and leukocytes.
  • Cellular adhesion is the process through which leukocytes attach to cellular sub- strates, such as endothelial cells, in order to migrate from circulation to sites of ongoing inflammation, and properly defend the host against foreign invaders such as bacteria or viruses.
  • An excellent review of the defense system is provided by Eisen, H.W., (In: Microbiology, 3rd Ed., Harper & Row, Philadelphia, PA (1980), pp. 290-295 and 381-418).
  • ICAM-1 One of the molecules on the surface of endothelial cells which participates in the adhesion process.
  • This molecule has been shown to mediate adhesion by binding to molecules of the CD-18, CD- 11/18 family of glycoproteins which are present on the cell surfaces of leukocytes (Sanchez-Madrid, F. et al, I. Exper. Med. 55:1785-1803 (1983); Keizer, G.D. et al, Eur. J. Immunol. 75:1142-1147 (1985)).
  • Intercellular Adhesion Molecule is an inducible cell surface glycoprotein expressed on various cell types including vascular endothelial cells, and is expressed preferentially at sites of inflammation. Since ICAM-1 is the natural binding ligand of LFA-1, ICAM-l-LFA-1 interactions play a central role in cellular adhesion, recruitment of lymphocytes to sites of inflammation and the triggering of lymphocyte functions which contribute to both specific and non-specific inflammation.
  • the endothelial cell receptor protein recognized by this antibody was isolated and found to be a 90 kd protein (Tomassini et al, J. Virol 58:290-295 (1986) and later shown to be the ICAM-1 molecule (Staunton et al, Cell 5(5:849-854 (1989)).
  • HIV HIV infection is the cause of AIDS.
  • Two major variants of HIV have been described: HTV-l and HIV-2. HIV-1 is prevalent in North America and Europe, in contrast to HIV-2 which is prevalent only in Africa. The viruses have similar structures and encode proteins having similar function. The nucleotide and protein sequences of the genes and gene products of the two variants have been found to have about 40% homology with one another.
  • HIV infection is believed to occur via the binding of a viral protein (termed “gpl20”) to a receptor molecule (termed “CD4") present on the surface of T4 ("T helper") lymphocytes (Schnittman, S. M. et al, I. Immunol 747:4181-4186 (1988), which reference is incorporated herein by reference).
  • the virus then enters the cell and proceeds to replicate, in a process which ultimately results in the death of the T cell.
  • the destruction of an individual's T4 population is a direct result of HIV infection. HIV can be recovered from peripheral blood mononuclear cells and human plasma (7. Clin. Microbiol 26:2371-2376 (1988); N Engl. I. Med 321:1621-1625 (1989)).
  • the destruction of the T cells results in an impairment in the ability of the infected patient to combat opportunistic infections.
  • individuals afflicted with AIDS often develop cancers, the relationship between these cancers and HIV infection is, in most cases, uncertain.
  • the mere replication of the HIV virus is lethal to infected cells, such replication is typically detected in only a small fraction of the T4 cells of an infected individual.
  • Several lines of research have elucidated other mechanisms through which the HIV virus mediates the destruction of the T4 population. Apart from through HTV replication, HIV infected cells can be destroyed through the action of cytotoxic, killer cells.
  • Killer cells are normally present in humans, and serve to monitor the host and destroy any foreign cells (such as in mismatched blood transfusions or organ transplants, etc.) which may be encountered.
  • T4 cells Upon infection with HIV, T4 cells display the gpl20 molecule on their cell surfaces. Killer cells recognize such T4 cells as foreign (rather than native cells), and accordingly, mediate their destruction.
  • HTV infection can also lead to the destruction of non-infected healthy cells.
  • Infected cells can secrete the gpl20 protein into the blood system.
  • the free gpl20 molecules can then bind to'the CD4 receptors of healthy, uninfected cells. Such binding causes the cells to take on the appearance of HTV infected cells.
  • Cytotoxic, killer cells recognize the gpl20 bound to the uninfected T4 cells, conclude that the cell is foreign, and mediate the destruction of the T4 cells.
  • a “syncytium” is a multinucleated giant cell, formed from the fusion of as many as several hundred T4 cells. Infection with HIV causes the infected cell to become able to fuse with other T4 cells. Such fusion partners may themselves be HIV infected, or they may be uninfected healthy cells. The syncytium cannot function and soon dies. Its death accomplishes the destruction of both HIV infected and HIV uninfected T4 cells. This process is of special interest to the present invention since it entails the direct cell-cell contact of T4 cells.
  • HTV-infected cells to form syncytia indicates that such cells acquire a means for fusing with healthy cells.
  • cell-cell contacts may be of fundamental importance in the process through which HIV infection is transmitted from one cell to another within an individual.
  • HTV infection and especially HIV-1 infection, appears to influence cell surface expression of the leukocyte integrins and cellular adherence reactions mediated by these heterodimers (Petit, A.J., et al, J. Clin. Invest. 7P:188 (1987); Hildreth, J.E.K., et al, Science 244:1075 (1989); Valentin,
  • HTV-l infected U937 cells adhere to IL-1 stimulated endothelium in greater frequency than uninfected U937 cells; this behavior can be suppressed by treating the infected cells with anti-CD18 or anti-CDlla monoclonal antibodies or by treating endothelial substrates with anti-ICAM-1 (Rossen, R.D., et al, Trans. J SSOC. American Physicians
  • CD18 or CDlla Monoclonal antibodies to CD18 or CDlla have also been found to be able to inhibit formation of syncytia involving phytohemagglutinin (PHA)-stimulated lymphoblastoid cells and constitutively infected, CD4-negative T cells (Hildreth, J.E.K., et al, Science 244:1075 (1989)).
  • PHA phytohemagglutinin
  • HTV infected cells remains unknown, and is not necessary to an appreciation of the present invention, studies with radiolabeled gpl20 suggest that heterodimers containing CD 18 do not provide a binding site for the virus (Valentin, A., et al, J. Immunology 144:934-937 (1990)).
  • HTV infection involves cell-cell interactions, and/or viral-cell interactions which mimic such cell-cell interactions.
  • the cell-cell interactions may result in the transport of cell-free virus or the transport of virus across endothelial barriers within the cytoplasm of infected mononuclear cells.
  • Viral-cell interactions which mimic the cell-cell interactions may facilitate or enable free virus to attach to and/or infect healthy cells.
  • the present invention thus derives, in part, from the observation that HIV infection, and particularly HIV-1, infection results in increased expression of the CDlla/CD18 heterodimer, and its binding ligand, ICAM-1.
  • This increased expression is significant in that it enhances the ability of HTV-infected T cells to adhere or aggregate with one another (i.e. to undergo "homotypic aggregation"). Sfnce such homotypic aggregation is not observed to occur among quiescent normal leukocytes, this discovery indicates that the expression of the CD11/CD18 receptors and/or ICAM-1 is required for such aggregation.
  • adhesion permits HIV-1 to be transmitted from an infected cell to a healthy cell of an individual, and also permits or facilitates infection of healthy cells with free virus. Since ICAM-1 plays a central role in cell-cell interactions murine monoclonal antibodies that bind to ICAM-1 have been proposed as a method of preventing HIV infection (WO 90/13281).
  • leukocytes The migration and dissemination of leukocytes is important in protecting an individual from the consequences of infection. These processes, however, are also responsible for the migration and dissemination of viral-infected leukocytes. Of particular concern is the migration and dissemination of leukocytes infected with HIV. The migration of such cells results in the formation of extravascular foci, and may cause tumors and other abnormalities.
  • HTV-l histologic examination of affected organs reveals focal extravascular mononuclear cell infiltrates. Attempts to identify virus- infected cells in such infiltrates in the central nervous system have revealed the presence of HTV-l infected cells. These studies have shown - that HTV-l resides primarily in monocytes and macrophages, and other cells of this lineage (R.T. Johnson, et al FASEB J. 2:2970 (1988); M.H. Stoler et al, J. Amer. Med. Assn. 256:2360 (1986); S. Gartner et al J. .Amer. Med. Assn. 256:2365 (1986); S.
  • Asthma is a heterogeneous family of diseases. It is characterized by a hyper-responsiveness of the tracheobronchi to stimuli (McFadden,
  • asthma is manifested by the extensive narrowing of the tracheobronchi, by thick tenacious secretions, by paroxysms of dyspnea, cough, and wheezing. Although the relative contribution of each of these conditions is unknown, the net result is an increase in airway resistance, hyperinflation of the lungs and thorax, abnormal distribution of ventilation and pulmonary blood flow.
  • the disease is manifested in episodic periods of acute symptoms interspersed between symptom-free periods. The acute episodes result in hypoxia, and can be fatal. Approximately 3% of the general world population suffers from the disease.
  • Allergic asthma is usually associated with a heritable allergic disease, such as rhinitis, urticaria, eczema, etc.
  • the condition is characterized by positive wheal-and-flare reactions to intradermal injections of airborne antigens (such as pollen, environmental or occupational pollutants, etc.), and increased serum levels of IgE.
  • airborne antigens such as pollen, environmental or occupational pollutants, etc.
  • IgE airborne antigens
  • Allergic asthma is believed to be dependent upon an IgE response controlled by T and B lymphocytes and activated by the interaction of airborne antigen with mast cell-bound pre-formed IgE molecules.
  • the antigenic encounter must occur at concentrations sufficient to lead to IgE production for a prolonged period of time in order to sensitize an individual. Once sensitized, an asthma patient may exhibit symptoms in response to extremely low levels of antigen.
  • Asthma symptoms may be exacerbated by the presence and level of the triggering antigen, environmental factors, occupational factors, physical exertion, and emotional stress.
  • Asthma may be treated with ethylxanthines (such as theophylline), beta-adrenergic agonists (such as catecholamines, resorcinols, saligenins, and ephedrine), glucocorticoids (such as hydrocortisone), inhibitors of mast cell degranulation (i.e. chromones such as cromolyn sodium) and anticholinergics (such as atropine).
  • ethylxanthines such as theophylline
  • beta-adrenergic agonists such as catecholamines, resorcinols, saligenins, and ephedrine
  • glucocorticoids such as hydrocortisone
  • inhibitors of mast cell degranulation i.e. chromones such as cromolyn sodium
  • anticholinergics such as atropine
  • Asthma is believed to involve an influx of eosinophils ("eosinophilia”) into the tissues of the lung (Frigas, E. et al, J. Allergy Clin.
  • eosinophils Upon degranulation, eosinophils release enzymes such as histaminase, arylsulfatase and phospholipase D which enzymatically neutralize the harmful mediators of the mast cell. These molecules also promote the destruction of the mucociliary apparatus, and thus prevent the clearing of the bronchial secretions, and contribute to the lung damage characteristic of asthma.
