WO1989008708A1 - Ribosome binding site - Google Patents

Ribosome binding site Download PDF

Info

Publication number
WO1989008708A1
WO1989008708A1 PCT/US1989/000650 US8900650W WO8908708A1 WO 1989008708 A1 WO1989008708 A1 WO 1989008708A1 US 8900650 W US8900650 W US 8900650W WO 8908708 A1 WO8908708 A1 WO 8908708A1
Authority
WO
WIPO (PCT)
Prior art keywords
ribosome binding
binding site
sequence
ptrp
expression
Prior art date
Application number
PCT/US1989/000650
Other languages
English (en)
French (fr)
Inventor
Che-Shen C. Tomich
Mary K. Olsen
Original Assignee
The Upjohn Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Upjohn Company filed Critical The Upjohn Company
Publication of WO1989008708A1 publication Critical patent/WO1989008708A1/en
Priority to DK201090A priority Critical patent/DK201090D0/da

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/525Tumour necrosis factor [TNF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/61Growth hormone [GH], i.e. somatotropin

Definitions

  • This invention relates to methods for enhancing expression of heterologous polypeptides. More specifically, the invention relates to the enhancement of expression of heterologous polypeptides by altering the ribosome binding sites operatively linked thereto.
  • heterologous polypeptides including bovine somatotropin (BSt) are difficult to express in most E. coli expression systems. Modifications within the first 4 codons of the cDNA encoding the BSt structural gene result in increased levels of BSt expression when these modified eDNAs are expressed in a pBR322-related vector. These modified cDNAs are expressed at even higher levels when placed in a runaway expression vector (United States patent application S.N. 016,294, filed 19 February 1987 and incorporated herein by refer ⁇ ence) .
  • the modified ribosome binding sites of the instant invention produce expression of heterologous polypeptides with a non-runaway vector, for example, a derivative of pBR322, equivalent to that achieved with a runaway vector.
  • a non-runaway vector for example, a derivative of pBR322
  • methods for cloning and expressing heterologous polypeptides in transformed hosts are well known to those skilled in the art.
  • heterologous polypeptides include, for example, human insulin, growth hormone, interferon and factor VIII, viral antigens, and other animal hormones.
  • the ribosome binding site is one of the elements involved in such expression. It covers the region about 20 nucleotides on both sides of the initiation codon and contains the Shine-Dalgarno sequence usually 6-10 nucleotides upstream from the initiation codon.
  • the 20 nucleotides after the initiation codon includes the beginning of the gene sequence inserted for expression and often cannot be subjected to modifications without changing the amino acid sequence of the gene. Therefore, in a practical sense, manipulation of the ribosome binding site can only be carried out at the region upstream from the initiation codon.
  • the ribosome binding site is known to function best if it contains certain bases but there is no known requirement for any particular base in a particular site except that the Shine-Dalgarno sequence is generally purine-rich. The subtle differences among various known ribosome binding site sequences do not provide an obvious comparison to predict which genes will be highly and which will be poorly expressed when associated therewith.
  • a preferred embodiment of the present invention utilizes sequences that are rich in A and T nucleotides to flank the Shine-Dalgarno sequence thereby producing ribosome binding sites that have an increased number of adenine and thymidine residues as compared to the naturally occurring ribosome binding sites from which they are derived.
  • Naturally occurring BSt is a mixture of heterogeneous proteins, the a ino acid sequences of which are known (Paladini, A.C., et al., Molecular Biology of Growth Hormone, CRC Reviews in. Bioche ⁇ ⁇ 15(l):25-56 ⁇ (1983).
  • Th naturally occurring mixtures have been purified from pituitary glands of cattle.
  • Recombinant bovine somatotropin can be produced in transformed microorganisms using a variety of recombinant genetic plasmids (see, e.g., Seeburg, P.H., et al. , "Efficient Bacterial Expression of Bovine and Porcine Growth Hormones," DNA, 2:37-45 (1983)); European Patent Application 47 600; United Kingdom Patent Application, GB 2073245A; Schoner, B.E. , et al., Role of mRNA Translational Efficiency in Bovine Growth Hormone Expression in Escherichia coli, PNAS USA, 81:5403-5407 (1984); European Patent Application 103 395; and European Patent Application 111,814).
