WO1991001998A1 - Proteins with tnf activity - Google Patents

Proteins with tnf activity Download PDF

Info

Publication number
WO1991001998A1
WO1991001998A1 PCT/EP1990/001190 EP9001190W WO9101998A1 WO 1991001998 A1 WO1991001998 A1 WO 1991001998A1 EP 9001190 W EP9001190 W EP 9001190W WO 9101998 A1 WO9101998 A1 WO 9101998A1
Authority
WO
WIPO (PCT)
Prior art keywords
tnf
arg
proteins
sequence
heavy chain
Prior art date
Application number
PCT/EP1990/001190
Other languages
German (de)
French (fr)
Inventor
Thomas Doerper
Heinz Hillen
Franz Emling
Lothar Daum
Achim Moeller
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Publication of WO1991001998A1 publication Critical patent/WO1991001998A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/525—Tumour necrosis factor [TNF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones

Definitions

  • the invention relates to new proteins with TNF activity, their production and their use in therapy.
  • TNF tumor necrosis factor
  • proteolytic enzymes - tuftsin endocarboxidase and leukokininase - released from the leukophilic IgG and binds to specific tuftsin receptors on neutrophilic granulocytes, monocytes and macrophages (Nishioka et al., Cancer Investigation 2, 39-49, 1984).
  • the tetrapeptide rigin which also originates from the heavy chain of leukokinin and has the primary structure H2N-GLY-GLU-PRO-ARG-COOH (Veretennikova et al., Int. J. Peptide Prot.
  • TNF hybrid molecules To stimulate granulocytes for degranulation and superoxide formation (Tsujimoto et al., Biochem. Biophys. Res. Comm. 137, 1094-1100, 1986; Klebanoff et al., J.Immunol. 136, 4220-4225, 1986) selectively amplified by the new TNF hybrid molecules described. Other features of the TNF such as the direct cytotoxicity to tumor cells is not affected to the same extent by this enhancement of activity, so that the new TNF hybrid molecules are particularly suitable for influencing neutrophil granulocytes.
  • the invention relates to proteins with the following amino acid sequence:
  • X is a peptide fragment from the leukokinin heavy chain with the amino acid sequence Y-Pro-Arg-Z, wherein Y is a direct bond or a sequence of 1-6 amino acids preceding the Pro-Arg in the leukokinin heavy chain sequence, and Z is a direct bond or a sequence of 1-6 amino acids that follow the Pro-Arg in the leukokinin heavy chain sequence.
  • ProArg occurs in two places in the heavy chain of leukokinin. The following amino acid sequences precede the ProArg at these points:
  • ProArg GluGluGlnPheAsnSer and GluProGlnValTyrThr.
  • the new proteins can be produced by a. creates a vector that contains the genetic information for the
  • the appropriate cDNA is used to prepare a suitable vector.
  • the monocyte cell line HL 60 (ATCC No. CCL 240) was cultivated as described (Pennica et al., Nature 312, 724-729, 1984), the mRNA was isolated after stimulation and according to known methods in cDNA translated.
  • a cDNA library was created by inserting this cDNA into the commercially available cloning vector Lambda gt 10.
  • a cDNA clone containing the coding part of the TNF gene was identified using radioactive labeled 01 igonucleotide probes (FIG. 1).
  • Plasmids pBR 322 and pBR 327 were carried out in a manner known per se.
  • the genes or gene fragments can also be provided with suitable chemically synthesized control regions which enable expression of the proteins.
  • the transformation of the hybrid plasmids obtained in this way into suitable host organisms, advantageously E. coli, is also known and is described in detail.
  • the hybrid plasmids can also be provided with corresponding signal sequences which allow the polypeptides to be secreted into the periplasm of E. coli. Due to the degeneration of the genetic code, it is also possible to use other DNA sequences, for example chemically synthesized TNF genes with different DNA sequences, for the expression of TNF hybrid genes.
  • the new hybrid proteins with TNF activity can be used as new active ingredients in the therapy of malignant diseases in humans.
  • the starting material is a recombinant phage with the TNF cDNA, which was prepared according to the method described by Pennica et al. (Nature 312, 724-729, 1984).
  • RNA was isolated from this cell line and the cDNA was produced from it according to Maniatis: Molecular Cloning, Cold Spring Harbor Laboratory, 1982, pages 224ff. A gene balance was created with this cDNA, the lambda phage gtlO being used as the vector.
  • the library was screened with the help of a TNF-specific, chemically synthesized oligonucleotide sample that was radioactively labeled.
  • the new hybrid plasmid pTNF-1 was obtained by linking 0.1 pmole of the vector fragment, 0.2 pmole of the 578 bp TNF fragment and 0.5 pmole A1 and B1 each with the enzyme T4-DNA ligase (FIG. 1, An and Bn mean the oligonucleotides A1, A2 ... and B1, B2 ).
  • the new hybrid plasmids pTNF-2, pTNF-3, pTNF-4 and pTNF-5 were obtained in each case.
  • the starting point is the plasmid pTNF-1 constructed in Example 1. This carries a unique Bgl2 recognition site (AGATCT). The plasmid pTNF-1 was opened with the restriction enzyme Bgl2. To 0.1 pmol of this
  • DNA fragments were added to 0.3 pmol of an equimolar mixture of synthetically produced A6 and B6 and linked by a reaction catalyzed by T4 DNA ligase (FIG. 2).
  • Transformation-competent E. coli cells were transformed with 0.1 to 1 ⁇ g of the hybrid plasmids according to Examples 1 to 4 and plated out on LB agar plates containing ampicillin. Clones containing correctly integrated partial TNF sequences could then be identified by plasmid rapid analyzes [Maniatis et al, Cold Spring Harbor
  • Competent E. coli cells were transformed with the hybrid plasmids obtained (Maniakis et al., Cold Spring Harbor Laboratory, 1982, pages 249ff.). The transformed host organism was fermented overnight at 37 ° C in LB culture medium.
  • the protein precipitate was suspended in 0.2 M arginine hydrochloride pH 7.5 and dialyzed against 0.4 M arginine hydrochloride pH 7.5. After 16 h, the pH was adjusted to 8.5 with dilute NH 3 solution and diluted to 5 times the volume with water. This solution was chromatographed on a ®R-Sepharose column (Pharmacia) equilibrated with 0.01 M arginine buffer pH 8.5. Elution was carried out with 0.02 M Na phosphate, 0.06 M NaCl. After dilution to 2.5 times, the eluate was chromatographed on a ®S-Sepharose column (Pharmacia) equilibrated with 0.02 M Na phosphate pH 8.0.
  • the surviving cells were stained with a crystal violet solution (15 g crystal violet, 7 g NaCl 646 ml ethanol, 172.8 ml 37% formaldehyde made up to 2 liters with H 2 O).
  • a crystal violet solution 15 g crystal violet, 7 g NaCl 646 ml ethanol, 172.8 ml 37% formaldehyde made up to 2 liters with H 2 O.
  • the cells were mixed with 50 ⁇ l of the staining solution at room temperature for 20 min. The culture plates were then washed with water until all unbound dye was removed.
  • the stained cells were lysed by adding 100 ⁇ l of staining solution (50% ethanol, 0.1% acetic acid) and evaluated photometrically at 540 nm.
  • the following activities were expressed in the cell lines tested, expressed in units per mg protein. One unit is the amount of substance that induces 50% .ge lysis of the treated cells. Substance Biological activity in relative units
  • MCF-7 a human breast cancer cell line
  • PMN Polymorphonuclear neutrophil granulocytes
  • Chemiluminescence (CL) was measured in a luminometer at 37 ° C. with luc igenin (100 ⁇ M), UBSS with ImM Ca 2+ and Mg 2+ and 0.1% HSA in a total volume of 0.5 ml and 2.5- 104 PMN cells per sample with and without TNF or TNF derivative.
  • the stimulation of the oxygen radical release of PMN in the presence of TNF or TNF derivatives was calculated as a percentage of the basic activity (without cytokine) for each measurement.
  • TNF and TNF derivatives were compared at a concentration of 1 ng cytokine / ml. Substance PMN stimulation in relative units