  • EP-289949 describes the preparation of a murine monoclonal (R6- 5-D6) having specificity for ICAM-1 which is the preferred antibody for the above referenced therapies.
  • Samples of R6-5-D6 have been deposited with the American Type Culture Collection as deposit ATCC HB9580 on 30th October 1987.
  • R6-5-D6 has been deposited with the ATCC under the provisions of Rule 28(4) of the EPC.
  • anti-ICAM-1 MAbs which are the basis of the above described methods of treatment, are murine MAbs and as a result are likely to cause a significant HAMA response if administered in repeat doses to human patients. It would be highly desirable to diminish or abolish this undesirable HAMA response by suitable humanization or other appropriate recombinant DNA manipulation of these potentially highly useful antibodies and thus extend and enlarge their use. It would also be desirable to apply the techniques of recombinant DNA technology to these antibodies to prepare anti-ICAM-1 RAMs in general.
  • the present invention provides a method of constructing a recombinant antibody molecule (RAM).
  • RAMs of the present invention comprises the antigen binding regions derived from the heavy and/or light chain variable regions of an anti-ICAM-1 antibody.
  • the present invention provides a method for the construction of CDR-grafted humanized antibody molecules (HAM). Specifically the
  • HAMs of the present invention have specificity for ICAM-1 and have an antigen binding site wherein at least one or more of the complementarity determining regions (CDRs) of the variable domains are derived from a non-human anti-ICAM-1 antibody.
  • CDRs complementarity determining regions
  • the invention further pertains to the HAMs and RAMs of the present invention which are detectably labeled.
  • the invention additionally includes a recombinant DNA molecule capable of expressing the RAMs or HAMs of the present invention.
  • the invention further includes a host cell capable of producing HAMs or RAMs of the present invention when transformed by the recombinant DNA molecules disclosed herein.
  • the invention additionally includes diagnostic and therapeutic uses for the HAMs and RAMs of the present invention.
  • the invention further provides a method for treating inflammation resulting from a response of the specific defense system in a mammalian subject which comprises providing to a subject in need of such treatment an amount of an anti-inflammatory agent sufficient to suppress the inflammation; wherein the anti-inflammatory agent is a HAM or RAM of monoclonal antibody capable of binding to ICAM-1.
  • the invention further provides a method for treating non-specific inflammation in humans, and other mammals.
  • the invention includes a method for treating inflammation resulting from a response of the specific and non-specific defense system in a mammalian subject which comprises providing to a subject in need of such treatment an anti-inflammatory agent, capable of binding to an ICAM-1, in an amount sufficient to suppress the inflammation; wherein the anti-inflammatory agent is a HAM or RAM capable of binding to ICAM-1.
  • the invention further includes the above-described method for treating inflammation wherein the inflammation is associated with a condition selected from the group consisting of: adult respiratory distress syndrome; multiple organ injury syndrome secondary to septicemia; multiple organ injury syndrome secondary to trauma; reperfusion injury of myocardial or other tissues; acute glomerulonephritis; reactive arthritis; dermatosis with acute inflammatory components; acute purulent meningitis or other central nervous system inflammatory disorders; thermal injury; hemodialysis; leukapheresis; ulcerative colitis; Crohn's disease; necrotizing enterocolitis; granulocyte transfusion associated syndrome; and cytokine-induced toxicity.
  • a condition selected from the group consisting of: adult respiratory distress syndrome; multiple organ injury syndrome secondary to septicemia; multiple organ injury syndrome secondary to trauma; reperfusion injury of myocardial or other tissues; acute glomerulonephritis; reactive arthritis; dermatosis with acute inflammatory components; acute purulent meningitis or other central nervous system inflammatory disorders; thermal injury
  • the invention further provides a method of suppressing the metastasis of a hematopoietic tumor cell, the cell requiring a functional member of the LFA-1 family for migration, wherein said method comprises providing to a patient in need of such treatment an amount of an anti-inflammatory agent sufficient to suppress the metastasis; wherein the anti-inflammatory agent is a HAM or RAM capable of binding to ICAM-1.
  • the invention further provides a method of suppressing the growth of an ICAM-1-expressing tumor cell which comprises providing to a patient in need of such treatment an amount of a toxin sufficient to suppress the growth, the toxin being derivatized to one of the HAMs or
  • the invention further provides a method of diagnosing the presence and location of an inflammation resulting from a response of the specific defense system in a mammalian subject suspected of having the inflammation which comprises:
  • the invention additionally provides a method of diagnosing the presence and location of an inflammation resulting from a response of the specific defense system in a mammalian subject suspected of having the inflammation which comprises: (a) incubating a sample of tissue of the subject with a composition containing a detectably labeled HAM or RAM capable of identifying a cell which expresses ICAM-1, and
  • the invention further provides a method of diagnosing the presence and location of an ICAM-1-expressi ⁇ g tumor cell in a mammalian subject suspected of having such a cell, which comprises: (a) administering to the subject a composition containing a detectably labeled HAM or RAM capable of binding to ICAM-1, and
  • the invention further provides a method of diagnosing the presence and location of an ICAM-1-expressing tumor cell in a mammalian subject suspected of having such a cell, which comprises:
  • the invention additionally includes a pharmaceutical composition comprising:
  • an anti-inflammatory agent consisting of a RAM or HAM capable of binding to ICAM-1
  • at least one immunosuppressive agent selected from the group consisting of: dexamethasone, azathioprine and cyclosporin A.
  • the present invention also relates to the use of HAMs and RAMs capable of binding ICAM-1 in anti-viral therapy.
  • the invention provides a method for treating viral infection, wherein said virus binds to ICAM-1 in an individual in need of such treatment, wherein the method comprises providing to the individual an amount of a HAM or RAM capable of binding ICAM-1 sufficient to suppress viral infection.
  • the invention further provides a method for suppressing the infection of leukocytes with HTV, which comprises administering to a patient exposed to or effected by HIV, an effective amount of an HTV-l infection suppression agent, the agent being a RAM or HAM capable of binding to ICAM-1.
  • the invention further concerns the embodiment of the above method wherein the HIV is HIV-1.
  • the invention further provides a method for suppressing the extravascular migration of a virally infected leukocyte in a patient having such a leukocyte, which comprises administering to the patient an effective amount of a HAM or RAM capable of impairing the ability of said leukocyte to bind to ICAM-1.
  • the invention further comprises the embodiment of the above- described method wherein the agent is a HAM or RAM capable of binding to ICAM-1.
  • the invention further provides a method for treating asthma in a patient which comprises providing to the patient an effective therapeutic amount of a HAM or RAM capable of binding to ICAM-1
  • the invention further concerns the embodiment of the above described methods wherein the HAM or RAM capable of binding to ICAM-1 is derived from the murine monoclonal antibody R6-5-6D.
  • Figure 1 shows the cDNA sequence for the 5' untranslated region, signal sequence, variable region and part constant region together with corresponding amino acid sequence for the R6-5-D6 murine MAb light chain
  • Figure 2 shows similar cDNA and amino acid sequence for the R6-5- D6 murine mab heavy chain
  • Figure 3 shows a plasmid diagram of plasmid expression vector PEE6 hCMV
  • Figure 4 shows plasmid diagrams indicating the strategy for construction of light chain expression plasmid ⁇ AL5
  • Figure 5 shows plasmid diagrams indicating the strategy for construction of heavy chain expression plasmid pAL6
  • Figure 6 shows a graph giving results of a competition assay comprising binding of recombinant and murine R6-5-D6 and a control MAb UPC10;
  • Figure 7 shows the amino acid sequence using the single letter code, of the variable region for the light chains of the grafted genes gL221 and gL221A. Underlined are the amino acids derived from the murine sequence.
  • Figure 8 shows the oligonucleotide pairs used to build the variable region gene for the gL221 construct.
  • Figure 9 shows an outline diagram of the process of construction of the plasmid pBJl which is an expression vector capable of directing the expression and secretion of the gL221 light chain in a suitable eukaiyotic host cell.
  • the 408 bp BstBI-SplI fragment is cloned into pE1081 at the unique BstBl and SplI sites and generates a full light chain gene in which the humanized variable region gene is fused directly to the human kappa constant region gene.
  • the resultant light chain protein has the correct V-C junction sequence.
  • Figure 10 shows the oligonucleotide pairs used to build the variable region gene for the gL221A construct.
  • Figure 11 shows the amino acid sequence, using the single letter code, of the variable region for the heavy chains of the murine anti-ICAM-1 antibody, the humanized gH341, gH341A, gH341B and gH341D chains and for comparison the EU heavy variable region sequence.
  • gH341A, gH341B and gH341D the murine sequence included in the gene designs are noted by underlining.
  • Figure 12 shows the oligonucleotide pairs used to build the variable region gene for the gH341 construct.
  • Figure 13 shows an outline of the process of construction of the gH341B gene using a Polymerase Chain Reaction (PCR) process for the introduction of a single amino acid substitution.
  • Figure 14 shows the oligonucleotides used to build the Xhol-Aapal gene fragment which was used to construct the gH341D gene.
  • Figure 15 shows the results of COS cell expression in which various and gene combinations noted on the figures were used to Figure 16 produce novel antibody.
  • the yield of antibody was calculated by ELISA as described in the Methods Section and used to tabulate the measured binding of the antibody to the ICAM-1 antigen on JY cells.
  • Figure 17 shows the results of a competition binding assay with chimeric and CDR-grafted antibodies.
  • the first embodiment of the present invention provides a RAM comprising antigen binding regions derived from the heavy and/or light chain variable regions of an anti-ICAM-1 antibody.
  • the anti-ICAM-1 antibody is a rodent MAb.