  • the instant invention relates to. ribosome binding sites enriched in adenine and thymine.
  • the instant invention provides recombinant DNA molecules comprising a sequence of deoxyribonucleotides encoding a heterologous polypeptide and a ribosome binding site operatively linked thereto, wherein the ribosome binding site has an increased number of adenine (A) and thymidine (T) residues as compared to the naturally occurring ribosome binding site from which it is derived or to which it is related.
  • A adenine
  • T thymidine
  • heterologous polypeptide is a somatotrop- in, preferably porcine, ovine and borine, and most preferably, bovine somatotropin.
  • the recombinant DNA molecule ribosome binding site deoxyribonucleotide sequence is AAGTTCACGTTATTAAAAATTAAAGAG- GTATATATTAATG or AAGTTCACGTTATTAAAAATTAAGGAGGTATATCGATAATG, and preferably for bovine so atotropin, AAGTTCACGTTATTAAAAATTAAAGAG- GTATATATTAATGGCCTTCCCAGCT or AAGTTCACGTTATTAAAAATTAAGGAGGTATATCGATAA- TGGCCTTCCCAGCT.
  • the instant invention also provides DNA molecules comprising a sequence of deoxyribonucleotides selected from AAGTTCACGTTATTAAAAAT- TAAAGAGGTATATATTAATGGCCTTCCCAGCT, AAGTTCACGTTATTAAAAATTAAGGAGGTATATC- GATAATGGCCTTCCCAGCT, AAGTTCACGTTATTAAAAATTAAAGAGGTATATATTAATG and AAGTTCACGTTATTAAAAATTAAGGAGGTATATCGATAATG.
  • the instant invention also provides a ribosome binding site having an increased number of A and T residues as compared to the naturally occurring ribosome binding site from which it is derived or to which it is related.
  • E. coli strains are grown on Luria broth (LB), LB with 0.2% glucose, Difco's Antibiotic Medium #2, or M9 medium supplemented with 0.2% glucose and 0.05-0.1% acid-hydrolyzed casein amino acids. Strains resistant to antibiotics are maintained at the drug con ⁇ centrations described in Maniatis. Transformations are performed according to the method described by Morrison, D.A. (1977), J. of Bact., 132:349-351.
  • restriction endonuclease and other DNA modifying enzymes are commercially available and are used according to the manufacturer's instructions.
  • Restriction fragments are separated by either agarose or polyacrylamide gel electrophoresis and isolated by electroelution (Maniatis) .
  • Protein concentration is determined using the BioRad protein assay kit, based on Coomassie Blue staining.
  • SDS polyacrylamide gel electrophoresis for protein analysis is performed as described in Morse, L. r et al. , 1978, J. Virol., 26:389- 410.
  • Hybridization conditions for oligonucleotide probes are as previously described by Goeddel, D.V. et al. , Nature, 290:20-26 (1981) .
  • mini-lysates of plasmid DNA are prepared according to the method of Holmes, D.S. et al. , Analyt. Biochem. , 114:193 (1981), or the alkaline lysis procedure described in Maniatis. Large scale plasmid preparation is by CsCl sedimentation, according to procedures described in Maniatis. Plasmid sequencing is done according to the dideoxy chain termination method of Wallace, R.B. et al., Gene, 16:21-26 (1981), or the chemical degradation method of Maxam, A.M. and Gilbert, W. , Methods in Enzymology, 65:499-560 (1980).
  • Oligonucleotides are chemically synthesized according to the solid phase phosphoramidite triester method (Beaucage, S.L. and Caruthers, M.H. , Tetrahedron Letts. , 22(20) :1859-1862 (1981)) using an automated synthesizer, as " described In Needham-VanDevanter, D.R. et al., Nucleic Acids Res., 12:6159-6168 (1984). Oligonucleotides are purified by preparative gel electrophoresis using 12-20% poly- acrylamide with 7M urea. The appropriate band is eluted from the gel by incubating the gel slice in 0.54 M ammonium acetate at 37 c . The salt is removed by absorption of the oligonucleotides on a Waters Sep-Pak C18 column and eluting with acetonitrile:H 2 0 (40:60 V:V) .
  • expression vectors that contain, at a minimum, a strong promoter to direct mRNA transcrip ⁇ tion, a ribosome binding site for translational initiation, and, usually, a transcription terminator (collectively, “the expression control sequences") all of which are operatively linked to the desired gene.
