WO1990008838A1 - Marquage d'acides nucleiques a l'aide de marqueurs fluorescents - Google Patents

Marquage d'acides nucleiques a l'aide de marqueurs fluorescents Download PDF

Info

Publication number
WO1990008838A1
WO1990008838A1 PCT/US1990/000182 US9000182W WO9008838A1 WO 1990008838 A1 WO1990008838 A1 WO 1990008838A1 US 9000182 W US9000182 W US 9000182W WO 9008838 A1 WO9008838 A1 WO 9008838A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
marker
probe
labeling
hybridization
Prior art date
Application number
PCT/US1990/000182
Other languages
English (en)
Inventor
Larry W. Mclaughlin
Original Assignee
Research Corporation Technologies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Research Corporation Technologies, Inc. filed Critical Research Corporation Technologies, Inc.
Publication of WO1990008838A1 publication Critical patent/WO1990008838A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

Definitions

  • the present invention relates to DNA markers and, particularly, nucleic acid labeling techniques. More 5 specifically, this invention contemplates a protocol which permits the covalent introduction of single or multiple fluorescent markers or other probes such as spin labels and drug analogues into DNA fragments and oligodeoxynucleotides.
  • the instant technique particularly employing multiple -*-0 fluorescent markers, allows high sensitivity detection of nucleic acids (without the use of sophisticated detection devices) in the low femtomolar (10 -15 moles) range and additionally permits the placement of markers and probes at specific locations within the macromolecule.
  • - ⁇ -> invention can be used with high detection sensitivity for DNA sequencing and hybridization procedures including a host of diagnostic and therapeutic procedures.
  • the present technique can also be employed as a tool for the study of nucleic acid dynamics through recognition and evaluation of fluorescence
  • radioisotopes in amounts in the low femtomolar range (10-15 moles) .
  • the use of radioisotopes is rendered less than ideal by the associated problems of safety and disposal.
  • Fluorescent dyes as well as spin labels are also useful in many aspects of biophysics since the -0 properties of a given marker can vary substantially with changes in the immediate microenvironment.
  • Such probes can be useful for the study of structure, conformation and dynamics in biopolymers providing that they can easily be placed at specific locations within the desired 5 macromolecule.
  • fluorescent labeling In order for fluorescent labeling procedures to compete effectively with and replace radioisotopic labeling techniques for the detection of macromolecules during various biochemical assays, the fluorescent labeling must result in 0 high detection sensitivity, rapid and simple procedures for the introduction of the fluorescent marker to the macromolecule of interest must be available, and the results must be reproducible. By meeting these criteria and with the additional advantage of reduced health hazards, fluorescent labeling techniques could then replace the use of radioisotopes in a number of biochemical assays.
  • Intercalative dyes such as ethidium bromide generally meet these criteria and in many cases have completely replaced radioisotopic labeling procedures for the 0 detection of double stranded DNA.
  • assays including DNA sequencing and hybridization
  • DNA sequencing has been attempted using such labeling techniques but requires sophisticated electronic detection, and then only has evidenced limited success.
  • Several methods have been reported for the incorporation of multiple labels into nucleic acids. Most of these rely on an enzymatic polymerization reaction in order to introduce a modified nucleoside carrying the desired label or one which can be easily modified with the fluorescent marker at numerous positions.
  • Base-specific reactions have also been employed, such as modification of guanine residues with N-acetoxy-2-acetylaminofluorene followed by detection with tetramethylrhodamine-labeled antibodies raised against the modifying reagent.
  • Multiple labeling techniques have commonly resulted in enhanced detection sensitivity with respect to single labels and have been reasonably reproducible. However, these techniques have previously not been simple or rapid to employ.
  • the modified nucleoside has previously only been obtained by time-consuming chemical syntheses.
  • biotin labeling is not a fluorescent chromophore
  • biotin labeling when combined with immunochemical, histochemical or affinity detection systems provides another alternative to radioisotopic labeling of nucleic acids.
  • Biotin-labeled nucleic acids have been used in hybridization studies, gene mapping studies employing electron microscopy and gene enrichment in cesium chloride gradients.
  • Biotin labeling has been typically approached in conceptually the same manner as fluorescent labeling techniques in which either a single label at the nucleic acid terminus or multiple labels requiring the synthesis of a biotin labeled dNTP derivative are employed.
  • each of the existing techniques suffers from the requirements of arduous chemical synthesis and/or limited detectability.
  • one object of the present invention is to provide an improved method for labeling nuclei acids.
  • Another object of this invention is to provide an improved method of fluores ⁇ ently labeling nucleic acids.
  • a further object of the present invention is to provide new probes for use in DNA labeling and related techniques.
  • a still further object of this invention is to provide a new detection product which constitutes a phosphorothiolate diester covalently complexed with a nucleotidic residue, and which is also complexed with a detectable marker.
  • Another object of this invention is to provide multiple sites, i.e., internally within the macromolecule, for the attachment of fluorophores and other markers and/or probes to the nucleic acid thereby enabling multiple labeling techniques.
  • a further object of the present invention is to selectively introduce fluorescent markers and other markers and probes at specifically desired sites of the macromolecule. These markers or reporter groups include fluorophores, biotin, spin labels, drugs or their analogues, hydrolytic reagents, chiral metal complexes and the like.
  • Another object of this invention is to selectively introduce fluorescent markers and other probes after the molecule of interest has been treated with any one of various desired biochemical assays, i.e., in a "post-assay" procedure.
  • Still another object of this invention is to selectively introduce fluorescent markers and other probes before the molecule of interest has been treated with any one of various desired biochemical assays, i.e., in a "pre-assay" procedure.
  • Yet another object of the present invention is to provide an improved process for DNA sequencing, t)NA hybridization techniques and DNA diagnostics and DNA therapeutics.
  • a still further other object of this invention is to provide a new detection procedure which eliminates the use of radioisotopes and the disadvantages associated with such conventional methods.
  • nucleic acids are labeled with markers such that, e.g., the fluorescent marker or any other type of probe can be placed into a specific location in the nucleic acid.
  • markers such that, e.g., the fluorescent marker or any other type of probe can be placed into a specific location in the nucleic acid.
  • various sites for the attachment of the desired probes or markers are generated by employing phosphorothioate diesters in place of native phosphodiesters which are chemically or enzymatically introduced at the desired site within a nucleic acid and subsequently marked with the desired reporter group.
  • the present methodology not only permits multiple labeling and high sensitivity in a simple technique in the absence of sophisticated detection devices, but also permits the introduction of a particular probe or marker after conventional biochemical assays, i.e., "post-assay.”