Abstract

The invention relates to derivatives of the tumour necrosis factor (TNF) produced by joining partial sequences of the heavy leukokinine chain to the terminal amino of the mature human TNF. These proteins are suitable for use in drugs. A process for obtaining them is also described.

Description

Proteine mit TNF-Wirkung  Proteins with TNF effect
Beschreibung Die Erfindung betrifft neue Proteine mit TNF-Wirkung, deren Herstellung und deren Verwendung in der Therapie. Description The invention relates to new proteins with TNF activity, their production and their use in therapy.
Von Carswell et al. [Proc. Natl . Acad. Sei. USA 72,3666-3670, 1975] wurde berichtet, daß das Serum von Endotoxin-behandelten Tieren, die zuvor mit Mycobacterien-Starmn Calmette-Guerin (BCG) infiziert worden waren, eine hämorrhagische Nekrose bei verschiedenen Tumoren in der Maus bewirkte. Diese Aktivität wurde einem Tumor-Nekrose-Faktor (TNF) zugeschrieben. TNF zeigt auch eine cytostatische oder cytotoxische Wirkung gegenüber einer Vielzahl von transformierten Zellinien in vitro, während normale By Carswell et al. [Proc. Natl. Acad. Be. USA 72,3666-3670, 1975], it was reported that the serum from endotoxin-treated animals previously infected with Mycobacteria strains Calmette-Guerin (BCG) caused hemorrhagic necrosis in various mouse tumors. This activity was attributed to a tumor necrosis factor (TNF). TNF also shows a cytostatic or cytotoxic effect against a variety of transformed cell lines in vitro, while normal
menschliche und tierische Zellinien davon nicht betroffen werden [Ruff und Gifford, Lymphokine Reports Vol. 2, pp 235-275, Academic Press, New York, 1981]. Kürzlich wurde die biochemische Charakterisierung und das Gen für den menschlichen TNF beschrieben [Aggarwal et al., J. Biol. Chem. 260, 245-2354, 1985; Nedwin et al., Nucl. Acids Res. 13, 6361-673, 1985]. Aus diesen Daten läßt sich folgende Proteinstruktur für das reife humane TNF ableiten: human and animal cell lines are not affected [Ruff and Gifford, Lymphokine Reports Vol. 2, pp 235-275, Academic Press, New York, 1981]. Biochemical characterization and the gene for human TNF have recently been described [Aggarwal et al., J. Biol. Chem. 260, 245-2354, 1985; Nedwin et al., Nucl. Acids Res. 13, 6361-673, 1985]. The following protein structure for mature human TNF can be derived from these data:
ValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnPro ValArgSerSerSerArgThrProSerAspLysProValAlaHisValValAlaAsnPro
GlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGly GlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGly
ValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer ValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer
GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle
SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro
CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu
GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp
TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu
1970 wurde beschrieben, daß eine bestimmte Fraktion von Immunglobulin G die Fähigkeit besitzt, an polymorphonukleäre πeutrophile Granulozyten zu binden und sie zur Phagozytose zu stimulieren (Najjar und Nishioka, Nature 228, 672-673, 1970). Diese Phagozytose-stimulierende Aktivität konnte auf ein Peptidfrεgment der schweren Kette des Leukokinins zurückgeführt werden. Die Primärstruktur dieses Tuftsin genannten Peptids ist H2N-THR-LYS-PRO-ARG-COOH. Dieses Tetrapeptid wird mittels zweier In 1970 it was described that a certain fraction of immunoglobulin G has the ability to bind to polymorphonuclear πeutrophile granulocytes and to stimulate them to phagocytosis (Najjar and Nishioka, Nature 228, 672-673, 1970). This phagocytosis-stimulating activity could be attributed to a peptide fragment of the leukokinin heavy chain. The primary structure of this peptide called tuftsin is H 2 N-THR-LYS-PRO-ARG-COOH. This tetrapeptide is made by two
proteolytischer Enzyme - Tuftsin-Endocarboxidase und Leukokininase - aus dem leukophilen IgG freigesetzt und bindet an spezifische Tuftsin-Rezeptoren auf neutrophilen Granulozyten, Monozyten und Makrophagen (Nishioka et al., Cancer Investigation 2, 39-49, 1984). Ahnliche Eigenschaften wie Tuftsin besitzt das ebenfalls aus der schweren Kette von Leukokinin stammende Tetrapeptid Rigin mit der Primärstruktur H2N-GLY-GLU-PRO-ARG-COOH (Veretennikova et al., Int. J.Peptide Prot. proteolytic enzymes - tuftsin endocarboxidase and leukokininase - released from the leukophilic IgG and binds to specific tuftsin receptors on neutrophilic granulocytes, monocytes and macrophages (Nishioka et al., Cancer Investigation 2, 39-49, 1984). The tetrapeptide rigin, which also originates from the heavy chain of leukokinin and has the primary structure H2N-GLY-GLU-PRO-ARG-COOH (Veretennikova et al., Int. J. Peptide Prot.
Res. 17, 430-435 (1981)).  Res. 17, 430-435 (1981)).
Es wurde nun gefunden, daß man durch Anfügen von Partialsequenzen aus der schweren Kette von Leukokinin an den Aminoterminus des reifen humanen TNF Hybridproteine erhält, die vorteilhaftere Eigenschaften besitzen als das humane TNF selbst. Insbesondere die Fähigkeit des TNF, neutrophile It has now been found that by adding partial sequences from the heavy chain of leukokinin to the amino terminus of the mature human TNF, hybrid proteins are obtained which have more advantageous properties than the human TNF itself. In particular, the ability of the TNF to be neutrophilic