  • a second embodiment of the present invention provides a CDR-grafted humanized antibody molecule (HAM) having specificity for the ICAM-1 antigen and having an antigen binding site wherein at least the complementarity determining regions (CDRs) of the variable domains are derived from a non-human (e.g., rodent) anti-ICAM-1 antibody.
  • the HAM is prepared by recombinant DNA technology.
  • the anti-ICAM-1 binding region typically comprises at least one CDR from the anti-ICAM-1 antibody.
  • the anti-ICAM-1 antigen binding region comprises at least two and preferably all three CDRs of each of the heavy chain and/or light chain variable regions.
  • the CDRs may comprise the Kabat CDRs, the structural loop
  • the HAMs of the present invention characteristically do not include humanized chimeric antibody molecules in which the antigen binding site comprises a complete heavy and/or light chain variable domain derived from an antibody of desired antigen binding specificity.
  • the HAM is characteristically a CDR-grafted antibody.
  • the HAMs of the present invention preferably comprise CDR- grafted antibody as defined in co-pending International Patent Application PCT/GB 90/02017 (Celltech Limited).
  • the CDRs of the light chain correspond to the Kabat
  • the light chain may have mouse residues at one or more of positions 1, 2 and/or 3, 46, 47, 49, 60, 70, 84, 85 and 87 and preferably has non-human residues at at least positions 46 and 47.
  • the HAM heavy chain preferably has non-human (eg mouse) residues at positions 23 and/or 24 and 71 and/or 73. Additionally, the heavy chain may have non-human residues at one, some or all of positions 48 and/or 49, 69, 76 and/or 78, 80, 88 and/or 91 and 6.
  • the CDRs of the heavy chain correspond to the Kabat CDR at CDR2 (positions 50-65), the structural loop residues at CDR3 (positions 95-100) and a composite of both the Kabat and structural loop residues at CDR1 (positions 24-35); for example, when the human variable region framework used is KOL.
  • the CDRs of the heavy chain may comprise non-human (eg mouse) residues at positions 26 to 35 for CDR1, positions 50 to 56 for CDR2 and positions 94 to 100 for CDR3; for example, when the human variable region framework used in EU.
  • EU has a particularly idiosyncratic J region between residues 103 to 113 and it may be useful to include the murine amino acids, or a consensus human J region or a suitable combination of both at residues 103 to 108 inclusive.
  • the actual linear amino acid sequence may contain fewer or additional amino acids than in the strict Kabat numbering, corresponding to a shortening of, or insertion into, a structural component, whether framework or CDR, of the basic variable domain structure.
  • a structural component whether framework or CDR, of the basic variable domain structure.
  • 90/07861 contains a single amino acid insert (residue 52a) after residue
  • the RAMs or HAMs of the present invention may comprise: a complete antibody molecule, having full length heavy and light chains; a fragment thereof, such as the Fab or (Fab') 2 fragment; a light chain or heavy chain monomer or dimer, or a single chain antibody, e.g., a single chain FV in which heavy and light chain variable regions are joined by a peptide linker; or any other recombinant or CDR-grafted molecule with the same specificity as the original donor antibody.
  • the CDR- grafted heavy and light chain variable region may be combined with other antibody domains as appropriate.
  • the remaining immunoglobulin-derived parts of the RAM or HAM may be derived from any suitable human immunoglobulin.
  • variable region framework sequences may be used having regard to class/type of the donor antibody from which the antigen binding regions are derived.
  • the type of human framework used is of the same/similar class/type as the donor antibody.
  • the framework is chosen to maximize/optimize homology with the donor antibody sequence particularly at positions close or adjacent to the CDRs.
  • human frameworks which may be used to construct CDR- grafted HAMs are KOL, NEWM, REI EU, LAY and POM (Kabat et al , in Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, NIH (1987); and Wu et al, I. Exp. Med. 132:211-250 (1970)) and the like; for instance, KOL and NEWM for the heavy chain and REI for the light chain and EU, LAY and POM for both the heavy chain and the light chain.
  • human constant region domains of the HAM may be selected having regard to the proposed function of the antibody in particular the effector functions which may be required.
  • the constant region domains may be human IgA, IgE, IgG or IgM domains.
  • IgG human constant region domains may be used especially of the IgGl and IgG3 isotopes, when the HAM is intended for therapeutic purposes and antibody effector functions are required.
  • IgG2 and IgG4 isotypes may be used when the HAM is intended for therapeutic purposes and antibody effector functions are not required e.g. for simple blocking of ICAM-l/LFA-1 interactions.
  • ICAM-1 antibodies selection of the IgGl isotype has been shown to result in the highest avidity binding (see our co-pending International Patent Apphcation of even date herewith which relates to humanized chimeric anti-ICAM-1 antibodies).
  • the remainder of the HAM need not comprise only protein sequences from the human immunoglobulin.
  • a gene may be constructed in which a DNA sequence encoding part of a human immunoglobulin chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule.
  • the RAM or HAM of the present invention may be a "chemical derivative" of the RAM or HAM.
  • a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half life, etc. The moieties may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980).
  • Toxin-derivatized molecules constitute a special class of "chemical derivatives.”
  • a "toxin- derivatized” molecule is a molecule (such as ICAM-1 or an antibody) which contains a toxin moiety. The binding of such a molecule to a cell brings the toxin moiety into close proximity with the cell and thereby promotes cell death.
  • Any suitable toxin moiety may be employed; however, it is preferable to employ toxins such as, for example, the ricin toxin, the diphtheria toxin, radioisotopic toxins, membrane-channel- forming toxins, etc. Procedures for coupling such moieties to a molecule are well known in the art.
  • the RAM or HAM can be attached to a macrocycle, for chelating a heavy metal atom.
  • the procedures of recombinant DNA technology may be used to produce a "chemical derivative" of the RAM or HAM in which the Fc fragment or CH3 domain of a complete antibody molecule has been replaced by or has attached thereto by peptide linkage a functional non-immunoglobulin protein such as an enzyme or toxin molecule.
  • the invention also provides recombinant DNA processes for the preparation of the HAMs of the invention.
  • the present invention a process for producing an anti-ICAM-1 humanized antibody molecule which process is provided which comprises: (a) producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain wherein at least one or more of the CDRs of the variable domain are derived from a non-human (rodent) anti-ICAM- 1 antibody and the remaining immunoglobulin-derived parts of the antibody chain are derived from a human immunoglobulin;
  • variable region framework residues may correspond to non-human (e.g. mouse) residues as described above in relation to preferred embodiments of the second embodiment of the invention. It will be appreciated, however, that this embodiment of the invention, as for previous embodiments, does not encompass processes for the production of chimeric antibodies, i.e., antibodies in which substantially the complete heavy and/or light chain variable domain is derived from a non-human (rodent) anti-ICAM-1 antibody.
  • the cell line may be transfected with two vectors, the first vector containing an operon encoding a light chain-derived polypeptide and the second vector containing an operon encoding a heavy chain-derived polypeptide.
  • the vectors are identical except in so far as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed.
  • a single vector may be used, the vector including the DNA sequences encoding both light chain- and heavy chain-derived polypeptides.
  • the DNA in the coding sequences for the light and heavy chains may comprise cDNA or genomic DNA or both. However, it is preferred that the DNA sequence encoding the heavy or light chain comprises at least partially genomic DNA. Most preferably, the heavy or light chain encoding sequence comprises a fusion of cDNA and genomic DNA.
  • the present invention also includes cloning and expression vectors and transfected cell lines used in the process of the invention.
  • the anti-ICAM-1 antibodies of the invention include all anti- ICAM-1 specificities. Typically, however, the antibodies have specificity for antigenic epitopes of ICAM-1 which when bound by the antibody block, inhibit or otherwise modify ICAM-l/LFA-1 and or ICAM-l Mac-1 interactions. Preferably the antibodies have specificity for the same or similar ICAM-1 antigenic epitopes as the R6-5-D6 etc. antibodies. Most especially the antibodies are derived from the R6-5-D6 antibody.
  • the present invention also includes therapeutic and diagnostic compositions containing the RAM or HAM of the invention and uses of such compositions in therapy and diagnosis.
  • the therapeutic uses to which the products of the anti-ICAM-1 invention may be put include any of the therapeutic uses to which anti-
  • ICAM-1 antibodies may be put including for example any or all of the therapeutic uses described in EP-0289949, EP-0314863, and corresponding applications.
  • Monoclonal antibodies to members of the CD 18 or CD-11/18 complex inhibit many adhesion dependent functions of leukocytes including binding to endothelium (Haskard, D., et al, J. Immunol
  • the antibodies inhibit the ability of the leukocyte to adhere to the appropriate cellular substrate which in turn inhibits the final outcome.
  • the present invention provides an improvement through the use of a HAM or RAM derived from an anti-ICAM-1 monoclonal antibody.
  • lymphocytes are capable of continually monitoring an animal for the presence of foreign antigens. Although these processes are normally desirable, they are also the cause of organ transplant rejection, tissue graft rejection and many autoimmune diseases. Hence, any means capable of attenuating or inhibiting cellular adhesion would be highly desirable in recipients of organ transplants (e.g. kidney), tissue grafts or autoimmune patients.
  • a HAM or RAM capable of binding to ICAM-1 is highly suitable as anti-inflammatory agents in a mammalian subject.
  • such an agent differs from general anti-inflammatory agents and non- humanized antibodies in that they are capable of selectively inhibiting adhesion, do not offer other side effects such as nephrotoxicity which are found with conventional agents, and limit the amount of HAMA associated with the use of murine MAbs.
  • a HAM or RAM capable of binding to ICAM-1 can therefore be used to prevent organ (e.g. kidney) or tissue rejection, or modify autoimmune responses without the fear of such side effects, in the mammalian subject.
  • organ e.g. kidney
  • ICAM-1 may permit one to perform organ transplants even between individuals having HLA mismatch.
  • a method for suppressing specific inflammation comprises providing to recipient subjects in need of such a treatment an amount of one of the HAMs or RAMs of the present invention sufficient to suppress inflammation.
  • An amount is said to be sufficient to "suppress" inflammation if the dosage, route of administration, etc. of the agent are sufficient to attenuate or prevent inflammation.