  • the advantages of the novel detection products of this invention also allow the labeling of DNA fragments in conventional DNA sequencing or hybridization assays. Such assays further permit a host of therapeutic procedures where a DNA hybridization probe with attached phosphorothioate dies er(s) i s employed dLn vivo or in vitro to locate a sequence within genomic DNA and which is subsequently reacted with, e.g., a label for detection or identification, a reactive molecule for degradation, or other toxic therapeutic agents.
  • the novel product also allows study of the structure and dynamics of nucleic acids as well as protein-nucleic acid complexes.
  • the novel product of the present invention includes a nucleotidic residue covalently complexed with a phosphorothioate diester and further complexed to a marker enabling detection of the product.
  • BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 sets forth the structure of the phosphorothioate triester composed of the nucleotidic residue and phosphorothioate diester complexed with the bimane label (bimane-Tp(S)T triester) .
  • Fig. 2 is a graphic illustration of the stability of the bimane-Tp(S)T triester at ambient temperature measured during a total time period of 20 hours at pH values between 3-11.
  • Fig. 3 is a graphic depiction of an HPLC analysis of the reaction mixture containing the octamer d[GC(s)CCGGGC] (0.3 mM) and monobromobimane (3.0 mM) after reaction for 5 hours at ambient temperature.
  • Fig. 4 is a photographic reproduction of a pol acrylamide gel (6%) illustrating "post-assay" labeling of DNA fragments with monobromobimane.
  • Fig. 4(A) represents an Hpall restriction endonuclease digest of an M13mpl8 DNA template, which has been elongated with DNA polymerase I (E ⁇ _ coli) using dNTPs and then treated with the endonuclease.
  • Fig. 4(B) represents an Aval restriction endonuclease digest of an Ml3mpl9 DNA template, which was elongated with DNA polymerase I (E___ coli) using dNTPs and then treated with endonuclease.
  • Fig. 5 represents phosphorothioate triester oligodeoxynucleotides carrying (a) a PROXYL spin label. (b) a derivative of the dihydropyrroloindole subunit of CC-1065, (c) a sulfonamide-linked dansyl fluorophore, and (d) an N-linked dansyl fluorophore.
  • the present invention contemplates the selective labeling of nucleic acids with fluorescent molecules and other probes such as, for example, biotin, which are useful in DNA sequencing and DNA hybridization assays.
  • the present invention also contemplates other probes such as, for example, spin labels which are useful in the analysis of nucleic acid structure and dynamics.
  • the convenient labeli methodology of this invention further permits a broad range of DNA therapeutic and diagnostic procedures and is particularly characterized by the selective covalent introduction of single or multiple markers and probes into DNA fragments and oligodeoxynucleotides.
  • the novel detecti product of this invention is characterized by a nucleotidic residue covalently complexed with a phosphorothioate dieste which is mutually covalently complexed with a selected marker.
  • the probe is selectively introduced into a single site of choice or into multiple sites as desired.
  • the present invention preferably employs a phosphorothioate diester [for example, Tp(s)T, phosphorothioate diester derivative of TpT (thymidyl(3'—5') thymidine) ] which is selectively incorporated into a DNA fragment or oligodeoxynucleotide at any and each nucleotide residue desired.
  • a phosphorothioate diester for example, Tp(s)T, phosphorothioate diester derivative of TpT (thymidyl(3'—5') thymidine)
  • the probe of the present invention phosphorothioate diester derivative
  • the probe of the present invention is prepared by introducing the phosphorothioate diester into the nucleic acid fragment either enzymatically, e.g., according to the method of Potter and Eckstein (Potter, B. and Eckstein, F. , J. Biol. Chem., 259; 14243-14248, 1984), or chemically, e.g., according to the method of Connolly, et al. (Connoll et al.. Biochemistry, 23; 3443-3453, 1982).
  • the enzymatic technique of Potter and Eckstein employs the desired dNTP -** S 2'-deoxynucleoside-5'-0- (1-thiotriphosphate) , a suitable enzyme with polymerizing characteristics such as DNA polymerase or reverse transcriptase, a DNA template and a primer.
  • the enzyme employed uses dNTP S as a substrate to synthesize nucleic acids of varying chain length, and upon enzymatic reaction, phosphorothioate diester is incorporated between two nucleoside residues, along with the concurrent liberation of pyrophosphate.
  • the phosphorothioate diester may be introduced chemically into the nucleic acid by the method of Connolly, - et al. (or Stec, et al., J. Am. Chem. Soc, 106; 6077-6079). This is generally a three step procedure. First, a phosphit triester (nucleoside phosphite triester) is formed by reacting a nucleoside phosphoramidite in the presence of a weak acid such as tetrazole. Second, the phosphite triester is oxidized in the presence of elemental sulfur (S R ) , CS_ an lutidine, to form a phosphorothioate triester complex.
  • S R elemental sulfur
  • CS_ an lutidine
  • the phosphorothioate triester is hydrolyzed to the desired phosphorothioate diester.
  • the selective introduction of the phosphorothioate diester derivative into the DNA fragment or oligodeoxynucleotide is determined by the choice of oxidation procedures at any given position. As explained above, the phosphorothioate diester is obtained by oxidation in the presence of S_, CS 2 and lutidine.
  • the native phosphate diester is obtained by oxidation of the phosphite triester with a mixture of I_, THF (tetrahydrofuran) , H Rail0 an lutidine followed by hydrolysis of the triester to yield a phosphate diester.
  • the appropriate choice of either set of conditions allows the placement of the phosphorothioate diester in the desired position with respect to the native phosphate diester. This technique allows for selective reactivity at a specific nucleotidyl site, and avoids nonspecific reaction with other functional groups available in the nucleic acid.
  • the complex formed is described below: 3 '-Nucleoside
  • the phosphorothioate diester can subsequently be alkylated with fluorescent molecules or other probes such as, for example, biotin.
  • the complex which results is referred to as a "phosphorothioate triester" (which comprises an internucleotidic residue, a phosphorothioate diester and a detectable marker) .
  • the means by which this procedure occurs, e.g., alkylation refers to the displacement of the functional group (such as the bromine in monobromobimane) and the formation of a sulfur-carbon bond between the fluorescent marker and the phosphorothioate diester.
  • various fluorophores can be employed, for example, monobromobimane (MBB) , bromomethylcoumarin, as well as a variety of chromophores carrying bromoacetamides, iodoacetamides, aziridinosulfonamides or 0-bromo-o/,&-unsatu- rated carbonyls; monobromobimane is preferred.
  • MBB monobromobimane
  • chromophores carrying bromoacetamides, iodoacetamides, aziridinosulfonamides or 0-bromo-o/,&-unsatu- rated carbonyls
  • monobromobimane is preferred.
  • post-assay procedure.
  • post-assay procedure is meant, generally, that the phosphorothioate diester-containing DNA is used in the assay of choice, for example, in polyacrylamide gel electrophoresis, and the fluorescent molecule or other marker or probe can be introduced at a later time, for example, while the nucleic acid is embedded in the polyacrylamide gel matrix.
  • the assay procedures contemplated by the present invention in this context include, for example, gel electrophoresis, Southern hybridization, and DNA sequencing techniques such as are described by Sanger, et al. (Sanger, et al. , Proc. Natl. - Acad. Sci., 74: 5436-5467, 1977).