  • the term "operatively linked” includes having an appropriate start signal in front of the gene encoding the desired product and maintaining the correct reading frame to permit expres ⁇ sion of the inserted gene under the control of the expression control sequences and synthesis of the desired product encoded for by that gene.
  • the promoter chosen to direct the synthesis of the product should be regulated in such a way that cell growth can reach high densities before the promoter Is induced.
  • regulatory regions suitable for this purpose are the promoter and operator region of the E. coli tryptophan biosynthetic pathway (trp promoter) and the leftward promoter of phage lambda (P*_) •
  • the trp promoter is repres- sed in the presence of tryptophan and can be induced by tryptophan starvation or by the addition of the inducer indole acrylic acid (Yanofsky, C, et al., J. Bacteriol.
  • Promoter P L is controlled by the represser cl.
  • a temperature-sensitive mutation in the cl gene e.g., cI857
  • PL can be induced at temperatures above 38°C (Herskowitz, I. and Hagen, D. , 1980, Ann. Rev. Genet., 14:399-445).
  • Most preferred are expression vectors having restriction enzyme sites for insertion of genes to be ex ⁇ pressed at an appropriate distance from the Shine-Dalgarno sequence.
  • the start codon usually ATG, should be located in conjunction with an appropriate ribosomal binding site sequence for efficient expression of a gene (Gold, L. , et al., 1981, Ann.
  • the preferred DNA coding sequence of the present Invention is the BSt cDNA sequence modified at the 4th codon by changing GCC to GCT.
  • the preferred vector of this invention comprises a pBR322 replicon which expresses the modified bovine somatotropin at particularly high levels.
  • Vectors other than pBR322- derived plasmids can also be used.
  • pBR322 has a ColEl replicon.
  • Other useful plasmids with ColEl replicons include ⁇ KC7, pAT153, and pBR325. They differ from pBR322 only In their drug resistance makers.
  • vectors include pACYC184 (pl5A replicon) , ⁇ N01523 (pMBl replicon), pLG338 (pSClOl replicon), and pBEU50 (Rl replicon) (Maniatis; Pouvels, P.H. , et al, Cloning Vectors , Elsevier, New York 1985). Also useful are pURA (Rl and ColEl replicon; U.S. application S.N.
  • the expression vector pTrpl is derived from pSK4 (Kaytes, P.S. et al. , 1986, J. of Biotechnology, 4:205-218).
  • pTrpl contains the promoter and operator sequence of the tryptophan biosynthetic pathway (trp promoter) of E. coli , the Shine-Dalgarno sequence of the trpL gene, the replication origin from pBR322 and a gene for ampicillin resistance.
  • pTrpl also has a unique Clal site following the trpL Shine-Dalgarno sequence and a unique Kpnl/Asp718 site immediately after the initiation codon ATG.
  • a gene having an initiation codon which is inserted at the Clal site of pTrpl is expressed with no extraneous a ino acids.
  • the 494 bp PvuII fragment containing the cDNA sequence coding for amino acid residues 24 to 188 of BSt is isolated from pLG23 (deposited with the Northern Regional Research Laboratory in Peoria, Illinois, USA under Accession Number NRRL B12436) and inserted into the blunt-ended Kpnl site of pTrpl to produce a BSt cDNA sequence lacking the codons for the first 22 amino acid residues.
  • the resulting plasmid is designated pTrp-BStml.
  • the PvuII site at the codon for amino acid residue 188 Is removed by replacing the BSt 3' end between the Mstll and fiamHI sites with the appropriate oligonucleotides.
  • the resulting plasmid is designated pTrp-BStmlb.
  • the small Clal to PvuII region is also replaced by the appropriate oligonucleotides.
  • the resulting plas ⁇ mids, pTrp-BStl02 and pTrp-BStm4 have the BSt sequence downstream from the trp promoter and the trpL ribosome binding site.
  • Plasmid pTrp-BStl02 has no changes in the beginning of the BSt coding sequence while pTrp-BStm4 has the fourth codon for alanine changed from GCC to GCT. These plasmids are shown in Chart 1. EXAMPLE 1. Construction of a Plasmid for BSt Expression having an A T-RIch Ribosome Binding Site
  • oligonucleotides are used to replace the Hpal to Clal region in pTrp-BStm4. Referring now to Chart 2, pTrp-BStm4 is treated with Hpal and
  • the Hpal cleavage site is located in the trp promoter sequence and the Clal cleavage site is located 1 immediately upstream from the initiation codon ATG.