  • the HAM or RAM may be administered either alone or in combination with one or more additional immunosuppressive agents
  • the administration of such a composition may be for either a "prophylactic” or "therapeutic” purpose.
  • the immunosuppressive composition is provided in advance of any inflammatory response or symptom (for example, prior to, at, or shortly after) the time of an organ or tissue transplant but in advance of any symptoms of organ rejection).
  • the prophylactic administration of the composition serves to prevent or attenuate any subsequent inflammatory response (such as, for example, rejection of a transplanted organ or tissue, etc.).
  • the immunosuppressive composition is provided at (or shortly after) the onset of a symptom of actual inflammation (such as, for example, organ or tissue rejection).
  • the therapeutic administration of the composition serves to attenuate any actual inflammation (such as, for example, the rejection of a transplanted organ or tissue).
  • the anti-inflammatory agents of the present invention may, thus, be provided either prior to the onset of inflammation (so as to suppress an anticipated inflammation) or after the initiation of inflammation.
  • a composition containing a HAM or RAM capable of binding to ICAM-1 may be administered to a patient experiencing delayed type hypersensitivity reaction.
  • such compositions might be provided to a individual who had been in contact with antigens such as poison ivy, poison oak, etc.
  • a HAM or RAM of the present invention is administered to a patient in conjunction with an antigen in order to prevent a subsequent inflammatory reaction.
  • the additional administration of an antigen with an ICAM-1-binding HAM or RAM may temporarily tolerize an individual to subsequent presentation of that antigen. Since LAD patients that lack LFA-1 'do not mount an inflammatory response, it is believed that antagonism of LFA-l's natural ligand, ICAM-1, will also inhibit an inflammatory response.
  • ICAM-1 The ability of antibodies against ICAM-1 to inhibit inflammation provides the basis for their therapeutic use in the treatment of chronic inflammatory diseases and autoimmune diseases such as lupus erythematosus, autoimmune thyroiditis, experimental allergic encephalomyelitis (EAE), multiple sclerosis, some forms of diabetes Reynaud's syndrome, rheumatoid arthritis, etc.
  • autoimmune diseases such as lupus erythematosus, autoimmune thyroiditis, experimental allergic encephalomyelitis (EAE), multiple sclerosis, some forms of diabetes Reynaud's syndrome, rheumatoid arthritis, etc.
  • EAE experimental allergic encephalomyelitis
  • multiple sclerosis some forms of diabetes Reynaud's syndrome
  • rheumatoid arthritis etc.
  • a HAM or RAM capable of binding ICAM-1 may be employed in the treatment of those diseases currently treatable through steroid therapy.
  • the present invention derives from the discovery that ICAM-1 on endothelial cells binds to the members of the CD18 family of molecules on granulocytes responsible for mediating granulocyte-endothelial cell adhesion and that antagonists of ICAM-1 are capable of inhibiting such adhesion. Such inhibition provides a means for treating general, non ⁇ specific tissue inflammation.
  • a "non ⁇ specific defense system reaction” is a response mediated by leukocytes incapable of immunological memory. Such cells include granulocytes and macrophages.
  • inflammation is said to result from a response of the non-specific defense system, if the inflammation is caused by, mediated by, or associated with a reaction of the non-specific defense system.
  • inflammation which result, at least in part, from a reaction of the non-specific defense system include inflammation associated with conditions such as: adult respiratory distress syndrome (ARDS) or multiple organ injury syndromes secondary to septicemia or trauma; reperfusion injury of myocardial or other tissues; acute glomerulonephritis; reactive arthritis; dermatoses with acute inflammatory components; acute purulent meningitis or other central nervous system inflammatory disorders (e.g. stroke); thermal injury; hemodialysis; leukapheresis; ulcerative colitis; Crohn's disease; necrotizing enterocolitis; granulocyte transfusion associated syndromes; and cytokine-induced toxicity.
  • ARDS adult respiratory distress syndrome
  • multiple organ injury syndromes secondary to septicemia or trauma reperfusion injury of myocardial or other tissues
  • acute glomerulonephritis reactive arthritis
  • dermatoses with acute inflammatory components acute purulent meningitis or other central nervous system inflammatory disorders (e.g. stroke); thermal injury; hemodialysis;
  • a method of treating non-specific inflammation comprises providing to a subject in need of such treatment an affective amount of a HAM or RAM of the present invention.
  • a HAM or RAM capable of binding ICAM-1 may be employed as a means of imaging or visualizing the sites of infection and inflammation in a patient.
  • a HAM or RAM capable of binding ICAM-1 may be employed as a means of imaging or visualizing the sites of infection and inflammation in a patient.
  • RAM is detectably labeled, through the use of radioisotopes, affinity labels (such as biotin, avidin, etc.) fluorescent labels, paramagnetic atoms, etc and are provided to a patient to localize the site of infection or inflammation. Procedures for accomplishing such labeling are well known to the art. Clinical application of antibodies in diagnostic imaging are reviewed by Grossman, H.B., Urol Clin. North Amer. 75:465-474 (1986)), Unger, E.C. et al, Invest. Radiol 20:693-700 (1985)), and Khaw, B.A. et al, Science 209:295-297(1980)).
  • affinity labels such as biotin, avidin, etc.
  • the detection of foci of such detectably labeled antibodies is indicative of a site of inflammation or tumor development.
  • this examination for inflammation is done by removing samples of tissue, including blood cells, and incubating such samples in the presence of the detectably labeled antibodies.
  • this technique is done in a non-invasive manner through the use of magnetic imaging, fluorography, etc.
  • Such a diagnostic test may be employed in monitoring organ transplant recipients for early signs of potential tissue rejection.
  • assays may also be conducted in efforts to determine an individual's predilection to rheumatoid arthritis or other chronic inflammatory diseases.
  • Immune responses to therapeutic or diagnostic agents such as, for example, bovine insulin, interferon, tissue-type plasminogen activator or murine monoclonal antibodies substantially impair the therapeutic or diagnostic value of such agents, and can, in fact, causes diseases such as serum sickness.
  • therapeutic or diagnostic agents such as, for example, bovine insulin, interferon, tissue-type plasminogen activator or murine monoclonal antibodies
  • such antibodies would be administered in combination with the therapeutic or diagnostic agent.
  • the addition of an effective amount of a HAM or RAM with specificity to ICAM-1 is administer to a subject in order to prevent the recipient from recognizing the agent, and therefore prevent the recipient from initiating an immune response against it. The absence of such an immune response results in the ability of the patient to receive additional administrations of the therapeutic or diagnostic agent.
  • Another aspect of the present invention relates to the discovery of that ICAM-1 is the cellular receptor of certain viruses, and is thus required in order for the virus to adhere to and infect human cells
  • rhinoviruses and especially rhinoviruses of the major serotype have been found to be capable of mediating their infection through their capacity to bind to the ICAM-1 molecules present on cell surfaces.
  • the tenth embodiment of the present invention is directed toward the use of HAMs and RAMs capable of binding ICAM-1 to treat viral infection. Because such antibodies are capable of blocking the ICAM-1 of endothelial cells for viral attachment, their administration to a recipient individual results in the decrease in receptors available for viral binding, and thus decreases the percentage of viruses which attach and infect the cells of an individual.
  • ICAM-1 has the ability to interact with and bind to viruses, and in particular, rhinoviruses of the major serotype within the genus Picornaviridae, group A coxsackieviruses (Colonno, R.J. et al, J. virol 57:7-12 (1986)) and Mengo viruses (Rossmann, M.G. et al, Virol 164:373- 382 (1988)).
  • This interaction is mediated by ICAM-1 amino acid residues which are present in domain 1 of the ICAM-1 molecule.
  • Such interactions are assisted, however, by contributions from amino acids present in domains 2 and 3 of ICAM-1.
  • the preferred RAMs and HAMs of this embodiment are antibodies capable of binding to domains 1, 2, and 3 of ICAM-1. More preferred are HAMs and
  • RAMs capable of binding to domains 1 and 2 of ICAM-1. Most preferred are HAMs and RAMs capable of binding domain 1 of ICAM-1.
  • the administration of the anti-viral agents of the present invention may be for either a "prophylactic” or "therapeutic” purpose.
  • the anti-viral agent is provided in advance of any symptom of viral infection (for example, prior to, at, or shortly after the time of infection, but in advance of any symptoms of such infection).
  • the prophylactic administration of the agent serves to prevent or attenuate any subsequent viral infection, or to reduce the possibility that such infection will be contagious to others.
  • the anti-viral agent When provided therapeutically, the anti-viral agent is provided at (or shortly after) the onset of a symptom of actual viral infection (such as, for example, nasal congestion, fever, etc.
  • a symptom of actual viral infection such as, for example, nasal congestion, fever, etc.
  • the therapeutic administration of the agent serves to attenuate any actual viral infection.
  • the anti-viral agents of the present invention may, thus, be provided either prior to the onset of viral infection (so as to suppress an anticipated infection) or after the initiation of such infection.
  • the eleventh embodiment of present invention provides a method for suppressing the infection of HIV, which comprises administering to an HTV-infected individual an effective amount of an HIV infection suppression agent.
  • an HIV infection suppression agent such as, for example, HTV-2
  • the method may be applied to any HIV-1 variant (such as, for example, HTV-2) which may infect cells in a way which may be suppressed by the agents of the present invention.
  • HIV-1 variant such as, for example, HTV-2
  • Such variants are the equivalents of HTV-l for the purposes of the present invention.
  • One aspect of the present invention derives from the recognition that expression of LFA-1 and, in some cases, ICAM-1, stimulated by HIV infection, promotes cell-to-cell adherence reactions that can increase the contact time of infected with uninfected cells, facilitating transfer of virus from infected to uninfected cells.
  • HAMs and RAMs derived from capable of binding ICAM-1 are able to suppress infection by HIV, and, in particular, by HIV-1.
  • One means through which molecules which bind to ICAM-1 may suppress HTV infection is by impairing the ability of the ICAM-1 expressed by HTV-infected cells to bind to the CD11/CD18 receptors of a healthy T cell.