  • Gel electrophoresis as used here is typically performed by running DNA samples down specific lanes in a ge (e.g., a polyacrylamide gel or agarose gel), under controlle current and temperature conditions for a short period of time. This procedure leaves the DNA embedded in the gel matrix.
  • a ge e.g., a polyacrylamide gel or agarose gel
  • Southern hybridization involves the use of a blotting membrane to remove the fractionated nucleic acid from the gel and allows for hybridization of labeled probes to the nucleic acid on the surface of the blotting membrane.
  • Radioisotopic labeling 32P has been commonly employed for the detection of nucleic acids resolved by electrophoresis o after hybridization techniques.
  • the labeling reaction is initiated after annealing of the primer to the template.
  • the second step involves adding the termination mixture, which is a higher concentration of all four dNTP derivatives plus one of the dideoxy derivatives
  • Post-assay fluorescent labeling techniques as described herein permit the introduction of multiple fluorescent molecules or other appropriate markers into the nucleic acid, e.g., after electrophoresis and "post-assay" labeling of detecting oligodeoxynucleotides and DNA fragments can be detected on the basis of, e.g., fluorescence, with high sensitivity.
  • Detection of fluorescent markers can be achieved by use of e.g., a standard long-wavelength ultraviolet transilluminator, to view the DNA in the gel.
  • the labeling procedure is particularly useful in conventional enzymatic procedures for the sequencing of DNA.
  • the four dNTPois derivatives used in the sequencing reaction can be substituted such that the DNA fragments produced will contain phosphorothioate diesters at all internucleotidic positions which can allow multiple labeling and ultimately allow reading of large and small DNA fragments.
  • the labeling procedure is also applicable to site specific identification of nucleotides by introducing at least one phosphorothioate diester selectively into an internucleotidic residue or DNA fragment or oligodeoxy ⁇ nucleotide, labeling said phosphorothioate diester with a marker and detecting said marker.
  • the aforesdescribed labeling technique can also be applicable to hybridization studies using, e.g., membrane-bound nucleic acids.
  • a fluorescently labeled cloned DNA probe can be used to localize specific nucleic acid sequences in mixtures of DNA restriction fragments fractionated by gel electrophoresis.
  • a replica of the gel is made by transferring all of the fractionated DNA fragments to a sheet of nitrocellulose paper or similar membrane (the "blotting membrane") by diffusion or electrophoresis.
  • the hybridization probe can be labeled before or after the hybridization assay occurs. The locations of the fragments that hybridize to fluorescently labeled DNA probes are then identified by their fluorescence.
  • nitrocellulose paper replicas can be made of crowded colonies of bacteria growing on an agar surface so that hybridization of the pape with a specific labeled probe can be used to identify the fe cells carrying a newly cloned specific DNA fragment.
  • the labeling and detection techniques herein discussed can also surprisingly be easily employed in DNA diagnostics and DNA therapy.
  • the present advantage, relativ to art recognized techniques, is particularly manifest in that the presence of the phosphorothioate diester does not effectively alter the biophysical nature of the DNA and yet selectively introduces a nucleophilic site which is readily modified and exploited for diagnostic and therapeutic purposes.
  • the phosphorothioate diester can be introduced into the DNA and subsequently hybridized to a gen of interest in vitro or in vivo, and then followed by specific introduction of a probe to that gene.
  • the probe to the particular gene can then be used to discover the locationo of the gene. This leads to detection of the presence or absence of the gene under diagnostic investigation.
  • the probe can then be used in DNA therapeutics to inactivate or destroy that particular gene or if necessary, to activate that gene. For example, diagnosing genetic disorders and direction of drug delivery (e.g. , anticancer or antiviral drugs) .
  • the present invention can be used in spectroscopic analysis (e.g., Nuclear Magnetic Resonance studies, and in particular, the Nuclear Overhauser Enhancement [NOE] ) to measure distances within nucleic acids by use of probes which can label specific phosphorothioate diesters.
  • spectroscopic analysis e.g., Nuclear Magnetic Resonance studies, and in particular, the Nuclear Overhauser Enhancement [NOE]
  • the present invention can also be applied to
  • Electron Spin Resonance studies which previously relied upon the use of non-specific labeling.
  • the simple and rapid procedures described here will allow the preparation and study of nucleic acid fragments containing spin labels, attached at well-characterized locations.
  • the proceudre described herein can also be used for the specific attachment of hydrolytic reagents (e.g. , ferric ion complexes) , intercalators and proteins to nucleic acids.
  • the present invention can also be used to probe the structure of DNA fragments or oligodeoxynucleotides by using chiral metal complexes (e.g. , the ⁇ -isomer or -isomer of tris- (4,7-diphenylphenan- throline) cobalt (III) ) as the one marker of choice to be attached to the phosphorothioate diester.
  • chiral metal complexes e.g. , the ⁇ -isomer or -isomer of tris- (4,7-diphenylphenan- throline) cobalt (III)
  • chiral metal complexes e.g. , the ⁇ -isomer or -isomer of tris- (4,7-diphenylphenan- throline) cobalt (III)
  • chiral metal complexes e.g. , the ⁇ -isomer or -isomer of tris- (4,7-diphenylphen
  • high detection sensitivity of fluorescent labeled nucleic acids can be facilitated by the introduction of multiple fluorescent markers to a corresponding multiple number of phosphorothioate diesters earlier introduced at the selected internucleotidic sites; the labeling reaction must occur at adjacent phosphorothioate diesters such that, to achieve maximum sensitivity, a nucleic acid fragment carries a fluorophore at each and every internucleotidic phosphorus residue.
  • experimentation indicates that there is no steric hindrance or other difficulty in placing fluorescent labels on adjacent phosphorothioate diesters, thus permitting maximization of this technique.
  • post-assay labeling procedures are useful for a variety of biochemical assays; one of the most important specific applications involves the detection of nucleic acids resolved by gel electrophosesis techniques.
  • One "post-assay” labeling procedure can be accomplished using short oligodeoxynucleotide fragments resolved by a given assay (e.g., gel electrophoresis) and then soaking the gel containing the small nucleic acid fragment with a solution which contains the fluorescent marker of choice. Small fragments with several labeled phosphorothioate diesters are quantitatively compared with the fluorescence exhibited by a nucleic acid fragment with a single fluorophore.
  • oligodeoxynucleotide primer can be extended using a template (e.g. , M13mpl8 or M13mpl9 or other single-stranded DNA) and then the resulting material can be hydrolyzed with an appropriate restriction endonuclease.
  • the amount of DNA fragment which can be visualized is approximated based upon the maximum amount of template present in the reaction mixture or as the result of internal standardization via radioisotopic labeling.
  • the variety of bands produced can be visualized by "post-assay" fluorescent labeling procedures. The results show a further increase in sensitivity relative to the increased sensitivity in small nucleic acid fragments.