Granulozyten zur Degranulation und Superoxid-Bildung zu stimulieren (Tsujimoto et al., Biochem. Biophys. Res. Comm. 137, 1094-1100, 1986; Klebanoff et al., J.Immunol. 136, 4220-4225, 1986), wird durch die beschriebenen neuen TNF-Hybridmoleküle selektiv verstärkt. Andere Eigenschaften des TNF wie z.B. die direkte Cytotoxizität gegenüber Tumorzellen werden von dieser Wirkungsverstärkung nicht im gleichen Maß betroffen, so daß sich die neuen TNF-Hybridmoleküle besonders zur Beeinflußung von neutrophilen Granulozyten eignen.  To stimulate granulocytes for degranulation and superoxide formation (Tsujimoto et al., Biochem. Biophys. Res. Comm. 137, 1094-1100, 1986; Klebanoff et al., J.Immunol. 136, 4220-4225, 1986) selectively amplified by the new TNF hybrid molecules described. Other features of the TNF such as the direct cytotoxicity to tumor cells is not affected to the same extent by this enhancement of activity, so that the new TNF hybrid molecules are particularly suitable for influencing neutrophil granulocytes.
Die Erfindung betrifft Proteine mit folgender Aminosäuresequenz: The invention relates to proteins with the following amino acid sequence:
MetavalbArgcSerd-Xe-ValfArggSerhArg.j ThrProSerAspLysProValAlaHisValVal AlaAsnProGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGly ValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer Met a val b Arg c Ser d -X e -ValfArggSerhArg.j ThrProSerAspLysProValAlaHisValVal AlaAsnProGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAlaAsnGalSalGLSlGlSlGGlSlGlSlGlSlGlSlGlSlGlSlGlSlGlSlGlSlGlGlSlGlSlGlSlGlSlGlSlGlSlGlSlGlSlGlSlG
GlnValLeuPheLysGlyG^nGlyCysProSerThrHisValLeuLeuThrHisThrlle GlnValLeuPheLysGlyG ^ nGlyCysProSerThrHisValLeuLeuThrHisThrlle
SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro
CysGlnArgGluThrProöluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu CysGlnArgGluThrProöluGlyAlaGluAlaLysProTrpTyrGluProIleTyrLeu
GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGluIleAsnArgProAsp
TyrLeuAspPheAlaGluSferGlyGlnValTyrPheGlyllelleAlaLeu, worin a,b,c, f, g, i 0 oder 1 TyrLeuAspPheAlaGluSferGlyGlnValTyrPheGlyllelleAlaLeu, where a, b, c, f, g, i 0 or 1
d, h 0, 1, 2, 3 oder 4 und d, h 0, 1, 2, 3 or 4 and
e 1, 2, 3 oder 4 e 1, 2, 3 or 4
X ein Peptidfragment aus der schweren Kette des Leukokinins mit der Aminosäuresequenz Y-Pro-Arg-Z, worin Y eine direkte Bindung oder eine Sequenz von 1-6 Aminosäuren ist, die dem Pro-Arg in der Sequenz der schweren Kette des Leukokinins vorangehen, und Z eine direkte Bindung oder eine Sequenz von 1-6 Aminosäuren ist, die dem Pro-Arg in der Sequenz der schweren Kette des Leukokinins nachfolgen, sind. In der schweren Kette des Leukokinins tritt ProArg an zwei Stellen auf. An diesen Stellen gehen dem ProArg folgende Aminosäuresequenzen voran: X is a peptide fragment from the leukokinin heavy chain with the amino acid sequence Y-Pro-Arg-Z, wherein Y is a direct bond or a sequence of 1-6 amino acids preceding the Pro-Arg in the leukokinin heavy chain sequence, and Z is a direct bond or a sequence of 1-6 amino acids that follow the Pro-Arg in the leukokinin heavy chain sequence. ProArg occurs in two places in the heavy chain of leukokinin. The following amino acid sequences precede the ProArg at these points:
HisAsnAlaLysThrLys und SerLysAlaLysGlyGln. Folgende Sequenzen folgen auf ProArg: GluGluGlnPheAsnSer und GluProGlnValTyrThr. Unter diesen Proteinen sind diejenigen bevorzugt, in denen a, b, c, d, f, g, h, i = 0, e = 1 oder 2 und X = eine Teilsequenz aus 4 Aminosäuren (ThrLysProArg oder GlyGlnProArg) ist. Die neuen Proteine lassen sich herstellen, indem man a. einen Vektor herstellt, der die genetische Information für die  HisAsnAlaLysThrLys and SerLysAlaLysGlyGln. The following sequences follow ProArg: GluGluGlnPheAsnSer and GluProGlnValTyrThr. Preferred among these proteins are those in which a, b, c, d, f, g, h, i = 0, e = 1 or 2 and X = is a partial sequence of 4 amino acids (ThrLysProArg or GlyGlnProArg). The new proteins can be produced by a. creates a vector that contains the genetic information for the
Proteine gemäß Anspruch 1 enthält,  Contains proteins according to claim 1,
b. den Vektor vermehrt b. increased the vector
c. die für Expression nötigen Signale in den Vektor einbaut, c. incorporates the signals necessary for expression into the vector,
d. den Vektor in einen Wirtsorganismus einbringt und d. introduces the vector into a host organism and
e. den Wirtsorganismus vermehrt und das Protein isoliert. e. increases the host organism and isolates the protein.
Zur Herstellung eines geeigneten Vektors geht man von der entsprechenden cDNA aus. The appropriate cDNA is used to prepare a suitable vector.
Für die Isolierung der entsprechenden cDNA wurde die Monocyten-Zellinie HL 60 (ATCC Nr. CCL 240) wie beschrieben kultiviert (Pennica et al., Nature 312, 724-729, 1984), die mRNA nach Stimulierung isoliert und nach bekannten Verfahren in cDNA übersetzt. For the isolation of the corresponding cDNA, the monocyte cell line HL 60 (ATCC No. CCL 240) was cultivated as described (Pennica et al., Nature 312, 724-729, 1984), the mRNA was isolated after stimulation and according to known methods in cDNA translated.