  • the agents of the present invention are intended to be provided to recipient subjects in an amount sufficient to achieve a suppression of HIV infection. An amount is said to be sufficient to "suppress" HIV infection if the dosage, route of administration, etc. of the agent are sufficient to attenuate or prevent such HIV infection.
  • the agents are to be provided to patients who are exposed to, or effected by HIV infection.
  • the HAMs and RAMs of the present invention may be for either a "prophylactic" or "therapeutic" purpose in the treatment of HTV infection.
  • the antibody When provided prophylactically, the antibody is provided in advance of any symptom of viral infection (for example, prior to, at, or shortly after) the time of such infection, but in advance of any symptoms of such infection).
  • the prophylactic administration of the antibody serves to prevent or attenuate any subsequent HIV infection.
  • the antibody is provided at (or shortly after) the detection of virally infected cells.
  • the therapeutic administration of the antibody serves to attenuate any additional HIV infection.
  • the agents of the present invention may, thus, be provided either prior to the onset of viral infection (so as to suppress the anticipated HIV infection) or after the actual detection of such virally infected cells (to suppress further infection).
  • the invention provides an improved therapy for AIDS, and an enhanced means for suppressing HIV infection, and particularly HTV-l infection, which comprises the co-administration of:
  • ICAM-1 ICAM-1, a soluble ICAM-1 derivative, CD11 (either CDlla, CDllb, or CDllc), a soluble CD11 derivative,
  • CD18 a soluble CD18 derivative, or a CD11/CD18 heterodimer, or a soluble derivative of a CD11/CD18 heterodimer and/or
  • a method for suppressing the migration of HIV-infected cells comprises administering an effective amount of an anti- migration agent to an HIV-infected individual.
  • the anti-migration agents of the present invention include any HAM or RAM capable of impairing the ability of an HIV-infected T cell to bind to ICAM-1.
  • HAMs and RAMs which bind to ICAM-1 will suppress migration by impairing the ability of the ICAM-1 expressed by
  • HIV-infected T cells to bind to cells expressing a CD11/CD18 receptor.
  • a HAM or RAM capable of binding to ICAM-1.
  • the agents of the present invention are intended to be provided to recipient subjects in an amount sufficient to suppress the migration of HTV (or other virally) infected T cells. An amount is said to be sufficient to "suppress" migration of T cells if the dosage, route of administration, etc. of the agent are sufficient to attenuate or prevent such migration.
  • the administration of such compound(s) may be for either a
  • the HAM or RAM is provided in advance of any symptom of viral infection (for example, prior to, at, or shortly after) the time of such infection, but in advance of any symptoms of such infection).
  • the prophylactic administration of the HAM or RAM serves to prevent or attenuate any subsequent migration of virally infected T cells.
  • the HAM or RAM is provided at (or shortly after) the detection of virally infected T cells.
  • the therapeutic administration of the antibody serves to attenuate any additional migration of such T cells.
  • the HAMs and RAMs of the present invention may, thus, be provided either prior to the onset of viral infection (so as to suppress the anticipated migration of infected T cells) or after the actual detection of such virally infected cells.
  • a HAM and RAM capable of binding to ICAM-1 is used in the treatment of asthma.
  • the therapeutic effects of the anti-asthma agents of the present invention may be obtained by providing such agents to a patient by any suitable means (i.e. intravenously, intramuscularly, subcutaneously, enteralry, or parenterally). It is preferred to administer the agents of the present invention intranasally as by nasal spray, swab, etc. It is especially preferred to administer such agents by oral inhalation, or via an oral spray or oral aerosol. When administering agents by injection, the administration may be by continuous infusion, or by single or multiple boluses.
  • the anti-asthma agents of the present invention are intended to be provided to recipient subjects in an amount sufficient to lessen or attenuate the severity, extent or duration of the asthma symptoms.
  • the HAMs and RAMs of the present invention may be administered either alone or in combination with one or more additional anti-asthma agents (such as methylxanthines (such as theophylline), beta- adrenergic agonists (such as catecholamines, resorcinols, saligenins, and ephedrine), glucocorticoids (such as hydrocortisone), chromones (such as cromolyn sodium) and anticholinergics (such as atropine), in order to decrease the amount of such agents needed to treat the asthma symptoms.
  • additional anti-asthma agents such as methylxanthines (such as theophylline), beta- adrenergic agonists (such as catecholamines, resorcinols, saligenins
  • the administration of the HAMs or RAMs of the present invention may be for either a “prophylactic” or “therapeutic” purpose.
  • the HAMs or RAMs are provided in advance of any asthma symptom.
  • the prophylactic administration of the HAMs or RAMs serves to prevent or attenuate any subsequent asthmatic response.
  • the HAMs or RAMs are provided at (or shortly after) the onset of a symptom of asthma.
  • the therapeutic administration of the antibody serves to attenuate any actual asthmatic episode.
  • the antibodies of the present invention may, thus, be provided either prior to the onset of an anticipated asthmatic episode (so as to attenuate the anticipated severity, duration or extent of the episode) or after the initiation of the episode.
  • ICAM-1 may be obtained by providing to a patient an effective amount of a HAM or RAM which is substantially free of natural contaminants.
  • HAMs and RAMs of the present invention disclosed herein are said to be "substantially free of natural contaminants" if preparations which contain them are substantially free of materials with which these products are normally and naturally found.
  • the present invention extends to HAMs and RAMs which may be produced either by an animal, or by tissue culture, or recombinant DNA means.
  • the dosage of administered agent will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition, previous medical history, etc.
  • it is desirable to provide the recipient with a dosage of antibody which is in the range of from about 1 pg/kg to 10 mg kg (body weight of patient), although a lower or higher dosage may be administered.
  • a HAM or RAM capable of binding to ICAM-1 may be administered to patients intravenously, intramuscularly, subcutaneously, enterally, topically inhaled, intranasally or parenterally.
  • the administration may be by continuous administration, or by single or multiple boluses.
  • a composition is said to be "pharmacologically acceptable” if its administration can be tolerated by a recipient patient.
  • Such an agent is said to be administered in a "therapeutically effective amount” if the amount administered is physiologically significant.
  • An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.
  • the HAMs and RAMs of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby these antibodies are combined in a mixture with a pharmaceutically acceptable carrier vehicle.
  • Suitable vehicles and their formulation, inclusive of other human proteins, e.g., human serum albumin, are described, for example, in Remington's Pharmaceutical Sciences (16th ed., Osol, A., Ed., Mack, Easton PA (1980)).
  • a pharmaceutically acceptable composition suitable for effective ad ⁇ ministration such compositions will contain an effective amount of a HAM or RAM together with a suitable amount of carrier vehicle.
  • Controlled release preparations may be achieved through the use of polymers to complex or absorb the HAM or RAM.
  • the controlled delivery may be exercised by selecting appropriate macromolecules (for example polyesters, polyamino acids, polyvinyl, pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, or protamine, sulfate) and the concentration of macromolecules as well as the methods of incorporation in order to control release.
  • Another possible method to control the duration of action by controlled release preparations is to incorporate the HAM or RAM into particles of a poly ⁇ meric material such as polyesters, polyamino acids, hydrogels, poly(lactic acid) or ethylene vinylacetate copolymers.
  • microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatine-microcapsules and poly- (methylmethacylate) microcapsules, respectively, or in colloidal drug delivery systems, for example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules or in macroemulsions.
  • Ingelheim Pharmaceuticals Inc. (Lot No. R6-5-D6 - E9-B2 0-29-86) and was grown up in antibiotic free Dulbecco's Modified Eagles Medium (DMEM) supplemented with glutamine and 5% foetal calf serum, and divided to provide both an overgrown supernatant for evaluation and cells for extraction of RNA.
  • the overgrown supernatant was shown to contain murine IgG2a/kappa antibody.
  • Cell culture supernatant was examined and confirmed to contain the antibody R6-5-D6.
  • DNA sequencing was performed as described in Sanger et al. (1977) (Sanger et al, Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)) and the Amersham International Pic sequencing handbook. COS cell expression and metabolic labelling studies were as described in Whittle et al (1987) (Whittle et al, Prot. Eng.
  • 96 well microtitre plates were coated with F(ab') 2 goat anti-human kappa light chain. The plates were washed with water and samples added and incubated for one hour at room temperature. The plates were washed and F(ab') 2 goat anti-human F(ab') 2 Horse radish peroxidase (HRPO) conjugate was then added and incubated for a further hour. Enzyme substrate was then added to reveal the reaction.
  • HRPO Horse radish peroxidase
  • Assembly assays were performed on supernatants from transfected COS cells and from transfected CHO cells to determine the amount of intact IgG present.
  • the assembly assay for intact mouse IgG in cell supernatants was an ELISA with the following format: 96 well microtitre plates were coated with F(ab') 2 goat anti-mouse IgG Fc.
  • the assembly assay for intact humanized anti»ICAM-l in COS cell supernatants was an ELISA with the following format: 96 well microtitre plates were coated with F(ab') 2 goat anti-human IgG Fc. The plates were washed and samples added and incubated for 1 hour at room temperature. The plates were washed and monoclonal mouse anti-human kappa chain was added and incubated for 1 hour at room temperature. The plates were washed and F(ab') 2 goat anti-mouse IgG
  • JY cells a human B lymphoblastoid cell line which constitutively expresses ICAM-1 on the cell surface
  • Monolayers of JY cells were fixed onto 96 well ELISA plates using poly-L-lysie and paraformaldehyde. Samples were added to the monolayers and incubated for 1 hour at room temperature. The plates were washed gently using PBS.
  • F(ab;) 2 goat anti-human IgG Fc (HPO conjugated) or F(ab') 2 goat anti-mouse IgG Fc (HRPO conjugated) which was added as appropriate for humanized or mouse samples. Enzyme substrate was then added to reveal the reaction.
  • the negative control for the cell-based assay was chimeric B72.3 (IgG4) or pooled, purified human IgG2 and IgG4 (Chemicon).
  • the positive control was murine R6.5.D6 MAb or chimeric anti-ICAM-1 antibodies. 3.3.2 Competition Binding