  • fluorophores are available and many can be employed in the present process. Any fluorophore can be utilized for the "post-assay" fluorescent labeling procedures contemplated by the present invention which reasonably possess the following properties: high quantum yield; solubility in aqueous (or largely aqueous) solutions; relatively small size to allow diffusion through the gel matrix; high fluorescence only after reaction with a sulfur residue; and removal of the excitation maximum from the absorbance maximum of the nucleic acids.
  • One preferred fluorophore which meets these criteria is monobromobimane.
  • Other fluorophores of choice can include, for example, bromomethylcoumarin, or fluorophores carrying bromo- or iodoacetamides, or aziridinosulfonamides.
  • the fluorophores of choice have the ability to alkylate the phosphorothioate diester.
  • the phosphorothioate diester is more nucleophilic than any other site on the nucleic acid and results in formation of a stable phosphorothioate triester when labeled with the fluorophore of choice.
  • DNA sequencing using, e.g., the Sanger dideoxy method and DNA hybridization (using e.g., the Southern technique) .
  • DNA sequencing using, e.g., the Sanger dideoxy method and DNA hybridization (using e.g., the Southern technique) .
  • DNA sequencing is most amenable to enzymatic dideoxy sequencing procedures. This approach incorporates phosphorothioate diesters in place of native phosphate diesters in the DNA fragments generated. After gel electrophoresis, multiple fluorophores, such as MBB, can be attached to the DNA via alkylation of the sulfur residue of the phosphorothioate diesters.
  • MBB multiple fluorophores
  • the Sanger sequencing technique commonly utilizes a single ° ⁇ -[S ]dNTP derivative to introduce the readioactive label.
  • the "post-assay" labeling of this invention can be directly applied to the detection of these fragments.
  • the "post-assay" fluorescent labeling technique provides the sensitivity necessary to visualize DNA sequencing ladders in the absence of radioisotopes.
  • the technique as described here employs all four dNTP « S derivatives plus one of the dideoxy derivatives (ddNTP) in the elongation and then termination of the DNA primer.
  • Sequencing ladders can be generated with dNTP ⁇ S substrates in the like manner to the methodology with dNTP derivatives. It is then desirable to vary the elongation and termination conditions such that in the initial fluorescence labeling the amount of DNA in each band may be varied. Then the amount of DNA that appears in the bands can be maximized e.g., ranging from approximately 300 to 500 base pairs.
  • Fragments of this size can be resolved, and 300 to 500 fluorophores or other types of markers can be incorporated into such fragments.
  • the distribution of the fragments can be altered by changing the relative ratios of the dideoxynucleotide/deoxynucleotides triphosphates.
  • a ddNTP/dNTP « ⁇ S ratio of about 1:10 may be used to obtain a distribution of small and large fragments. A decrease in this ratio is effected to allow for more efficient polymerization in a stepwise manner to as low as about 1:500 in order to shift the distribution to longer fragments.
  • [35S]dATP as a method for introducing the radioisotopic label has been reported and is commonly employed. Dideoxy sequencing using 35S labeling typically involves two steps. After annealing of the primer to the template the labeling reaction is initiated. A low concentration of dTTP, dGTP, dCTP and b ⁇ -[ 35SjdATP is employed in order to elongate the primer and incorporate some radioisotope.
  • the second step involves adding the termination mixture which is a higher concentration of all four dNTP derivates plus one of the dideoxy derivatives (ddNTP) . It is a simple procedure to then substitute the four dNTP° S derivatives in both reactions (actually there is only one reaction since no radioisotopic labeling is involved) such that the DNA fragments produced will contain phosphorothioate diesters at all internucleotidic positions.
  • radioisotopic labeling can be used in combination with fluorescent markers to. monitor the limits of detection sensitivity.
  • a "minus-dCTP" labeling reaction is employed. This uses a primer and template of known sequence, for example, of the following sequences: M13mpl8 3* ...CAAAAGGGTCAGTGCTGCAACATTTTGCT...5 • primer 5'-GTTTTCCCAGTCACGAC-3' -
  • the labeling reaction can now be performed with low concentration of the dTTP « S, dGTP S and ⁇ -[ 35 S]dATP.
  • the elongation of the primer proceeds until the first dG present in the template and then terminates resulting in the following sequence containing four 35S labels:
  • the termination reaction uses all four dNTP ol. S derivatives at concentrations some two orders of magnitude higher than the labeling reaction such that any remaining radioactive •* - [ 35S]dATP is diluted and the quantity available for incorporation becomes insignificant.
  • the amount of material present (based upon the known specific activity of the et - - l 35S]dATP) in a given band can now be easily determined by excising the band, lyophilizing the gel and determining the radioactivity present by scintillation counting.
  • concentrations of the template and primer as well as the ratio of the ddNTP to dNTP « S, the amount of DNA present in a given fragment can be altered.
  • DNA sequencing in the abscence of radioisotopes can then be effectuated by detecting the hundreds of labeled, e.g., bimane-labeled phosphorothioate triesters by utilization of single or sophisticated electronic techniques.
  • the post-assay fluorescent labeling technique can also be applied to hybridization studies using nucleic acids.
  • the stability of a native DNA duplex is first tested against nucleic acid containing a number of phosphorothioate diesters and the effect of this stability when the phosphorothioate diesters are alkylated by a fluorophore is determined.
  • the results for the detection of a 21-mer fragment containing 20 phosphorothioate diesters shows that in the absence of electronic instrumentation it can readily be detected visually.
  • Nucleic acids with one label can be detected and detection of single nucleotides can be facilitated. Such visibility is increased proportionatly with the proportionate number of markers.
  • a 21-mer fragment is one example of a small hybridization probe which can be used to detect nucleic acid sequences.
  • DNA fragments or oligodeoxynucleotides of reproducible size are generated by selective chemical means, such as by a restriction endonuclease enzyme. These nucleic acids are resolved by a biochemical assay such as polyacylamide or agarose gel electrophoresis. The nucleic acid resolved in this manner is then transferred to a blotting membrane, e.g nitrocellulose membrane and the DNA probe is hybridized to the nucleic acid.
  • the marker of choice e.g., a fluorescent marker, may be introduced before or after the hybridization assay.
  • the marker can be detected using simple or sophisticated detection techniques.
  • One of the primary differences between "post-assay” fluorescent labeling within a gel matrix and labeling on a blotting membrane is that the latter occurs primarily on the surface of the membrane and not within a three dimensional matrix. With such surface phenomena it is possible to also " use biotin labeled hybridization probes and detection with fluorescent protein complexes which could not be used for labels embedded in a gel matrix (the proteins involved are of large molecular weight and would not readily diffuse through the pores of the gel matrix) .
  • the phosphorothioate diester can be employed to allow efficient multiple (and specific) labeling with a biotin derivative.
  • the bromoacetamido group can be used to modify the phosphorothioate diester.
  • a biotin derivative containing this functional group can be prepared quite simply by techniques available to one of ordinary skill in the art. Biotin labeling in this manner is considered an effective method for detecting nucleic acids when combined with immunochemical, histochemical or affinity detection systems. Two similar proteins, avidin and streptavidin, bind biotin very strongly and when coupled to fluorescent markers, enzymes or electron-dense proteins, can be exploited for the detection of nucleic acids.