Durch Einsetzen dieser cDNA in den kommerziell erhältlichen Klonierungsvektor Lambda gt 10 wurde eine cDNA-Bibliothek angelegt. Mit Hilfe von radioaktiv markierten 01 igonukleotidsonden wurde ein cDNA-Klon identifiziert, der den kodierenden Teil des TNF-Gens enthält (Fig.1). A cDNA library was created by inserting this cDNA into the commercially available cloning vector Lambda gt 10. A cDNA clone containing the coding part of the TNF gene was identified using radioactive labeled 01 igonucleotide probes (FIG. 1).
Teile dieser Sequenz, die durch Restriktionserkennungsstellen leicht zugänglich sind, werden benutzt, um die in den Beispielen näher beschriebenen neuen TNF-Hybridgene zu klonieren (Fig. 1). Der Einbau der Genfragmente in Klonierungsvektoren, beispielsweise in die handelsüblichen Parts of this sequence, which are easily accessible through restriction recognition sites, are used to clone the new TNF hybrid genes described in more detail in the examples (FIG. 1). The incorporation of the gene fragments in cloning vectors, for example in the commercial ones
Plasmide pBR 322 und pBR 327 erfolgte in an sich bekannter Weise. Auch können die Gene oder Genfragmente mit geeigneten chemisch synthetisierten Kontrollregionen versehen werden, die eine Expression der Proteine ermöglichen. Die Transformation der so erhaltenen Hybridplasmide in geeignete Wirtsorganismen, vorteilhaft E. coli, ist ebenfalls bekannt und e ingehend beschrieben. Auch können die Hybridplasmide mit entsprechenden Signalsequenzen versehen werden, die die Sektretion der Polypeptide in das Periplasma von E. coli erlauben. Aufgrund der Degeneration des genetischen Codes ist es aber auch möglich, andere DNA-Sequenzen, z.B. chemisch synthetisierte TNF-Gene mit unterschiedlicher DNA-Sequenz, für die Expression von TNF-Hybridgenen zu benutzen. Plasmids pBR 322 and pBR 327 were carried out in a manner known per se. The genes or gene fragments can also be provided with suitable chemically synthesized control regions which enable expression of the proteins. The transformation of the hybrid plasmids obtained in this way into suitable host organisms, advantageously E. coli, is also known and is described in detail. The hybrid plasmids can also be provided with corresponding signal sequences which allow the polypeptides to be secreted into the periplasm of E. coli. Due to the degeneration of the genetic code, it is also possible to use other DNA sequences, for example chemically synthesized TNF genes with different DNA sequences, for the expression of TNF hybrid genes.
Die neuen Hybridproteine mit TNF-Wirkung können als neue Wirkstoffe in der Therapie von malignen Erkrankungen des Menschen eingesetzt werden. The new hybrid proteins with TNF activity can be used as new active ingredients in the therapy of malignant diseases in humans.
Beispiele Examples
Herstellung von Plasmiden Production of plasmids
1. Herstellung eines Hybridplasmids, das das Genfragment für ein 1. Production of a hybrid plasmid which is the gene fragment for a
TNF-Derϊvat mit verändertem Amino-Terminus trägt.  TNF-Derϊvat with changed amino terminus.
Ausgangsmaterial ist ein rekombinanter Phage mit der cDNA von TNF der nach dem von Pennica et al. (Nature 312,724-729, 1984) beschriebenen Verfahren erhalten wurde. Dazu wurde die menschliche Monocyten-Zellinie HL 60 The starting material is a recombinant phage with the TNF cDNA, which was prepared according to the method described by Pennica et al. (Nature 312, 724-729, 1984). For this purpose, the human monocyte cell line HL 60
(ATCC CCL240) mit Phorbolester (PMA) behandelt, um sie zur TNF-Produktion anzuregen. 4 h nach der Phorbolesterbehandlung wurde die RNA aus dieser Zellinie isoliert und daraus nach Maniatis: Molecular Cloning, Cold Spring Harbor Laboratory, 1982, Seiten 224ff die cDNA hergestellt. Mit dieser cDNA wurde eine Genbalck angelegt, wobei als Vektor der Lambda-Phage gtlO benutzt wurde. Mit Hilfe einer TNF-spezi fischen, chemisch synthetisierten Oligonukleotidprobe, die radioaktiv markiert war, wurde die Genbank durchgemustert. Von einem dabei als positiv identifizierten Klon wurde durch Spaltung mit den Restriktionsenzymen Aval und Hind3 ein 578bp langes DNAFragment erhalten, das für die Aminosäuren 8 bis 157 des humanen TNF-Moleküls codiert. Dieses Fragment wurde durch Elektrophorese in einem 1 % Agarosegel von den anderen entstandenen Fragmenten abgetrennt und aus dem Gel nach bekannten Verfahren eluiert [Maniatis et al., Cold Spring Harbor Laboratory, Seite 164, 1982]. Das erhaltene Bruchstück wurde anschließend in eirten Vektor eingebaut, der durch Spaltung des Plasmids pBR322 mit den Restriktionsendonukleasen Clal und Hind3 erhalten worden war. Das bei der Spaltung entstandene große Fragment wurde durch eine zweimalige Ethanolfällung rein erhalten.  (ATCC CCL240) treated with phorbol ester (PMA) to stimulate TNF production. 4 h after the phorbol ester treatment, the RNA was isolated from this cell line and the cDNA was produced from it according to Maniatis: Molecular Cloning, Cold Spring Harbor Laboratory, 1982, pages 224ff. A gene balance was created with this cDNA, the lambda phage gtlO being used as the vector. The library was screened with the help of a TNF-specific, chemically synthesized oligonucleotide sample that was radioactively labeled. From a clone identified as positive by cleavage with the restriction enzymes Aval and Hind3, a 578 bp long DNA fragment was obtained which codes for amino acids 8 to 157 of the human TNF molecule. This fragment was separated from the other fragments formed by electrophoresis in a 1% agarose gel and eluted from the gel by known methods [Maniatis et al., Cold Spring Harbor Laboratory, page 164, 1982]. The fragment obtained was then inserted into a first vector which had been obtained by cleaving the plasmid pBR322 with the restriction endonucleases Clal and Hind3. The large fragment resulting from the cleavage was obtained in pure form by double ethanol precipitation.