  • the CG overhang produced by Clal digestion is removed by mung-bean nuclease.
  • the fragment so produced (fragment 1) is then ligated to fragment 2 (Chart 2) which comprises 2 complementary oligonucleotides chemically synthesized as set forth above and annealed together. Because fragment 2 can ligate to fragment 1 in two orientations, "the desired orientation in relation to the Shine-
  • the plasmids were transformed into competent E . coli strains, K12 (ATCC #e23716) and D112 (U.S. patent application S.N.
  • Samples were- taken from the induction cultures and analyzed by SDS-polyacrylamide gel electrophoresis. The gels were stained with Coomassie Blue and were scanned to determine the amount of visible BSt. The gels were also used for Western immunoblotting analysis. The results are set forth in Table 1. The values for low level expression are from immunoblotting analysis and the values for high level expression are from SDS-PAGE. Porcine and ovine somatotropins can be made in a similar fashion.
  • EXAMPLE 3 Construction of a Second Plasmid for BSt Expression having an A T-Rich Ribosome Binding Site
  • Plasmid pTrp2-BStm4 is constructed similarly to pAT-BStm4 (Example 1) except that the two complementary oligonucleotides used have the sticky end of Clal and therefore they are cloned into pTrp-
  • BStm4 treated with Hpal and Clal.
  • the difference between pTrp2-BStm4 and pAT-BStm4 is that the ribosome binding site in pTrp2-BStm4 is less A-T rich than in the ribosome binding site in pAT-BStm4 (see Chart 5) .
  • pTrp-conSD contains the promoter and operator sequence of the tryptophan biosynthetic pathway (trp promoter) of E. coli, a ribosome binding site sequence with
  • the ribosome binding site sequence is AAGTTCACGTAAGGAGGATATCGATAATG in pTrp-conSD and AAGTTCACGTTAT- TAAAAATTAAGGAGGTATATCGATAATG in pTrp2. The difference between these two sequences is that the ribosome binding site in pTrp2 is more A T- rich than in pTrp-conSD from which it is derived.
  • TNF a The gene coding for TNF a is purchased from British Bio-tech ⁇ nology Limited (Brook House, Watlington Road, Cowley, Oxford, 0X45LY, UK). This gene has several unique restriction endonuclease sites. A 590 bp SnaBI-BamHI fragment can be isolated from this gene which contains the mature TNF ⁇ sequence truncated for the first two codons. This fragment,, together with two complementary oligonucleo ⁇ tides to supply the first two codons, is cloned into the expression vectors pTrp-conSD and pTrp2.
  • fragments 5 and 6 are treated with Clal and BamHI to yield fragments 5 and 6, respectively.
  • Fragment 5 is ligated to fragments 7 (SnaBI-BamHI fragment containing the truncated TNF ⁇ gene) and 8 (oligonucleotides supplying the beginning of TNF ⁇ sequence and with Clal and SnaBI ends) to yield pTrp-conSD-TNF ⁇ .
  • fragment 6 is ligated with fragments 7 and 8 to yield pTrp2-TNF ⁇ .
  • Plasmids pTrp-conSD-TNF ⁇ and pTrp2-TNFo are transformed into E. coli strain JM103, induced for expression, and analyzed for expres ⁇ sion essentially as set forth in Example 2.
  • the level of TNF a expression from pTrp-conSD-TNF ⁇ and pTrp2-TNF ⁇ are about 5% and 30% of the total cell protein, respectively. Therefore, the A T-rich ribosome binding site increases TNF ⁇ expression.
  • pTrp-BSt * _4 is treated with Hpal, Clal and Mung-bean nuclease to obtain fragment 1.
  • fragment 4 Two complementary oligonucleotides are annealed (fragment 4) and ligated to fragment 3 to yield pTrp2 (4.6 kb) .
  • pTrp-conSD is treated with Clal and BamHI to yield fragment 5.
  • pTrp2 is treated with Clal and BamHI to yield fragment 6.
  • TNF ⁇ gene is treated with SnaBl and BamHI to isolate fragment 7 (460 bp) .
  • Fragments 5, 7 and 8 are ligated to yield pTrp-conSD-TNF ⁇ and fragments 6, 7 and 8 are ligated to yield pTrp2-TNF ⁇ .
  • pTrp-conSD-TNF ⁇ and pTrp2-TNF ⁇ (5.1 kb)
  • ribosome binding sites useful for expressing heterologous polypeptides are indicated to the left of the vertical lines.
  • sequences to the right of the vertical lines comprise part of the BSt genes.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US1989/000650 1988-03-11 1989-02-23 Ribosome binding site WO1989008708A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DK201090A DK201090D0 (da) 1988-03-11 1990-08-22 Rekombinant dna-molekyle samt ribosom-bindingssted indeholdt deri

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16688288A 1988-03-11 1988-03-11
US166,882 1988-03-11

Publications (1)

Publication Number Publication Date
WO1989008708A1 true WO1989008708A1 (en) 1989-09-21

Family

ID=22605061

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1989/000650 WO1989008708A1 (en) 1988-03-11 1989-02-23 Ribosome binding site

Country Status (5)

Country Link
EP (1) EP0404824A1 (de)
JP (1) JPH03503360A (de)
AU (1) AU3341089A (de)
DK (1) DK201090D0 (de)
WO (1) WO1989008708A1 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996006937A1 (en) * 1994-08-30 1996-03-07 The Austin Research Institute Improvements in production of proteins in host cells

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0111814A2 (de) * 1982-12-16 1984-06-27 Mgi Pharma, Inc. Klonierung und Expression von nucleotiden Sequenzen die für Rinderwachstumshormon kodieren
EP0173149A1 (de) * 1984-08-21 1986-03-05 Hoechst Aktiengesellschaft Synthetische Regulationsregion
EP0241446A2 (de) * 1986-03-27 1987-10-14 Monsanto Company Erhöhte Produktion von Proteinen in Bakterien durch Verwendung einer neuen Ribosombindungsstelle

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0111814A2 (de) * 1982-12-16 1984-06-27 Mgi Pharma, Inc. Klonierung und Expression von nucleotiden Sequenzen die für Rinderwachstumshormon kodieren
EP0173149A1 (de) * 1984-08-21 1986-03-05 Hoechst Aktiengesellschaft Synthetische Regulationsregion
EP0241446A2 (de) * 1986-03-27 1987-10-14 Monsanto Company Erhöhte Produktion von Proteinen in Bakterien durch Verwendung einer neuen Ribosombindungsstelle