  • the use of fluorescent labeled antibodies raised against biotin can also be employed for detection.
  • the biotin-labeled hybridization probe may be detected by use of a commercially available kit used for the detection of fluorescently labeled antibodies or by use of a transilluminator to detect the fluorescent group or protein.
  • Hybridization assays require the hybridization probe form stable Watson-Crick base pairs in order to localize the probe at a given sequence.
  • the addition of biotin derivatives to the internucleotidic phosphorus residues can result in some destabilization of the double stranded hybridization product.
  • a series of biotin labeled probes can be prepared containing from one to approximately five biotin labels and the stability of the duplexes formed can be examined with biotin modified oligodeoxynucleotides in comparison with those unmodified. This can be accomplished by labeling of the oligodeoxynucleotides containing the correctly positioned (and number of) phosphorothioate diester(s) and isolation of the product using HPLC techniques. Duplex stability can be monitored by thermal denaturation experiments and circular dichroism spectra.
  • biotin labeled oligodeoxy ⁇ nucleotide can then be examined using, for example, the 21-mer previously described.
  • the sensitivity to detection of probes containing a varying number of biotin labels can be examined using commercially available fluorescent labeled proteins. "Spacing" the labels every two, three or more phosphorus residues can be the simplest route to enhance detection sensitivity.
  • the phosphorothioate-containing probe is hybridized in one step; this avoids problems with the instability (if any) of the biotin labeled hybridization product. Subsequently, modification with the biotin label occurs, and after removal of the excess label, the protein solution is added for detection.
  • This approach is conceptually similar to. the one described for the visualization of DNA sequencing ladders and may also be the simplest approach to hybridization assays.
  • Hybridization experiments can also be performed with relatively long DNA fragments obtained from restriction digests and multiple phosphorothioate diesters can be incorporated into such a fragment using DNA polymerase and nick-translation procedures.
  • Radioisotopic labeling is accomplished by introducing "nicks" in the DNA with a dilute solution of DNase I and then elongating the nicked sites using DNA polymerase and the -- ⁇ __- [ 32P]dNTP substrates.
  • the -radioisotopic derivatives can then be replaced with the dNTP S derivatives and then hundreds of phosphorothioate diesters can be incorporated into the fragment.
  • the simplest system to test hybridization can be one involving the M13 DNA being used in the sequencing reactions.
  • M13 RF (replicative form) DNA can be prepared in the conventional manner and then cleaved out a 444-mer to use as a hybridization probe.
  • the 444-mer can then undergo nick-translation to incorporate the phosphorothioate diesters and then the modified and native sequences resolved by gel electrophoresis.
  • a second sample of the M13 RF DNA for example, can be digested such that the complementary 444-mer restriction fragment (in additon to others) is produced and transferred from an agarose gel to nitrocellulose or similar blotting membrane.
  • the hybridization can then proceed followed by post-assay fluorescent labeling using, e.g., monobromobimane; fluorescent labeling with hundreds of markers provides the desired detection sensitivity. Since the monobromobimane is largely non-fluorescent until it alkylates a sulfur containing f nctionality, the membrane background fluorescence is relatively low. The labeled marker can then be detected with relative ease.
  • DNA probes are generated from RNA. Again, one can simply use the dNTP S derivatives, which function as substrates for reverse transcriptase, to form the complementary DNA strand for use as a hybridization probe.
  • the use of the new labeling approach provides well-characterized hybridization probes which can be used for the detection of specific DNA sequences, in the absence of radioisotopes, for example, in
  • Southern blots Northern blots, colony screening or plaque screening.
  • the labeling of specific phosphorothioate diesters is also valuable for structural studies involving fluorescent energy transfer techniques and electron spin resonence (ESR) techniques.
  • ESR electron spin resonence
  • the application of these two spectroscopic techniques has long suffered from the difficulty in specifically attaching the desired probe to the nucleic acid fragment.
  • the present procedure permits simple and rapid synthesis of a variety of nucleic acid sequences which can be easily modified with fluorescent markers or spin labels for spectroscopic studies.
  • Fluorescent Energy Transfer Techniques allow for a simple and rapid means for measurement of longer distances within the nucleic acid structure, complementing NMR techniques such as that of the Nuclear Overhauser Enhancement (NOE) which can only measure small distances in the nucleic acid.
  • NMR Nuclear Overhauser Enhancement
  • ESR spectra can be valuable for the study of ⁇ biopolymer dynamics providing that the appropriate spin labe can be specifically bound to the macromolecule of interest.
  • the technique has suffered a similar disadvantag to energy transfer experiments in the difficulty of specifically placing the label on the macromolecule.
  • the us of the phosphorothioate diester can again be valuable in thi respect.
  • Nucleic acid fragments can be prepared with spin labels by exactly the same approach as described above for fluorescent markers. Specifically labeled probes can be designed and prepared for these ESR studies. Other procedures which can be used in association with the instant technique involve optimization of fluorescence detection.
  • Tp(s)T the phosphorothioate diester derivative of TpT
  • TpT the phosphorothioate diester derivative of TpT
  • the sulfur oxidation solution was injected directly onto the column with a syringe. After a reaction time of 1 h at ambient temperature, the column was washed with a 1:1 solution of CS, and lutidine to remove the residual sulfur. The column was then replaced on the machine, and the synthesis cycle was resumed.
  • the 21-mer d(GCTATCGAAAGATCTCATAAG) was synthesized in an analogous manner. The synthesis was interrupted at every oxidation step to allow oxidation with the sulfur solution.
  • the oligodeoxynucleotides of interest were treated with an excess of monobromobimane, and the reaction was monitored by HPLC. Specifically, a solution of Tp(s)T (3.6 mM) in water was allowed to react overnight (18 h) with a 6-fold excess of monobromobimane (22 mM) . The octamer (0.3 mM) in water was allowed to react with either a 5-fold excess of MBB (1.5 mM) or a 10-fold excess of MBB (3.0 mM) .
  • the fragment Tp (s)Tp(s)Tp(s)T (0.43 mM, a phosphorothioate diester concentration of 1.29 mM) was treated with an 8-fold excess (with respect to the phosphorothioate diesters) of MBB (10.5 mM) .
  • Covalent fluorescent labeling of the 15-mer in solution (0.8 mM) with MBB was achieved at 7.5 mM MBB (3-fold excess for 2.4 mM phosphorothioate diester) .
  • the bimane-labeled Tp(s)T was isolated by reverse-phase HPLC on a 4.6 x 250 mm column of ODS-Hypersil with 50 mM triethylammonium acetate, pH 7.0, and a gradient of 0-70% acetonitrile in 1 h.
  • the other labeling reactions were monitored by reverse-phase HPLC on a 4.5 x 250 mm column of ODS-Hypersil with either 20 mM KH 2 P0 4 , pH 5.5, and a gradient of 0-70% methanol in 30 min (the octamer and tetramer) or 50 mM triethylammonium acetate, pH 7.0, and a gradient of 0-35% acetonitrile in 1 h (15-mer) .