Als Cla-Ava-Adaptor diente ein äquimolares Gemisch synthetisch hergestellter Oligonukleotide Al und Bl, die folgende Primärstruktur besitzen: An equimolar mixture of synthetically produced oligonucleotides Al and B1, which have the following primary structure, served as the Cla-Ava adapter:
A1: 5'-CGATACTACTATGGTCAGATCTTCATCTTCTCGAACC -3' A1: 5'-CGATACTACTATGGTCAGATCTTCATCTTCTCGAACC -3 '
B1: 3'- TATGATGATACCAGTCTAGAAGTAGAAGAGCTTGGGGCT -5' Man erhielt das neue Hybridplasmid pTNF-1, indem man 0,1 pMol des Vektorfragments, 0,2 pMol des 578 bp langen TNF-Fragments und jeweils 0,5 pMol A1 und B1 mit dem Enzym T4-DNA-Ligase verknüpfte (Fig. 1, An und Bn bedeuten darin die Oligonukleotide A1, A2 ... und B1, B2 ...) B1: 3'- TATGATGATACCAGTCTAGAAGTAGAAGAGCTTGGGGCT -5 ' The new hybrid plasmid pTNF-1 was obtained by linking 0.1 pmole of the vector fragment, 0.2 pmole of the 578 bp TNF fragment and 0.5 pmole A1 and B1 each with the enzyme T4-DNA ligase (FIG. 1, An and Bn mean the oligonucleotides A1, A2 ... and B1, B2 ...)
2. TNF-Hybridmoleküle mit Tuftsin und Rigin 2. TNF hybrid molecules with Tuftsin and Rigin
Die Konstruktion erfolgte analog Beispiel 1 mit den neuen Oligonukleotiden A2/B2, A3/B3, A4/B4 und A5/B5: The construction was carried out analogously to Example 1 with the new oligonucleotides A2 / B2, A3 / B3, A4 / B4 and A5 / B5:
A2: 5'-CGATACTACTATGACCAAGCCTCGTACC -3' A2: 5'-CGATACTACTATGACCAAGCCTCGTACC -3 '
B2: 3'- TATGATGATACTGGTTCGGAGCATGGGGCT -5'  B2: 3'- TATGATGATACTGGTTCGGAGCATGGGGCT -5 '
A3: 5'-CGATACTACTATGACCAAGCCTCGTACCAAGCCTCGTACC -3' A3: 5'-CGATACTACTATGACCAAGCCTCGTACCAAGCCTCGTACC -3 '
B3: 3'- TATGATGATACTGGTTCGGAGCATGGTTCGGAGCATGGGGCT -5' B3: 3'- TATGATGATACTGGTTCGGAGCATGGTTCGGAGCATGGGGCT -5 '
A4: 5'-CGATACTACTATGGGTCAGCCTCGTACC -3' A4: 5'-CGATACTACTATGGGTCAGCCTCGTACC -3 '
B4: 3'- TATGATGATACCCAGTCGGAGCATGGGGCT -5' A5: 5'-CGATACTACTATGTCTCACAACGCTAAGACC  B4: 3'- TATGATGATACCCAGTCGGAGCATGGGGCT -5 'A5: 5'-CGATACTACTATGTCTCACAACGCTAAGACC
B5: 3'- TATGATGATACAGAGTGTTGCGATTCTGG B5: 3'- TATGATGATACAGAGTGTTGCGATTCTGG
AAGCCTCGTGAAGAACAGTTCTTCTTCCAGACC -3' AAGCCTCGTGAAGAACAGTTCTTCTTCCAGACC -3 '
TTCGGAGCACTTCTTGTCAAGAAGAAGGTCTGGGGCT -5'  TTCGGAGCACTTCTTGTCAAGAAGAAGGTCTGGGGCT -5 '
Man erhielt jeweils die neuen Hybridplasmide pTNF-2, pTNF-3, pTNF-4 und pTNF-5. The new hybrid plasmids pTNF-2, pTNF-3, pTNF-4 and pTNF-5 were obtained in each case.
3. Herstellung von Hybridplasmiden, die die Gene für Leukokinin-TNF- Hybridproteine tragen 3. Production of hybrid plasmids which carry the genes for leukokinin-TNF hybrid proteins
Ausgangspunkt ist das in Beispiel 1 konstruierte Plasmid pTNF-1. Dieses trägt eine singuläre Bgl2-Erkennungsstelle (AGATCT) . Das Plasmid pTNF-1 wurde mit dem Restriktionsenzym Bgl2 geöffnet. Zu 0,1 pMol dieses The starting point is the plasmid pTNF-1 constructed in Example 1. This carries a unique Bgl2 recognition site (AGATCT). The plasmid pTNF-1 was opened with the restriction enzyme Bgl2. To 0.1 pmol of this
DNA-Fragments wurden 0,3 pMol eines äquimolaren Gemisches von synthetisch hergestellten A6 und B6 hinzugefügt und durch eine durch T4-DNA-Ligase katalysierte Reaktion verknüpft (Fig. 2). DNA fragments were added to 0.3 pmol of an equimolar mixture of synthetically produced A6 and B6 and linked by a reaction catalyzed by T4 DNA ligase (FIG. 2).
A6: 5'-GATCACACAACGCTAAGACCAAGCCTCGTGAAGAACAGTTCA -3' A6: 5'-GATCACACAACGCTAAGACCAAGCCTCGTGAAGAACAGTTCA -3 '
B6: 3'- TGTGTTGCGATTCTGGTTCGGAGCACTTCTTGTCAAGTCTAG -5' Man erhielt das neue Hybridplasmid pTNF-1/6. Bei dieser Konstruktion erhielt man auch Hybridplasmide, bei denen das Oligonukleotidfragment A6/B6 nicht nur einmal sondern mehrfach hintereinander in das TNF-Gen integriert war. Die Anzahl der integrierten Kopien ließ sich mit bekannten DNA-Sequenzierungsverfahren bestimmen. Eine zweifache Integration des A6/B6-Fragments ergab das TNF-Hybridplasmid pTNF-1/7; eine dreifache Integration das Plasmid pTNF-1/8. B6: 3'- TGTGTTGCGATTCTGGTTCGGAGCACTTCTTGTCAAGTCTAG -5 ' The new hybrid plasmid pTNF-1/6 was obtained. This construction also gave hybrid plasmids in which the oligonucleotide fragment A6 / B6 was integrated into the TNF gene not only once but several times in succession. The number of integrated copies could be determined using known DNA sequencing methods. Double integration of the A6 / B6 fragment resulted in the TNF hybrid plasmid pTNF-1/7; a triple integration of the plasmid pTNF-1/8.
4. Transformation der Hybridplasmide 4. Transformation of the hybrid plasmids
Transformations-kompetente E.col i-Zellen wurden mit 0,1 bis 1 μg der Hybridplasmide gemäß Beispiel 1 bis 4 transformiert und auf Ampicillin enthaltenden LB-Agarplatten ausplattiert. Anschließend ließen sich Klone, die korrekt integrierte TNF-Teilsequenzen enthielten, durch Plasmid- Schnellanalysen identifizieren [Maniatis et al, Cold Spring Harbor Transformation-competent E. coli cells were transformed with 0.1 to 1 μg of the hybrid plasmids according to Examples 1 to 4 and plated out on LB agar plates containing ampicillin. Clones containing correctly integrated partial TNF sequences could then be identified by plasmid rapid analyzes [Maniatis et al, Cold Spring Harbor