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DNA, vol. 2, no. 3, 1983, Mary Ann Liebert Inc., Publishers, H.A. De Boer et al.: "Portable Shine-Dalgarno regions: a system for a systematic study of defined alterations of nucleotide sequences within E. coli robisome binding sites", pages 231-235 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996006937A1 (en) * 1994-08-30 1996-03-07 The Austin Research Institute Improvements in production of proteins in host cells

Also Published As

Publication number Publication date
EP0404824A1 (de) 1991-01-02
DK201090A (da) 1990-08-22
AU3341089A (en) 1989-10-05
DK201090D0 (da) 1990-08-22
JPH03503360A (ja) 1991-08-01

Similar Documents

Publication Publication Date Title
Brosius Toxicity of an overproduced foreign gene product in Escherichia coli and its use in plasmid vectors for the selection of transcription terminators
EP0136490B1 (de) DNS-Plasmide
EP0075444B1 (de) Verfahren und Produkte zur leichten mikrobiologischen Expression von DNS-Sequenzen
US4727028A (en) Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
EP0131843B1 (de) Expressionsvektoren zur erhöhten Produktion von Polypeptiden, diese Vektoren enthaltende Plasmide, diese Plasmide enthaltenden Wirte, durch die Vektoren hergestellte Produkte und entsprechende Verfahren
RU2072393C1 (ru) Способ получения рекомбинантного полипептида со свойствами свиного гормона роста
EP0077670A2 (de) Humanes Immuninterferon
EP0088622B1 (de) Tierische Interferone, Verfahren bei deren Herstellung, dieselben enthaltende Zusammensetzungen, kodierende DNS-Sequenzen hierfür und diese Sequenzen enthaltende Expressionsvektoren und dadurch transformierte Zellen
EP0211047B1 (de) Arab-promoter und verfahren zur herstellung von polypeptiden einschliesslich cecropinen mittels mikrobiologischer verfahren
EP0111389A2 (de) Wesentlich sauberes Schweinewachstumshormon, DNS-Sequenzen dafür und Expressionsvektoren und transfektierte Mikroorganismen zur Herstellung von Schweinewachstumshormon
US4795706A (en) Novel expression control sequences
EP0104061B1 (de) Expressionsvektoren
EP0147178B1 (de) Expressionsplasmide für die Herstellung eines heterologen Proteins in Bakterien
US6617130B1 (en) DNA construct for regulating the expression of a polypeptide coding sequence in a transformed bacterial host cell
US5268284A (en) Ribosome binding site
HU197937B (en) Process for producing new cloning carriers usable for the expression of polypeptides in microbiological host cells
JP2580303B2 (ja) 異種蛋白をコ−ド付けするcDNA類、発現ベクタ−類および宿主類
EP0218652B1 (de) Dns-sequenz
WO1989008708A1 (en) Ribosome binding site
US6054291A (en) Expression vectors for enhanced production of polypeptides, plasmids containing the vectors, hosts containing the plasmids, products manufactured thereby and related methods
US5827694A (en) DNA encoding non-human animal interferons, vectors and hosts therefor, and recombinant production of IFN polypeptides
Chew et al. Simultaneous regulation of plasmid replication and heterologous gene expression in Escherichia coli
US5527691A (en) Expression vectors containing lambdapl promoter and T1 T2 rRNA termination sequence, plasmids containing the vectors, hosts containing the plasmids and related methods
US5147789A (en) Stabilized expression vectors containing lambda pl promoter and the gene for the CI434 repressor, plasmids containing the vectors, hosts containing the plasmids and related methods
EP0295285B1 (de) Verfahren zur herstellung eines rinderwachstumshormons mittels eines kunstgens

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU DK FI HU JP KR NO SU US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1989904305

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1989904305

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1989904305

Country of ref document: EP