  • the samples were analyzed by HPLC on a 4.6 x 250 mm column of ODS-Hypersil using 0.02 M potassium phosphate, pH 5.5, with a linear gradient of 0-70% methanol in 30 min.
  • the bimane-labeled Tp(s)T eluted at 21 min, while the product TpT eluted at 16 min.
  • 31P NMR studies were done at 121.5 MHz using a varian multinuclear FT-NMR. Positive chemical shift values are reported in parts per million (ppm) downfield from the external standard of aqueous 85% phosphoric acid. NMR analysis was done on a sample containing 1.2 umol of
  • the oligodeoxynucleotide was eluted with 10 mL of 50% aqueou methanol.
  • the solution containing the DNA fragment was evaporated to dryness and redissolved in 0.4 M distilled water. Isolated yields ranged from 60 to 80%.
  • the 21-mer, 23.3 uM (1 A 2 unit) was end labeled in an analogous manner but could not be eluted with aqueous methanol.
  • the Sep-pak cartidge was prewashed with acetonitrile and distilled water.
  • the unincorporated ATP and salts were then eluted with 1% aqueous acetonitrile while the oligodeoxynucleotide was eluted with 50% aqueous acetonitrile. Isolated yields also ranged from 60 to 80%. 6) Post-Assay Labeling
  • the gels were treated with one of the following: 75% aqueous mixtures of methanol, ethanol, butanol, dimethylformamide, or concentrated glycerol. The gels were viewed using a long ultraviolet wavelength light transilluminator. 7) Fluorescent Studies
  • the fluorescense (excitation 385 nm, emission 465 nm) of varying solutions of bimane-labeled Tp(s)T in 5 mM KH 2 P0 4 , pH 4.5, was measured by using a fluorescence spectrophotometer, and a standard curve of fluorescence vs. phosphorothioate diester concentration was fitted to the data employing a linear least-squares analysis.
  • the 5'- 32P end-labeled 15-mer was electroeluted for 2 h from a 20% polyacrylamide gel into dialysis tubing containing 0.5x TBE buffer.
  • the solution was evaporated to dryness, redissolved in 1 mL of distilled water, and desalted using a column of Sephadex G-10.
  • the DNA fragment was collected, evaporated to dryness, and redissolved in 3 mL of 5 mM KH 2 P0., pH 4.5.
  • the fluorescence of the solution was measured and the concentration of the 15-mer determined by scintillation counting.
  • the fluorescence as a function of concentration of the phosphorothioate diesters was plotted on the standard bimane-labeled Tp(s)T curve.
  • the 5'- 32P end-labeled 21-mer was electroeluted for 24 h from the polyacrylamide gel after post-assay labeling.
  • the solution was evaporated to dryness and redissolved in 0.5 mL of distilled water. In this case, the solution containing the 21-mer was adjusted to 10 mM
  • Ml3 mpl8 DNA was converted to the replicative form (RF) as follows.
  • the template DNA (2.5 ug) and universal primer (0.1 ug) were annealed in 25 uL of buffer containing 100 mM NaCl, 20 mM gCl 2 , and 100 mM Tris-HCl, pH 8.0, by heating the mixture to 56°C for 15 min followed by slow cooling to ambient temperature.
  • the final 50-uL reaction mixture containing dATP, dGTP, dCTP, dTTP (500 uM each), ATP (1 mM) , DNA polymerase 1 (Escherichia coli, 10 units) , and T4 DNA ligase (8 units) was incubated overnight at 16°C.
  • the Aval reaction mixture contained RF M13mpl9 DNA, 100 mM NaCl, 20 mM MgCl 2 , and 100 mM Tris-HCl, pH 8.0.
  • the Hpall reaction mixture contained RF M13mpl8 DNA, 3 mM KC1, 5 mM MgCl 2 , 100 ug/mL BSA, and 5 mM Tris-HCl, pH 7.4. The reactions were initiated by the addition of the enzyme and incubated at 37°C for 2 h.
  • reaction mixture was loaded onto 6% acrylamide, 0.6% bis(acrylamide) gels (20 x 20 x 0.04 cm or 34 x 42 x 0.04 cm) containing 3 mM Na 2 EDTA, 7 M urea, and 50 mM Tris-borate, pH 8.3. Fluorescent labeling proceeded as described above.
  • Longer DNA fragments containing phosphorothioates can be prepared by enzymatic synthesis if the dNTP substrates are substituted by the od-thio derivatives (Taylor et al. , Nucleic Acids Res. , 13: 8749-8764, 1985) .
  • an oligonucleotide primer was extended using an M13mpl8 or M13mpl9 template and the resulting material was hydrolyzed with a restriction endonuclease. It was possible to prepare M13 RF DNA containing phosphorothioates at each position.
  • Two oligonucleotides were synthesized for covalent attachment of a variety of reporter groups, including spin labels, fluorophores and drug derivatives.
  • a dodecadeoxynucleotide and an eicosodeoxynucleotide were chemically synthesized by the phosphoramidite method described in Example 1 and altering the oxidation step at th appropriate cycle, resulting in two phosphorus diastereomers (Rp and Sp) . It is possible to prepare the oligonucleotide such that it contains a pure phosphorus diastereoisomer as described [Connolly et a_l. , Biochemistry 23: 3443-3453, 1984; Taylor et al. , 1985] .
  • the dodecamer has the sequence d[CGCA(s)AAAAAGCG] and the eicosomer has the sequence d[CGTACTAGT (s)AACTAGTACG] .
  • Tp(s)T was reacted with a number of fluorophores or reporter groups containing a variety of functional groups.
  • Oligodeoxynucleotides of Example 10 containing a single covalently bound reporter group were obtained by incubation of the phosphorothioate-containing DNA fragment - with the reporter group of choice in aqueous or largely aqueous solutions at pH values from 5 to 8. These reactions were performed at 25 to 50°C and usually proceeded with yields greater than 85% after 24 h at 50°C. Resolution of the reaction mixture and isolation of the triester product was accomplished by using HPLC (4.6 X 250 mm Hypersil-ODS with 0.02 M KH-PO. pH 5.5 and a methanol gradient) .
  • the reaction to produce the compound in Fig. 5c was conducted as described above using the following specific conditions: 12 mM N-dansylaziridine, 0.34 mM dodecamer, pH 8.0 (phosphate) at 25°C in a solution containing 50% acetonitrile. Similar condiitons were employed to label the eicosomer.
  • the reaction to produce the compound in Fig. 5d was conducted as described above using the following specific conditions: 10 mM 1,5-I-AEDANS, 0.80 mM dodecamer, pH 6.0 (phosphate) at 50°C in a solution containing 25% DMF. Similar conditions were employed to label the eicosomer.
  • the unlabeled dodecamer helix, d[CGCA(s) AAAAGCG] d[CGCTTTTTTGCG] exhibited a T of 55°C, and this was indistinguishable from the values obtained for the PROXYL- labeled (a in Figure 5) or drug-labeled (b in Figure 5) helices.
  • the T value for the self-complementary eicosomer, d[CGTACTAGTT(s)AACTAGTACG] 2 with two labels was also largely unchanged (68.5°C) in comparison to the unlabeled fragment
  • hydrolytic stability of the phosophorothioate triesters is an important practical consideration for the value of such derivatives in many studies. Hydrolysis of the triesters proceeded by desulfurization (monitored by HPLC and confirmed by comparison with authentic standards) . No detectable cleavage of the oligodeoxynucleotide at the point of attachment was observed. This agrees with the results of ethylated or hydroxyethylated derivatives, which result in primarily desulfurization and only very minor amounts of chain cleavage.
  • the triester prepared from a "-bromo- ⁇ _ ⁇ , -unsaturated carbonyl (b in Figure 5) exhibited stability similar to that of the PROXYL-labeled derivatives while that resulting from reaction with the aziridinyl sulfonamide (c in Figure 5) was more stable [the Tp(s)T-labeled triester was hydrolyzed ⁇ 1% (pH 7) , 5%(pH 8) , and 34% (pH 10) after 24 h at ambient temperature] .
  • the triester produced from 1,5-I-AEDANS and Tp(s)T was significantly less stable than the PROXYL-labeled derivative although the triesters formed both resulted from iodoacetamides.
  • the AEDANS-labeled dimer exhibited 19% (pH 7) and 88% (pH 8) hydrolysis (24 h) ; it was completely hydrolyzed within 2 h at pH 10.
  • the AEDANS-labeled dodecamer (d in Figure 5) exhibited only 1%, 49%, and 99% hydrolysis at the same respective pH values (24 h) .