  • Monolayers of JY cells were prepared as in 3.3.1. Antibody samples were added and incubated overnight at 4 C. Biotinylated anti-ICAM-1 was added to all the wells. The mixture was left at room temperature for 2 hours. The plates were washed and streptavidin-HRPO was added. After further incubation enzyme substrate was added to reveal the reaction.
  • cDNA was prepared by priming from Oligo-dT to generate full length cDNA. The cDNA was methylated and EcoRI linkers added for cloning.
  • the cDNA library was ligated to pSP64 vector DNA which had been EcoRI cut and the 5' phosphate groups removed by calf intestinal phosphatase (EcoRI/CIP). The ligation was used to transform high transformation efficiency Escherichia coli HB101 (24 E. coli
  • HB101 from Bethesda Research Lbs (BRL) in the case of the light chain
  • E. coli LM1035 prepared by electroporation (Dower et al, Nucl Acids Res. 16:6127 (1988)) in the case of the heavy chain.
  • cDNA libraries were prepared. 11600 colonies were screened for the light chain and 25000 colonies were screened for the heavy chain.
  • E. coli colonies positive for either heavy or light chain probes were identified either by oligonucleotide screening using the oligonucleotide: 5'TCCAGATGTTAACTGCTCAC for the light chain, which is complementary to a sequence in the mouse kappa constant region, or by using a 980 bp BamHI-EcoRI restriction fragment of a previously isolated mouse IgG2a constant region clone. 6 light chain and 10 heavy chain clones were identified and taken for second round screening. Positive clones from the second round of screening were grown up and DNA prepared. The sizes of the gene inserts were estimated by gel electrophoresis and DNA inserts of a size capable of containing a full length cDNA were sequenced.
  • Celltech expression vectors are based on the plasmid pEE6 hCMV as shown in Figure 3 (Bebbington, C.R., Published International Patent Apphcation WO 89/01036).
  • a polylinker for the insertion of genes to be expressed has been introduced after the major immediate early promoter/enhancer of the human Cytomegalovirus (hCMV).
  • Marker genes for selection of the plasmid in transfected eukaryotic cells can be inserted as BamHI cassettes in the unique BamHI site of pEE6 hCMV. It is usual practice to insert the neo and gpt markers prior to insertion of the gene of interest, whereas the GS marker is inserted last because of the presence of internal EcoRI sites in the cassette.
  • the selectable markers are expressed from the SV40 late promoter which also provides an origin of rephcation so that the vectors can be used for expression in the COS cell transient expression system.
  • the mouse sequences were excised as EcoRI fragments and cloned into either EE6-hCMV-neo for the light chain ( Figure 4) and into EE6- hCMV-gpt for the heavy chain ( Figure 5).
  • Plasmids pAL5 ( Figure 4) and ⁇ AL6 ( Figure 5) were co-transfected into COS cells and supernatant from the transient expression experiment was shown to contain assembled antibody which bound to JY cells ( Figure 6). Metabolic labelling experiments using 35 S methionine showed expression and assembly of heavy and light chains.
  • Light Chain Sequence Figure 7 shows the amino acid sequence of two variable regions in which the mouse framework regions have been replaced by the analogous sequences from the EU light chain.
  • the only mouse sequences used are residues 24-34, 50-56 and 89-97 inclusive.
  • gL221A several framework residues have been left as mouse. This was done after consideration of the possible contribution of these residues to domain packing and stability of the conformation of the antigen binding region.
  • the residue numbers are 2, 3, 49, 60, 70, 84, 85 and 87 and are noted in the Figure by underlining.
  • Figure 8 shows the oligonucleotide pairs used to build the variable region gene for the gL221 construct. Oligonucleotides were chemically phosphorylated during synthesis. 20 pmole of complementary oligonucleotides were paired and heated to 65 °C and allowed to anneal by cooling to room temperature. All of the pairs were then mixed and ligated overnight using T4 DNA ligase. The terminal restriction sites were exposed by cleavage of the ligation products with the enzymes BstBI and Spll.
  • pE1081 is a vector, similar to pEE6 hCMV described above, containing the hCMV promoter and the human kappa constant region in a configuration such that insertion of the variable region sequence on a BstBI-SplI fragment will allow efficient expression and secretion of full length light chain sequence in suitable eukaryotic cells, e.g. Cos-1 cells.
  • FIG. 9 shows a diagram of the construction procedure.
  • the gL221A gene was assembled in a similar manner to give a plasmid pBJl.
  • Figure 10 shows the oligonucleotide pairs used to build the variable region gene for the gL221A construct.
  • Figure 11 shows the amino acid sequence of heavy chain variable regions in which the mouse framework regions have been replaced by analogous sequences from the EU heavy chain.
  • EU heavy chain has a particularly idiosyncratic J region and the murine sequence from the anti-ICAM antibody R6-5-D6 in fact more closely resembles the normal human sequence motif than does EU. Therefore the murine sequence between residues 103 to 108 inclusive (numbered according to EU index, Kabat et al, in Sequences of Proteins of Immunological Interest US Department of Health and Human Services, NIH, USA (1987) were incorporated into the gene design.
  • gH341 the mouse sequences from residues 26-35, 50-56 and 94- 100B (numbered according to EU index Kabat et al, in Sequences of Proteins of Immunological Interest US Department of Health and Human Services, Nm, USA (1987) were included, as well as those mentioned earlier.
  • gH341A at amino acids 24 and 73 the mouse residues were used.
  • gH341B at amino acids 24, 48 and 73 mouse residues were used.
  • gH341D at amino acids 24, 48, 69, 71, 73, 80, 88, and 91 the mouse residues were used. These extra mouse residues were included to accommodate decisions on the likely contribution of these residues to domain integrity and the correct positioning of the antigen binding region.
  • Figure 12 shows the oligonucleotide pairs used to build the variable region gene for the gH341 construct.
  • the gene was assembled as described in 9.1 for gL221.
  • Hindlll and Apal were used to isolate the required gene fragment restriction enzymes Hindlll and Apal.
  • the 440 bp gene fragment was cloned into the Hindlll and Apal sites of pE1004 (a vector similar to pEE6 hCMV described above) which is a vector containing the hCMV promoter and the human IgG4 constant region in a configuration such that introduction of the variable region sequence will allow efficient expression and secretion of full length heavy chain sequence, when co-expressed with a vector capable of producing a suitable light chain, in a eukaryotic cell, e.g.
  • the vector also encodes the hypoxanthine guanine phosphoribosyl transferase gene (gpt gene) to allow for the formation of stable cell lines in, for example, Chinese Hamster Ovary (CHO) cells.
  • gpt gene hypoxanthine guanine phosphoribosyl transferase gene
  • Candidate clones were confirmed by DNA sequencing.
  • pJA192 was used for expression studies.
  • the gH341A gene was assembled in a similar manner to give pJA195.
  • the residues 24 and 73 investigated in the gH341A gene in JA192 are separated to form two further genes, gH341Al and gH341A2, using a restriction site, Xhol, which lies between the two codons in the gH341A gene.
  • Xhol a restriction site which lies between the two codons in the gH341A gene.
  • the gH341B gene was prepared from gH341A in pJA195 by a Polymerase Chain Reaction (PCR) mutagenesis procedure in which the codon for amino acid 48 was altered such that the resultant amino acid changed from the human residue, methionine, to the mouse amino acid isoleucine.
  • PCR Polymerase Chain Reaction
  • the process for the construction of gH341B is outlined in Figure 13.
  • a candidate clone pAL19 was confirmed by DNA sequencing and used for expression studies.
  • the gH341D gene was assembled by oligonucleotide assembly of the 3' half of the variable region and was cloned into pJA195 (gH341A) as a 294 bp Xhol-Apal fragment.
  • Figure 13 shows the oligonucleotides used to assemble this gene fragment.
  • the resultant vector was termed pAL20.
  • an alternative acceptor framework could be used.
  • the antibody As an alternative to the use of EU as heavy chain acceptor, an alternative acceptor framework could be used.
  • the antibody For example, the antibody
  • KOL has been shown to be a useful acceptor.
  • the gene, gH341A has murine sequence at regions 36-35, 50-62, 64-65 and 95-100b inclusive (Kabat et al, in Sequences of Proteins of Immunological Interest US Department of Health and Human Services, NIH, USA (1987)) and also at amino acid locations 24, 71 and 73.
  • the oligonucleotides required to assemble the gene are shown in Figure 14. 10 pmole of each oligonucleotide is mixed in a 100 ⁇ l final volume of buffer.
  • the mixture is subjected to 30 cycles of temperature adjustment of to 95 °C for 1 minute, 55 °C for 1 minute and 72°C 1 minute with 0.5 units of Taq Polymerase.
  • the required fragment can be recovered after Hindlll and Apal digestion of the reaction products and can be cloned into pE1004 for expression studies.
  • Figure 15 shows a series of transfections in which the gL221 and gL221A genes were co-transfected with cH, and the gH341, gH341A, gH341B, gH341D genes were co-transfected with cL. Comparison was made to the cL cH combination.
  • Figure 16 shows a comparison of the gH341D gene co-expressed with either gL221 or gL221A. It can be seen that the binding of the antibodies relative to the chimeric antibody is about 75% and 50% respectively for the gL221A/gH341D and gL221/gH341D combinations.
  • Figure 17 shows the result of a competition assay in which the IgG4 gL221A gH341D antibody successfully competes for binding to ICAM-1 on JY cells against the parent mouse antibody R6.5.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Oncology (AREA)
  • Nutrition Science (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pulmonology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Anticorps à greffe de régions déterminantes complémentaires adaptés au modèle humain, capables de se lier à la molécule d'adhérence intercellulaire ICAM-1. Ces anticorps sont utiles dans le traitement d'inflammations spécifiques et non spécifiques, d'affections rhinovirales, d'infections par VIH, de la dissémination de cellules contaminées par le VIH, ainsi que de l'asthme. De plus, les anticorps adaptés au modèle humain peuvent être utiles dans des procédés de diagnostic et de localisation de sites d'inflammation et d'infection et de tumeurs exprimant la ICAM-1.
PCT/US1991/002942 1990-04-27 1991-04-29 Anticorps anti-molecule 1 d'adherence intercellulaire a greffe de regions determinantes complementaires adaptes au modele humain, leur procede de preparation et d'utilisation WO1991016927A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
BR919106392A BR9106392A (pt) 1990-04-27 1991-04-29 Anticorpos anti-icam-1 enxertados-cdr humanizados,metodos de preparacao e uso dos mesmos
NO92924087A NO924087L (no) 1990-04-27 1992-10-22 Antistoffer, fremgangsmaate for deres fremstilling og anvendelse dera
FI924818A FI924818A (fi) 1990-04-27 1992-10-23 Cdr-ympade anti-icam-1-antikroppar foer maenniskobruk, foerfaranden foer deras framstaellning samt deras anvaendning

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB909009549A GB9009549D0 (en) 1990-04-27 1990-04-27 Recombinant antibody and method
GB9009549.8 1990-04-27

Publications (1)

Publication Number Publication Date
WO1991016927A1 true WO1991016927A1 (fr) 1991-11-14

Family

ID=10675134

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1991/002942 WO1991016927A1 (fr) 1990-04-27 1991-04-29 Anticorps anti-molecule 1 d'adherence intercellulaire a greffe de regions determinantes complementaires adaptes au modele humain, leur procede de preparation et d'utilisation

Country Status (8)

Country Link
EP (1) EP0528951A4 (fr)
JP (1) JPH06500229A (fr)
AU (1) AU7900191A (fr)
BR (1) BR9106392A (fr)
CA (1) CA2081478A1 (fr)
GB (1) GB9009549D0 (fr)
HU (2) HUT62652A (fr)
WO (1) WO1991016927A1 (fr)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0459577A2 (fr) * 1990-06-01 1991-12-04 Merck & Co. Inc. Portions exprimées microbiologiquement d'un anticorps monoclonal, bloquant l'attachement des rhinovirus aux récepteurs cellulaires
EP0528931A1 (fr) * 1990-04-27 1993-03-03 Celltech Limited ANTICORPS ANTI-MOLECULE 1 d'ADHERENCE INTERCELLULAIRE CHIMERIQUE ADAPTES AU MODELE HUMAIN, PROCEDE DE PREPARATION ET D'UTILISATION
WO1993006864A1 (fr) * 1991-10-01 1993-04-15 The General Hospital Corporation Prevention du rejet d'une allogreffe a l'aide d'anticorps contre des molecules d'adhesion
US5484892A (en) * 1993-05-21 1996-01-16 Dana-Farber Cancer Institute, Inc. Monoclonal antibodies that block ligand binding to the CD22 receptor in mature B cells
WO1996034015A1 (fr) * 1995-04-24 1996-10-31 Boehringer Ingelheim Pharmaceuticals, Inc. Anticorps anti-icam-1 modifies et leur utilisation dans le traitement des inflammations
US5589453A (en) * 1988-09-01 1996-12-31 Molecular Therapeutics, Inc. Human rhinovirus receptor protein (ICAM-1) that inhibits rhinovirus attachment and infectivity
US5622700A (en) * 1992-08-21 1997-04-22 Genentech, Inc. Method for treating a LFA-1-mediated disorder
US5674982A (en) * 1990-07-20 1997-10-07 Bayer Corporation Multimeric form of human rhinovirus receptor protein
US5686582A (en) * 1990-07-20 1997-11-11 Bayer Corporation Multimeric forms of human rhinovirus receptor protein
US5844094A (en) * 1992-09-25 1998-12-01 Commonwealth Scientific And Industrial Research Organization Target binding polypeptide
US5914112A (en) * 1996-01-23 1999-06-22 Genentech, Inc. Anti-CD18 antibodies in stroke
US6037454A (en) * 1996-11-27 2000-03-14 Genentech, Inc. Humanized anti-CD11a antibodies
US6107461A (en) * 1990-07-20 2000-08-22 Bayer Corporation Multimeric forms of human rhinovirus receptor and fragments thereof, and method of use
US6524581B1 (en) 1998-12-30 2003-02-25 The Children's Medical Center Corporation Prevention and treatment of retinal ischemia and edema
US6566095B1 (en) 1999-06-24 2003-05-20 Johns Hopkins University Compositions and methods for preventing transepithelial transmission of HIV
US6582698B1 (en) 1999-03-19 2003-06-24 Genentech, Inc. Treatment method
US6652855B1 (en) 1999-03-19 2003-11-25 Genentech, Inc. Treatment of LFA-1 associated disorders with increasing doses of LFA-1 antagonist
WO2003035696A3 (fr) * 2001-07-19 2003-11-27 Perlan Therapeutics Inc Anticorps humanises
US7361344B2 (en) 1996-01-23 2008-04-22 Genentech, Inc. Co-administration of a thrombolytic and an-anti-CD18 antibody in stroke
US7396530B2 (en) 2004-06-09 2008-07-08 Genentech, Inc. Method of treating granuloma annulare or sarcoid
EP2067790A2 (fr) 1994-04-04 2009-06-10 Genentech, Inc. Anticorps agoniste de kinase de la protéine tyrosine SAL-S1
US7985833B2 (en) 2000-04-21 2011-07-26 Fuso Pharmaceutical Industries, Ltd. Collectin
JP2012228269A (ja) * 2002-03-13 2012-11-22 Biogen Idec Ma Inc 抗αｖβ６抗体
EP2729497A1 (fr) * 2011-07-05 2014-05-14 Dinona Inc. Anticorps induisant une tolérance des lymphocytes t spécifique d'un antigène et son utilisation
US8992924B2 (en) 2005-07-08 2015-03-31 Biogen Idec Ma Inc. Anti-ανβ6 antibodies and uses thereof
US10035859B2 (en) 2013-03-15 2018-07-31 Biogen Ma Inc. Anti-alpha V beta 6 antibodies and uses thereof
US10035860B2 (en) 2013-03-15 2018-07-31 Biogen Ma Inc. Anti-alpha V beta 6 antibodies and uses thereof
WO2020141869A1 (fr) * 2018-12-31 2020-07-09 다이노나(주) Anticorps se liant de manière spécifique à icam-1 et utilisation associée

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5223396A (en) * 1991-05-03 1993-06-29 Boehringer Ingelheim Pharmaceuticals, Inc. Method for detecting organ transplant rejection

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989001783A2 (fr) * 1987-09-04 1989-03-09 Celltech Limited Anticorps recombinant et procede
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0314863B1 (fr) * 1987-11-02 1994-12-07 Baylor College Of Medicine Utilisation du ICAM-1 ou de ses derivés fonctionels pour le traitement des inflammations non spécifiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
WO1989001783A2 (fr) * 1987-09-04 1989-03-09 Celltech Limited Anticorps recombinant et procede

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
European Journal of Immunology, Vol. 20, issued December 1990, GEISSLER et al., "A Monoclonal Antibody Directed Against the Human Intercellular Adhesion Molecule (ICAM-1) Modulates the Release of Tumor Necrosis Factor-alpha, Interferon-alpha and Interleukin 1", pages 2591-2596, see entire document. *
European Journal of Immunology, Vol. 20, issued February 1990, BUCKLE et al., "Human Memory T Cells Express Intercellular Adhesion Molecule-1 which can be Increased by Interleukin-2 and Interferon-alpha", pages 337-341, see entire document. *
Journal of Clinical Investigation, Vol. 82, issued November 1988, SMITH et al., "Recognition of an Endothelial Determinant for CD18-dependent Human Neutrophil Adherence and Transendothelial Migration, pages 1746-1756, see entire document. *
Journal of Immunology, Vol. 143, No. 4, issued 15 August 1989, BARTON et al., "The Effect of Anti-Intercellular Adhesion Molecule-1 on Phorbil-Ester-Induced Rabbit Lung Inflammation", pages 1278-1282, see Abstract and Discussion. *
Nature, Vol. 321, issued 29 May 1986, JONES et al., "Replacing the Complementarily-determining regions in a Human Antibody with those from a Mouse", pages 522-525, see entire document. *
Proceedings of the National Academy of Science, US, Vol. 86, issued December 1989, QUEEN et al., "A Humanized Antibody that binds to the Interleukin-2 Receptor", pages 10029-10033, see entire document. *
Proceedings of the National Academy of Sciences, US, Vol. 81, issued November 1984, MORRISON et al., "Chimeric Human Antibody Molecules: Mouse Antigen-Binding Domains with Human Constant Region Domains", pages 6851-6855, see entire document. *
See also references of EP0528951A4 *

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5589453A (en) * 1988-09-01 1996-12-31 Molecular Therapeutics, Inc. Human rhinovirus receptor protein (ICAM-1) that inhibits rhinovirus attachment and infectivity
EP0528931A1 (fr) * 1990-04-27 1993-03-03 Celltech Limited ANTICORPS ANTI-MOLECULE 1 d'ADHERENCE INTERCELLULAIRE CHIMERIQUE ADAPTES AU MODELE HUMAIN, PROCEDE DE PREPARATION ET D'UTILISATION
EP0528931A4 (en) * 1990-04-27 1993-04-28 Celltech Limited Humanized chimeric anti-icam-1 antibodies, methods of preparation and use
EP0459577A3 (en) * 1990-06-01 1992-08-05 Merck & Co. Inc. Microbially expressed portions of a monoclonal antibody block rhinovirus attachment to cell receptors
EP0459577A2 (fr) * 1990-06-01 1991-12-04 Merck & Co. Inc. Portions exprimées microbiologiquement d'un anticorps monoclonal, bloquant l'attachement des rhinovirus aux récepteurs cellulaires
US5686581A (en) * 1990-07-20 1997-11-11 Bayer Corporation Multimeric form of human rhinovirus receptor protein
US5871733A (en) * 1990-07-20 1999-02-16 Bayer Corporation Multimeric forms of human rhinovirus receptor protein
US6107461A (en) * 1990-07-20 2000-08-22 Bayer Corporation Multimeric forms of human rhinovirus receptor and fragments thereof, and method of use
US5674982A (en) * 1990-07-20 1997-10-07 Bayer Corporation Multimeric form of human rhinovirus receptor protein
US5686582A (en) * 1990-07-20 1997-11-11 Bayer Corporation Multimeric forms of human rhinovirus receptor protein
WO1993006864A1 (fr) * 1991-10-01 1993-04-15 The General Hospital Corporation Prevention du rejet d'une allogreffe a l'aide d'anticorps contre des molecules d'adhesion
US5622700A (en) * 1992-08-21 1997-04-22 Genentech, Inc. Method for treating a LFA-1-mediated disorder
US5844094A (en) * 1992-09-25 1998-12-01 Commonwealth Scientific And Industrial Research Organization Target binding polypeptide
EP1550729A1 (fr) * 1992-09-25 2005-07-06 Commonwealth Scientific And Industrial Research Organisation Polypeptides se fixant à une cible comprenant un domaine de type immunoglobuline (IG-like) VL fusioné à une domaine de type immunoglobuline (IG-like) VH
US5484892A (en) * 1993-05-21 1996-01-16 Dana-Farber Cancer Institute, Inc. Monoclonal antibodies that block ligand binding to the CD22 receptor in mature B cells
EP2067790A2 (fr) 1994-04-04 2009-06-10 Genentech, Inc. Anticorps agoniste de kinase de la protéine tyrosine SAL-S1
WO1996034015A1 (fr) * 1995-04-24 1996-10-31 Boehringer Ingelheim Pharmaceuticals, Inc. Anticorps anti-icam-1 modifies et leur utilisation dans le traitement des inflammations
US7655230B2 (en) 1996-01-23 2010-02-02 Genentech, Inc. Co-administration of a tissue plasminogen activator, anti-CD11b antibody and anti-CD18 antibody in stroke
US7361344B2 (en) 1996-01-23 2008-04-22 Genentech, Inc. Co-administration of a thrombolytic and an-anti-CD18 antibody in stroke
US5914112A (en) * 1996-01-23 1999-06-22 Genentech, Inc. Anti-CD18 antibodies in stroke
US6037454A (en) * 1996-11-27 2000-03-14 Genentech, Inc. Humanized anti-CD11a antibodies
US6703018B2 (en) 1996-11-27 2004-03-09 Genentech, Inc. Method of treatment using humanized anti-CD11a antibodies
US8586712B2 (en) 1998-11-30 2013-11-19 Perlan Therapeutics, Inc. Humanized antibodies
US7696324B2 (en) 1998-11-30 2010-04-13 Perlan Therapeutics, Inc. Humanized antibodies
US6670321B1 (en) 1998-12-30 2003-12-30 The Children's Medical Center Corporation Prevention and treatment for retinal ischemia and edema
US6524581B1 (en) 1998-12-30 2003-02-25 The Children's Medical Center Corporation Prevention and treatment of retinal ischemia and edema
US7364734B2 (en) 1999-03-19 2008-04-29 Genentech, Inc. Treatment of LFA-1 associated disorders with increasing doses of LFA-1 antagonist
US6652855B1 (en) 1999-03-19 2003-11-25 Genentech, Inc. Treatment of LFA-1 associated disorders with increasing doses of LFA-1 antagonist
US6582698B1 (en) 1999-03-19 2003-06-24 Genentech, Inc. Treatment method
US6566095B1 (en) 1999-06-24 2003-05-20 Johns Hopkins University Compositions and methods for preventing transepithelial transmission of HIV
US8604162B2 (en) 2000-04-21 2013-12-10 Fuso Pharmaceutical Industries, Ltd. Collectin
US7985833B2 (en) 2000-04-21 2011-07-26 Fuso Pharmaceutical Industries, Ltd. Collectin
AU2002363027B2 (en) * 2001-07-19 2008-09-18 Perlan Therapeutics, Inc. Humanized antibodies against ICAM-1, their production and uses
AU2002363027C1 (en) * 2001-07-19 2009-04-30 Perlan Therapeutics, Inc. Humanized antibodies against ICAM-1, their production and uses
EP2336186A1 (fr) * 2001-07-19 2011-06-22 Perlan Therapeutics, Inc. Anticorps humanisés contre ICAM-1, leurs production et usage
WO2003035696A3 (fr) * 2001-07-19 2003-11-27 Perlan Therapeutics Inc Anticorps humanises
JP2012228269A (ja) * 2002-03-13 2012-11-22 Biogen Idec Ma Inc 抗αｖβ６抗体
JP2015126743A (ja) * 2002-03-13 2015-07-09 バイオジェン・エムエイ・インコーポレイテッドＢｉｏｇｅｎ ＭＡ Ｉｎｃ． 抗αｖβ６抗体
US9745376B2 (en) 2002-03-13 2017-08-29 Biogen Ma Inc. Anti-ανβ6 antibodies
US7396530B2 (en) 2004-06-09 2008-07-08 Genentech, Inc. Method of treating granuloma annulare or sarcoid
US8992924B2 (en) 2005-07-08 2015-03-31 Biogen Idec Ma Inc. Anti-ανβ6 antibodies and uses thereof
EP2729497A1 (fr) * 2011-07-05 2014-05-14 Dinona Inc. Anticorps induisant une tolérance des lymphocytes t spécifique d'un antigène et son utilisation
EP2729497A4 (fr) * 2011-07-05 2015-01-14 Dinona Inc Anticorps induisant une tolérance des lymphocytes t spécifique d'un antigène et son utilisation
AU2011372348B2 (en) * 2011-07-05 2015-04-30 Kumho Ht, Inc. An antibody inducing antigen-specific T cell tolerance and use thereof
US10035859B2 (en) 2013-03-15 2018-07-31 Biogen Ma Inc. Anti-alpha V beta 6 antibodies and uses thereof
US10035860B2 (en) 2013-03-15 2018-07-31 Biogen Ma Inc. Anti-alpha V beta 6 antibodies and uses thereof
WO2020141869A1 (fr) * 2018-12-31 2020-07-09 다이노나(주) Anticorps se liant de manière spécifique à icam-1 et utilisation associée

Also Published As

Publication number Publication date
CA2081478A1 (fr) 1991-10-28
HU9203371D0 (en) 1993-01-28
HUT62652A (en) 1993-05-28
AU7900191A (en) 1991-11-27
BR9106392A (pt) 1993-04-27
JPH06500229A (ja) 1994-01-13
EP0528951A1 (fr) 1993-03-03
EP0528951A4 (en) 1993-05-26
GB9009549D0 (en) 1990-06-20

Similar Documents

Publication Publication Date Title
AU649682B2 (en) Humanized chimeric anti-ICAM-1 antibodies, methods of preparation and use
WO1991016927A1 (fr) Anticorps anti-molecule 1 d'adherence intercellulaire a greffe de regions determinantes complementaires adaptes au modele humain, leur procede de preparation et d'utilisation
EP1278543B1 (fr) Methode d'administration d'un anticorps
RU2184147C2 (ru) Реконструированное человеческое анти-нм1.24 антитело, днк, кодирующая н и l цепи человеческого анти-нм1.24 антитела, вектор, способ получения реконструированного человеческого анти-нм1.24 антитела, фармацевтическая композиция для лечения миеломы
EP0804237B1 (fr) Anticorps humanises diriges contre la molecule d'adhesion leucocytaire vla-4
EP0678122B1 (fr) Molecules d'anticorps anti-vla4 de recombinaison
JP2763030B2 (ja) 細胞間粘着分子およびその結合性リガンド
AU679506B2 (en) Intercellular adhesion molecules, and their binding ligands
WO1992022323A1 (fr) Molecules d'adhesion intracellulaire icam-3 et leurs ligands de fixation
CA2237808A1 (fr) Utilisations therapeutiques d'anticorps humanises contre l'alpha-4 integrine
CA1341185C (fr) Molecules d'adhesion intercellulaire et ses ligands de fixation
US5817311A (en) Methods of inhibiting T-cell medicated immune responses with LO-CD2a-specific antibodies
ZA200503173B (en) LFA-1 alpha subunit antibodies and methods of use
US5891841A (en) Methods of using intercellular adhesion molecule-3 (ICAM-3), antibodies thereto, and soluble fragments thereof
JP3778922B2 (ja) 細胞間粘着分子およびその結合性リガンド
US7592006B1 (en) Composition comprising the LO-CD2a antibody
EP1854480A2 (fr) Traitement de désordres associés à LFA-1 avec augmentation des doses d'antagonistes LFA-1
AU670243C (en) Intercellular adhesion molecule-3 and its binding ligands
IE19960275A1 (en) Intercellular adhesion molecules, and their binding ligands

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AT AU BB BG BR CA CH DE DK ES FI GB HU JP KP KR LK LU MC MG MW NL NO PL RO SD SE SU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BF BJ CF CG CH CM DE DK ES FR GA GB GR IT LU ML MR NL SE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 924818

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 2081478

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1991910051

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1991910051

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1991910051

Country of ref document: EP