Laboratory, 1982, Seite 366].  Laboratory, 1982, page 366].
5. Produktion der Proteine Die in den obigen Beispielen hergestellten Hybridplasmide werden an der Clal-Stelle geöffnet und mit synthetisch hergestellten Signalsequenzen für die Genexpression versehen. 5. Production of the proteins The hybrid plasmids produced in the above examples are opened at the Clal site and provided with synthetically produced signal sequences for gene expression.
Mit den erhaltenen Hybridplasmiden wurden kompetente E.coli Zellen transformiert (Maniakis et al., Cold Spring Harbor Laboratory, 1982, Seite 249ff.). Der transformierte Wirtsorganismus wurde über Nacht bei 37°C in LB-Nährmedium fermentiert. Competent E. coli cells were transformed with the hybrid plasmids obtained (Maniakis et al., Cold Spring Harbor Laboratory, 1982, pages 249ff.). The transformed host organism was fermented overnight at 37 ° C in LB culture medium.
6. Reinigung der Proteine 6. Purification of the proteins
1 l Fermentationsbrühe eines eine neue Substanz produzierenden E.coli-Stamms wurden 30 min bei 3000 g zentrifugiert. Der Rückstand wurde in 200 ml 0,4 M Argininhydrochlorid, 20 mM Natriumphosphat pH 8,5 aufgenommen und 30 min mit Ultraschall behandelt. Die Suspension wurde mit 6 ml 2M MnCl2 versetzt und 45 min bei 3000 g zentrifugiert. Der überstand wurde mit verdünnter NH3-Lösung auf pH 8,9 gebracht und mit festem Ammoniumsulfat auf 60 % Sättigung eingestellt. 1 liter of fermentation broth of a new substance producing E. coli strain was centrifuged at 3000 g for 30 min. The residue was taken up in 200 ml of 0.4 M arginine hydrochloride, 20 mM sodium phosphate pH 8.5 and treated with ultrasound for 30 min. 6 ml of 2M MnCl 2 were added to the suspension and centrifuged at 3000 g for 45 min. The supernatant was brought to pH 8.9 with dilute NH 3 solution and adjusted to 60% saturation with solid ammonium sulfate.
Das Proteinpräzipitat wurde in 0,2 M Argininhydrochlorid pH 7,5 suspendiert und gegen 0,4M Argininhydrochlorid pH 7,5 dialysiert. Nach 16 h wurde mit verdünnter NH3-Lösung auf pH 8,5 eingestellt und auf das 5fache Volumen mit Wasser verdünnt. Diese Lösung wurde über eine mit 0,01 M Argininpuffer pH 8,5 äquilibrierte ®R-Sepharose-Säule (Pharmacia) chromatographiert. Die Elution erfolgte mit 0,02 M Na-Phosphat, 0,06 M NaCl. Das Eluat wurde nach dem Verdünnen auf das 2, 5fache über eine mit 0,02 M Na-Phosphat pH 8,0 äquilibrierte ®S- Sepharose-Säule (Pharmacia) chromatographiert. Nach Waschen der Säule mit Aquilibrierungspuffer erhielt man durch Elution mit 0,05 M Na-Phosphat, 0, 1 M NaCl, 0,1 M Arginin pH 8,6 SDS-Polyacrylamidgel-elektrophoretisch reines Protein. So wurden folgende Verbindungen der Formel gemäß Anspruch 1 erhalten: The protein precipitate was suspended in 0.2 M arginine hydrochloride pH 7.5 and dialyzed against 0.4 M arginine hydrochloride pH 7.5. After 16 h, the pH was adjusted to 8.5 with dilute NH 3 solution and diluted to 5 times the volume with water. This solution was chromatographed on a ®R-Sepharose column (Pharmacia) equilibrated with 0.01 M arginine buffer pH 8.5. Elution was carried out with 0.02 M Na phosphate, 0.06 M NaCl. After dilution to 2.5 times, the eluate was chromatographed on a ®S-Sepharose column (Pharmacia) equilibrated with 0.02 M Na phosphate pH 8.0. After washing the column with equilibration buffer, elution with 0.05 M Na phosphate, 0.1 M NaCl, 0.1 M arginine pH 8.6 SDS polyacrylamide gel electrophoretically pure protein was obtained. The following compounds of the formula according to Claim 1 were thus obtained:
A . X = ThrLysProArg A. X = ThrLysProArg
B . X = ThrLysProArgThrLysProArg  B. X = ThrLysProArgThrLysProArg
C . X = GlyGlnProArg  C. X = GlyGlnProArg
D . X = HisAsnAlaLysThrLysProArgGluGluGlnPhe D. X = HisAsnAlaLysThrLysProArgGluGluGlnPhe
E . X = HisAsnAlaLysThrLysProArgGluGluGlnPhe  E. X = HisAsnAlaLysThrLysProArgGluGluGlnPhe
ArgSerHisAsnAlaLysThrLysProArgGluGluGlnPhe  ArgSerHisAsnAlaLysThrLysProArgGluGluGlnPhe
F. X = HisAsnAlaLysThrLysProArgGluGluGlnPhe  F. X = HisAsnAlaLysThrLysProArgGluGluGlnPhe
ArgSerHisAsnAlaLysThrLysProArgGluGluGlnPhe  ArgSerHisAsnAlaLysThrLysProArgGluGluGlnPhe
ArgSerHisAsnAlaLysThrLysProArgGluGluGlnPhe  ArgSerHisAsnAlaLysThrLysProArgGluGluGlnPhe
7. Cytotoxische Aktivität der neuen Polypeptide 7. Cytotoxic activity of the new polypeptides
5.103 frisch trypsinisierte, im exponentiellen Wachstum sich befindliche Zellen wurden in 96-Loch-Platten in 150 μl komplettem Wachstumsmedium (MEM mit Earle's Salzen + 10 % FCS, Flow Laboratories, Meckenheim), ausplattiert und über Nacht bei 37°C, 5 % CO2 in einer Wasserdampf-gesättigten Atmosphäre inkubiert. Die Substanzzugabe erfolgte am nächsten Tag in 25 μl komplettem Kulturmedium pro Kulturloch. Die Startkonzentration betrug 10 ng/ml; titriert wurde seriell 2fach mit Doppelbestimmungen. Folgende Kontrollen wurden auf jeder Kulturplatte mitangelegt: a) nur Kulturmedium; b) Zellen mit Kulturmedium, aber ohne Substanz; c) ein titrierter TNF-Standard bekannter biologischer Aktivität. Nach einer weiteren Inkubation von 48 h bei den oben angegebenen Bedingungen wurden die überlebenden Zellen mit einer Kristallviolettlösung (15 g Kristallviolett, 7 g NaCl 646 ml Ethanol, 172,8 ml 37 %iges Formaldehyd auf 2 1 mit H2O aufgefüllt) angefärbt. Dazu wurden nach dem Ausschlagen des Kulturmediums die Zellen für 20 min mit 50 μl der Färbelösung bei Raumtemperatur versetzt. Die Kulturplatten wurden danach so lange mit Wasser gewaschen, bis alle ungebundenen Farbstoffanteile entfernt waren. Die gefärbten Zellen wurden durch Zugabe von 100 μl Färbelösung (50 % Ethanol, 0,1 % Essigsäure) lysiert und bei 540 nm photometrisch ausgewertet. Für die Substanzen ergaben sich dajsei in den getesteten Zellinien folgende Aktivitäten, ausgedrückt in Einheiten pro mg Protein. Eine Einheit ist diejenige Menge an Substanz, die eilte 50 %.ge Lyse der behandelten Zellen induziert. Substanz Biologische Aktivität in relativen Einheiten 5,103 freshly trypsinized cells in exponential growth were plated in 96-well plates in 150 μl of complete growth medium (MEM with Earle's salts + 10% FCS, Flow Laboratories, Meckenheim) and overnight at 37 ° C., 5% CO 2 incubated in a water vapor saturated atmosphere. The substance was added the next day in 25 μl of complete culture medium per culture well. The starting concentration was 10 ng / ml; Serial titration was carried out twice with double determinations. The following controls were also created on each culture plate: a) culture medium only; b) cells with culture medium but without substance; c) a titrated TNF standard of known biological activity. After a further incubation of 48 h under the conditions specified above, the surviving cells were stained with a crystal violet solution (15 g crystal violet, 7 g NaCl 646 ml ethanol, 172.8 ml 37% formaldehyde made up to 2 liters with H 2 O). For this purpose, after knocking out the culture medium, the cells were mixed with 50 μl of the staining solution at room temperature for 20 min. The culture plates were then washed with water until all unbound dye was removed. The stained cells were lysed by adding 100 μl of staining solution (50% ethanol, 0.1% acetic acid) and evaluated photometrically at 540 nm. For the substances The following activities were expressed in the cell lines tested, expressed in units per mg protein. One unit is the amount of substance that induces 50% .ge lysis of the treated cells. Substance Biological activity in relative units
(rhTNF≡ 1,0)  (rhTNF≡ 1.0)
L-929 MCF-7 L-929 MCF-7
rh-TNF 1, 0 1, 0 rh-TNF 1, 0 1, 0
A 1 , 8 1, 7 A 1, 8 1, 7
B 2, 2 1, 6 B 2, 2 1, 6
D 0, 7 0, 8 D 0, 7 0, 8
E 0, 9 0, 6  E 0, 9 0, 6
F 0, 1 0, 2  F 0, 1 0, 2
In der Tabelle bedeuten: In the table mean:
L-929 eine Maus-Fibrosarkom-Zellinie, L-929 a mouse fibrosarcoma cell line,
MCF-7 eine Humane Mamakarzinom-Zellinie, MCF-7 a human breast cancer cell line,
rh-TNF rekombinanter humaner TNF. rh-TNF recombinant human TNF.
8. Stimulation der Sauerstoffradikal-Freisetzung von polymorphonukleären neutrophilen Granulozyten (PMN) 8. Stimulation of Oxygen Radical Release from Polymorphonuclear Neutrophil Granulocytes (PMN)
Polymorphonukleäre neutrophile Granulozyten (PMN) wurden aus heparinisiertem Blut von gebunden Spendern durch ®Dextran-Sedimentation Polymorphonuclear neutrophil granulocytes (PMN) were bound from heparinized blood from donors by ®Dextran sedimentation
(®Dextran T250, 1 g, 60 min, Raumtemperatur) und anschließende Trennung über einen ®Percoll zwei-Stufen-Gradienten (60 %/68 % ®Percoll, 4°C, 600 g, 30 min) isoliert. Die Zellen aus der 60 %/68 % Interphase wurden zweimal in HBSS ohne Ca2+/Wg2+ mit 0,1 % HSA gewaschen und dann im selben Puffer in einer Konzentration von 5.106 zellen/ml aufbewahrt. Die (®Dextran T250, 1 g, 60 min, room temperature) and subsequent separation using a ®Percoll two-stage gradient (60% / 68% ®Percoll, 4 ° C, 600 g, 30 min). The cells from the 60% / 68% interphase were washed twice in HBSS without Ca2 + / Wg 2+ with 0.1% HSA and then kept in the same buffer in a concentration of 5.10 6 cells / ml. The
Chemolumineszenzπiessung (CL) wurde in einem Luminometer bei 37°C mit Luc igenin (100 μM), UBSS mit je ImM Ca2+ und Mg2+ und 0,1 % HSA in einem Gesamtvolumen von 0,5 ml und 2,5-104 PMN-Zellen pro Probe mit und ohne TNF bzw. TNF-Derivat vorgenommen. Chemiluminescence (CL) was measured in a luminometer at 37 ° C. with luc igenin (100 μM), UBSS with ImM Ca 2+ and Mg 2+ and 0.1% HSA in a total volume of 0.5 ml and 2.5- 104 PMN cells per sample with and without TNF or TNF derivative.
Die Ergebnisse basϊererr auf der Integration der Impulse über 30 min und die Aktivitäten der TNF-Derivate wurden relativ zu TNF (= 1,0) angegeben. Die Stimulation der Sauerstoffradikal-Freisetzung von PMN in Gegenwart von TNF oder TNF-Derivaten wurde in Prozent der Basisaktivität (ohne Cytokin) für jede Messung berechnet. TNF und TNF-Derivate wurden miteinander bei einer Konzentration von 1 ng Cytokin/ml verglichen. Substanz PMN-Stimulation in relativen Einheiten The results are based on the integration of the impulses over 30 min and the activities of the TNF derivatives were given relative to TNF (= 1.0). The stimulation of the oxygen radical release of PMN in the presence of TNF or TNF derivatives was calculated as a percentage of the basic activity (without cytokine) for each measurement. TNF and TNF derivatives were compared at a concentration of 1 ng cytokine / ml. Substance PMN stimulation in relative units
(rhTNF = 1)  (rhTNF = 1)
rhTNF 1,0 rhTNF 1.0
rhTNF + Tuftsin 1,0 rhTNF + Tuftsin 1.0
(molares Verhältnis 1:1) (molar ratio 1: 1)
A 2,5  A 2.5
B 3,4  B 3.4
D 3,3  D 3.3
E 4,6  E 4.6

Claims

Patentansprüche Claims
1. Proteine, gekennzeichnet durch folgende Aminosäuresequenz: MetaValbArgcSerd-Xe-ValfArggSerhArgjThrProSerAspLysProValAlaHisVal ValAlaAsnProGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAla AsnGlyValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle 1. Proteins, characterized by the following amino acid sequence: Met Val a b c Arg Ser -X d e f -Val Arg Ser g h j Arg ThrProSerAspLysProValAlaHisVal ValAlaAsnProGlnAlaGluGlyGlnLeuGlnTrpLeuAsnArgArgAlaAsnAlaLeuLeuAla AsnGlyValGluLeuArgAspAsnGlnLeuValValProSerGluGlyLeuTyrLeuIleTyrSer GlnValLeuPheLysGlyGlnGlyCysProSerThrHisValLeuLeuThrHisThrlle
SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro  SerArglleAlaValSerTyrGlnThrLysValAsnLeuLeuSerAlalleLysSerPro
CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProlleTyrLeu  CysGlnArgGluThrProGluGlyAlaGluAlaLysProTrpTyrGluProlleTyrLeu
GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGlulleAsnArgProAsp  GlyGlyValPheGlnLeuGluLysGlyAspArgLeuSerAlaGlulleAsnArgProAsp
TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu, worin a,b,c,f,g,i 0 oder 1  TyrLeuAspPheAlaGluSerGlyGlnValTyrPheGlyllelleAlaLeu, where a, b, c, f, g, i 0 or 1
d, h 0, 1, 2, 3 oder 4  d, h 0, 1, 2, 3 or 4
e 1, 2, 3 oder 4  e 1, 2, 3 or 4
X ein Peptidfragment aus der schweren Kette des  X is a peptide fragment from the heavy chain of the
Leukokinins mit der Aminosäuresequenz Y-Pro-Arg-Z, worin Y eine direkte Bindung oder eine Sequenz von 1-6 Aminosäuren ist, die dem Pro-Arg in der Sequenz der schweren Kette des Leukokinins vorangehen, und Z eine direkte Bindung oder eine Sequenz von 1-6 Aminosäuren ist, die dem Pro-Arg in der Sequenz der schweren Kette des Leukokinins nachfolgen,  Leukokinins having the amino acid sequence Y-Pro-Arg-Z, where Y is a direct bond or a sequence of 1-6 amino acids preceding the Pro-Arg in the leukokinin heavy chain sequence, and Z is a direct bond or sequence of 1-6 amino acids that follow the Pro-Arg in the leukokinin heavy chain sequence,
sind.  are.
2. Protein gemäß Anspruch 1, dadurch gekennzeichnet, daß 2. Protein according to claim 1, characterized in that
X ThrLysProArg, X ThrLysProArg,
AlaLysThrLysProArgGluGlu,  AlaLysThrLysProArgGluGlu,
HisAsnAlaLysThrLysProArgGluGluGlnPhe,  HisAsnAlaLysThrLysProArgGluGluGlnPhe,
GlyGlnProArg oder  GlyGlnProArg or
LysAlaLysGlyGlnProArgGluProGlnVal  LysAlaLysGlyGlnProArgGluProGlnVal
und  and
e 1, 2 oder 3 sind.  e are 1, 2 or 3.
3. DNA, codierend für ein Protein gemäß Anspruch 1. 3. DNA coding for a protein according to claim 1.
4. Vektor, enthaltend eine DNA gemäß Anspruch 3. 4. Vector containing a DNA according to claim 3.
5. Wirtsorganismus, enthaltend einen Vektor gemäß Anspruch 4. 5. Host organism containing a vector according to claim 4.
6. Verfahren zur Herstellung eines Proteins gemäß Anspruch 1, dadurch gekennzeichnet, daß man einen Wirtsorganismus nach Anspruch 5 züchtet und das Protein daraus isoliert. 6. A method for producing a protein according to claim 1, characterized in that one cultivates a host organism according to claim 5 and the protein is isolated therefrom.
7. Protein gemäß Anspruch 1 zur Verwendung bei der Bekämpfung von 7. Protein according to claim 1 for use in combating
Krankheiten.  Diseases.
8. Verwendung der Proteine gemäß Anspruch 1 zur Bekämpfung von 8. Use of the proteins according to claim 1 for combating
neoplastischen Erkrankungen und Autoimmunerkrankungen sowie zur Bekämpfung und Prophylaxe von Infektionen, Entzündungen und  neoplastic diseases and autoimmune diseases as well as for the control and prophylaxis of infections, inflammation and
Abstoßungsreaktionen bei Transplantationen.  Rejection reactions in transplants.
PCT/EP1990/001190 1989-07-29 1990-07-20 Proteins with tnf activity WO1991001998A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DEP3925183.7 1989-07-29
DE3925183A DE3925183A1 (en) 1989-07-29 1989-07-29 PROTEINS WITH TNF EFFECT

Publications (1)

Publication Number Publication Date
WO1991001998A1 true WO1991001998A1 (en) 1991-02-21

Family

ID=6386137

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1990/001190 WO1991001998A1 (en) 1989-07-29 1990-07-20 Proteins with tnf activity

Country Status (5)

Country Link
EP (1) EP0485407A1 (en)
JP (1) JPH04507241A (en)
CA (1) CA2051124A1 (en)
DE (1) DE3925183A1 (en)
WO (1) WO1991001998A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3716513A1 (en) * 1987-05-16 1988-11-24 Basf Ag PROTEINS WITH TNF EFFECT

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3716513A1 (en) * 1987-05-16 1988-11-24 Basf Ag PROTEINS WITH TNF EFFECT

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Chemical Abstracts, Band 107, no. 15, 12 Oktober 1987, (Columbus, Ohio, US), Wleklik, Marek S. et al. : "Tuftsin induced tumor necrosis activity ", siehe Seite 561, Zusammenfassung 132356h, & Mol. Cell. Biochem. 1987, 75( 2), 169- 17 *
Diolog Information Services, File 154: Medline 83-90, Diolog Accession No. 05968021, Tsujimoto M. et al: "Tumor necrosis factor provokes superxidie anion generation from neutrophils", & Biochem. Biophys. Res. Commun., 30 June 1986, 137 (3), Pages 1094-1100. *
Diolog Information Sevice, File 154, Medline 83-90, Dialog Accession No. 05896803, Klebanoff S.J. et al.: "Stimulation of neutrophils by tumor necrosis factor", & J. Immunol., 01 June 1986, 136 (11), Pages 4420-4425. *

Also Published As

Publication number Publication date
CA2051124A1 (en) 1991-01-30
DE3925183A1 (en) 1991-02-07
JPH04507241A (en) 1992-12-17
EP0485407A1 (en) 1992-05-20

Similar Documents

Publication Publication Date Title
CA1341590C (en) Human immune interferon
EP0099084B1 (en) Process for the preparation of interferon and expression vehicles therefor
EP0236920B1 (en) Hybrid interferons, their use as medicaments and as intermediates in the preparation of antibodies, their use and process for their preparation
JP2682858B2 (en) Leukemia inhibitory factor
EP0291804A2 (en) Proteins with a TNF effect
EP0288809B1 (en) Bifunctional proteins
EP0161504B1 (en) Production of polypeptides with a human gamma-interferon activity
JPS6128392A (en) Structural gene encoding mutein and its production
EP0271824B1 (en) Horse gamma interferon
DD297188A5 (en) GM-CSF AND IL-3 COMPREHENSIVE FUSION PROTEINS
EP0238993A2 (en) Aprotinin homologues produced by genetic engineering
DE69823218T2 (en) AMINOTERMINAL SHORTENED MCP-2 AS A CHEMOKIN ANTAGONIST
EP0170204B1 (en) Genetic sequences, type i interferon peptide coded by them, and these organisms producing the same
EP0544292A2 (en) Method of introduction of nucleic acids in cells
EP0163249B1 (en) Gene-technological process for the preparation of human interleukin-2, and device for carrying out this process
DE3843534A1 (en) NEW TNF POLYPEPTIDES
DE3536939A1 (en) BIOLOGICALLY ACTIVE DERIVATIVES OF HUMAN (GAMMA) INTERFERON, THEIR PRODUCTION AND MEDICINAL PRODUCTS CONTAINING SUCH DERIVATIVES
DE2712615A1 (en) PROCESS FOR MANUFACTURING FILAMENTOES PHAGEN AS A VECTOR FOR SYNTHETIC RECOMBINATES
EP0250000B1 (en) Polypeptides, their preparation and their use
EP0244627A2 (en) Expression vectors for the production of polypeptides
EP0306870A2 (en) Gamma-interferon derivatives, process for their manufacture, vectors and medicines obtained therefrom
WO1991001998A1 (en) Proteins with tnf activity
AT393690B (en) Homogeneous, recombinant immune interferon fragments
DE3421731A1 (en) Human tumour necrosis factor
DE3426049A1 (en) Human tumour necrosis factor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1990910668

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2051124

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: 1990910668

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990910668

Country of ref document: EP