Abstract

L'invention concerne des marqueurs d'ADN et, en particulier, des techniques de marquage d'acides nucléiques. D'une manière plus précise, cette invention concerne un protocole qui permet l'introduction covalente de marqueurs fluorescents simples ou multiples ou d'autres sondes dans des fragments d'ADN et des oligodésoxynucléotides. La présente technique, utilisant en particulier des marqueurs fluorescents multiples, permet une détection de grande sensibilité d'acides nucléiques (sans utiliser des dispositifs sophistiqués de détection) dans la plage inférieure femtomolaire (10-15 moles) et permet aussi de placer des marqueurs et des sondes en des emplacements spécifiques à l'intérieur de la macromolécule. La présente invention peut être utilisée avec une grande sensibilité de détection pour des procédés d'hybridation et de mise en séquence d'ADN y compris une multitude de procédures diagnostiques et thérapeutiques. La présente technique peut être utilisée comme outil pour l'étude de la dynamique des acides nucléiques par l'intermédiaire de la reconnaissance et de l'évaluation du transfert d'énergie de fluorescence et de la résonance du spin des électrons, et l'étude de la structure, de la conformation et de la dynamique de biopolymères. Des procédés de marquage spécifique permettent l'introduction d'une sonde ou autre entité pour la localisation de séquences désirées ou l'apport de la sonde à une séquence spécifique. Ce procédé est fondamental pour les domaines en développement de diagnostics et de thérapies par l'ADN.
PCT/US1990/000182 1989-01-10 1990-01-09 Marquage d'acides nucleiques a l'aide de marqueurs fluorescents WO1990008838A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US29563789A 1989-01-10 1989-01-10
US295,637 1989-01-10

Publications (1)

Publication Number Publication Date
WO1990008838A1 true WO1990008838A1 (fr) 1990-08-09

Family

ID=23138575

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1990/000182 WO1990008838A1 (fr) 1989-01-10 1990-01-09 Marquage d'acides nucleiques a l'aide de marqueurs fluorescents

Country Status (2)

Country Link
CA (1) CA2007431A1 (fr)
WO (1) WO1990008838A1 (fr)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0431523A2 (fr) * 1989-12-04 1991-06-12 Enzo Biochem, Inc. Composés de nucléotides modifiés
EP0549107A1 (fr) 1991-10-11 1993-06-30 BEHRINGWERKE Aktiengesellschaft Méthode pour produire un polynucléotide qui peut être utilisé pour des amplifications à amorce unique et utilisation d'oligonucléotides contenant le phosphorotioate comme amorces pour l'amplification d'acides nucléiques
US5475092A (en) * 1992-03-25 1995-12-12 Immunogen Inc. Cell binding agent conjugates of analogues and derivatives of CC-1065
FR2824335A1 (fr) * 2001-05-04 2002-11-08 Bio Merieux Procede de marquage et de fragmentation d'adn
FR2824323A1 (fr) * 2001-05-04 2002-11-08 Bio Merieux Reactif de marquage et procede de detection de molecules biologiques
WO2003052115A2 (fr) * 2001-12-14 2003-06-26 Amersham Biosciences Ab Marquage post-synthese d'acides nucleiques et utilisation de ceux-ci
US6696246B1 (en) 1998-08-21 2004-02-24 Naxcor, Inc. Assays using crosslinkable immobilized nucleic acids
US7338805B2 (en) 2001-05-04 2008-03-04 Bio Merieux Labeling reagents, methods for synthesizing such reagents and methods for detecting biological molecules
US7691635B2 (en) 2004-03-26 2010-04-06 Biomerieux Labeling reagents, methods for the synthesis of such reagents and methods for the detection of biological molecules
US8140148B2 (en) 1998-01-20 2012-03-20 Boston Scientific Scimed Ltd. Readable probe array for in vivo use
US8309695B2 (en) 2007-06-11 2012-11-13 Biomerieux Marking reagents bearing diazo and nitro functions, methods for the synthesis of such reagents and methods for detecting biological molecules
US9266902B2 (en) 2008-07-29 2016-02-23 Biomerieux Labelling reagents having a pyridine nucleus bearing a diazomethyl function, process for synthesis of such reagents and processes for detection of biological molecules

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4910300A (en) * 1985-12-11 1990-03-20 Chiron Corporation Method for making nucleic acid probes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4358535A (en) * 1980-12-08 1982-11-09 Board Of Regents Of The University Of Washington Specific DNA probes in diagnostic microbiology
US4358535B1 (fr) * 1980-12-08 1986-05-13
US4910300A (en) * 1985-12-11 1990-03-20 Chiron Corporation Method for making nucleic acid probes

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0431523A3 (en) * 1989-12-04 1991-09-25 Enzo Biochem, Inc. Modified nucleotide compounds
US7495088B1 (en) 1989-12-04 2009-02-24 Enzo Life Sciences, Inc. Modified nucleotide compounds
EP0431523A2 (fr) * 1989-12-04 1991-06-12 Enzo Biochem, Inc. Composés de nucléotides modifiés
EP0549107A1 (fr) 1991-10-11 1993-06-30 BEHRINGWERKE Aktiengesellschaft Méthode pour produire un polynucléotide qui peut être utilisé pour des amplifications à amorce unique et utilisation d'oligonucléotides contenant le phosphorotioate comme amorces pour l'amplification d'acides nucléiques
US5475092A (en) * 1992-03-25 1995-12-12 Immunogen Inc. Cell binding agent conjugates of analogues and derivatives of CC-1065
US5585499A (en) * 1992-03-25 1996-12-17 Immunogen Inc. Cyclopropylbenzindole-containing cytotoxic drugs
US5846545A (en) * 1992-03-25 1998-12-08 Immunogen, Inc. Targeted delivery of cyclopropylbenzindole-containing cytotoxic drugs
US8140148B2 (en) 1998-01-20 2012-03-20 Boston Scientific Scimed Ltd. Readable probe array for in vivo use
US6696246B1 (en) 1998-08-21 2004-02-24 Naxcor, Inc. Assays using crosslinkable immobilized nucleic acids
US7338805B2 (en) 2001-05-04 2008-03-04 Bio Merieux Labeling reagents, methods for synthesizing such reagents and methods for detecting biological molecules
WO2002090584A3 (fr) * 2001-05-04 2003-09-25 Bio Merieux Procédé de marquage et de fragmentation d'adn
WO2002090319A1 (fr) * 2001-05-04 2002-11-14 Bio Merieux Reactifs de marquage, procedes de synthese de tels reactifs et procedes de detection de molecules biologiques
CN1325659C (zh) * 2001-05-04 2007-07-11 比奥·麦利尤股份有限公司 标记和片段化dna的方法
WO2002090584A2 (fr) * 2001-05-04 2002-11-14 Bio Merieux Procédé de marquage et de fragmentation d'adn
FR2824323A1 (fr) * 2001-05-04 2002-11-08 Bio Merieux Reactif de marquage et procede de detection de molecules biologiques
FR2824335A1 (fr) * 2001-05-04 2002-11-08 Bio Merieux Procede de marquage et de fragmentation d'adn
WO2003052115A2 (fr) * 2001-12-14 2003-06-26 Amersham Biosciences Ab Marquage post-synthese d'acides nucleiques et utilisation de ceux-ci
WO2003052115A3 (fr) * 2001-12-14 2003-10-09 Amersham Biosciences Ab Marquage post-synthese d'acides nucleiques et utilisation de ceux-ci
US7691635B2 (en) 2004-03-26 2010-04-06 Biomerieux Labeling reagents, methods for the synthesis of such reagents and methods for the detection of biological molecules
US8309695B2 (en) 2007-06-11 2012-11-13 Biomerieux Marking reagents bearing diazo and nitro functions, methods for the synthesis of such reagents and methods for detecting biological molecules
US9266902B2 (en) 2008-07-29 2016-02-23 Biomerieux Labelling reagents having a pyridine nucleus bearing a diazomethyl function, process for synthesis of such reagents and processes for detection of biological molecules

Also Published As

Publication number Publication date
CA2007431A1 (fr) 1990-07-10

Similar Documents

Publication Publication Date Title
Fidanza et al. Site-specific labeling of DNA sequences containing phosphorothioate diesters
Xu et al. Nonenzymatic autoligation in direct three-color detection of RNA and DNA point mutations
CA2145405C (fr) Nucleotides marques avec un colorant infrarouge et leur utilisation dans la detection des acides nucleiques
US5573906A (en) Detection of nucleic acids using a hairpin forming oligonucleotide primer and an energy transfer detection system
EP0777674B1 (fr) Reactifs polynucleotidiques contenant des fractions non nucleotidiques, et procedes de synthese et d'utilisation associes
US5824796A (en) Cross-linking oligonucleotides
US6465175B2 (en) Oligonucleotide probes bearing quenchable fluorescent labels, and methods of use thereof
US5118802A (en) DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
JP3293820B2 (ja) 標的ポリヌクレオチドにハイブリツド形成するための新規な一工程方法とポリヌクレオチド化合物
WO1990014353A1 (fr) Oligonucleotides de reticulation
EP0373956B1 (fr) Sondes nucléotides
JPS61115094A (ja) 核酸ラベリング用新規ビオチンヌクレオチド
CA2325399A1 (fr) Nucleotides modifies et methodes utiles pour le sequencage d'acides nucleiques
EP1442142A2 (fr) Sondes d'acide nucleique et procedes de detection et/ou de quantification d'analytes d'acide nucleique
JPH09506510A (ja) 核酸が媒介する電子伝達
EP0661979A1 (fr) Oligonucleotides a reticulation pour la formation de triple brin a mediation enzymatique
WO1990008838A1 (fr) Marquage d'acides nucleiques a l'aide de marqueurs fluorescents
US6063571A (en) Process for amplifying nucleic acids using DNA/PNA primers
EP0527433B1 (fr) Marqueur fluorescent
USRE38416E1 (en) Cross-linking oligonucleotides
US6087101A (en) Optical characterization of nucleic acids and oligonucleotides
US20020155470A1 (en) Methods and compositions for detecting polynucleotide duplex damage and errors
Agrawal et al. Functionalization of oligonucleotides by the incorporation of thio-specific reporter groups
US5587472A (en) Coumarin-labeled nucleoside 5'-triphosphates
EP0610215A1 (fr) Dosage de polynucleotides a l'aide de sites de clivage pouvant etre selectionnes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE