USRE46631E1

USRE46631E1 - Dengue tetravalent vaccine containing a common 30 nucleotide deletion in the 3′-UTR of dengue types 1,2,3, and 4, or antigenic chimeric dengue viruses 1,2,3, and 4

Info

Publication number: USRE46631E1
Application number: US13/896,384
Authority: US
Inventors: Stephen S. Whitehead; Brian R. Murphy; Lewis Markoff; Barry Falgout; Joseph E. Blaney; Kathryn A. Hanley; Ching-Juh Lai
Original assignee: US Department of Health and Human Services
Current assignee: US Department of Health and Human Services
Priority date: 2002-05-03
Filing date: 2013-05-17
Publication date: 2017-12-12
Also published as: US20180010099A1; WO2003092592A2; PT2338508T; CY1120558T1; US7517531B2; JP2005532044A; BRPI0309631B1; EP1554301A2; US20070009552A1; HUE037330T2; SI1554301T1; US20090258036A1; US20200392469A1; BRPI0309631A8; TR201806655T4; AU2003231185A1; EP3763382A1; ES2677348T3; US10837003B2; WO2003092592A3

Abstract

The invention relates to a dengue virus tetravalent vaccine containing a common 30 nucleotide deletion (Δ30) in the 3′-untranslated region of the genome of dengue virus serotypes 1, 2, 3, and 4, or antigenic chimeric dengue viruses of serotypes 1, 2, 3, and 4.

Description

RELATED APPLICATIONS

This application is a continuation and claims the benefit of priority of International Application No. PCT/US03/13279 filed Apr. 25, 2003, designating the United States of America and published in English on Nov. 13, 2003, as WO 03/092592, which claims the benefit of priority of U.S. Provisional Application No. 60/377,860 filed May 3, 2002 and U.S. Provisional Application No. 60/436,500 filed Dec. 23, 2002, all of which are hereby expressly incorporated by reference in their entireties.

FIELD OF THE INVENTION

The invention relates to a dengue virus tetravalent vaccine containing a common 30 nucleotide deletion (Δ30) in the 3′-untranslated region of the genome of

dengue virus serotypes

1, 2, 3, and 4, or antigenic chimeric dengue viruses of

serotypes

1, 2, 3, and 4.

BACKGROUND OF THE INVENTION

Dengue virus is a positive-sense RNA virus belonging to the Flavivirus genus of the family Flaviviridae. Dengue virus is widely distributed throughout the tropical and semitropical regions of the world and is transmitted to humans by mosquito vectors. Dengue virus is a leading cause of hospitalization and death in children in at least eight tropical Asian countries (WHO 1997 Dengue Haemorrhagic Fever: Diagnosis, Treatment, Prevention, and Control 2nd Edition, Geneva). There are four serotypes of dengue virus (DEN1, DEN2, DEN3, and DEN4) that annually cause an estimated 50-100 million cases of dengue fever and 500,000 cases of the more severe form of dengue virus infection known as dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS) (Gubler, D. J. and Meltzer, M. 1999 Adv Virus Res 53:35-70). This latter disease is seen predominantly in children and adults experiencing a second dengue virus infection with a serotype different than that of their first dengue virus infection and in primary infection of infants who still have circulating dengue-specific maternal antibody (Burke, D. S. et al. 1988 Am J Trop Med Hyg 38:172-180; Halstead, S. B. et al. 1969 Am J Trop Med Hyg 18:997-1021; Thein, S. et al. 1997 Am J Trop Med Hyg 56:566-575). A dengue vaccine is needed to lessen disease burden caused by dengue virus, but none is licensed. Because of the association of more severe disease with secondary dengue virus infection, a successful vaccine must simultaneously induce immunity to all four serotypes. Immunity is primarily mediated by neutralizing antibody directed against the envelope (E) glycoprotein, a virion structural protein. Infection with one serotype induces long-lived homotypic immunity and a short-lived heterotypic immunity (Sabin, A. 1955 Am J Trop Med Hyg 4:198-207). Therefore, the goal of immunization is to induce a long-lived neutralizing antibody response against DEN1, DEN2, DEN3, and DEN4, which can best be achieved economically using live attenuated virus vaccines. This is a reasonable goal since a live attenuated vaccine has already been developed for the related yellow fever virus, another mosquito-borne flavivirus present in tropical and semitropical regions of the world (Monath, T. P. and Heinz, F. X. 1996 in: Fields Virology, Fields, D. M et al. eds. Philadelphia: Lippincott-Raven Publishers, pp. 961-1034).

Several live attenuated dengue vaccine candidates have been developed and evaluated in humans and non-human primates. The first live attenuated dengue vaccine candidates were host range mutants developed by serial passage of wild-type dengue viruses in the brains of mice and selection of mutants attenuated for humans (Kimura, R. and Hotta, S. 1944 Jpn J Bacteriol 1:96-99; Sabin, A. B. and Schlesinger, R. W. 1945 Science 101:640; Wisserman, C. L. et al. 1963 Am J Trop Med Hyg 12:620-623). Although these candidate vaccine viruses were immunogenic in humans, their poor growth in cell culture discouraged further development. Additional live attenuated DEN1, DEN2, DEN3, and DEN4 vaccine candidates have been developed by serial passage in non-human tissue culture (Angsubhakorn, S. et al. 1994 Southeast Asian J Trop Med Public Health 25:554-559; Bancroft, W. H. et al. 1981 Infect Immun 31:698-703; Bhamarapravati, N. et al. 1987 Bull World Health Organ 65:189-195; Eckels, K. H. et al. 1984 Am J Trop Med Hyg 33:684-698; Hoke, C. H. Jr. et al. 1990 Am J Trop Med Hyg 43:219-226; Kanesa-Thasan, N. et al. 2001 Vaccine 19:3179-3188) or by chemical mutagenesis (McKee, K. T. et al. 1987 Am J Trop Med Hyg 36:435-442). It has proven very difficult to achieve a satisfactory balance between attenuation and immunogenicity for each of the four serotypes of dengue virus using these approaches and to formulate a tetravalent vaccine that is safe and satisfactorily immunogenic against each of the four dengue viruses (Kanesa-Thasan, N. et al. 2001 Vaccine 19:3179-3188; Bhamarapravati, N. and Sutee, Y. 2000 Vaccine 18:44-47).

Two major advances using recombinant DNA technology have recently made it possible to develop additional promising live attenuated dengue virus vaccine candidates. First, methods have been developed to recover infectious dengue virus from cells transfected with RNA transcripts derived from a full-length cDNA clone of the dengue virus genome, thus making it possible to derive infectious viruses bearing attenuating mutations that have been introduced into the cDNA clone by site-directed mutagenesis (Lai, C. J. et al. 1991 PNAS USA 88:5139-5143). Second, it is possible to produce antigenic chimeric viruses in which the structural protein coding region of the full-length cDNA clone of dengue virus is replaced by that of a different dengue virus serotype or from a more divergent flavivirus (Bray, M. and Lai, C. J. 1991 PNAS USA 88:10342-10346; Chen, W. et al. 1995 J Virol 69:5186-5190; Huang, C. Y. et al. 2000 J Virol 74:3020-3028; Pletnev, A. G. and Men, R. 1998 PNAS USA 95:1746-1751). These techniques have been used to construct intertypic chimeric dengue viruses that have been shown to be effective in protecting monkeys against homologous dengue virus challenge (Bray, M. et al. 1996 J Virol 70:4162-4166). A similar strategy is also being used to develop attenuated antigenic chimeric dengue virus vaccines based on the attenuation of the yellow fever vaccine virus or the attenuation of the cell-culture passaged dengue viruses (Monath, T. P. et al. 1999 Vaccine 17:1869-1882; Huang, C. Y. et al. 2000 J Virol 74:3020-3028).

Another study examined the level of attenuation for humans of a DEN4 mutant bearing a 30-nucleotide deletion (Δ30) introduced into its 3′-untranslated region by site-directed mutagenesis and that was found previously to be attenuated for rhesus monkeys (Men, R. et al. 1996 J Virol 70:3930-3937). Additional studies were carried out to examine whether this Δ30 mutation present in the DEN4 vaccine candidate was the major determinant of its attenuation for monkeys. It was found that the Δ30 mutation was indeed the major determinant of attenuation for monkeys, and that it specified a satisfactory balance between attenuation and immunogenicity for humans (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13).

SUMMARY OF THE INVENTION

The previously identified Δ30 attenuating mutation, created in dengue virus type 4 (DEN4) by the removal of 30 nucleotides from the 3′-UTR, is also capable of attenuating a wild-type strain of dengue virus type 1 (DEN1). Removal of 30 nucleotides from the DEN1 3′-UTR in a highly conserved region homologous to the DEN4 region encompassing the Δ30 mutation yielded a recombinant virus attenuated in rhesus monkeys to a level similar to recombinant virus DEN4Δ30. This establishes the transportability of the Δ30 mutation and its attenuation phenotype to a dengue virus type other than DEN4. The effective transferability of the Δ30 mutation, described by this work, establishes the usefulness of the Δ30 mutation to attenuate and improve the safety of commercializable dengue virus vaccines of any serotype. We envision a tetravalent dengue virus vaccine containing

dengue virus types

1, 2, 3, and 4 each attenuated by the Δ30 mutation. We also envision a tetravalent dengue virus vaccine containing recombinant antigenic chimeric viruses in which the structural genes of

dengue virus types

1, 2, and 3 replace those of DEN4Δ30; 1, 2, and 4 replace those of DEN3Δ30; 1, 3, and 4 replace those of DEN2Δ30; and 2, 3, and 4 replace those of DEN1Δ30. In some instances, such chimeric dengue viruses are attenuated not only by the Δ30 mutation, but also by their chimeric nature. The presence of the Δ30 attenuating mutation in each virus component precludes the reversion to a wild-type virus by intertypic recombination. In addition, because of the inherent genetic stability of deletion mutations, the Δ30 mutation represents an excellent alternative for use as a common mutation shared among each component of a tetravalent vaccine.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. The live attenuated tetravalent dengue virus vaccine contains dengue viruses representing each of the 4 serotypes, with each serotype containing its full set of unaltered wild-type structural and non-structural proteins and a shared Δ30 attenuating mutation. The relative location of the Δ30 mutation in the 3′ untranslated region (UTR) of each component is indicated by an arrow.

FIG. 2. A. The Δ30 mutation removes 30 contiguous nucleotides (shaded) from the 3′ UTR of DEN4. Nucleotides are numbered from the 3′ terminus. B. Nucleotide sequence alignment of the TL2 region of DEN1, DEN2, DEN3, and DEN4 and their Δ30 derivatives. Also shown is the corresponding region for each of the four DEN serotypes. Upper case letters indicate sequence homology among all 4 serotypes, underlining indicates nucleotide pairing to form the stem structure. C. Predicted secondary structure of the TL2 region of each DEN serotype. Nucleotides that are removed by the Δ30 mutation are boxed (DEN1—between nts 10562-10591, DEN2 Tonga/74—between nts 10541-10570, DEN3 Sleman/78—between nts 10535-10565, and DEN4—between nts 10478-10507).

FIG. 3. Viremia levels in rhesus monkeys inoculated with rDEN4 vaccine candidates bearing 5-FU derived mutations. Groups of four or two (rDEN4 and rDEN4Δ30) monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Serum was collected daily and virus titers were determined by plaque assay in Vero cells. The limit of virus detection was 0.7 log₁₀PFU/ml. Mean virus titers are indicated for each group.

FIG. 4. Viremia levels in rhesus monkeys inoculated with rDEN4 vaccine candidates bearing pairs of charge-to-alanine mutations in NS5. Groups of four or two (rDEN4 and rDEN4Δ30) monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Serum was collected daily and virus titers were determined by plaque assay in Vero cells. The limit of virus detection was 1.0 log₁₀PFU/ml. Mean virus titers are indicated for each group. Viremia was not detected in any monkey after day 4.

FIG. 5. The Δ30 mutation attenuates both DEN1 and DEN4 for rhesus monkeys. Groups of 4 monkeys were immunized subcutaneously with 5.0 log₁₀PFU of the indicated virus. Serum was collected each day following immunization and virus titers were determined and are shown as mean log₁₀PFU/ml.

FIG. 6. A. Diagram of the p2 (Tonga/74) full-length cDNA plasmid. Regions subcloned are indicated above the plasmid. Numbering begins at the 5′ end of the viral sequence. B. The Δ30 mutation removes the indicated 30 nucleotides from the 3′ UTR sequence to create p2Δ30.

FIG. 7. Viremia levels in rhesus monkeys inoculated with DEN2 (Tonga/74), rDEN2, and rDEN2Δ30 vaccine candidate. Groups of four monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Serum was collected daily and virus titers were determined by plaque assay in Vero cells. The limit of virus detection was 0.7 log₁₀PFU/ml. Mean virus titers are indicated for each group. Viremia was not detected in any monkey after day 8.

FIG. 8. A. Diagram of the p3 (Sleman/78) full-length cDNA plasmid. Regions subcloned are indicated above the plasmid. Numbering begins at the 5′ end of the viral sequence. The sequence and insertion location of the SpeI linker is shown. B. The Δ30 mutation removes the indicated 31 nucleotides from the 3′ UTR sequence to create p3Δ30.

FIG. 9. A. Recombinant chimeric dengue viruses were constructed by introducing either the CME or the ME regions of DEN2 (Tonga/74) into the DEN4 genetic background. The relative location of the Δ30 mutation in the 3′ UTR is indicated by an arrow and

intertypic junctions

1, 2, and 3 are indicated. B. Nucleotide and amino acid sequence of the intertypic junction regions. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated.

FIG. 10. Growth kinetics in Vero cells of chimeric rDEN2/4Δ30 viruses encoding single or combined Vero cell adaptation mutations. Vero cells were infected with the indicated viruses at an MOI of 0.01. At the indicated time points post-infection, 1 ml samples of tissue culture medium were removed, clarified by centrifugation, and frozen at −80° C. The level of virus replication was assayed by plaque titration in C6/36 cells. Lower limit of detection was 0.7 log₁₀PFU/ml. Replication levels on day 4 post-infection are indicated by the dashed line.

FIG. 11. A. Recombinant chimeric dengue viruses were constructed by introducing either the CME or the ME regions of DEN3 (Sleman/78) into the DEN4 genetic background. The relative location of the Δ30 mutation in the 3′ UTR is indicated by an arrow and

intertypic junctions

1, 2, and 3 are indicated. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated. B. Nucleotide and amino acid sequence of the intertypic junction regions. Restriction enzyme recognition sites used in assembly of each chimeric cDNA are indicated.

FIG. 12. A. Recombinant chimeric dengue viruses were constructed by introducing either the CME or the ME regions of DEN1 (Puerto Rico/94) into the DEN4 genetic background. The relative location of the Δ30 mutation in the 3′ UTR is indicated by an arrow and

intertypic junctions

Brief Description of the Sequences

	GenBank Accession
Serotype	No. or description

DEN1	U88535
DEN2	Tonga/74
DEN3	Sleman/78
DEN4	AF326825

Brief Description of the SEQ ID NOs

	Figure,
	Table, or	SEQ
Identification	Appendix	ID NO.

TL2 region of DEN1	FIG. 2C	1
TL2 region of DEN2	FIG. 2C	2
TL2 region of DEN3	FIG. 2C	3
TL2 region of DEN4	FIG. 2C	4
TL2 region of DEN1Δ30	FIG. 2B	5
TL2 region of DEN2Δ30	FIG. 2B	6
TL2 region of DEN3Δ30	FIG. 2B	7
TL2 region of DEN4Δ30	FIG. 2B	8
TL2 region of p2	FIG. 6B	9
TL2 region of p2Δ30	FIG. 6B	10
TL2 region of p3	FIG. 8B	11
TL2 region of p3Δ30	FIG. 8B	12
Spel linker in p3	FIG. 8A	13
rDEN2/4 junction 1	FIG. 9B	14-nt, 15-aa
rDEN2/4 junction 2	FIG. 9B	16-nt, 17-aa
rDEN2/4 junction 3	FIG. 9B	18-nt, 19-aa
rDEN3/4 junction 1	FIG. 11B	20-nt, 21-aa
rDEN3/4 junction 2	FIG. 11B	22-nt, 23-aa
rDEN3/4 junction 3	FIG. 11B	24-nt, 25-aa
rDEN1/4 junction 1	FIG. 12B	26-nt, 27-aa
rDEN1/4 junction 2	FIG. 12B	28-nt, 29-aa
rDEN1/4 junction 3	FIG. 12B	30-nt, 31-aa
D4 selected NS4B region	Table 15	32-nt, 33-aa
D1 selected NS4B region	Table 15	34-nt, 35-aa
D2 selected NS4B region	Table 15	36-nt, 37-aa
D3 selected NS4B region	Table 15	38-nt, 39-aa

CCACGGGCGCCGT	Table 26	40

AAGGCCTGGA	Table 26	41

TATCCCCGGGAC	Table 26	42

AGAGCTCTCTC	Table 26	43

GAATCTCCACCCGGA	Table 26	44

CTGTCGAATC	Table 26	45

DEN2 (Tonga/74)	Appendix 1	46-nt, 47-aa
cDNA plasmid p2
DEN3 (Sleman/78)	Appendix 2	48-nt, 49-aa
cDNA plasmid p3
DEN1 (Puerto Rico/94) CME	Appendix	3	50-nt, 51-aa
chimeric region
DEN1 (Puerto Rico/94) ME	Appendix	4	52-nt, 53-aa
chimeric region

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT Introduction

A molecular approach is herewith used to develop a genetically stable live attenuated tetravalent dengue virus vaccine. Each component of the tetravalent vaccine, namely, DEN1, DEN2, DEN3, and DEN4, must be attenuated, genetically stable, and immunogenic. A tetravalent vaccine is needed to ensure simultaneous protection against each of the four dengue viruses, thereby precluding the possibility of developing the more serious illnesses dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS), which occur in humans during secondary infection with a heterotypic wild-type dengue virus. Since dengue viruses can undergo genetic recombination in nature (Worobey, M. et al. 1999 PNAS USA 96:7352-7), the tetravalent vaccine should be genetically incapable of undergoing a recombination event between its four virus components that could lead to the generation of viruses lacking attenuating mutations. Previous approaches to develop a tetravalent dengue virus vaccine have been based on independently deriving each of the four virus components through separate mutagenic procedures, such as passage in tissue culture cells derived from a heterologous host. This strategy has yielded attenuated vaccine candidates (Bhamarapravati, N. and Sutee, Y. 2000 Vaccine 18:44-7). However, it is possible that gene exchanges among the four components of these independently derived tetravalent vaccines could occur in vaccinees, possibly creating a virulent recombinant virus. Virulent polioviruses derived from recombination have been generated in vaccinees following administration of a trivalent poliovirus vaccine (Guillot, S. et al. 2000 J Virol 74:8434-43).

The present invention describes: (1) improvements to the previously described rDEN4Δ30 vaccine candidate, 2) attenuated rDEN1Δ30, rDEN2Δ30, and rDEN3Δ30 recombinant viruses containing a 30 nucleotide deletion (Δ30) in a section of the 3′ untranslated region (UTR) that is homologous to that in the rDEN4Δ30 recombinant virus, (3) a method to generate a tetravalent dengue virus vaccine composed of rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, and rDEN4Δ30, 4) attenuated antigenic chimeric viruses, rDEN1/4Δ30, rDEN2/4Δ30, and rDEN3/4Δ30, for which the CME, ME, or E gene regions of rDEN4Δ30 have been replaced with those derived from DEN1, DEN2, or DEN3; alternatively rDEN1/3Δ30, rDEN2/3Δ30, and rDEN4/3Δ30 for which CME, ME, or E gene regions of rDEN3Δ30 have been replaced with those derived from DEN1, 2, or 4; alternatively rDEN1/2Δ30, rDEN3/2Δ30, and rDEN4/2Δ30 for which CME, ME, or E gene regions of rDEN2Δ30 have been replaced with those derived from DEN1, 3, or, 4; and alternatively rDEN2/1Δ30, rDEN3/1Δ30, and rDEN4/1Δ30 for which CME, ME, or E gene regions of rDEN1Δ30 have been replaced with those derived from DEN2, 3, or 4, and 5) a method to generate a tetravalent dengue virus vaccine composed of rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, and rDEN4Δ30, alternatively rDEN1/3Δ30, rDEN2/3Δ30, rDEN4/3Δ30, and rDEN3Δ30, alternatively rDEN1/2Δ30, rDEN3/2Δ30, rDEN4/2Δ30, and rDEN2Δ30, and alternatively rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30, and rDEN1Δ30. These tetravalent vaccines are unique since they contain a common shared attenuating mutation which eliminates the possibility of generating a virulent wild-type virus in a vaccinee since each component of the vaccine possesses the same Δ30 attenuating deletion mutation. In addition, the rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30 tetravalent vaccine is the first to combine the stability of the Δ30 mutation with broad antigenicity. Since the Δ30 deletion mutation is in the 3′ UTR of each virus, all of the proteins of the four component viruses are available to induce a protective immune response. Thus, the method provides a mechanism of attenuation that maintains each of the proteins of DEN1, DEN2, DEN3, and DEN4 viruses in a state that preserves the full capability of each of the proteins of the four viruses to induce humoral and cellular immune responses against all of the structural and non-structural proteins present in each dengue virus serotype.

As previously described, the DEN4 recombinant virus, rDEN4Δ30 (previously referred to as 2AΔ30), was engineered to contain a 30 nucleotide deletion in the 3′UTR of the viral genome (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13; Men, R. et al. 1996 J Virol 70:3930-7). Evaluation in rhesus monkeys showed the virus to be significantly attenuated relative to wild-type parental virus, yet highly immunogenic and completely protective. Also, a phase I clinical trial with adult human volunteers showed the rDEN4Δ30 recombinant virus to be safe and satisfactorily immunogenic (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). To develop a tetravalent vaccine bearing a shared attenuating mutation in a untranslated region, we selected the Δ30 mutation to attenuate wild-type dengue viruses of

serotypes

1, 2, and 3 since it attenuated wild-type DEN4 virus for rhesus monkeys and was safe in humans (FIG. 1).

The Δ30 mutation was first described and characterized in the DEN4 virus (Men, R. et al. 1996 J Virol 70:3930-7). In DEN4, the mutation consists of the removal of 30 contiguous nucleotides comprising nucleotides 10478-10507 of the 3′ UTR (FIG. 2A) which form a putative stem-loop structure referred to as TL2 (Proutski, V. et al. 1997 Nucleic Acids Res 25:1194-202). Among the flaviviruses, large portions of the UTR form highly conserved secondary structures (Hahn, C. S. et al. 1987 J Mol Biol 198:33-41; Proutski, V. et al. 1997 Nucleic Acids Res 25:1194-202). Although the individual nucleotides are not necessarily conserved in these regions, appropriate base pairing preserves the stem-loop structure in each serotype, a fact that is not readily apparent when only considering the primary sequence (FIG. 2B, C).

Immunogenic Dengue Chimeras and Methods for their Preparation

Immunogenic dengue chimeras and methods for preparing the dengue chimeras are provided herein. The immunogenic dengue chimeras are useful, alone or in combination, in a pharmaceutically acceptable carrier as immunogenic compositions to minimize, inhibit, or immunize individuals and animals against infection by dengue virus.

Chimeras of the present invention comprise nucleotide sequences encoding the immunogenicity of a dengue virus of one serotype and further nucleotide sequences selected from the backbone of a dengue virus of a different serotype. These chimeras can be used to induce an immunogenic response against dengue virus.

In another embodiment, the preferred chimera is a nucleic acid chimera comprising a first nucleotide sequence encoding at least one structural protein from a dengue virus of a first serotype, and a second nucleotide sequence encoding non-structural proteins from a dengue virus of a second serotype different from the first. In another embodiment the dengue virus of the second serotype is DEN4. In another embodiment, the structural protein can be the C protein of a dengue virus of the first serotype, the prM protein of a dengue virus of the first serotype, the E protein of a dengue virus of the first serotype, or any combination thereof.

The term “residue” is used herein to refer to an amino acid (D or L) or an amino acid mimetic that is incorporated into a peptide by an amide bond. As such, the amino acid may be a naturally occurring amino acid or, unless otherwise limited, may encompass known analogs of natural amino acids that function in a manner similar to the naturally occurring amino acids (i.e., amino acid mimetics). Moreover, an amide bond mimetic includes peptide backbone modifications well known to those skilled in the art.

Furthermore, one of skill in the art will recognize that individual substitutions, deletions or additions in the amino acid sequence, or in the nucleotide sequence encoding for the amino acids, which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an encoded sequence are conservatively modified variations, wherein the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:

- 1) Alanine (A), Serine (S), Threonine (T);
- 2) Aspartic acid (D), Glutamic acid (E);
- 3) Asparagine (N), Glutamine (Q);
- 4) Arginine (R), Lysine (K);
- 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
- 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

As used herein, the terms “virus chimera,” “chimeric virus,” “dengue chimera” and “chimeric dengue virus” means an infectious construct of the invention comprising nucleotide sequences encoding the immunogenicity of a dengue virus of one serotype and further nucleotide sequences derived from the backbone of a dengue virus of a different serotype.

As used herein, “infectious construct” indicates a virus, a viral construct, a viral chimera, a nucleic acid derived from a virus or any portion thereof, which may be used to infect a cell.

As used herein, “nucleic acid chimera” means a construct of the invention comprising nucleic acid comprising nucleotide sequences encoding the immunogenicity of a dengue virus of one serotype and further nucleotide sequences derived from the backbone of a dengue virus of a different serotype. Correspondingly, any chimeric virus or virus chimera of the invention is to be recognized as an example of a nucleic acid chimera.

The structural and nonstructural proteins of the invention are to be understood to include any protein comprising or any gene encoding the sequence of the complete protein, an epitope of the protein, or any fragment comprising, for example, three or more amino acid residues thereof.

Dengue Chimeras

Dengue virus is a mosquito-borne flavivirus pathogen. The dengue virus genome contains a 5′ untranslated region (5′ UTR), followed by a capsid protein (C) encoding region, followed by a premembrane/membrane protein (prM) encoding region, followed by an envelope protein (E) encoding region, followed by the region encoding the nonstructural proteins (NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5) and finally a 3′ untranslated region (3′ UTR). The viral structural proteins are C, prM and E, and the nonstructural proteins are NS1-NS5. The structural and nonstructural proteins are translated as a single polyprotein and processed by cellular and viral proteases.

The dengue chimeras of the invention are constructs formed by fusing structural protein genes from a dengue virus of one serotype, e.g. DEN1, DEN2, DEN3, or DEN4, with non-structural protein genes from a dengue virus of a different serotype, e.g., DEN1, DEN2, DEN3, or DEN4.

The attenuated, immunogenic dengue chimeras provided herein contain one or more of the structural protein genes, or antigenic portions thereof, of the dengue virus of one serotype against which immunogenicity is to be conferred, and the nonstructural protein genes of a dengue virus of a different serotype.

The chimera of the invention contains a dengue virus genome of one serotype as the backbone, in which the structural protein gene(s) encoding C, prM, or E protein(s) of the dengue genome, or combinations thereof, are replaced with the corresponding structural protein gene(s) from a dengue virus of a different serotype that is to be protected against. The resulting viral chimera has the properties, by virtue of being chimerized with a dengue virus of another serotype, of attenuation and is therefore reduced in virulence, but expresses antigenic epitopes of the structural gene products and is therefore immunogenic.

The genome of any dengue virus can be used as the backbone in the attenuated chimeras described herein. The backbone can contain mutations that contribute to the attenuation phenotype of the dengue virus or that facilitate replication in the cell substrate used for manufacture, e.g., Vero cells. The mutations can be in the nucleotide sequence encoding non-structural proteins, the 5′ untranslated region or the 3′ untranslated region. The backbone can also contain further mutations to maintain the stability of the attenuation phenotype and to reduce the possibility that the attenuated virus or chimera might revert back to the virulent wild-type virus. For example, a first mutation in the 3′ untranslated region and a second mutation in the 5′ untranslated region will provide additional attenuation phenotype stability, if desired. In particular, a mutation that is a deletion of 30 nts from the 3′ untranslated region of the DEN4 genome between nts 10478-10507 results in attenuation of the DEN4 virus (Men et al. 1996 J. Virology 70:3930-3933; Durbin et al. 2001 Am J Trop Med 65:405-413, 2001). Therefore, the genome of any dengue type 4 virus containing such a mutation at this locus can be used as the backbone in the attenuated chimeras described herein. Furthermore, other dengue virus genomes containing an analogous deletion mutation in the 3′ untranslated region of the genomes of other dengue virus serotypes may also be used as the backbone structure of this invention.

Such mutations may be achieved by site-directed mutagenesis using techniques known to those skilled in the art. It will be understood by those skilled in the art that the virulence screening assays, as described herein and as are well known in the art, can be used to distinguish between virulent and attenuated backbone structures.

Construction of Dengue Chimeras

The dengue virus chimeras described herein can be produced by substituting at least one of the structural protein genes of the dengue virus of one serotype against which immunity is desired into a dengue virus genome backbone of a different serotype, using recombinant engineering techniques well known to those skilled in the art, namely, removing a designated dengue virus gene of one serotype and replacing it with the desired corresponding gene of dengue virus of a different serotype. Alternatively, using the sequences provided in GenBank, the nucleic acid molecules encoding the dengue proteins may be synthesized using known nucleic acid synthesis techniques and inserted into an appropriate vector. Attenuated, immunogenic virus is therefore produced using recombinant engineering techniques known to those skilled in the art.

As mentioned above, the gene to be inserted into the backbone encodes a dengue structural protein of one serotype. Preferably the dengue gene of a different serotype to be inserted is a gene encoding a C protein, a prM protein and/or an E protein. The sequence inserted into the dengue virus backbone can encode both the prM and E structural proteins of the other serotype. The sequence inserted into the dengue virus backbone can encode the C, prM and E structural proteins of the other serotype. The dengue virus backbone is the DEN1, DEN2, DEN3, or DEN4 virus genome, or an attenuated dengue virus genome of any of these serotypes, and includes the substituted gene(s) that encode the C, prM and/or E structural protein(s) of a dengue virus of a different serotype, or the substituted gene(s) that encode the prM and/or E structural protein(s) of a dengue virus of a different serotype.

Suitable chimeric viruses or nucleic acid chimeras containing nucleotide sequences encoding structural proteins of dengue virus of any of the serotypes can be evaluated for usefulness as vaccines by screening them for phenotypic markers of attenuation that indicate reduction in virulence with retention of immunogenicity. Antigenicity and immunogenicity can be evaluated using in vitro or in vivo reactivity with dengue antibodies or immunoreactive serum using routine screening procedures known to those skilled in the art.

Dengue Vaccines

The preferred chimeric viruses and nucleic acid chimeras provide live, attenuated viruses useful as immunogens or vaccines. In a preferred embodiment, the chimeras exhibit high immunogenicity while at the same time not producing dangerous pathogenic or lethal effects.

The chimeric viruses or nucleic acid chimeras of this invention can comprise the structural genes of a dengue virus of one serotype in a wild-type or an attenuated dengue virus backbone of a different serotype. For example, the chimera may express the structural protein genes of a dengue virus of one serotype in either of a dengue virus or an attenuated dengue virus background of a different serotype.

The strategy described herein of using a genetic background that contains nonstructural regions of a dengue virus genome of one serotype, and, by chimerization, the properties of attenuation, to express the structural protein genes of a dengue virus of a different serotype has lead to the development of live, attenuated dengue vaccine candidates that express structural protein genes of desired immunogenicity. Thus, vaccine candidates for control of dengue pathogens can be designed.

Viruses used in the chimeras described herein are typically grown using techniques known in the art. Virus plaque or focus forming unit (FFU) titrations are then performed and plaques or FFU are counted in order to assess the viability, titer and phenotypic characteristics of the virus grown in cell culture. Wild type viruses are mutagenized to derive attenuated candidate starting materials.

Chimeric infectious clones are constructed from various dengue serotypes. The cloning of virus-specific cDNA fragments can also be accomplished, if desired. The cDNA fragments containing the structural protein or nonstructural protein genes are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) from dengue RNA with various primers. Amplified fragments are cloned into the cleavage sites of other intermediate clones. Intermediate, chimeric dengue clones are then sequenced to verify the sequence of the inserted dengue-specific cDNA.

Full genome-length chimeric plasmids constructed by inserting the structural or nonstructural protein gene region of dengue viruses into vectors are obtainable using recombinant techniques well known to those skilled in the art.

Methods of Administration

The viral chimeras described herein are individually or jointly combined with a pharmaceutically acceptable carrier or vehicle for administration as an immunogen or vaccine to humans or animals. The terms “pharmaceutically acceptable carrier” or “pharmaceutically acceptable vehicle” are used herein to mean any composition or compound including, but not limited to, water or saline, a gel, salve, solvent, diluent, fluid ointment base, liposome, micelle, giant micelle, and the like, which is suitable for use in contact with living animal or human tissue without causing adverse physiological responses, and which does not interact with the other components of the composition in a deleterious manner.

The immunogenic or vaccine formulations may be conveniently presented in viral plaque forming unit (PFU) unit or focus forming unit (FFU) dosage form and prepared by using conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.

Preferred unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients particularly mentioned above, the formulations of the present invention may include other agents commonly used by one of ordinary skill in the art.

The immunogenic or vaccine composition may be administered through different routes, such as oral or parenteral, including, but not limited to, buccal and sublingual, rectal, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. The composition may be administered in different forms, including, but not limited to, solutions, emulsions and suspensions, microspheres, particles, microparticles, nano-particles and liposomes. It is expected that from about 1 to about 5 doses may be required per immunization schedule. Initial doses may range from about 100 to about 100,000 PFU or FFU, with a preferred dosage range of about 500 to about 20,000 PFU or FFU, a more preferred dosage range of from about 1000 to about 12,000 PFU or FFU and a most preferred dosage range of about 1000 to about 4000 PFU or FFU. Booster injections may range in dosage from about 100 to about 20,000 PFU or FFU, with a preferred dosage range of about 500 to about 15,000, a more preferred dosage range of about 500 to about 10,000 PFU or FFU, and a most preferred dosage range of about 1000 to about 5000 PFU or FFU. For example, the volume of administration will vary depending on the route of administration. Intramuscular injections may range in volume from about 0.1 ml to 1.0 ml.

The composition may be stored at temperatures of from about −100° C. to about 4° C. The composition may also be stored in a lyophilized state at different temperatures including room temperature. The composition may be sterilized through conventional means known to one of ordinary skill in the art. Such means include, but are not limited to, filtration. The composition may also be combined with bacteriostatic agents to inhibit bacterial growth.

Administration Schedule

The immunogenic or vaccine composition described herein may be administered to humans, especially individuals travelling to regions where dengue virus infection is present, and also to inhabitants of those regions. The optimal time for administration of the composition is about one to three months before the initial exposure to the dengue virus. However, the composition may also be administered after initial infection to ameliorate disease progression, or after initial infection to treat the disease.

Adjuvants

A variety of adjuvants known to one of ordinary skill in the art may be administered in conjunction with the chimeric virus in the immunogen or vaccine composition of this invention. Such adjuvants include, but are not limited to, the following: polymers, co-polymers such as polyoxyethylene-polyoxypropylene copolymers, including block co-polymers, polymer p 1005, Freund's complete adjuvant (for animals), Freund's incomplete adjuvant; sorbitan monooleate, squalene, CRL-8300 adjuvant, alum, QS 21, muramyl dipeptide, CpG oligonucleotide motifs and combinations of CpG oligonucleotide motifs, trehalose, bacterial extracts, including mycobacterial extracts, detoxified endotoxins, membrane lipids, or combinations thereof.

Nucleic Acid Sequences

Nucleic acid sequences of dengue virus of one serotype and dengue virus of a different serotype are useful for designing nucleic acid probes and primers for the detection of dengue virus chimeras in a sample or specimen with high sensitivity and specificity. Probes or primers corresponding to dengue virus can be used to detect the presence of a vaccine virus. The nucleic acid and corresponding amino acid sequences are useful as laboratory tools to study the organisms and diseases and to develop therapies and treatments for the diseases.

Nucleic acid probes and primers selectively hybridize with nucleic acid molecules encoding dengue virus or complementary sequences thereof. By “selective” or “selectively” is meant a sequence which does not hybridize with other nucleic acids to prevent adequate detection of the dengue virus sequence. Therefore, in the design of hybridizing nucleic acids, selectivity will depend upon the other components present in the sample. The hybridizing nucleic acid should have at least 70% complementarity with the segment of the nucleic acid to which it hybridizes. As used herein to describe nucleic acids, the term “selectively hybridizes” excludes the occasional randomly hybridizing nucleic acids, and thus has the same meaning as “specifically hybridizing.” The selectively hybridizing nucleic acid probes and primers of this invention can have at least 70%, 80%, 85%, 90%, 95%, 97%, 98% and 99% complementarity with the segment of the sequence to which it hybridizes, preferably 85% or more.

The present invention also contemplates sequences, probes and primers that selectively hybridize to the encoding nucleic acid or the complementary, or opposite, strand of the nucleic acid. Specific hybridization with nucleic acid can occur with minor modifications or substitutions in the nucleic acid, so long as functional species-species hybridization capability is maintained. By “probe” or “primer” is meant nucleic acid sequences that can be used as probes or primers for selective hybridization with complementary nucleic acid sequences for their detection or amplification, which probes or primers can vary in length from about 5 to 100 nucleotides, or preferably from about 10 to 50 nucleotides, or most preferably about 18-24 nucleotides. Isolated nucleic acids are provided herein that selectively hybridize with the species-specific nucleic acids under stringent conditions and should have at least five nucleotides complementary to the sequence of interest as described in Molecular Cloning: A Laboratory Manual, 2nd ed., Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989.

If used as primers, the composition preferably includes at least two nucleic acid molecules which hybridize to different regions of the target molecule so as to amplify a desired region. Depending on the length of the probe or primer, the target region can range between 70% complementary bases and full complementarity and still hybridize under stringent conditions. For example, for the purpose of detecting the presence of dengue virus, the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes is at least enough to distinguish hybridization with a nucleic acid from other organisms.

The nucleic acid sequences encoding dengue virus can be inserted into a vector, such as a plasmid, and recombinantly expressed in a living organism to produce recombinant dengue virus peptide and/or polypeptides.

The nucleic acid sequences of the invention include a diagnostic probe that serves to report the detection of a cDNA amplicon amplified from the viral genomic RNA template by using a reverse-transcription/polymerase chain reaction (RT/PCR), as well as forward and reverse amplimers that are designed to amplify the cDNA amplicon. In certain instances, one of the amplimers is designed to contain a vaccine virus-specific mutation at the 3′-terminal end of the amplimer, which effectively makes the test even more specific for the vaccine strain because extension of the primer at the target site, and consequently amplification, will occur only if the viral RNA template contains that specific mutation.

Automated PCR-based nucleic acid sequence detection systems have been recently developed. TaqMan assay (Applied Biosystems) is widely used. A more recently developed strategy for diagnostic genetic testing makes use of molecular beacons (Tyagi and Kramer, 1996 Nature Biotechnology 14:303-308). Molecular beacon assays employ quencher and reporter dyes that differ from those used in the TaqMan assay. These and other detection systems may used by one skilled in is the art.

EXAMPLE 1 Improvement of Dengue Virus Vaccine Candidate rDEN4Δ30

The safety of recombinant live-attenuated dengue-4 vaccine candidate rDEN4Δ30 was evaluated in twenty human volunteers who received a dose of 5.0 log₁₀plaque forming units (PFU) (Durbin A. P. et al. 2001 Am J Trop Med Hyg 65:405-413). The vaccine candidate was found to be safe, well-tolerated and immunogenic in all of the vaccinees. However, five of the vaccinees experienced a transient elevation in alanine aminotransferase levels, three experienced neutropenia and ten vaccinees developed an asymptomatic macular rash, suggesting that it may be necessary to further attenuate this vaccine candidate.

Currently, a randomized, double-blind, placebo-controlled, dose de-escalation study is being conducted to determine the human infectious dose 50 (HID₅₀) of rDEN4Δ30. Each dose cohort consists of approximately twenty vaccinees and four placebo recipients. To date, complete data for doses of 3.0 log₁₀PFU and 2.0 log₁₀PFU has been collected. rDEN4Δ30 infected 100% of vaccinees when 3.0 log₁₀PFU was administered and 95% of vaccinees when 2.0 log₁₀PFU was administered (Table 1). The vaccine candidate caused no symptomatic illness at either dose (Table 1). One vaccinee who received 3.0 log₁₀PFU experienced a transient elevation in alanine aminotransferase levels and approximately one fourth of the vaccinees experienced neutropenia at both doses (Table 1). Neutropenia was transient and mild. More than half of the vaccinees developed a macular rash at both doses; the occurrence of rash was not correlated with vaccination dose or with viremia (Table 1 and Table 2). Neither peak titer nor onset of viremia differed between the 3.0 log₁₀PFU and 2.0 log₁₀PFU doses, though both measures of viremia were significantly lower for these doses than for a dose of 5.0 log₁₀PFU (Table 3). The vaccine candidate was immunogenic in 95% of vaccinees at both doses and neutralizing antibody did not decline between days 28 and 42 post-vaccination (Table 4). Although the HID₅₀has not been determined yet, it is clearly less than 2.0 log₁₀PFU. Interestingly, decreases in the dose of vaccine have had no consistent effect on immunogenicity, viremia, benign neutropenia or the occurrence of rash. Thus will not necessarily be possible to further attenuate rDEN4Δ30 by decreasing the dose of virus administered, and other approaches must be developed.

TABLE 1

rDEN4Δ30 clinical summary

No.

Mean

No. volunteers with:

No. of		in-	with	peak			Neutro-
subjects	Dose^a	fected	viremia	titer^b	Fever	Rash	penia^c	↑ALT

20	5.0	20	14	1.2 (0.2)	1^d	10	3	5
20	3.0	20	7	0.4 (0.0)	0	11	5	1^e
20	2.0	19	11	0.6 (0.1)	1^d	16	4	0
8	0	0	0	0	0	0	0	0

^aLog₁₀pfu
^bLog₁₀pfu/mL
^cNeutropenia defined as ANC < 1500/dl
^dT Max in volunteer = 100.4° F.
^eALT day 0 = 78, ALT max = 91 (day 14)

TABLE 2

Pattern of rash in vaccinees

	No.	No.				Mean
	with	with	Viremia	Viremia	Mean day of	duration
Dose^a	viremia	rash	& rash	no rash	onset ± SD	(days ± SD)

5	14/20	10/20	9/20	5/20	8.1 ± 1.3 [A]^a	3.6 ± 2.0 [A]
3	7/20	11/20	6/20	1/20	12.2 ± 1.4 [B]	5.0 ± 2.1 [A]
2	11/20	16/20	9/20	2/20	11.2 ± 1.4 [B]	6.9 ± 1.7 [B]

^alog₁₀pfu
^bMeans in each column with different letters are significantly different (α = 0.05)

TABLE 3

rDEN4Δ30 viremia summary

			Mean onset of	Mean duration
	# with	Mean peak titer	viremia	of viremia
Dose^a	viremia	(log₁₀pfu/mL)	(day ± SD)	(day ± SD)

5	14	1.2 ± 0.2 [A]	5.8 ± 2.4 [A]^b	4.4 ± 2.4 [A]
3	7	0.4 ± 0.0 [B]	9.1 ± 2.5 [B]	1.6 ± 1.0 [B]
2	11	0.6 ± 0.1 [B]	8.7 ± 2.4 [B]	2.6 ± 2.0 [A]

^alog₁₀pfu
^bMeans in each column with different letters are significantly different (α = 0.05)

TABLE 4

Immunogenicity of rDEN4Δ30

			Geometric mean
			serum neutralizing	%
No. of	Dose	No.	antibody titer (range)	serocon-

subjects	(log₁₀)	infected	Day 28	Day 42	version

20	5.0	20	567 (72-2455)	399 (45-1230)	100
20	3.0	20	156 (5-2365)	158 (25-1222)	95
20	2.0	19	163 (5-943)	165 (5-764)	95
8	0	0	0	0	0

Two approaches have been taken to further attenuate rDEN4Δ30. This first is the generation and characterization of attenuating point mutations in rDEN4 using 5′ fluorouracil mutagenesis (Blaney, J. E. Jr. et al. 2002 Virology 300: 125-139; Blaney, J. E. Jr. et al. 2001 J. Virol. 75: 9731-9740). This approach has identified a panel of point mutations that confer a range of temperature sensitivity (ts) and small plaque (sp) phenotypes in Vero and HuH-7 cells and attenuation (att) phenotypes in suckling mouse brain and SCID mice engrafted with HuH-7 cells (SCID-HuH-7 mice). In this example, a subset of these mutations has been introduced to rDEN4Δ30 and the phenotypes of the resulting viruses evaluated.

A second approach was to create a series of paired charge-to-alanine mutations in contiguous pairs of charged amino acid residues in the rDEN4 NS5 gene. As demonstrated previously, mutation of 32 individual contiguous pairs of charged amino acid residues in rDEN4 NS5 conferred a range of ts phenotypes in Vero and HuH-7 cells and a range of att phenotypes in suckling mouse brain (Hanley, K. H. et al. 2002 J. Virol. 76 525-531). As demonstrated below, these mutations also confer an att phenotype in SCID-HuH-7 mice. These mutations have been introduced, either as single pairs or sets of two pairs, into rDEN4Δ30 to determine whether they are compatible with the Δ30 mutation and whether they enhance the att phenotypes of rDEN4Δ30.

A panel of rDEN4 viruses bearing individual point mutations have been characterized which possess temperature sensitive and/or small plaque phenotypes in tissue culture and varying levels of attenuated replication in suckling mouse brain when compared to wild type rDEN4 virus (Blaney, J. E. et al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). Three mutations have been selected to combine with the Δ30 deletion mutation to evaluate their ability to further restrict replication of rDEN4Δ30 in rhesus monkeys. First, the missense mutation in NS3 at nucleotide 4995 (Ser>Pro) which confers temperature sensitivity in Vero and HuH-7 cells and restricted replication in suckling mouse brain was previously combined with the Δ30 mutation (Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). The resulting virus, rDEN4Δ30-4995, was found to be more restricted (1,000-fold) in mouse brain replication than rDEN4Δ30 virus (<5-fold) when compared to wild type rDEN4 virus. Second, a missense mutation at nucleotide 8092 (Glu>Gly) which also confers temperature sensitivity in Vero and HuH-7 cells and 10,000-fold restricted replication in suckling mouse brain was combined with the Δ30 mutation here. Third, a substitution in the 3′ UTR at nucleotide 10634 which confers temperature sensitivity in Vero and HuH-7 cells, small plaque size in HuH-7 cells, and approximately 1,000-fold restricted replication in suckling mouse brain and SCID mice transplanted with HuH-7 cells was combined with the Δ30 mutation here (Blaney, J. E. et al. 2002 Virology 300:125-139).

For the present investigation, subcloned fragments of p4 (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13) containing the above mutations were introduced into the p4Δ30 cDNA clone. For transcription and recovery of virus, cDNA was linearized with Acc65I (isoschizomer of KpnI which cleaves leaving only a single 3′ nucleotide) and used as template for transcription by SP6 RNA polymerase as previously described (Blaney, J. E. et al. 2002 Virology 300:125-139). C6/36 mosquito cells were transfected using liposome-mediated transfection and cell culture supernatants were harvested between days five and seven. Recovered virus was terminally diluted twice in Vero cells and passaged two (rDEN4Δ30-4995) or three (rDEN4Δ30-8092 and rDEN4Δ30-10634) times in Vero cells.

The complete genomic sequences of rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses were determined as previously described (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413). As expected, each rDEN4Δ30 virus derivative contained the Δ30 mutation. Unexpectedly, in rDEN4Δ30-4995 virus, the nucleotide changes in the codon containing nucleotide 4995, resulted in a Ser>Leu amino acid change rather than a Ser>Pro change since the p4Δ30-4995 cDNA was designed to introduce the Ser>Pro change (Table 5). The p4Δ30-4995 cDNA clone was indeed found to encode a Ser>Pro change at nucleotide 4995, so it is unclear how the virus population acquired the Ser>Leu mutation. Nevertheless, this virus was evaluated to assess the phenotype specified by this missense mutation. rDEN4Δ30-4995 virus was also found to contain an incidental mutation at nucleotides 4725-6 which resulted in a single amino acid change (Ser>Asp). The rDEN4Δ30-8092 and rDEN4Δ30-10634 viruses contained the appropriate nucleotide substitutions as well as additional incidental mutations in E, NS4B and NS4B, respectively (Table 5).

TABLE 5

Missense and UTR mutations present in rDEN4Δ30 virus
derivatives bearing introduced point mutations.

				Amino	Amino
		Nucleotide	Nucleotide	acid	acid
Virus	Gene	position	substitution	position^a	change

rDEN4Δ30-	NS3	4725	U > G	1542	Ser > Asp
4995	NS3	4726	C > A	1542	Ser > Asp
	NS3	4995^b	U > C	1632	Ser > Leu
rDEN4Δ30-	E	1612	A > C	504	Asp > Ala
8092	NS4B	7131	A > G	2344	Thr > Ala
	NS5	8092^b	A > G	2664	Glu > Gly
rDEN4Δ30-	NS4B	6969	A > U	2290	Met > Leu
10634	NS4B	7182	G > C	2361	Gly > Arg
	3′ UTR	10634^b	U > C	none	none

^aAmino acid position in DEN4 polyprotein beginning with the methionine residue of the C protein (nucleotides 102-104) as position 1.
^bMutation restricts replication in mouse models of DEN4 infection which were introduced by Kunkel mutagenesis.

Replication of the three modified rDEN4Δ30 viruses were compared to rDEN4Δ30 and wild type rDEN4 virus in the suckling mouse brain model and SCID mice transplanted with HuH-7 cells (SCID-HuH-7 mice). Experiments were conducted as previously described (Blaney, J. E. et al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). Briefly, for infection of suckling mouse brain, groups of six seven-day-old mice were inoculated intracerebrally with 4.0 log₁₀PFU of virus and the brain of each mouse was removed five days later. Clarified supernatants of 10% brain suspensions were then frozen at −70° C., and the virus titer was determined by plaque assay in Vero cells. For analysis of DEN4 virus replication in SCID-HuH-7 mice, four to six week-old SCID mice were injected intraperitoneally with 10⁷HuH-7 cells. Five to six weeks after transplantation, mice were infected by direct inoculation into the tumor with 4.0 log₁₀PFU of virus, and serum for virus titration was obtained by tail-nicking on day 7. The virus titer was determined by plaque assay in Vero cells.

Wild type rDEN4 virus replicated to 6.0 log₁₀PFU/g in suckling mouse brain, and rDEN4Δ30 was restricted in replication by 0.7 log₁₀PFU/g, which is similar to previous observations (Table 6) (Blaney, J. E. et al. 2001 J Virol. 75:9731-9740). rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses were found to have restricted replication in suckling mouse brain when compared to rDEN4 virus of 3.3, 2.8, and 2.4 log₁₀PFU/g, respectively. These results indicate that the additional attenuating mutations serve to further restrict replication of the rDEN4Δ30 virus in mouse brain ranging from 50-fold (rDEN4Δ30-10634) to 400-fold (rDEN4Δ30-4995). In SCID-HuH-7 mice, virus titer of rDEN4Δ30 virus was 0.4 log₁₀PFU/ml lower than rDEN4 virus, which is also similar to previous studies (Blaney, J. E. et al. 2002 Virology 300:125-139). Each modified rDEN4Δ30 virus was found to be further restricted in replication in SCID-HuH-7 mice (Table 6). rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses had restricted replication in SCID-HuH-7 mice when compared to rDEN4 virus of 2.9, 1.1, and 2.3 log₁₀PFU/g below the level of wild type rDEN4 virus, respectively. Two important observations were made: (1) The 4995, 8092 and 10634 mutations were compatible for viability with the Δ30 mutation, and (2) These three modified rDEN4Δ30 viruses had between a 10 and 1,000-fold reduction in replication in comparison to rDEN4 wild-type virus, which allows viruses with a wide range of attenuation in this model to be further evaluated in monkeys or humans.

TABLE 6

Addition of point mutations in NS3, NS5, or the 3′ UTR to
rDEN4Δ30 virus further attenuates the virus for suckling
mouse brain and SCID-HuH-7 mice.

	Replication in suckling	Replication in
	mouse brain^a	SCID-HuH-7 mice^c

		Virus	Mean		Virus	Mean
		titer ± SE	log₁₀-unit		titer ± SE	log₁₀-unit
	No. of	log₁₀PFU/g	reduction	No. of	log₁₀PFU/ml	reduction
Virus	mice	brain	from wt^b	mice	serum	from wt^b

rDEN4	12	6.0 ± 0.1	—	13	6.4 ± 0.2	—
rDEN4Δ30	12	5.3 ± 0.1	0.7	20	6.0 ± 0.2	0.4
rDEN4Δ30-4995	6	2.7 ± 0.4	3.3	5	3.5 ± 0.3	2.9
rDEN4Δ30-8092	6	3.2 ± 0.2	2.8	7	5.0 ± 0.4	1.1
rDEN4Δ30-10634	12	3.6 ± 0.1	2.4	5	4.4 ± 0.3	2.3

^aGroups of 6 suckling mice were inoculated i.c. with 10⁴PFU of virus. Brains were removed 5 days later, homogenized, and titered in Vero cells.
^bComparison of mean virus titers of mice inoculated with mutant virus and concurrent rDEN4 wt control.
^cGroups of HuH-7-SCID mice were inoculated directly into the tumor with 10⁴PFU virus. Serum was collected on day 6 and 7 and titered in Vero cells.

Based on the findings in the two mouse models of DEN4 virus infection, each of the rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses was evaluated in the rhesus macaque model of DEN4 infection which has been previously described (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413). Briefly, groups of four (rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634) or two (rDEN4, rDEN4Δ30, mock) monkeys were inoculated with 5.0 log₁₀PFU virus subcutaneously. Monkeys were observed daily and serum was collected on days 0 to 6, 8, 10, and 12, and virus titers were determined by plaque assay in Vero cells for measurement of viremia. On day 28, serum was drawn and the level of neutralizing antibodies was tested by plaque reduction assay in Vero cells as previously described (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413).

Viremia was detected beginning on day 1 post-infection and ended by day 4 in all monkeys (Table 7, FIG. 3). Viremia was present in each monkey infected with rDEN4, rDEN4Δ30, or rDEN4Δ30-10634 virus, but only 2 out of 4 monkeys infected with rDEN4Δ30-4995 or rDEN4Δ30-8092 virus had detectable viremia. As expected, infection with rDEN4 virus resulted in the highest mean number of viremic days per monkey (3.0 days) as well as mean peak virus titer (2.2 log₁₀PFU/ml). Monkeys infected with rDEN4Δ30 virus had both a lower mean number of viremic days per monkey (2.0 days) and mean peak virus titer (1.1 log₁₀PFU/ml) compared to rDEN4 virus. Groups of monkeys infected with each of the modified rDEN4Δ30 viruses had a further restricted mean number of viremic days with those inoculated with rDEN4Δ30-8092 virus having the lowest value, 0.5 days, a 4-fold reduction compared to rDEN4Δ30 virus. The mean peak virus titer of monkeys infected with rDEN4Δ30-4995 (0.9 log₁₀PFU/ml) or rDEN4Δ30-8092 (0.7 log₁₀PFU/ml) was also lower than those infected with rDEN4Δ30 virus. However, the mean peak virus titer of monkeys infected with rDEN4Δ30-10634 (1.3 log₁₀PFU/ml) was slightly higher than those infected with rDEN4Δ30 particularly on day 2 (FIG. 3).

TABLE 7

Addition of point mutations to rDEN4Δ30 further attenuates the virus for rhesus monkeys.

				Geometric mean
	No. of	Mean no.		serum neutralizing
	monkeys	of viremic	Mean peak	antibody titer
No. of	with	days per	virus titer	(reciprocal dilution)

Virus^a	monkeys	viremia	monkey^b	(log₁₀PFU/ml ± SE)	Day 0	Day 28

mock	2	0	0	<0.7	<10	<10
rDEN4	2	2	3.0	2.2 ± 0.6	<10	398
rDEN4Δ30	2	2	2.0	1.1 ± 0.4	<10	181
rDEN4Δ30-4995	4	2	0.8	0.9 ± 0.2	<10	78
rDEN4Δ30-8092	4	2	0.5	0.7 ± 0.1	<10	61
rDEN4Δ30-10634	4	4	1.3	1.3 ± 0.2	<10	107

^aGroups of rhesus monkeys were inoculated subcutaneously with 10⁵PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10, 12, and 28. Virus titer was determined by plaque assay in Vero cells.
^bViremia was not detected in any monkey after day 4.

Serum collected on day 0 and 28 was tested for the level of neutralizing antibodies against rDEN4. No detectable neutralizing antibodies were found against DEN4 on day 0, as expected, since the monkeys were pre-screened to be negative for neutralizing antibodies against flaviviruses (Table 7). On day 28, monkeys infected with rDEN4 had a mean serum neutralizing antibody titer (reciprocal dilution) of 398 which was approximately two-fold higher than monkeys infected with rDEN4Δ30 virus (1:181). This result and the two-fold higher level of viremia in rDEN4 virus-infected monkeys are similar to results obtained previously (Durbin et al. 2001 Am. J. Trop. Med. Hyg. 65:405-413). Monkeys infected with rDEN4Δ30-4995 (1:78), rDEN4Δ30-8092 (1:61), and rDEN4Δ30-10634 (1:107) viruses each had a reduced mean serum neutralizing antibody titer compared to monkeys infected with rDEN4Δ30 virus. The four monkeys which had no detectable viremia did have serum neutralizing antibody titers indicating that they were indeed infected. Despite the slight increase in mean peak virus titer of rDEN4Δ30-10634 virus compared with rDEN4Δ30 virus, rDEN4Δ30-10634 virus had a lower mean serum neutralizing antibody titer compared to monkeys infected with rDEN4Δ30 virus. This and the lower mean number of viremic days per monkey suggests that the 10634 mutation can attenuate the replication of rDEN4Δ30 virus in monkeys.

On day 28 after inoculation, all monkeys were challenged with 5.0 log₁₀PFU wild type rDEN4 virus subcutaneously. Monkeys were observed daily and serum was collected on days 28 to 34, 36, and 38, and virus titers were determined by plaque assay in Vero cells for measurement of viremia after challenge. Twenty eight days after rDEN4 virus challenge, serum was drawn and the level of neutralizing antibodies was tested by plaque reduction assay in Vero cells. Mock-inoculated monkeys had a mean peak virus titer of 2.3 log₁₀PFU/ml after challenge with a mean number of viremic days of 3.5 (Table 8). However, monkeys inoculated with rDEN4, rDEN4Δ30, or each of the modified rDEN4Δ30 viruses had no detectable viremia, indicating that despite the decreased replication and immunogenicity of rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 viruses, each was sufficiently immunogenic to induce protection against wild type rDEN4. Increases in mean neutralizing antibody titer were minimal (<3-fold) following challenge in all inoculation groups except mock-infected providing further evidence that the monkeys were protected from the challenge.

TABLE 8

rDEN4Δ30 containing additional point mutations protects rhesus monkeys from wt
DEN4 virus challenge

	Mean no. of		Geometric mean serum
	viremic days per		neutralizing antibody
	monkey after	Mean peak	titer (reciprocal
No. of	rDEN4	virus titer	dilution)

Virus^a	monkeys	challenge	(log₁₀PFU/ml ± SE)	Day 28	Day 56

Mock	2	3.5	2.3 ± 0.1	<10	358
rDEN4	2	0.0	<0.7	398	753
rDEN4Δ30	2	0.0	<0.7	181	202
rDEN4Δ30-4995	4	0.0	<0.7	78	170
rDEN4Δ30-8092	4	0.0	<0.7	61	131
rDEN4Δ30-10634	4	0.0	<0.7	107	177

^a28 days after primary inoculation with the indicated viruses, rhesus monkeys were challenged subcutaneously with 10⁵PFU rDEN4 virus in a 1 ml dose. Serum was collected on days 28 to 34, 36, 38, and 56. Virus titer was determined by plaque assay in Vero cells.

Taken together, these results indicate that the three point mutations, 4995, 8092, and 10634) described above do further attenuate the rDEN4Δ30 vaccine candidate in suckling mouse brain, SCID-HuH-7 mice, and rhesus monkeys. Because of additional incidental mutations (Table 4) present in each modified rDEN4Δ30 virus, the phenotypes cannot be directly attributed to the individual 4995, 8092, and 10634 point mutations. However, the presence of similar mouse-attenuation phenotypes in other rDEN4 viruses bearing one of these three mutations supports the contention that the 4995, 8092, and 10634 point mutations are responsible for the att phenotypes of the modified rDEN4Δ30 viruses. Since rDEN4Δ30-4995, rDEN4Δ30-8092, and rDEN4Δ30-10634 virus demonstrated decreased replication in rhesus monkeys while retaining sufficient immunogenicity to confer protective immunity, these viruses are contemplated as dengue vaccines for humans.

DEN4 viruses carrying both Δ30 and charge-to-alanine mutations were next generated. A subset of seven groups of charge-to-alanine mutations described above were identified that conferred between a 10-fold and 1,000-fold decrease in replication in SCID-HuH-7 mice and whose unmutated sequence was well-conserved across the four dengue serotypes. These mutations were introduced as single pairs and as two sets of pairs to rDEN4Δ30 using conventional cloning techniques. Transcription and recovery of virus and terminal dilution of viruses were conducted as described above. Assay of the level of temperature sensitivity of the charge-cluster-to-alanine mutant viruses in Vero and HuH-7 cells, level of replication in the brain of suckling mice and level of replication in SCID-HuH-7 mice was conducted as described above.

Introduction of one pair of charge-to-alanine mutations to rDEN4 produced recoverable virus in all cases (Table 9). Introduction of two pairs of charge-to-alanine mutations produced recoverable virus in two out of three cases (rDEN4Δ30-436-437-808-809 was not recoverable).

rDEN4Δ30 is not ts in Vero or HuH-7 cells. In contrast, seven of the seven sets of charge-to-alanine mutations used in this example conferred a ts phenotype in HuH-7 cells and five also conferred a ts phenotype in Vero cells. All six viruses carrying both Δ30 and charge-to-alanine mutations showed a ts phenotype in both Vero and HuH-7 cells (Table 9). rDEN4Δ30 is not attenuated in suckling mouse brain, whereas five of the seven sets of charge-to-alanine mutations conferred an att phenotype in suckling mouse brain (Table 10). Four of the viruses carrying both Δ30 and charge-to-alanine mutations were attenuated in suckling mouse brain (Table 10). In one case (rDEN4Δ30-23-24-396-397) combination of two mutations that did not attenuate alone resulted in an attenuated virus. Generally, viruses carrying both Δ30 and charge-to-alanine mutations showed levels of replication in the suckling mouse brain more similar to their charge-to-alanine mutant parent virus than to rDEN4Δ30.

rDEN4Δ30 is attenuated in SCID-HuH-7 mice, as are six of the seven charge-to-alanine mutant viruses used in this example. Viruses carrying both Δ30 and charge-to-alanine mutations tended to show similar or slightly lower levels of replication in SCID-HuH-7 mice compared to their charge-to-alanine mutant parent virus (Table 10). In three cases, viruses carrying both Δ30 and charge-to-alanine mutations showed at least a fivefold greater reduction in SCID-HuH-7 mice than rDEN4Δ30.

The complete genomic sequence of five viruses (rDEN4-200-201, rDEN4Δ30-200-201, rDEN4-436-437 [clone 1], rDEN4Δ30-436-437, and rDEN4-23-24-200-201) that replicated to >10⁵PFU/ml in Vero cells at 35° C. and that showed a hundredfold or greater reduction in replication in SCID-HuH-7 mice was determined (Table 11). Each of the five contained one or more incidental mutations. In one virus, rDEN4Δ30-436-437, the one additional mutation has been previously associated with Vero cell adaptation (Blaney, J. E. Jr. et al. 2002 Virology 300:125-139). Each of the remaining viruses contained at least one incidental mutation whose phenotypic effect is unknown. Consequently, the phenotypes described cannot be directly attributed to the charge-to-alanine mutations. However, the fact that rDEN4 and rDEN4Δ30 viruses carrying the same charge-to-alanine mutations shared similar phenotypes provides strong support for the ability of charge-to-alanine mutations to enhance the attenuation of rDEN4Δ30. Because rDEN4-436-437 [clone 1] contained 4 incidental mutations, a second clone of this virus was prepared. rDEN4-436-437 [clone2] contained only one incidental mutation (Table 11), and showed the same phenotypes as rDEN4-436-437 in cell culture and SCID-HuH-7 mice. rDEN4-436-437 [clone 2] was used in the rhesus monkey study described below.

TABLE 9

Addition of charge-to-alanine mutations to rDEN4Δ30 confers a ts phenotype in both Vero and HuH-7 cells.

Mean virus titer (log₁₀PFU/ml) at indicated temperature (° C.)^a

AA

No. nt

Vero

HuH-7

Virus	changed^b	changed	35	37	38	39	Δ^c	35	37	38	39	Δ

rDEN4	none	0	7.4	7.1	7.7	7.2	0.2	7.7	7.5	7.5	7.4	0.3
rDEN4Δ30	none	30	6.6	6.6	6.5	6.5	0.1	7.4	6.9	7.0	6.4	1.0
rDEN4-23-24	KE	3	6.7	6.6	6.0	6.5	0.2	7.1	7.3	5.6	<1.7	>5.4
rDEN4Δ30-23-24			6.1	5.5	4.9	<1.7	4.4	6.5	5.9	4.7	<1.7	>4.2
rDEN4-200-201	KH	4	5.3	4.8	4.8	4.3	1.0	5.7	5.4	2.7	<1.7	>4.0
rDEN4Δ30-200-201			6.0	5.3	5.6	<1.7	>4.3	5.8	5.0	5.9	<1.7	>4.1
rDEN4-436-437	DK	4	5.2	4.2	3.4	1.9	3.3	5.9	4.9	3.2	<1.7	>4.2
rDEN4Δ30-436-437			6.3	5.7	5.5	<1.7	>4.6	6.5	5.7	5.1	<1.7	>4.8
[clone1]
rDEN4-808-809	ED	3	4.6	4.1	<1.7	<1.7	>2.9	5.2	<1.7	<1.7	<1.7	>3.5
rDEN4Δ30-808-809			5.6	4.9	4.9	<1.7	>3.9	5.9	4.8	5.1	<1.7	>4.2
rDEN4-23-24-200-201	KE, KH	7	6.0	5.2	4.2	<1.7	>4.3	6.9	6.3	<1.7	<1.7	>5.2
rDEN4Δ30-23-24-200-201			4.5	4.2	4.8	<1.7	>2.8	4.9	4.5	2.9	<1.7	>3.2
rDEN4-23-24-396-397	KE, RE	7	6.5	5.8	5.5	<1.7	>4.8	7.1	5.9	5.4	<1.7	>5.4
rDEN4Δ30-23-24-396-397			6.1	5.2	4.8	<1.7	>4.4	6.9	5.4	4.9	<1.7	>5.2
rDEN-436-437-808-809	DK, ED	7	4.9	4.9	5.1	<1.7	>3.2	5.5	3.2	<1.7	<1.7	>3.8

^aUnderlined values indicate a 2.5 or 3.5 log₁₀PFU/ml reduction in titer in Vero or HuH-7 cells, respectively, at the indicated temperature when compared to the permissive temperature (35° C.).
^bAmino acid pair(s) changed to pair of Ala residues.
^cReduction in titer (log₁₀pfu/ml) compared to the permissive temperature (35° C.).

TABLE 10

Addition of charge-to-alanine mutations attenuates rDEN4Δ30 in suckling mouse
brain and enhances attenuation in SCID-HuH-7 mice.

Replication in suckling mice^a

Replication in SCID-HuH-7 mice^b

			Mean log			Mean log
		Mean virus titer ± SE	reduction from		Mean virus titer ± SE	reduction from
Virus	n	(log₁₀PFU/g brain)	wt^b	n	(log₁₀PFU/ml serum)	wt^d

rDEN4	18	6.2 ± 0.4	—	33	5.4 ± 0.3	—
rDEN4Δ30	12	5.9 ± 0.8	0.2	8	3.4 ± 0.3	2.3
rDEN4-23-24	18	4.7 ± 0.1	1.6	19	4.7 ± 0.5	1.3
rDEN4Δ30-23-24	6	5.6 ± 0.3	0.7	7	4.6 ± 0.4	1.5
rDEN4-200-201	12	5.5 ± 0.5	0.6	12	3.7 ± 0.2	2.6
rDEN4Δ30-200-201	6	5.5 ± 0.6	0.1	4	3.3 ± 0.6	1.8
rDEN4-436-437	18	2.7 ± 0.4	3.5	10	2.9 ± 0.7	2.5
rDEN4Δ30-436-437 [clone 1]	6	2.9 ± 0.3	3.4	4	2.3 ± 0.4	2.8
rDEN4-808-809	6	1.8 ± 0.1	3.1	8	3.2 ± 0.4	3.0
rDEN4Δ30-808-809	12	3.9 ± 0.7	2.1	4	3.7 ± 0.6	2.4
rDEN4-23-24-200-201	12	5.3 ± 0.5	0.7	13	3.4 ± 0.1	2.9
rDEN4Δ30-23-24-200-201	6	3.0 ± 0.2	2.6	5	1.8 ± 0.1	3.3
rDEN4-23-24-396-397	12	4.6 ± 0.9	1.5	8	3.6 ± 0.3	2.3
rDEN4Δ30-23-24-396-397	6	3.0 ± 0.2	2.6	5	2.2 ± 0.3	2.9
rDEN-436-437-808-809	6	<1.7 ± 0.0	3.6	8	2.1 ± 0.3	2.4

^aGroups of six suckling mice were inoculated i.c. with 10⁴PFU virus in a 30 μl inoculum. The brain was removed 5 days later, homogenized, and virus was quantitated by titration in Vero cells.
^bDetermined by comparing the mean viral titers in mice inoculated with sample virus and concurrent wt controls (n = 6). The attenuation (att) phenotype is defined as a reduction of ≧1.5 log₁₀PFU/g compared to wt virus; reductions of 1.5 are listed in boldface.
^cGroups of SCID-HuH-7 mice were inoculated directly into the tumor with 10⁴PFU virus.
^dDetermined by comparing mean viral titers in mice inoculated with sample virus and concurrent wt controls.

The attenuation phenotype is defined as a reduction of ≧1.5 log₁₀PFU/g compared to wt virus; reductions of ≧1.5 are listed in boldface.

TABLE 11

Missense and UTR mutations present in rDEN4 virus derivatives bearing
charge-to-alanine and the Δ30 mutation.

		Nucleotide	Nucleotide	Amino acid
Virus	Gene^a,b	position	substitution	position^c	Amino acid change^b

rDEN4-200-201	prM	626	A > T	61	Glu > Asp
	NS4A	6659	C > T	93	Leu > Phe
	NS5	8160-8165	AAACA > GCAGC	200-201	LysHis > AlaAla
rDEN4Δ30-200-201	NS3	4830	G > A	102	Gly > Arg
	NS5	8106	G > A	181	Val > Ile
	NS5	8160-8165	AAACA > GCAGC	200-201	LysHis > AlaAla
	3′ UTR	10478-10507	Δ30 deletion	None	None
rDEN4-436-437 [clone 1]	E	2331	T > G	464	Trp > Gly
	NS1	2845	C > T	140	Ser > Phe
	NS3*	4891	T > C	122	Ile > Thr
	NS5	8869-8873	GACAA > GCAGC	436-437	AspLys > AlaAla
	NS5	9659	A > G	699	Lys > Arg
rDEN4-436-437 [clone 2]	NS4B	7153	T > C	108	Val > Ala
	NS5	8869-8873	GACAA > GCAGC	436-437	AspLys > AlaAla
rDEN4Δ30-436-437	NS4B*	7163	A > C	111	Leu > Phe
	NS5	8869-73	GACAA > GCAGC	436-437	AspLys > AlaAla
	3′ UTR	10478-10507	Δ30 deletion	None	None
rDEN4-23-24-200-201	NS3	6751	A > C	124	Lys > Thr
	NS5	7629-7633	AAAGA > GCAGC	23-24	LysGlu > AlaAla
	NS5	8160-8165	AAACA > GCAGC	200-201	LysHis > AlaAla

^aAsterisk indicates previously identified Vero cell adaptation mutation.
^bBold values indicate mutations designed to occur in the designated virus.
^cAmino acid position in the protein product of the designated DEN4 gene; numbering starts with the amino terminus of the protein.

Based on the attenuation in the SCID-HuH7 mouse model, four of the charge-to-alanine mutant viruses (rDEN4-200-201, rDEN4Δ30-200-201, rDEN4-436-437 [clone 2], rDEN4Δ30-436-437) were evaluated in rhesus macaques as described above. As with the study of viruses carrying attenuating point mutations, viremia was detected on day 1 post-infection and ended by day 4 in all monkeys (FIG. 4, Table 12). Viremia was detected in most of the monkeys infected; only one of the four monkeys infected with rDEN4Δ30-200-201 and one of the four monkeys infected with rDEN4Δ30-436-437 showed no detectable viremia. Monkeys infected with rDEN4 showed the highest mean peak virus titer; and in each case viruses carrying the Δ30 mutation showed an approximately 0.5 log decrease in mean peak virus titer relative to their parental viruses and a 0.5 to 2 day decrease in mean number of viremic days per monkey. Monkeys infected with viruses carrying both the Δ30 and charge-to-alanine mutations showed a two-fold reduction in mean peak viremia relative to those infected with rDEN4Δ30. This suggests that addition of the charge-to-alanine mutations further attenuates rDEN4Δ30 for rhesus macaques.

As expected, none of the monkeys in this study showed detectable levels of neutralizing antibody on day 0. On day 28, every monkey infected with a virus showed a detectable levels of neutralizing antibody, indicating that all of the monkeys, even those that showed no detectable viremia, had indeed been infected. As in the study of attenuating point mutations, monkeys infected with rDEN4 had a mean serum neutralizing antibody titer (reciprocal dilution) which was approximately twice that of monkeys that had been infected with rDEN4Δ30. Monkeys infected with rDEN4-200-201 and rDEN4-436-437 [clone 2] had similar mean neutralizing antibody titers to rDEN4, and those infected with rDEN4Δ30-200-201 and rDEN4Δ30-436-437 had similar mean neutralizing antibody titers to rDEN4. In each case the addition of the Δ30 mutation to a virus resulted in a two-fold decrease in neutralizing antibody. Thus, although the addition of charge-to-alanine mutations to rDEN4Δ30 decreased mean peak viremia below that of rDEN4Δ30 alone, it did not affect levels of neutralizing antibody.

TABLE 12

Addition of paired charge-to-alanine mutations to rDEN4Δ30
further attenuates the virus for rhesus monkeys.

				Geometric mean
				serum neutralizing
	No. of	Mean no.		antibody titer
	monkeys	of viremic	Mean peak	(reciprocal
No. of	with	days per	virus titer	dilution)

Virus^a	monkeys	viremia	monkey^b	(log₁₀PFU/ml ± SE)	Day 0	Day 28

mock	2	0	0	<0.7	<5	<5
rDEN4	2	2	2.5	2.6 ± 0.3	<5	276
rDEN4Δ30	2	2	2.0	2.1 ± 0.1	<5	131
rDEN4-200, 201	4	4	2.3	1.8 ± 0.3	<5	212
rDEN4Δ30-200, 201	4	3	1.5	1.3 ± 0.2	<5	139
rDEN4-436, 437 [cl 2)	4	4	3.3	1.8 ± 0.2	<5	273
rDEN4Δ30-436, 437	4	3	1.3	1.0 ± 0.0	<5	143

^aGroups of rhesus monkeys were inoculated subcutaneously with 10⁵PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10 and 28. Virus titer was determined by plaque assay in Vero cells.
^bViremia was not detected in any monkey after day 4.

After challenge with rDEN4 on day 28, mock-infected monkeys had a mean peak virus titer of 1.5 log₁₀PFU/ml and a mean number of viremic days of 3.0 (Table 13). However, none of the monkeys previously inoculated with rDEN4, rDEN4Δ30 or the charge-to-alanine mutant viruses showed detectable viremia. Additionally, none of the monkeys showed a greater than four-fold increase in serum neutralizing antibody titer. Together these data indicate that infection with any of the viruses, including those carrying both Δ30 and the charge-to-alanine mutations, protected rhesus macaques from challenge with rDEN4.

TABLE 13

rDEN4Δ30 containing charge-to-alanine mutations protects rhesus monkeys from
wt DEN4 virus challenge

	Mean no. of		Geometric mean serum
	viremic days		neutralizing antibody
	per monkey	Mean peak	titer (reciprocal
No. of	after rDEN4	virus titer	dilution)

Virus^a	monkeys	challenge	(log₁₀PFU/ml ± SE)	Day 28	Day 56

mock	2	3.0	1.5 ± 0.7	<5	284
rDEN4	2	0.0	<0.7	276	316
rDEN4Δ30	2	0.0	<0.7	131	96
rDEN4-200, 201	4	0.0	<0.7	212	356
rDEN4Δ30-200, 201	4	0.0	<0.7	139	132
rDEN4-436,	4	0.0	<0.7	273	401
437 [cl 2]
rDEN4Δ30-436, 437	4	0.0	<0.7	143	182

^a28 days after primary inoculation with the indicated viruses, rhesus monkeys were challenged subcutaneously with 10⁵PFU rDEN4 virus in a 1 ml dose. Serum was collected on days 28 to 34, 36, 10, and 56. Virus titer was determined by plaque assay in Vero cells.

Addition of charge-to-alanine mutations to rDEN4Δ30 can confer a range of is phenotypes in both Vero and HuH-7 cells and att phenotypes in suckling mouse brain and can either enhance or leave unchanged attenuation in SCID-HuH-7 mice. Most importantly, addition of these mutations can decrease the viremia produced by rDEN4Δ30 in rhesus macaques without decreasing neutralizing antibody titer or protective efficacy. Thus addition of such mutations to rDEN4Δ30 is contemplated as enhancing attenuation in humans. Also, mutations are contemplated as being added that do not change the overall level of attenuation, but stabilize the attenuation phenotype because they themselves are independently attenuating even in the absence of the Δ30 mutation. Charge-to-alanine mutations are particularly useful because they occur outside of the structural gene regions, and so can be used to attenuate structural gene chimeric viruses. Moreover, they involve at least three nucleotide changes, making them unlikely to revert to wild type sequence.

A series of point mutations that enhance the replication of rDEN4 in Vero cells tissue culture have been identified; these are primarily located in the NS4B gene (Blaney, J. E. et. al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol 75:9731-9740). Vero cell adaptation mutations confer two desirable features upon a vaccine candidate. First, they enhance virus yield in Vero cells, the intended substrate for vaccine production, and thus render vaccine production more cost-effective. Second, although each of these Vero adaptation mutations are point mutations, they are likely to be extremely stable during vaccine manufacture, because they give a selective advantage in Vero cells. At least one Vero cell adaptation mutation, at position 7129, was also shown to decrease mosquito infectivity of rDEN4; poor mosquito infectivity is another desirable characteristic of a dengue vaccine candidate. To investigate the generality of this finding, we tested the effect of the remaining Vero cell adaptation mutations on the ability of rDEN4 to infect Aedes aegypti mosquitoes fed on an infectious bloodmeal. Table 14 shows the infectivity of each virus carrying a single Vero cell adaptation mutation at high titer. Of these, only one mutation, at position 7182, was associated with a large decrease in mosquito infectivity. Thus 7182 may be a particularly valuable mutation to include in an rDEN4 vaccine candidate, as it has opposite effects on replication in Vero cells and in mosquitoes.

TABLE 14

Effect of Vero cell adaptation mutations on rDEN4 mosquito infectivity

Aedes aegypti (oral infection)

Dose^a

% infected^b

Virus	(log₁₀pfu)	No. tested	Midgut	Head

rDEN4	4.3	27	70	25
rDEN4-4891	4.4	23	74	13
rDEN4-4995	4.8	20	80	50
rDEN4-7153	4.8	20	80	30
rDEN4-7546	4.6	20	55	10
rDEN4-7162	5.0	20	55	25
rDEN4-7163	4.9	15	73	72
rDEN4-7182	5.0	20	20	0
rDEN4-7630	4.3	10	70	10

^aVirus titer ingested, assuming a 2 iμl bloodmeal.
^bPercentage of mosquitoes with IFA detectable antigen in midgut or head tissue prepared 21 days after oral infection.

EXAMPLE 2 Generation and Characterization of a Recombinant DEN1 Virus Containing the Δ30 Mutation

We first sought to determine if the Δ30 mutation was able to satisfactorily attenuate a wild-type DEN virus other than the DEN4 serotype. To do this, the Δ30 mutation was introduced into the cDNA for DEN1 (Western Pacific). The pRS424DEN1WP cDNA clone (Puri, B. et al. 2000 Virus Genes 20:57-63) was digested with BamHI and used as template in a PCR using Pfu polymerase with forward primer 30 (DEN1 nt 10515-10561 and 10592-10607) and the M13 reverse sequencing primer (101 nt beyond the 3′ end of DEN1 genome sequence). The resulting PCR product was 292 bp and contained the Δ30 mutation. The pRS424DEN1WP cDNA was partially digested with Apa I, then digested to completion with Sac II and the vector was gel isolated, mixed with PCR product, and used to transform yeast strain YPH857 to yield growth on plates lacking tryptophan (Polo, S. et al. 1997 J Virol 71:5366-74). Positive yeast colonies were confirmed by PCR and restriction enzyme analysis. DNA isolated from two independent yeast colonies was used to transform E. coli strain STBL2. Plasmid DNA suitable for generating RNA transcripts was prepared and the presence of the Δ30 mutation was verified by sequence analysis.

For transcription and generation of virus, cDNA (designated pRS424DEN1Δ30) that was linearized with Sac II was used as template in a transcription reaction using SP6 RNA polymerase as described (Polo, S. et al. 1997 J Virol 71:5366-74). Transcription reactions were electroporated into LLC-MK2 cells and infection was confirmed by observation of CPE and immunofluorescence and harvested on day 14. Virus stocks were amplified on C6/36 mosquito cells and titered on LLC-MK2 cells. The genome of the resulting virus, rDEN1Δ30, was sequenced to confirm the presence of the Δ30 mutation. The Δ30 mutation removes nucleotides 10562-10591 of DEN1 (FIG. 2B, C), which corresponds to the TL2 of DEN1. The virus replicates efficiently in Vero cell culture to titers of 6.5 log₁₀PFU/ml, indicating that the Δ30 mutation is compatible with efficient growth of DEN1 in cell culture, a property essential for manufacture of the vaccine. Using similar techniques, parent virus rDEN1 was generated. Incidental mutations arising from virus passage in tissue culture were identified in both rDEN1 and rDEN1Δ30 using sequence analysis and are listed in Table 15. An additional rDEN1Δ30 virus was derived by transfection and amplification in Vero cells. Although this virus was not evaluated in the studies described below, its sequence analysis is included in Table 15. The properties of rDEN1Δ30 as a vaccine in vivo were next examined.

TABLE 15

Missense mutations present among the recombinant DEN1 viruses and
correlation of NS4B region mutations with those found in DEN4

	Trans-		Nucleo-	Nucleo-	Amino	Amino
	fection		tide	tide	acid	acid
Virus	cell type	Gene	position	change	position	change

wt rDEN1	LLC-MK2	prM	816	C > U	241	Ala > Val
		NS4B	7165^a	U > G	2357	Phe > Leu
		NS4B	7173^b	U > C	2360	Val > Ala
rDEN1Δ30	LLC-MK2	E	1748	A > U	552	Thr > Ser
rDEN1Δ30	Vero	E	1545	A > G	484	Lys > Arg

^aSame nucleotide as 7154 in rDEN4.
^bSame nucleotide as 7162 in rDEN4

* Nucleotide and amino acid comparison of selected NS4B region:

	7 7 7 7 7 7
DEN4	1 1 1 1 1 1
base	3 4 5 6 7 8
Number:	890123456789012345678901234567890123456789012345678901234567
	++ ++ + +++++ + + + + ++ + ++++++++ ++ ++ ++ ++

D4 7128-	CCAACAACCUUGACAGCAUCCUUAGUCAUGCUUUUAGUCCAUUAUGCAAUAAUAGGCCCA
	P T T L T A S L V M L L V H T A I I G P

D1 7139-	CCGCUGACGCUGACAGCGGCGGUAUUUAUGCUAGUGGCUCAUUAUGCCAUAAUUGGACCC
	P L T L T A A V P M L V A H T A I I G P

D2 7135-	CCUAUAACCCUCACAGCGGCUCUUCUUUUAUUGGUAGCACAUUAUGCCAUCAUAGGACCG
	P I T L T A A L L L L V A H T A I I G P

D3 7130-	CCACUAACUCUCACAGCGGCAGUUCUCCUGCUAGUCACGCAUUAUGCUAUUAUAGGUCCA
	P L T L T A A V L L L V T H T A I I G P
	+ + + + + + + + + + + + +
D4 = rDEN4
Dl = rDENl(WP)
D2 = rDEN2(Tonga/74)
D3 = rDEN3(Sleman/78)
+Homology among all four serotypes
Nucleotides are underlined in even multiples of 10.

Evaluation of the replication, immunogenicity, and protective efficacy of rDEN1Δ30 and wild-type parental rDEN1 virus (derived from the pRS424DEN1WP cDNA) in juvenile rhesus monkeys was performed as follows. Dengue virus-seronegative monkeys were injected subcutaneously with 5.0 log₁₀PFU of virus in a 1 ml dose divided between two injections in each side of the upper shoulder area. Monkeys were observed daily and blood was collected on days 0-10 and 28 and serum was stored at −70° C. Titer of virus in serum samples was determined by plaque assay in Vero cells as described previously (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). Plaque reduction neutralization titers were determined for the day 28 serum samples as previously described (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). All monkeys were challenged on day 28 with a single dose of 5.0 log₁₀PFU of wild-type rDEN1 and blood was collected for 10 days. Virus titer in post-challenge sera was determined by plaque assay in Vero cells. Monkeys inoculated with full-length wild-type rDEN1 were viremic for 2-3 days with a mean peak titer of 2.1 log₁₀PFU/ml (Table 16), and monkeys inoculated with rDEN1Δ30 were viremic for less than 1 day with a mean peak titer of 0.8 log₁₀PFU/ml, indicating that the Δ30 mutation is capable of attenuating DEN1. As expected for an attenuated virus, the immune response, as measured by neutralizing antibody titer, was lower following inoculation with rDEN1Δ30 compared to inoculation with wild-type rDEN1 (Table 16), yet sufficiently high to protect the animals against wild-type DEN1 virus challenge. Wild-type rDEN1 virus was not detected in any serum sample collected following virus challenge, indicating that monkeys were completely protected following immunization with either full-length wild-type rDEN1 or recombinant virus rDEN1Δ30. The level of attenuation specified by the Δ30 mutation was comparable in both the DEN1 and DEN4 genetic backgrounds (FIG. 5).

TABLE 16

The Δ30 mutation attenuates rDEN1 for rhesus monkeys

		Mean no.	Mean peak	Mean	Mean peak
		days with	titer	neutralization	titer of
Virus*	n	viremia	(log₁₀pfu/ml)	titer	challenge virus

rDEN1

	4	2.8	2.1	1230	<0.7
rDEN1Δ30	4	0.5	0.8	780	<0.7

*Rhesus monkeys were inoculated subcuateously with 5.0 log₁₀PFU of virus. Serum samples were collected daily for 10 days. Serum for neutralization assay was collected on day 28. All monkeys were challenged on day 28 with 5.0 log₁₀PFU of rDEN1.

As previously reported, rDEN4 virus replicated to greater than 6.0 log₁₀PFU/ml serum in SCID-HuH-7 mice, while the replication of rDEN4 virus bearing the Δ30 mutation was reduced by about 10-fold (Blaney, J. E. Jr. et al. 2002 Virology 300:125-139). The replication of rDEN1Δ30 was compared to that of wt rDEN1 in SCID-HuH-7 mice (Table 17). rDEN1Δ30 replicated to a level approximately 100-fold less than its wt rDEN1 parent. This result further validates the use of the SCID-HuH-7 mouse model for the evaluation of attenuated strains of DEN virus, with results correlating closely with those observed in rhesus monkeys.

TABLE 17

The Δ30 mutation attenuates rDEN1 for HuH-7-SCID mice

		No. of	Mean peak virus titer⁶
	Virus	Mice⁵	(log₁₀pfu/ml ± SE)

	wt rDEN1	9	7.3 ± 0.2
	rDEN1Δ30	8	5.0 ± 0.3

⁵Groups of HuH-7-SCID mice were inoculated directly into the tumor with 4.0 log₁₀pfu virus. Serum was collected on day 6 and 7, and virus titer was determined by plaque assay in Vero cells.
⁶Significant difference was found between rDEN1 and rDEN1Δ30 viruses, Tukey-Kramer test (P < 0.005).

Finally, the infectivity of rDEN1 and rDEN1Δ30 for mosquitoes was assessed, using the methods described in detail in Example 5. Previously, the Δ30 mutation was shown to decrease the ability of rDEN4 to cross the mosquito midgut barrier and establish a salivary gland infection (Troyer, J. M. et al. 2001 Am J Trop Med Hyg 65:414-419). However neither rDEN1 nor rDEN1Δ30 was able to infect the midgut of Aedes aegypti mosquitoes efficiently via an artificial bloodmeal (Table 18), so it was not possible to determine whether Δ30 might further block salivary gland infection. A previous study also showed that the Δ30 had no effect on the infectivity of rDEN4 for Toxorhynchites splendens mosquitoes infected via intrathoracic inoculation (Troyer, J. M. et al. 2001 Am J Trop Med Hyg 65:414-419), and a similar pattern was seen for rDEN1 and rDEN1Δ30 (Table 18). The genetic basis for the inability of rDEN1 to infect the mosquito midgut has not been defined at this time. However, this important property of restricted infectivity for the mosquito midgut is highly desirable in a vaccine candidate since it would serve to greatly restrict transmission of the vaccine virus from a vaccinee to a mosquito vector.

TABLE 18

DEN1 and DEN1Δ30 viruses are both highly infectious for
Toxorhynchites splendens, but do not infect Aedes aegypti efficiently.

	Toxorhynchites splendens
	(intrathoracic inoculation)	Aedes aegypti (oral infection)

Dose^a

Dose^c

% infected^d

Virus	(log₁₀pfu)	No. tested	% infected^b	(log₁₀pfu)	No. tested	Midgut	Head

rDEN1	3.5	7	100	4.0	26	11	0
	2.5	8	75
	1.5	7	71
	0.5	5	60
			MID₅₀< 0.5			MID₅₀≧ 4.4
rDEN1	2.7	8	100	3.2	20	10	0
Δ30	1.7	7	100
	0.7	6	83
			MID₅₀< 0.7			MID₅₀≧ 3.6

^aAmount of virus present in 0.22 μl inoculum.
^bPercentage of mosquitoes with IFA detectable antigen in head tissue prepared 14 days after inoculation.
^cVirus titer ingested, assuming a 2 μl bloodmeal.
^dPercentage of mosquitoes with IFA detectable antigen in midgut or head tissue prepared 21 days after oral infection. When virus infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID₅₀was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.

Thus, the Δ30 mutation, first described in DEN4, was successfully transferred to rDEN1. The resulting virus, rDEN1Δ30, was shown to be attenuated in monkeys and SCID-HuH-7 mice to levels similar to recombinant virus rDEN4Δ30, thereby establishing the conservation of the attenuation phenotype specified by the Δ30 mutation in a different DEN virus background. Based on the favorable results of rDEN4Δ30 in recent clinical trials (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13), it is predicted that rDEN1Δ30 will be suitably attenuated in humans. To complete the tetravalent vaccine, attenuated rDEN2 and rDEN3 recombinant viruses bearing the Δ30 mutation are contemplated as being prepared (See Examples 3 and 4 below). The demonstration that the Δ30 mutation specifies a phenotype that is transportable to another DEN serotype has important implications for development of the tetravalent vaccine. This indicates that the Δ30 mutation is expected to have a corresponding effect on DEN2 and DEN3 wild-type viruses.

EXAMPLE 3 Generation and Characterization of a Recombinant DEN2 Virus Containing the Δ30 Mutation

Evaluation of rDEN1Δ30 showed that it was satisfactorily attenuated. Based on this result, we sought to extend our technology to the creation of a DEN2 vaccine candidate. To do this, the Δ30 mutation was introduced into the cDNA of DEN2. A DEN2 virus isolate from a 1974 dengue epidemic in the Kingdom of Tonga (Tonga/74) (Gubler, D. J. et al. 1978 Am J Trop Med Hyg 27:581-589) was chosen to represent wt DEN2. The genome of DEN2 (Tonga/74) was sequenced in its entirety and served as consensus sequence for the construction of a full-length cDNA clone (Appendix 1). cDNA fragments of DEN2 (Tonga/74) were generated by reverse-transcription of the genome as indicated in FIG. 6A. Each fragment was subcloned into a plasmid vector and sequenced to verify that it matched the consensus sequence as determined for the virus. This yielded seven cloned cDNA fragments spanning the genome. Cloned fragments were modified as follows: Fragment X, representing the 5′ end of the genome was abutted to the SP6 promoter; Fragment L was modified to contain a translationally-silent SpeI restriction site at genomic nucleotide 2353; Fragment R was modified to contain a translationally-silent SpeI restriction site also at genomic nucleotide 2353, and to stabilize the eventual full-length clone, two additional translationally-silent mutations at nucleotides 2362-2364 and 2397 were created to ensure that translation stop codons were present in all reading frames other than that used to synthesize the virus polyprotein; Fragment A was modified at nucleotide 3582 to ablate a naturally occurring SpeI restriction site and at nucleotide 4497 to ablate a naturally occurring KpnI restriction site; Fragment C was modified at nucleotide 9374 to ablate a naturally occurring KpnI restriction site; and Fragment Y, representing the 3′ end of the genome was abutted to a KpnI restriction site. Each fragment was added incrementally between the AscI and KpnI restriction sites of DEN4 cDNA clone p4 (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13) to generate a full-length DEN2 cDNA clone (p2) with the same vector background successfully used to generate rDEN4 and rDEN4Δ30. cDNA clone p2 was sequenced to confirm that the virus genome region matched the DEN2 (Tonga/74) consensus sequence, with the exception of the translationally-silent modifications noted above. The Δ30 mutation was introduced into Fragment Y to generate Fragment YΔ30. To create p2Δ30, the Fragment Y region of p2 was replaced with Fragment YΔ30 (FIG. 6A, B).

For transcription and generation of infectious virus, cDNA (p2 and p2Δ30) was linearized with Acc65I (isoschizomer of KpnI which cleaves leaving only a single 3′ nucleotide) and used as template in a transcription reaction using SP6 RNA polymerase as previously described (Blaney, J. E. et. al. 2002 Virology 300:125-139). Transcripts were introduced into Vero cells or C6/36 mosquito cells using liposome-mediated transfection and cell culture supernatants were harvested on day 7.

rDEN2 virus was recovered from the p2 cDNA in both Vero and C6/36 cells, while rDEN2Δ30 was recovered from the p2Δ30 cDNA clone in only C6/36 cells (Table 19). The level of infectious virus recovered in C6/36 cells was comparable for the p2 and p2Δ30 cDNA clones when assayed by plaque titration and immunostaining in Vero or C6/36 cells. As previously observed, the efficiency of transfection in C6/36 cells was higher than that in Vero cells. Two rDEN2Δ30 viruses were recovered from independent cDNA clones, #2 and #10.

TABLE 19

rDEN2 virus is recovered in Vero and C6/36 cells, but
rDEN2Δ30 virus is recovered only in C6/36 cells.

		Virus titer of transfection
		harvest (day 7) determined
		in the indicated
Transfection	cDNA	cell type (log₁₀PFU/ml)

cell type	construct	Clone	Virus	Vero cells	C6/36 cells

Vero cells	p2	#8A	rDEN2	3.1	4.3
	p2Δ30	#	2	rDEN2Δ30	<0.7	<0.7
	p2Δ30	#	10	rDEN2Δ30	<0.7	<0.7
C6/36 cells	p2	#8A	rDEN2	5.5	7.5
	p2Δ30	#	2	rDEN2Δ30	4.8	7.6
	p2Δ30	#	10	rDEN2Δ30	4.6	7.5

To produce working stocks of rDEN2 and rDEN2Δ30 viruses, transfection harvests were passaged and terminally diluted in Vero cells, and genomic sequences of the viruses were determined. The Vero cell transfection harvest of rDEN2 virus was terminally diluted once in Vero cells, and individual virus clones were passaged once in Vero cells. To assess whether any homologous Vero cell adaptation mutations identified in the rDEN4 NS4B 7100-7200 region were present in these virus clones, seven independent terminally diluted clones were sequenced over this region. Each of the seven rDEN2 viruses contained a single nucleotide substitution in this region at nucleotide 7169 (U>C) resulting in a Val>Ala amino acid change. This nucleotide corresponds to the 7162 mutation identified in rDEN4 (Blaney, J. E. et. al. 2002 Virology 300:125-139), which has a known Vero cell adaptation phenotype suggesting that this mutation may confer a replication enhancement phenotype in rDEN2 virus. One rDEN2 virus clone was completely sequenced and in addition to the 7169 mutation, a missense mutation (Glu>Ala) was found in NS5 at residue 3051 (Table 20).

TABLE 20

Missense mutations which accumulate in rDEN2 and rDEN2Δ30
viruses after transfection or passage in Vero cells.

		Nucleotide	Nucleotide	Amino acid	Amino acid
Virus	Gene	position	substitution	position^a	change

rDEN2^b	NS4B	7169^c	U > C	2358	Val > Ala
(Vero)	NS5	9248	A > C	3051	Glu > Ala
rDEN2Δ30^d	NS3	4946	A > G	1617	Lys > Arg
(Vero)	NS4B	7169^c	U > C	2358	Val > Ala

^aAmino acid position in DEN2 polyprotein beginning with the methionine residue of the C protein (nucleotides 97-99) as position 1.
^bVirus was recovered in Vero cells and terminally-diluted once in Vero cells. Virus stock was prepared in Vero cells.
^cSame nucleotide position as 7162 in rDEN4.
^dVirus was recovered in C6/36 cells and passaged three times in Vero cells. Virus was then terminally diluted and a stock was prepared in Vero cells.

Because both rDEN2 and rDEN2Δ30 viruses grown in Vero cells acquired the same mutation at nucleotide 7169, which corresponds to the Vero cell adaptation mutation previously identified in rDEN4 at nucleotide 7162, it was reasoned that this mutation is associated with growth adaptation of rDEN2 and rDEN2Δ30 in Vero cells. In anticipation that the 7169 mutation may allow rDEN2Δ30 to be recovered directly in Vero cells, the mutation was introduced into the rDEN2Δ30 cDNA plasmid to create p2Δ30-7169. Transcripts synthesized from p2Δ30-7169, as well as p2 and p2Δ30 were introduced into Vero cells or C6/36 mosquito cells using liposome-mediated transfection as described above. Virus rDEN2Δ30-7169 was recovered from the p2Δ30-7169 cDNA in both Vero and C6/36 cells, while rDEN2Δ30 was recovered from the p2Δ30 cDNA clone in only C6/36 cells (Table 21). The 7169 mutation is both necessary and sufficient for the recovery of rDEN2Δ30 in Vero cells.

TABLE 21

rDEN2Δ30-7169 virus containing the 7169 Vero cell adaptation
mutation is recovered in both Vero and C6/36 cells

				Virus titer of trans-
				fection harvest
				(day 14) determined
Transfection	cDNA			in C6/36 cells
cell type	construct	Clone	Virus	(log₁₀PFU/ml)

Vero cells	p2	#8A	rDEN2	6.8
	p2Δ30	#	2	rDEN2Δ30	<0.7
	p2Δ30-7169^a	#37	rDEN2Δ30-7169	5.1
C6/36 cells	p2	#8A	rDEN2	6.9
	p2Δ30	#	2	rDEN2Δ30	7.1
	p2Δ30-7169	#37	rDEN2Δ30-7169	7.2

^aNucleotide 7169 in rDEN2 corresponds to nucleotide 7162 in rDEN4 which has been shown to be associated with growth adaptation in Vero cells.

To initially assess the ability of the Δ30 mutation to attenuate rDEN2 virus in an animal model, the replication of DEN2 (Tonga/74), rDEN2, and rDEN2Δ30 viruses was evaluated in SCID-HuH-7 mice. Previously, attenuation of vaccine candidates in SCID-HuH-7 mice has been demonstrated to be predictive of attenuation in the rhesus monkey model of infection (Examples 1 and 2). The recombinant viruses tested in this experiment were recovered in C6/36 cells. The DEN2 Tonga/74 virus isolate, rDEN2, and two independent rDEN2Δ30 viruses, (clones 20A and 21A) which were derived from two independent p2Δ30 cDNA clones, were terminally diluted twice in C6/36 cells prior to production of a working stock in C6/36 cells. These viruses should not contain any Vero cell adaptation mutations. DEN2 Tonga/74 virus replicated to a mean virus titer of 6.2 log₁₀PFU/ml in the serum of SCID-HuH-7 mice, and rDEN2 virus replicated to a similar level, 5.6 log₁₀PFU/ml (Table 22). Both rDEN2Δ30 viruses were greater than 100-fold restricted in replication compared to rDEN2 virus. These results indicate that the Δ30 mutation has an attenuating effect on replication of rDEN2 virus similar to that observed for rDEN4 and rDEN1 viruses.

TABLE 22

The Δ30 mutation restricts rDEN2 virus replication
in SCID-HuH-7 mice.

		Mean virus	Mean log₁₀-unit
	No. of	titer ± SE (log₁₀	reduction from
Virus	mice	PFU/ml serum)^a	value for wt^b

DEN2 (Tonga/74)	8	6.2 ± 0.3	—
rDEN2	9	5.6 ± 0.2	—
rDEN2Δ30 (clone 20A)	9	3.1 ± 0.2	2.5
rDEN2Δ30 (clone 21A)	9	2.9 ± 0.3	2.7

^aGroups of SCID-HuH-7 mice were inoculated directly into the tumor with 10⁴PFU virus grown in C6/36 cells. Serum was collected on day 7 and titered in C6/36 cells.
^bComparison of mean virus titers of mice inoculated with mutant virus and concurrent rDEN2 control.

DEN2 virus replication in SCID-HuH-7 mice was also determined using DEN2 (Tonga/74), rDEN2, and rDEN2Δ30 which were passaged in Vero cells (see Table 20, footnotes b and d). Both rDEN2 and rDEN2Δ30 had acquired a mutation in NS4B, nucleotide 7169, corresponding to the 7162 mutation identified in rDEN4 as Vero cell adaptation mutation. In the presence of the 7169 mutation, the Δ30 mutation reduced replication of rDEN2Δ30 by 1.0 log₁₀PFU/ml (Table 23). Previously, using virus grown in C6/36 cells and lacking the 7169 mutation, the Δ30 mutation reduced replication of rDEN2Δ30 by about 2.5 log₁₀PFU/ml (Table 22). These results indicate that Vero cell growth adaptation in DEN2 may also confer a slight growth advantage in HuH-7 liver cells. Nevertheless, the attenuation conferred by the Δ30 mutation is still discernible in these Vero cell growth adapted viruses.

TABLE 23

The Δ30 mutation restricts Vero cell adapted rDEN2 virus
replication in SCID-HuH-7 mice.

			Mean log₁₀-unit
	No.	Mean virus titer ± SE	reduction from
Virus	of mice	(log₁₀PFU/ml serum)^a	value for wt^b

DEN2 (Tonga/74)	6	5.9 ± 0.3	—
rDEN2	7	5.9 ± 0.2	—
rDEN2Δ30	9	4.9 ± 0.3	1.0

^aGroups of SCID-HuH-7 mice were inoculated directly into the tumor with 10⁴PFU virus. Serum was collected on day 7 and titered in C6/36 cells.
^bComparison of mean virus titers of mice inoculated with rDEN2Δ30 and rDEN2 control.

Evaluation of the replication, immunogenicity, and protective efficacy of rDEN2Δ30 and wild-type parental rDEN2 virus in juvenile rhesus monkeys was performed as follows. Dengue virus-seronegative monkeys were injected subcutaneously with 5.0 log₁₀PFU of virus in a 1 ml dose divided between two injections in each side of the upper shoulder area. Monkeys were observed daily and blood was collected on days 0-10 and 28 and serum was stored at −70° C. Viruses used in this experiment were passaged in Vero cells, and recombinant viruses contained the mutations shown in Table 20 (See footnotes b and d). Titer of virus in serum samples was determined by plaque assay in Vero cells as described previously (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). Plaque reduction neutralization titers were determined for the day 28 serum samples as previously described (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). All monkeys were challenged on day 28 with a single dose of 5.0 log₁₀PFU of wt DEN2 (Tonga/74) and blood was collected for 10 days. Virus titer in post-challenge sera was determined by plaque assay in Vero cells. Monkeys inoculated with wt DEN2 (Tonga/74) or rDEN2 were viremic for 4-5 days with a mean peak titer of 2.1 or 1.9 log₁₀PFU/ml, respectively.

Monkeys inoculated with rDEN2Δ30 were viremic for 2-3 days with a mean peak titer of 1.7 log₁₀PFU/ml (Table 24, FIG. 7), indicating that the Δ30 mutation is capable of attenuating DEN2, although not to the same low level observed in rDEN1Δ30 (Table 16). As expected for an attenuated virus, the immune response, as measured by neutralizing antibody titer, was lower following inoculation with rDEN2Δ30 compared to inoculation with wt DEN2 (Tonga/74) or rDEN2 (Table 24), yet sufficiently high to protect the animals against wt DEN2 virus challenge (Table 25). Thus, the decreased number of days of viremia for rDEN2Δ30, the decreased mean peak titer, and the decreased serum antibody response indicate that the Δ30 mutation attenuates rDEN2 for rhesus monkeys.

TABLE 24

rDEN2Δ30 is slightly more attenuated for rhesus monkeys than rDEN2

Virus^a	monkeys	viremia	monkey^b	(log₁₀PFU/ml ± SE)	Day 0	Day 28

mock	2	0	0	<0.7	<10	<10
DEN2 (Tonga/74)	4	4	4.5	2.1 ± 0.3	<10	311
rDEN2 (Vero)	4	4	4.0	1.9 ± 0.1	<10	173
rDEN2Δ30 (Vero)	4	4	2.8	1.7 ± 0.2	<10	91

^aGroups of rhesus monkeys were inoculated subcutaneously with 10⁵PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10, 12, and 28. Virus titer was determined by plaque assay in Vero cells.
^bViremia was not detected in any monkey after day 8.

TABLE 25

rDEN2Δ30 protects rhesus monkeys from wt DENT2 virus challenge

			Geometric mean
	Mean no. of		serum neutralizing
	viremic days per	Mean peak	antibody titer
No. of	monkey after	virus titer	(reciprocal dilution)

Virus^a	monkeys	DEN2 challenge	(log₁₀PFU/ml ± SE)	Day 28	Day 56

Mock	2	4.0	2.1 ± 0.1	<10	338
DEN2 (Tonga/74)	4	0	<0.7	311	334
rDEN2 (Vero)	4	0	<0.7	173	318
rDEN2Δ30 (Vero)	4	0	<0.7	91	267

^a28 days after inoculation with the indicated viruses, monkeys were challenged subcutaneously with 10⁵PFU DEN2 (Tonga/74) in a 1 ml dose. Serum was collected on days 28 to 34, 36, 38, and 56. Virus titer was determined by plaque assay in Vero cells.

The infectivity of DEN2 (Tonga/74), rDEN2 and rDEN2Δ30 for Aedes aegypti mosquitoes via an artificial bloodmeal was evaluated using the methods described in detail in Example 5. However at doses of 3.3 to 3.5 log₁₀pfu ingested, none of these three viruses infected any mosquitoes, indicating that DEN2 (Tonga/74) is poorly infectious for Aedes aegypti. As with rDEN1, the genetic basis for this lack of infectivity remains to be defined. The important property of restricted infectivity for the mosquito midgut is highly desirable in a vaccine candidate because it would serve to greatly restrict transmission of the virus from a vaccinee to a mosquito vector.

Several missense mutation identified in rDEN4 have been demonstrated to confer attenuated replication in suckling mouse brain and/or SCID-HuH-7 mice (Blaney, J. E. et al. 2002 Virology 300:125-139; Blaney, J. E. et al. 2001 J Virol 75:9731-9740). In addition, missense mutations that enhance replication of rDEN4 virus in Vero cells have been characterized. The significant sequence conservation among the DEN virus serotypes provides a strategy by which the mutations identified in rDEN4 viruses are contemplated as being used to confer similar phenotypes upon rDEN2 virus. Six mutations identified in rDEN4 virus that are at a site conserved in rDEN2 virus are being introduced into the p2 and p2Δ30 cDNA clones (Table 26). Specifically, two rDEN4 mutations, NS3 4891 and 4995, which confer Vero cell adaptation phenotypes and decreased replication in mouse brain, one mutation, NS4B 7182, which confers a Vero cell adaptation phenotype, and three mutations, NS1 2650, NS3 5097, and 3′ UTR 10634 which confer decreased replication in mouse brain and SCID-HuH-7 mice are being evaluated. These mutations have been introduced into sub-cloned fragments of the p2 and p2Δ30 cDNA clones, and have been used to generate mutant full-length cDNA clones (Table 26), from which virus has been recovered in C6/36 cells (Table 27). The evaluation of these mutant rDEN2 viruses is contemplated as determining that such point mutations can be transported into a different DEN virus serotype and confer a similar useful phenotype, as has been demonstrated for the Δ30 deletion mutation.

TABLE 26

Introduction of conserved point mutations characterized in
rDEN4 viruses into rDEN2 Tonga/74 virus.

Phenotype in
rDEN4 virus		Mutation in rDEN4 virus	Mutation introduced into DEN2 virus

Vero	Mouse	SCID-		Nucleo-	Amino	Amino	Nucleo-	Amino	Amino	RE
Adap-	brain	HuH-7		tide	acid	acid	tide	acid	acid	site/mutagenic
tation^a	att^b	att^c	Gene/region	position	position^d	change	position	position^d	change	region^e

+	+	−	NS3	4891	1597	Ile > Thr	4889	1598	Ile > Thr	Nar I
										CCAcgGGcGCCGT

+	+	−	NS3	4995	1632	Ser > Pro	4993	1633	Ser > Pro	Stu I
										AAGGccTGGA

+	−	−	NS4b	7182	2361	Gly > Ser	7189	2365	Gly > Ser	Xma I
										TAtccCCGGGAC

−	+	+	NS1	2650	850	Asn > Ser	2648	851	Asn > Ser	Sac I
										AGAgcTctcTC

−	+	+	NS3	5097	1666	Asp > Asn	5095	1667	Asp > Asn	Xma I
										GaATCTCCACCCgGA

−	+	+	3′ UTR	10634	n/a^f	n/a	10698	n/a	n/a	none
										CTGTcGAATC

^aPresence of the indicated mutation increases plaque size in Vero cells two-fold or greater than rDEN4 virus.
^bPresence of the indicated mutation restricts replication in 7-day-old mouse brain greater than 100-fold compared to rDEN4 virus.
^cPresence of the indicated mutation restricts replication in SCID-HuH-7 mice greater than 100-fold compared to rDEN4 virus.
^dAmino acid position in DEN4 or DEN2 polyprotein beginning with the methionine residue of the C protein (nucleotides 102-104 or 97-99, respectively) as position 1.
^ePrimers were engineered which introduced (underline) translationally-silent restriction enzyme (RE) sites. Lowercase letters indicate nt changes and bold letters indicate the site of the 5-FU mutation, which in some oligonucleotides differs from the original nucleotide substitution change in order to create a unique RE site. The change preserves the codon for the amino acid substitution.
^fNucleotide substitution in the 3′ UTR is U > C in DEN4 and DEN2 virus.

TABLE 27

rDEN2 viruses containing conserved 5-FU mutations
are recovered in C6/36 cells.

Virus	Nucleotide	Virus titer of transfection
(nucleotide	position in	harvest (day 7) determined
position in rDEN2)	rDEN4	in C6/36 cells (log₁₀PFU/ml)

rDEN2-4889	4891	7.6
rDEN2-4993	4995	7.2
rDEN2-7189	7182	3.5
rDEN2-2648	2650	—^a
rDEN2-5095	5097	—^a
rDEN2-10698	10634	7.7

^aTransfection has not yet been attempted.

EXAMPLE 4 Generation and Characterization of a Recombinant DEN3 Virus Containing the Δ30 Mutation

Because rDEN1Δ30 was satisfactorily attenuated, we sought to extend our technology to the creation of a DEN3 vaccine candidate. To do this, the Δ30 mutation was introduced into the cDNA of DEN3, similar to the method used to create rDEN2Δ30. A DEN3 virus isolate from a 1978 dengue epidemic in rural Sleman, Central Indonesia (Sleman/78) (Gubler, D. J. et al. 1981 Am J Trop Med Hyg 30:1094-1099) was chosen to represent wt DEN3. The genome of DEN3 (Sleman/78) was sequenced in its entirety and served as consensus sequence for the construction of a full-length cDNA clone (Appendix 2). cDNA fragments of DEN3 (Sleman/78) were generated by reverse-transcription of the genome as indicated in FIG. 8A. Each fragment was subcloned into a plasmid vector and sequenced to verify that it matched the consensus sequence as determined for the virus. This yielded six cloned cDNA fragments spanning the genome. Cloned fragments were modified as follows: Fragment 5, representing the 5′ end of the genome was abutted to the SP6 promoter preceded by an AscI restriction site; Fragment 1L was modified to contain a translationally-silent SpeI restriction site at genomic nucleotide 2345; Fragment 1R was modified to contain a translationally-silent SpeI restriction site also at genomic nucleotide 2345, and to stabilize the eventual full-length clone, three additional translationally-silent mutations at nucleotides 2354-2356, 2360-2362, and 2399 were created to ensure that translation stop codons were present in all reading frames other than that used to synthesize the virus polyprotein; Fragment 3 was modified at nucleotide 9007 to ablate a naturally occurring KpnI restriction site; and Fragment 4, representing the 3′ end of the genome was abutted to a KpnI restriction site. Each fragment was added incrementally between the AscI and KpnI restriction sites of DEN4 cDNA clone p4 (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13) to generate a full-length DEN3 cDNA clone with the same vector background successfully used to generate rDEN4 and rDEN2. However, a stable, full-length clone could not be recovered in E. coli when fragments 1L and 1R were combined into the same cDNA molecule. To overcome this instability, a synthetic DNA linker (FIG. 8A) containing redundant termination codons in each of the forward and reverse open reading frames was introduced into the SpeI restriction site at the same time that fragment 1L was added to complete the full-length cDNA construct. The resulting p3 clone containing the linker sequence was stable in E. coli, indicating that the linker sequence was sufficient to interrupt whatever deleterious element exists in this region. cDNA clone p3 was sequenced and the virus genome was found to match the DEN3 (Sleman/78) consensus sequence, with the exception of the linker sequence and translationally-silent modifications noted above (Appendix 2—shown with the linker sequence removed). The Δ30 mutation was introduced into Fragment 4 to generate Fragment 4Δ30. To create p3Δ30, the Fragment 4 region of p3 was replaced with Fragment 4Δ30 (FIG. 8A, B).

For transcription and generation of infectious virus, cDNA plasmids p3 and p3Δ30 were digested with SpeI and religated to remove the linker sequence, linearized with Acc65I (isoschizomer of KpnI which cleaves leaving only a single 3′ nucleotide), and used as templates in a transcription reaction using SP6 RNA polymerase as previously described (Blaney, J. E. et. al. 2002 Virology 300:125-139). Transcripts were introduced into Vero cells or C6/36 mosquito cells using liposome-mediated transfection and cell culture supernatants were harvested on day 14.

rDEN3 virus was recovered from the p3 cDNA in both Vero and C6/36 cells, while rDEN3Δ30 was recovered from the p3Δ30 cDNA clone in only C6/36 cells (Table 28). The level of infectious virus recovered in C6/36 cells was comparable for the p3 and p3Δ30 cDNA clones when assayed by plaque titration in Vero or C6/36 cells. As previously observed, the efficiency of transfection in C6/36 cells was higher than that in Vero cells. Two rDEN3Δ30 viruses were recovered from independent cDNA clones, #22 and #41.

TABLE 28

rDEN3 virus is recovered in Vero and C6/36 cells,
but rDEN3Δ30 virus is recovered only in C6/36 cells.

		Virus titer of transfection
		harvest (day 14)
		determined in the indicated
Transfection	cDNA	cell type (log₁₀PFU/ml)

cell type	construct	Clone	Virus	Vero cells	C6/36 cells

Vero cells	p3	#50	rDEN3	5.2	6.3
	p3Δ30	#22	rDEN3Δ30	<0.7	<0.7
	p3Δ30	#41	rDEN3Δ30	<0.7	<0.7
C6/36 cells	p3	#50	rDEN3	5.2	6.0
	p3Δ30	#22	rDEN3Δ30	5.9	6.9
	p3Δ30	#41	rDEN3Δ30	5.1	7.2

To produce working stocks of viruses, transfection harvests will be passaged and terminally diluted in Vero cells, and genomic sequences of the viruses will be determined. To improve virus yield in Vero cells, the Vero cell adaptation mutation previously identified in rDEN4 at nucleotide 7162 was introduced into the homologous NS4B region of p3 and p3Δ30 to create p3-7164 and p3Δ30-7164. This mutation creates a Val to Ala substitution at amino acid position 2357. As demonstrated for rDEN2Δ30, this mutation allowed for the direct recovery of virus in Vero cells (Table 27) and is anticipated to have the same effect for rDEN3Δ30.

To initially assess the ability of the Δ30 mutation to attenuate rDEN3 virus in an animal model, the replication of DEN3 (Sleman/78), rDEN3, and rDEN3Δ30 viruses will be evaluated in SCID-HuH-7 mice and rhesus monkeys. Previously, attenuation of vaccine candidates in SCID-HuH-7 mice has been demonstrated to be predictive of attenuation in the rhesus monkey model of infection (Examples 1 and 2). The evaluation of these mutant rDEN3 viruses is contemplated as determining that the Δ30 deletion mutations can be transported into the DEN3 virus serotype and confer a similar useful phenotype, as has been demonstrated for DEN1, DEN2, and DEN4.

In summary, the strategy of introducing the Δ30 mutation into wild-type DEN viruses of each serotype to generate a suitably attenuated tetravalent vaccine formulation is a unique and attractive approach for several reasons. First, the mutation responsible for attenuation is a 30-nucleotide deletion in the 3′ UTR, thus assuring that all of the structural and non-structural proteins expressed by each of the four components of the tetravalent vaccine are authentic wild-type proteins. Such wild-type proteins should elicit an antibody response that is broad based, rather than based solely on the M and E proteins that are present in chimeric dengue virus vaccine candidates (Guirakhoo, F. et al. 2001 J Virol 75:7290-304; Huang, C. Y. et al. 2000 J Virol 74:3020-8). The uniqueness of this approach derives from the fact that other live attenuated dengue virus vaccines have mutations in their structural or non-structural proteins (Butrapet, S. et al. 2000 J Virol 74:3011-9; Puri, B. et al. 1997 J Gen Virol 78:2287-91), therefore the immune response induced by these viruses will be to a mutant protein, rather than a wild-type protein. Second, deletion mutations are genetically more stable than point mutations, and reversion of the attenuation phenotype is unlikely. In humans, DEN4Δ30 present in serum of vaccinees retained its Δ30 mutation, confirming its genetic stability in vivo (Durbin, A. P. et al. 2001 Am J Trop Med Hyg 65:405-13). The attenuating mutations in other existing dengue live attenuated vaccine candidates are based on less stable point mutations (Butrapet, S. et al. 2000 J Virol 74:3011-9: Puri, B. et al. 1997 J Gen Virol 78:2287-91). Third, since the Δ30 mutation is common to each of the four viruses of the tetravalent vaccine, recombination between any of the four vaccine serotypes would not lead to loss of the attenuating mutation or reversion to a wild-type phenotype. Recombination between components of the trivalent polio vaccine has been observed (Guillot, S. et al. 2000 J Virol 74:8434-43), and naturally occurring recombinant dengue viruses have been described (Worobey, M. et al. 1999 PNAS USA 96:7352-7) indicating the ability of this flavivirus to exchange genetic elements between two different viruses. Clearly, gene exchange is readily achieved between different DEN virus serotypes using recombinant cDNA techniques (Bray, M. and Lai, C. J. 1991 PNAS USA 88:10342-6). Fourth, viruses with wild-type structural proteins appear more infectious than viruses with altered structural proteins (Huang, C. Y. et al. 2000 J Virol 74:3020-80). This permits the use of a low quantity of each of the four virus components in the final vaccine, contributing to the low cost of manufacture. Low-cost manufacture is an essential element in defining the ultimate utility of a dengue virus vaccine.

EXAMPLE 5 Generation and Characterization of Intertypic Chimeric DEN2 Viruses Containing the Δ30 Mutation

The four serotypes of dengue virus are defined by antibody responses induced by the structural proteins of the virus, primarily by a neutralizing antibody response to the envelope (E) protein. These structural proteins include the E glycoprotein, a membrane protein (M), and a capsid (C) protein. The mature virus particle consists of a well-organized outer protein shell surrounding a lipid bilayer membrane and a less-well-defined inner nucleocapsid core (Kuhn, R. J. et al. 2002 Cell 108:717-25). The E glycoprotein is the major protective antigen and readily induces virus neutralizing antibodies that confer protection against dengue virus infection. An effective dengue vaccine must therefore minimally contain the E protein of all four serotypes, namely DEN1, DEN2, DEN3, and DEN4, thereby inducing broad immunity and precluding the possibility of developing the more serious illnesses DHF/DSS, which occur in humans during secondary infection with a heterotypic wild-type dengue virus. Based on a previously reported strategy (Bray, M. and Lai, C. J. 1991 PNAS USA 88:10342-6), a recombinant cDNA technology is being used to develop a live attenuated tetravalent dengue virus vaccine composed of a set of intertypic chimeric dengue viruses bearing the structural proteins of each serotype.

Following the identification of a suitably attenuated and immunogenic DEN4 recombinant virus, namely DEN4Δ30 (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13), chimeric viruses based on the DEN4 cDNA have been generated in which the C-M-E (CME) or M-E (ME) genes have been replaced with the corresponding genes derived from the prototypic DEN2 New Guinea C (NGC) strain (FIG. 9A). To create the CME chimeric viruses, the BglII/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a similar region derived from DEN2. Likewise, to create the ME chimeric viruses, the PstI/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a homologous region derived from DEN2. The nucleotide and amino acid sequences of the resulting junctions are shown in FIG. 9B. The GenBank accession number for the nucleotide sequence of rDEN4Δ30 is AF326837. The GenBank accession number for DEN2 NGC is M29095, which represents the mouse neurovirulent strain of DEN2 NGC and differs from the prototypic strain used here as previously documented (Bray, M. et al. 1998 J Virol 72:1647-51).

For transcription and generation of virus, chimeric cDNA clones were linearized and used as template in a transcription reaction using SP6 RNA polymerase as described (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13). Transcripts were introduced into Vero cells using liposome-mediated transfection and recombinant dengue virus was harvested on day 7. The genomes of the resulting viruses were confirmed by sequence analysis of viral RNA isolated from recovered virus as previously described (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13). Incidental mutations arising from virus passage in tissue culture were identified in all viruses and are listed in Table 29. Notably, each virus contained a missense mutation in NS4B corresponding to a previously identified mutation from rDEN4 and associated with adaptation to replication in Vero cells (See Table 30 for correlation of nucleotide positions between rDEN4 and chimeric viruses). All viruses replicated in Vero cells to titers in excess of 6.0 log₁₀PFU/ml, indicating that the chimeric viruses, even those containing the Δ30 mutation, replicate efficiently in cell culture, a property essential for manufacture of the vaccine.

TABLE 29

Missense mutations observed among the Vero cell-grown
chimeric DEN2/4 viruses

				Amino	Amino
		Nucleotide	Nucleotide	acid	acid
Virus	Gene	position	change	position	change

rDEN2/4(CME)	NS4B	7161^a	A > U	2355	Leu > Phe
rDEN2/4Δ30(CME)	M	743	G > A	216	Gly > Glu
	E	1493	C > U	466	Ser > Phe
	NS4B	7544^b	C > T	2483	Ala > Val
rDEN2/4(ME)	E	1065	U > C	322	Phe > Leu
	NS4B	7163^a	A > U	2354	Leu > Phe
rDEN2/4Δ30(ME)	NS4B	7163^a	A > C	2354	Leu > Phe

^aSame nucleotide position as 7163 in rDEN4.
^bSame nucleotide position as 7546 in rDEN4.

TABLE 30

Nucleotide (nt) length differences for DEN chimeric viruses
compared to rDEN4.

rDEN	nt difference		Amino
chimeric	from rDEN4	ORF start	acid length

virus	(following CME region)	(nt position)	C	M	E

1/4 ME	0	102	113	166	495
1/4 CME	+3	102	114	166	495
2/4 ME	0	102	113	166	495
2/4 CME	−2	97	114	166	495
3/4 ME	−6	102	113	166	493
3/4 CME	−3	102	114	166	493
rDEN4	—	102	113	166	495

Results of a safety, immunogenicity, and efficacy study in monkeys are presented in Table 31. Monkeys inoculated with wild-type DEN2 were viremic for approximately 5 days with a mean peak titer of 2.1 log₁₀PFU/ml, while monkeys inoculated with any of the chimeric DEN2 viruses were viremic for 1.2 days or less and had a mean peak titer of less than 1.0 log₁₀PFU/ml. This reduction in the magnitude and duration of viremia clearly indicates that the chimeric viruses containing either the CME or ME proteins of DEN2 were more attenuated than the parental DEN2 NGC virus. Neither the animals receiving the wild-type DEN2 nor the DEN2/4 chimeric viruses were ill. The decreased replication of the attenuated viruses in monkeys is accompanied by a reduction in the immune response of inoculated monkeys. This is indicated in Table 31 by approximately a 5-fold reduction in the level of neutralizing antibody following inoculation with the chimeric viruses in comparison to titers achieved in animals inoculated with wild-type virus. Addition of the Δ30 mutation to the CME chimeric virus further attenuated the virus, such that rDEN2/4Δ30(CME) did not replicate in monkeys to a detectable level and did not induce a detectable immune response. This virus appeared over-attenuated, and if similar results were seen in humans, this virus would not be suitable for use as a vaccine. However, addition of the Δ30 mutation to the ME chimeric virus did not further attenuate this chimeric virus and the resulting rDEN2/4Δ30(ME) virus appears satisfactorily attenuated and immunogenic for use as a vaccine.

TABLE 31

Chimerization between dengue virus types 2 and 4 results in
recombinant viruses which are attenuated for rhesus monkeys.

				Mean peak	Geometric mean
			Mean no.	virus titer	neutralizing
			days with	(log₁₀	antibody titer
Group*	Virus	n	viremia	pfu/ml)	(reciprocal)

1	rDEN2/4 (CME)	6	1.2	0.9	50
2	rDEN2/4Δ30 (CME)	8	0	<0.7	<5
3	rDEN2/4 (ME)	4	1.0	0.8	76
4	rDEN2/4Δ30 (ME)	4	0.3	0.7	62
5	DEN2 NGC	6	5.5	2.1	312

*Rhesus monkeys were inoculated subcutaneously with 5.0 log₁₀PFU of virus. Serum samples were collected daily for 10 days. Serum for neutralization assay was collected on day 28. Serum samples obtained before virus inoculation had a neutralizing antibody titer of <5.

As described in the previous examples, SCID mice transplanted with the HuH-7 cells are a sensitive model for the evaluation of dengue virus attenuation. Each chimeric DEN2/4 virus was inoculated into groups of SCID-HuH-7 mice and levels of virus in the serum were determined (Table 32). Chimeric viruses replicated to levels between 20- and 150-fold lower than either of the parental viruses (rDEN4 and DEN2-NGC). CME chimeric viruses were slightly more attenuated than the comparable ME chimeric viruses, with the Δ30 mutation providing a 0.5 log₁₀reduction in replication. This level of attenuation by the Δ30 mutation was similar to that observed previously for rDEN4Δ30.

TABLE 32

Chimerization between dengue virus types 2 and 4 results in
recombinant viruses which are attenuated for HuH-7-SCID mice.

	No. of	Mean peak virus titer	Statistical
Virus^a	mice	(log₁₀pfu/ml ± SE)	group^b

rDEN4	32	6.3 ± 0.2	A
DEN2-NGC	9	6.1 ± 0.2	A
rDEN2/4 (CME)	7	4.4 ± 0.3	B
rDEN2/4Δ30 (CME)	7	3.9 ± 0.3	B
rDEN2/4 (ME)	6	4.8 ± 0.5	B
rDEN2/4Δ30 (ME)	9	4.3 ± 0.2	B

^aGroups of HuH-7-SCID mice were inoculated into the tumor with 4.0 log₁₀PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.
^bMean peak titers were assigned to statistical groups using the Tukey post-hoc test (P < 0.05). Groups with the same letter designation are not significantly different.

To evaluate the replication levels of each DEN2/4 chimeric virus in mosquitoes, two different genera of mosquitoes were experimentally infected. Aedes aegypti were infected by ingesting a virus-containing blood meal. By evaluating the presence of virus antigen in both the midgut and head tissue, infectivity could be determined for the local tissues (midgut), and the ability of virus to disseminate and replicate in tissues beyond the midgut barrier (head) could also be measured. The presence of virus in the head is limited by the ability of the ingested virus to replicate in the midgut and then disseminate to the salivary glands in the head, as well as the innate ability of the virus to replicate in the salivary glands. Intrathoracic inoculation of virus into Toxorhynchites splendens bypasses the mosquito midgut barrier. Parental viruses rDEN4 and DEN2-NGC readily infect Ae. aegypti and T splendens (Table 33), with DEN2-NGC appearing to be much more infectious in T. splendens. Each of the rDEN2/4 chimeric viruses was also tested in both mosquito types. In many cases it was not possible to inoculate Ae. aegypti with an undiluted virus stock of sufficient titer to achieve a detectable infection due to the very low infectivity of several of the viruses. Nevertheless, it is clear that the rDEN2/4 chimeric viruses are less infectious for the midgut and head. Parental viruses rDEN4 and DEN2-NGC, administered at a maximum dose of approximately 4.0 log₁₀PFU, were detectable in 74% and 94% of midgut preparations, and 32% and 71% of head preparations, respectively. Among the chimeric viruses, the highest level of infectivity, as observed for rDEN2/4Δ30 (CME), resulted in only 26% infected midgut samples and 6% head samples. In the more permissive T. splendens, the rDEN2/4 chimeric viruses were generally less infectious than either parental virus, with CME chimeric viruses being less infectious than ME viruses. It has previously been reported for DEN4 that the Δ30 mutation does not have a discernable effect on virus infectivity in T. splendens similar to that observed here for the rDEN2/4 chimeric viruses (Troyer, J. M. et al. 2001 Am J Trop Med Hyg 65:414-419).

TABLE 33

Dengue 2/4 chimeric viruses are less infectious compared to
either parental virus strain in mosquitoes

	Toxorhynchites splendens	Aedes aegypti
	(intrathoracic inoculation)	(oral infection)

Dose^a

No.

%

Dose^c

No.

% infected^d

Virus	log₁₀pfu	tested	infected^b	log₁₀pfu	tested	Midgut	Head

rDEN4	3.3	6	83	3.8	38	74	32
	2.3	7	57	2.8	15	26	6
	1.3	6	0	1.8	20	10	5
			MID₅₀= 2.2			MID₅₀= 3.4	MID₅₀≧ 4.1
DEN2-NGC	2.5	5	100	4.0	17	94	71
	1.2	15	93	3.0	25	36	16
	0.2	4	75	2.0	30	0	0
	0.02	8	38			MID₅₀= 3.2	MID₅₀= 3.6
			MID₅₀= 0.5
rDEN2/4 (CME)	3.9	9	11	4.4	11	9	0
	2.9	5	0	3.4	10	0	0
			MID₅₀≧ 4.3			MID₅₀≧ 4.9	Nc^e
rDEN2/4Δ30	3.5	6	17	4.0	15	26	6
(CME)	2.5	6	17	3.0	10	0	0
			MID₅₀≧ 3.9			MID₅₀≧ 4.3	MID₅₀≧ 4.5
rDEN2/4 (ME)	3.4	6	100	3.9	23	4	0
	2.4	5	20			MID₅₀≧ 4.4	Nc
	1.4	5	0
			MID₅₀= 2.8
rDEN2/4Δ30	2.6	11	9	3.1	30	0	0
(ME)			MID₅₀≧ 3.0			nc	Nc

^aAmount of virus present in 0.22 μl inoculum.
^bPercentage of mosquitoes with IFA detectable antigen in head tissue prepared 14 days after inoculation.
^cVirus titer ingested, assuming a 2 μl bloodmeal.
^dPercentage of mosquitoes with IFA detectable antigen in midgut or head tissue prepared 21 days after oral infection. When virus infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID₅₀was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.
^enc = not calculated, since virus antigen was not detected.

Chimerization of the DEN2 structural genes with rDEN4Δ30 virus resulted in a virus, rDEN2/4Δ30(CME), that had decreased replication in Vero cells compared to either parent virus. To evaluate Vero cell adaptation mutations (Blaney, J. E. et al. 2002 Virology 300:125-139) as a means of increasing the virus yield of a DEN vaccine candidate in Vero cells, selected mutations were introduced into this chimeric virus. Accordingly, rDEN2/4Δ30(CME) viruses bearing adaptation mutations were recovered, terminally diluted, and propagated in C6/36 cells to determine if the virus yield in Vero cells could be increased.

rDEN2/4Δ30(CME) viruses bearing Vero cell adaptation mutations were generated as follows. DNA fragments were excised from rDEN4 cDNA constructs encompassing single or double DEN4 Vero cell adaptation mutations and introduced into the cDNA clone of rDEN2/4Δ30(CME). The presence of the Vero cell adaptation mutation was confirmed by sequence analysis, and RNA transcripts derived from the mutant cDNA clones were transfected, terminally diluted, and propagated in C6/36 cells.

For evaluation of growth kinetics, Vero cells were infected with the indicated viruses at a multiplicity of infection (MOI) of 0.01. Confluent cell monolayers in duplicate 25-cm²tissue culture flasks were washed and overlaid with a 1 ml inoculum containing the indicated virus. After a two hour incubation at 37° C., cells were washed three times in MEM and 5 ml of MEM supplemented with 2% FBS was added. A 1 ml aliquot of tissue culture medium was removed, replaced with fresh medium, and designated the day 0 time-point. At the indicated time points post-infection, 1 ml samples of tissue culture medium were removed, clarified by centrifugation, and frozen at −80° C. The level of virus replication was assayed by plaque titration in C6/36 cells and visualized by immunoperoxidase staining. The limit of detection was <0.7 log₁₀PFU/ml.

The growth properties of rDEN2/4Δ30(CME) viruses bearing single Vero cell adaptation mutations at NS4B-7153, -7162, -7163, -7182, NS5-7630 or three combinations of mutations were compared in Vero cells with rDEN2/4Δ30 (CME) virus (FIG. 10). Without an introduced Vero cell adaptation mutation, rDEN2/4Δ30(CME) virus yield peaked at 4.4 log₁₀PFU/ml. Each individual adaptation mutation and the combined mutations conferred a substantial increase in replication. Specifically, rDEN2/4Δ30(CME)-7182 grew to the highest titer of 7.1 log₁₀PFU/ml, which was a 500-fold increase in yield. rDEN2/4Δ30(CME)-7162 had the lowest yield but still was increased 125-fold over the level of replication by rDEN2/4Δ30(CME) virus. Introduction of two adaptation mutations into rDEN2/4Δ30(CME) virus did not significantly increase virus yield over that of viruses bearing single Vero cell adaptation mutations. The observed increase of up to 500-fold in virus yield by the introduction of a Vero cell adaptation mutation into this chimeric vaccine candidate demonstrates the value of identifying and characterizing specific replication-promoting sequences in DEN viruses.

These results have particular significance for the development of a live attenuated dengue virus vaccine. First, it is clear that chimerization leads to attenuation of the resulting virus, as indicated by studies in rhesus monkeys, HuH7-SCID mice and mosquitoes. Although this conclusion was not made in the previous study with DEN2/DEN4 or DEN1/DEN4 chimeric viruses (Bray, M. et al. 1996 J Virol 70:4162-6), careful examination of the data would suggest that the chimeric viruses are more attenuated in monkeys compared to the wild-type parent viruses. Second, the Δ30 mutation can further augment this attenuation in a chimeric-dependent manner. Specifically, in this example, chimeric viruses bearing the CME region of DEN2 were over-attenuated by the addition of Δ30, whereas the attenuation phenotype of chimeric viruses bearing just the ME region of DEN2 was unaltered by the addition of the Δ30 mutation. This unexpected finding indicates that in a tetravalent vaccine comprised of individual component viruses bearing a shared attenuating mutation, such as the Δ30 mutation, only ME chimeric viruses can be utilized since CME chimeric viruses bearing the Δ30 mutation can be over-attenuated in rhesus monkeys and might provide only limited immunogenicity in humans.

EXAMPLE 6 Generation and Characterization of Intertypic Chimeric DEN3 Viruses Containing the Δ30 Mutation

Chimeric viruses based on the DEN4 cDNA have been generated in which the CME or ME genes have been replaced with the corresponding genes derived from DEN3 (Sleman/78), a virus isolate from the 1978 dengue outbreak in the Sleman region of Indonesia (Gubler, D. J. et al. 1981 Am J Trop Med Hyg 30:1094-1099) (Appendix 2). As described in Example 5 for the DEN2 chimeric viruses, CME chimeric viruses for DEN3 were generated by replacing the BglII/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 with a similar region derived from DEN3 (Sleman/78) (FIG. 11A). Likewise, to create the ME chimeric viruses, the PstI/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a similar region derived from DEN3 (Sleman/78). The nucleotide and amino acid sequences of the resulting junctions are shown in FIG. 11B. The genomes of the resulting viruses were confirmed by sequence analysis of viral RNA isolated from recovered virus as previously described (Durbin, A. P et al. 2001 Am J Trop Med Hyg 65:405-13). Incidental mutations arising from virus passage in tissue culture were identified in all viruses and are listed in Table 34. Notably, each virus contained a missense mutation in NS4B corresponding to a previously identified mutation from rDEN4 and associated with adaptation to growth in Vero cells (See Table 30 for correlation of nucleotide positions between rDEN4 and chimeric viruses). All viruses replicated in Vero cells to titers in excess of 5.7 log₁₀PFU/ml, indicating that the chimeric viruses, even those containing the Δ30 mutation, replicate efficiently in cell culture, a property essential for manufacture of the vaccine.

TABLE 34

Missense mutations observed among Vero cell-grown chimeric
DEN3/4 viruses

rDEN3/4Δ30	M	825	T > C	242	Phe > Leu
(CME)	E	1641	C > T	514	Leu > Phe
	E	2113	A > G	671	Lys > Arg
	NS4B	7159^a	T > C	2353	Leu > Ser
rDEN3/4(ME)	M	460	A > G	120	Asp > Gly
	NS4B	7177^b	G > U	2359	Gly > Val
	NS5	7702	C > U	2534	Ser > Phe
rDEN3/4Δ30	E	1432	A > U	444	Gln > Leu
(ME)	NS4B	7156^a	U > C	2352	Leu > Ser
	NS5	8692	A > C	2864	Asn > His

^aSame nucleotide position as 7162 in rDEN4.
^bSame nucleotide position as 7183 in rDEN4.

As described in the previous examples, SCID mice transplanted with HuH-7 cells are a sensitive model for the evaluation of dengue virus attenuation. Each chimeric DEN3/4 virus was inoculated into groups of SCID-HuH-7 mice and levels of virus in the serum were determined (Table 35). While chimeric virus rDEN3/4 (CME) was not attenuated, the remaining chimeric viruses replicated to levels between 40- and 400-fold lower than either of the parental viruses (rDEN4 and DEN3-Sleman/78). In the CME chimeric virus, the Δ30 mutation providing a remarkable 2.7 log₁₀reduction in replication. This level of attenuation conferred by the Δ30 mutation in the CME chimeric virus was much greater than that observed previously for rDEN4Δ30. The rDEN3/4 (ME) virus was 100-fold reduced in replication compared to either parent virus indicating that the ME chimerization was attenuating per se. Addition of the Δ30 mutation to rDEN3/4 (ME) did not result in additional attenuation.

TABLE 35

Chimerization between dengue virus types 3 and 4 results in
recombinant viruses which are attenuated for HuH-7-SCID mice.

rDEN4	32	6.3 ± 0.2	A
DEN3-Sleman/78	23	6.4 ± 0.2	A
rDEN3/4 (CME)	7	6.4 ± 0.6	A
rDEN3/4Δ30 (CME)	5	3.7 ± 0.4	B
rDEN3/4 (ME)	6	4.2 ± 0.7	B
rDEN3/4Δ30 (ME)	7	4.7 ± 0.4	A, B

^aGroups of HuH-7-SCID mice were inoculated into the tumor with 4.0 log₁₀PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.
^bMean peak titers were assigned to statistical groups using the Tukey post-hoc test (P < 0.05). Groups with the same letter designation are not significantly different.

Evaluation of the replication and immunogenicity of the DEN3 chimeric recombinant viruses and wild-type DEN3 virus in monkeys was performed as described in Example 5. Results of this safety and immunogenicity study in monkeys are presented in Table 36. Monkeys inoculated with rDEN3/4(CME) and wild-type DEN (Sleman/78) were viremic for approximately 2 days with a mean peak titer of between 1.6 and 1.8 log₁₀PFU/ml, respectively, indicating that chimerization of the CME structural genes of DEN3 did not lead to attenuation of virus replication, a different pattern than that observed for DEN2 chimerization (Table 31). However, chimerization of the ME structural genes resulted in attenuated viruses with undetectable viremia in monkeys, although all monkeys seroconverted with a greater than 10-fold increase in serum antibody levels. As expected for an attenuated virus, the immune response, as measured by neutralizing antibody titer, was lower following inoculation with any of the chimeric viruses compared to inoculation with wt DEN3 (Sleman/78), yet sufficiently high to protect the animals against wtDEN3 virus challenge (Table 37). It is clear that addition of the Δ30 mutation to rDEN3/4(CME) was capable of further attenuating the resulting virus rDEN3/4Δ30(CME).

TABLE 36

The Δ30 mutation further attenuates rDEN3/4(CME) for rhesus monkeys

			Geometric mean
		Mean peak	serum neutralizing
	Mean no.	virus titer	antibody
	of viremic	(log₁₀	titer (reciprocal
No. of	days per	PFU/ml ±	dilution)

Virus^a	monkeys	monkey^b	SE)	Day 0	Day 28

DEN3	4	2.3	1.8	<5	707
(Sleman/78)
rDEN3/4	4	2.0	1.6	<5	211
(CME)
rDEN3/4Δ30	4	0	<1.0	<5	53
(CME)
rDEN3/4	4	0	<1.0	<5	70
(ME)
rDEN3/4Δ30	4	0	<1.0	<5	58
(ME)

^aGroups of rhesus monkeys were inoculated subcutaneously with 10⁵PFU of the indicated virus in a 1 ml dose. Serum was collected on days 0 to 6, 8, 10, 12, and 28. Virus titer was determined by plaque assay in Vero cells.
^bViremia was not detected in any monkey after day 4.

TABLE 37

rDEN3/4 chimeric viruses protect rhesus monkeys from
wt DEN3 virus challenge

		Geometric
		mean serum
		neutralizing
Mean no. of	Mean peak	antibody titer
viremic days	virus titer	(reciprocal
per monkey	(log₁₀	dilution)

	No. of	after rDEN3	PFU/ml ±	Day	Day
Virus^a	monkeys	challenge	SE)	28	56

Mock	2	5.0	2.5 ± 0.4	<5	372
DEN3 (Sleman/78)	4	0	<1.0	707	779
rDEN3/4 (CME)	4	0	<1.0	211	695
rDEN3/4Δ30 (CME)	4	0.8	1.1 ± 0.2	53	364
rDEN3/4 (ME)	4	0	<1.0	70	678
rDEN3/4Δ30 (ME)	4	0	<1.0	58	694

^a28 days after primary inoculation with the indicated viruses, rhesus monkeys were challenged subcutaneously with 10 PFU DEN3 (Sleman/78) virus in a 1 ml dose. Serum was collected on days 28 to 34, 36, 38, and 56. Virus titer was determined by plaque assay in Vero cells.

To evaluate the replication levels of each DEN3/4 chimeric virus in mosquitoes, Aedes aegypti were infected by ingesting a virus-containing blood meal (Table 38). Parental viruses rDEN4 and DEN3 (Sleman/78) readily infect Ae. aegypti. Each of the rDEN3/4 chimeric viruses was also tested. In many cases it was not possible to infect Ae. aegypti with an undiluted virus stock of sufficient titer to achieve a detectable infection due to the very low infectivity of several of the viruses. At a dose of approximately 2.8-2.9 log₁₀PFU, rDEN4, DEN3 (Sleman/78), and rDEN3/4(CME) were equally infectious and disseminated to the head with equal efficiency. For the remaining chimeric viruses, infection was not detectable even at a dose of 3.4 log₁₀PFU, indicating that replication of rDEN3/4(ME) and rDEN3/4Δ30(CME) is restricted in Ae. aegypti. By comparing infectivity of rDEN3/4(CME) and rDEN3/4Δ30(CME), it is clear that the Δ30 mutation is capable of further attenuating the chimeric virus for mosquitoes.

TABLE 38

Ability of DEN3/4 chimeric viruses to infect Aedes aegypti fed an
infectious bloodmeal.

		No.
	Dose	Mosqui-	No. (%)	No. (%)
	Ingested	toes	Midgut	Disseminated
Virus Tested	(log₁₀pfu)^a	Tested	Infections^b,c,d	Infections^e

rDEN4	3.8	18	14 (77%)	2 (14%)
	2.8	20	7 (34%)	2 (10%)
	1.8	18	0	0
			MID₅₀= 3.4	MID₅₀≧ 4.4
DEN3	2.9	16	3 (18%)	2 (12%)
(Sleman)	1.9	10	1 (10%)	0
			MID₅₀≧ 3.5	MID₅₀+0≧ 3.5
rDEN3/4	3.9	20	6 (30%)	2 (10%)
(CME)	2.9	18	4 (22%)	0
	1.9	13	1 (7%)	0
			MID₅₀≧ 4.2	MID₅₀≧ 4.5
DEN3/4Δ30	3.3	20	0	0
(CME)			MID₅₀≧ 4.3	MID₅₀≧ 4.3
DEN3/4	3.4	15	0	0
(ME)			MID₅₀≧ 4.4	MID₅₀≧ 4.4

aAmount of virus ingested, assuming a 2μ bloodmeal.
^bNumber (percentage) of mosquitoes with detectable dengue virus in midgut tissue; mosquitoes were assayed 21 days post feed, and dengue virus antigen was identified by IFA.
^cWhen infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID₅₀was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.
^dWhen no infection was detected, the MID₅₀was assumed to be greater than a 10-fold higher dose of virus than the one used.
^eNumber (percentage) of mosquitoes with detectable dengue virus antigen in both midgut and head tissue.

EXAMPLE 7 Generation and Characterization of Intertypic Chimeric DEN1 Viruses Containing the Δ30 Mutation

Chimeric viruses based on the DEN4 cDNA have been generated in which the CME or ME genes have been replaced with the corresponding genes derived from DEN1 (Puerto Rico/94), a virus isolate from a 1994 dengue outbreak in Puerto Rico (Appendices 3 and 4). As described in Example 4 for the DEN2 chimeric viruses, CME chimeric viruses for DEN1 were generated by replacing the BglII/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 with a similar region derived from DEN1 (Puerto Rico/94) (FIG. 12A). Likewise, to create the ME chimeric viruses, the PstI/XhoI region of the cDNA for either rDEN4 or rDEN4Δ30 was replaced with a similar region derived from DEN1 (Puerto Rico/94). The nucleotide and amino acid sequences of the resulting junctions are shown in FIG. 12B.

For transcription and generation of virus, chimeric cDNA clones were linearized and used as template in a transcription reaction using SP6 RNA polymerase as described. Transcripts were introduced into C6/36 mosquito cells using liposome-mediated transfection and recombinant dengue virus was harvested between day 7 and 14. Viruses were subsequently grown in Vero cells and biologically cloned by terminal dilution in Vero cells. All viruses replicated in Vero cells to titers in excess of 6.0 log₁₀PFU/ml, indicating that the chimeric viruses, even those containing the Δ30 mutation, replicate efficiently in cell culture. Genomic sequence analysis is currently underway to identify incidental mutations arising from virus passage in tissue culture.

To evaluate the replication levels of DEN1/4(CME) and rDEN1/4Δ30(CME) chimeric virus in mosquitoes, Aedes aegypti were infected by ingesting a virus-containing blood meal (Table 39). Parental virus rDEN4 infects Ae. aegypti with an MID50 of 4.0 log₁₀PFU. However, parental virus DEN1(Puerto Rico/94), is unable to infect Ae. aegypti at a dose of up to 3.4 log₁₀PFU. Thus CME chimeric viruses DEN1/4 and rDEN1/4Δ30 share this inability to infect Ae. aegypti. Therefore, it is unnecessary in Ae. aegypti to evaluate the effect of the Δ30 mutation on the infectivity of the DEN1/4 chimeric viruses, in a manner similar to that used for the DEN2/4 and DEN3/4 chimeric viruses.

TABLE 39

Inability of DEN1/4 chimeric viruses to infect Aedes aegypti fed
an infectious bloodmeal.

		No.
	Dose	Mosqui-	No. (%)	No. (%)
Virus	ingested	toes	Midgut	Disseminated
tested	(log₁₀pfu)^a	Tested	Infections^b,c,d	Infections^e

rDEN4	4.3	21	18 (85%)	8 (44%)
	3.3	15	3 (20%)	0
	2.3	20	0	0
			MID₅₀= 4.0	MID₅₀≧ 4.3
DEN1	3.4	21	0	0
(Puerto Rico/94)			MID₅₀≧ 4.4	MID₅₀≧ 4.4
rDEN 1/4	3.8	20	0	0
(CME)			MID₅₀≧ 4.8	MID₅₀≧ 4.8
rDEN1/4Δ30	2.8	20	0	0
(CME)			MID₅₀≧ 3.8	MID₅₀≧ 3.8

^aAmount of virus ingested, assuming a 2μ bloodmeal.
^bNumber (percentage) of mosquitoes with detectable dengue virus in midgut tissue; mosquitoes were assayed 21 days post feed, and dengue virus antigen was identified by IFA.
^cWhen infection was detected, but did not exceed a frequency of 50% at the highest dose of virus ingested, the MID₅₀was estimated by assuming that a 10-fold more concentrated virus dose would infect 100% of the mosquitoes.
^dWhen no infection was detected, the MID₅₀was assumed to be greater than a 10-fold higher dose of virus than the one used.
^eNumber (percentage) of mosquitoes with detectable dengue virus antigen in both midgut and head tissue.

As described in the previous examples, SCID mice transplanted with the HuH-7 cells are a sensitive model for the evaluation of dengue virus attenuation. Each chimeric DEN1/4 virus was inoculated into groups of SCID-HuH-7 mice and levels of virus in the serum were determined (Table 40). Chimeric viruses replicated to levels between 15- and 250-fold lower than either of the parental viruses, rDEN4 and DEN1 (Puerto Rico/94). CME chimeric viruses were more attenuated than the comparable ME chimeric viruses, with the Δ30 mutation providing a 0.8 log₁₀reduction in replication. This level of attenuation exerted by the Δ30 mutation in the CME chimeric viruses was similar to that observed previously for rDEN4Δ30. However, the attenuating effect of the Δ30 mutation in the ME chimeric viruses is indiscernible.

TABLE 40

Chimerization between dengue virus types 1 and 4 results in
recombinant viruses which are attenuated for HuH-7-SCID mice.

rDEN4	32	6.3 ± 0.2	A
DEN1	4	6.4 ± 0.2	A
(Puerto Rico/94)
rDEN1/4 (CME)	8	4.7 ± 0.2	B, C
rDEN1/4Δ30 (CME)	6	3.9 ± 0.4	C
rDEN1/4 (ME)	6	5.0 ± 0.2	B
rDEN1/4Δ30 (ME)	6	5.1 ± 0.3	B

^aGroups of HuH-7-SCID mice were inoculated into the tumor with 4.0 log₁₀PFU of the indicated virus. Serum was collected on day 7 and virus titer was determined in Vero cells.
^bMean peak titers were assigned to statistical groups using the Tukey post-hoc test (P < 0.05). Groups with the same letter designation are not significantly different.

APPENDIX 1

Nucleotide and amino acid sequence of DEN2 (Tonga/74) cDNA plasmid p2

10 20 30 40 50 60 70 80 90
100
AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTGAGGGAGCTAAGCTCAACGTAGTTCTAACTGTTTTTTGATTAGAGAGCAGATCTCTGATGA
Met>

110 120 130 140 150 160 170 180 190
200
ATAACCAACGGAAAAAGGCGAGAAACACGCCTTTCAATATGCTGAAACGCGAGAGAAACCGCGTGTCAACTGTACAACAGTTGACAAAGAGATTCTCACT
AsnAsnGlnArgLysLysAlaArgAsnThrProPheAsnMetLeuLysArgGluArgAsnArgValSerThrValGlnGlnLeuThrLysArgPheSerLeu>

210 220 230 240 250 260 270 280 290
300
TGGAATGCTGCAGGGACGAGGACCACTAAAATTGTTCATGGCCCTGGTGGCATTCCTTCGTTTCCTAACAATCCCACCAACAGCAGGGATATTAAAAAGA
GlyMetLeuGlnGlyArgGlyProLeuLysLeuPheMetAlaLeuValAlaPheLeuArgPheLeuThrIleProProThrAlaGlyIleLeuLysArg>

310 320 330 340 350 360 370 380 390
400
TGGGGAACAATTAAAAAATCAAAGGCTATTAATGTTCTGAGAGGCTTCAGGAAGAGATTTGGAAGGATGCTGAATATCTTAAACAGGAGACGTAGAACTG
TrpGlyThrIleLysLysSerLysAlaIleAsnValLeuArgGlyPheArgLysGluIleGlyArgMetLeuAsnIleLeuAsnArgARgArgArgThr>

410 420 430 440 450 460 470 480 490
500
TAGGCATGATCATCATGCTGACTCCAACAGTGATGGCGTTTCATCTGACCACACGCAACGGAGAACCACACATGATTGTCAGTAGACAAGAAAAAGGGAA
ValGlyMetIleIleMetLeuThrProThrValMetAlaPheHisLeuThrThrArgAsnGlyGluProHisMetIleValSerArgGlnGluLysGlyLys>

510 520 530 540 550 560 570 580 590
600
AAGCCTTCTGTTCAAGACAAAGGATGGCACGAACATGTGTACCCTCATGGCCATGGACCTTGGTGAGTTGTGTGAAGACACAATCACGTATAAATGTCCT
SerLeuLeuPheLysThrLysAspGlyThrAsnMetCysThrLeuMetAlaMetAspLeuGlyGluLeuCysGluAspThrIleThrTyrLysCysPro>

610 620 630 640 650 660 670 680 690
700
TTTCTCAAGCAGAACGAACCAGAAGACATAGATTGTTGGTGCAACTCCACGTCCACATGGGTAACTTATGGGACATGTACCACCACAGGAGAGCACAGAA
PheLeuLysGlnAsnGluProGluAspIleAspCysTrpCysAsnSerThrSerThrTrpValThrTyrGlyThrCysThrThrThrGlyGluHisArg>

710 720 730 740 750 760 770 780 790
800
GAGAAAAAAGATCAGTGGCGCTTGTTCCACACGTGGGAATGGGATTGGAGACACGAACTGAAACATGGATCTCATCAGAAGGGGCCTGGAAACATGCCCA
ArgGluLysArgSerValAlaLeuValProHisValGlyMetGlyLeuGluThrArgThrGluThrTrpMetSerSerGluGlyAlaTrpLysHisAlaGln>

810 820 830 840 850 860 870 880 890
900
GAGAATTGAAACTTGGATTCTGAGACATCCAGGCTTTACCATAATGGCCGCAATCCTGGCATACACCATAGGGACGACGCATTTCCAAAGAGTCCTGATA
ArgIleGluThrTrpIleLeuArgHisProGlyPheThrIleMetAlaAlaIleLeuAlaTyrThrIleGlyThrThrHisPheGlnArgValLeuIle>

910 920 930 940 950 960 970 980 990
1000
TTCATCCTACTGACAGCCATCGCTCCTTCAATGACAATGCGCTGCATAGGAATATCAAATAGGGACTTTGTGGAAGGAGTGTCAGGAGGGAGTTGGGTTG
PheIleLeuLeuThrAlaIleAlaProSerMetThrMetArgCysIleGlyIleSerAsnArgAspPheValGluGlyValSerGlyGlySerTrpVal>

1010 1020 1030 1040 1050 1060 1070 1080 1090
1100
ACATAGTTTTAGAACATGGAAGTTGTGTGACGACGATGGCAAAAAACAAACCAACACTGGACTTTGAACTGATAAAAACAGAAGCCAAACAACCTGCCAC
AspIleValLeuGluHisGlySerCysValThrThrMetAlaLysAsnLysProThrLeuAspPheGluLeuIleLysThrGluAlaLysGlnProAlaThr>

1110 1120 1130 1140 1150 1160 1170 1180 1190
1200
CTTAAGGAAGTACTGTATAGAGGCCAAACTGACCAACACGACAACAGACTCGCGCTGCCCAACACAAGGGGAACCCACCCTGAATGAAGAGCAGGACAAA
LeuArgLysTyrCysIleGluAlaLysLeuThrAsnThrThrThrAspSerArgCysProThrGlnGlyGluProThrLeuAsnGluGluGlnAspLys>

1210 1220 1230 1240 1250 1260 1270 1280 1290
1300
AGGTTTGTCTGCAAACATTCCATGGTAGACAGAGGATGGGGAAATGGATGTGGATTGTTTGGAAAAGGAGGCATCGTGACCTGTGCTATGTTCACATGCA
ArgPheValCysLysHisSerMetValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlyGlyIleValThrCysAlaMetPheThrCys>

1310 1320 1330 1340 1350 1360 1370 1380 1390
1400
AAAAGAACATGGAAGGAAAAATTGTTCAGCCAGAAAACCTGGAATACACTGTCGTGATAACACCTCATTCAGGGGAAGAACATGCAGTGGGAAATGACAC
LysLysAsnMetGluGlyLysIleValGlnProGluAsnLeuGluTyrThrValValIleThrProHisSerGlyGluGluHisAlaValGlyAsnAspThr>

1410 1420 1430 1440 1450 1460 1470 1480 1490
1500
AGGAAAACATGGTAAAGAAGTCAAGATAACACCACAGAGCTCCATCACAGAGGCGGAACTGACAGGCTATGGCACTGTTACGATGGAGTGCTCTCCAAGA
GlyLysHisGlyLysGluValLysIleThrProGlnSerSerIleThrGluAlaGluLeuThrGlyTyrGlyThrValThrMetGluCysSerProArg>

1510 1520 1530 1540 1550 1560 1570 1580 1590
1600
ACGGGCCTCGACTTCAATGAGATGGTGTTGCTGCAAATGGAAGACAAAGCCTGGCTGGTGCACAGACAATGGTTCCTAGACCTACCGTTGCCATGGCTGC
ThrGlyLeuAspPheAsnGluMetValLeuLeuGlnMetGluAspLysAlaTrpLeuValHisArgGlnTrpPheLeuAspLeuProLeuProTrpLeu>

1610 1620 1630 1640 1650 1660 1670 1680 1690
1700
CCGGAGCAGACACACAAGGATCAAATTGGATACAGAAAGAAACACTGGTCACCTTCAAAAATCCCCATGCGAAAAAACAGGATGTTGTTGTCTTAGGATC
ProGlyAlaAspThrGlnGlySerAsnTrplleGlnLysGluThrLeuValThrPheLysAsnProHisAlaLysLysGlnAspValValValLeuGlySer>

1710 1720 1730 1740 1750 1760 1770 1780 1790
1800
CCAAGAGGGGGCCATGCATACAGCACTCACAGGGGCTACGGAAATCCAGATGTCATCAGGAAACCTGCTGTTCACAGGACATCTCAAGTGCAGGCTGAGA
GlnGluGlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnMetSerSerGlyAsnLeuLeuPheThrGlyHisLeuLysCysArgLeuArg>

1810 1820 1830 1840 1850 1860 1870 1880 1890
1900
ATGGACAAATTACAACTTAAAGGGATGTCATACTCCATGTGCACAGGAAAGTTTAAAATTGTGAAGGAAATAGCAGAAACACAACATGGAACAATAGTCA
MetAspLysLeuGlnLeuLysGlyMetSerTyrSerMetCysThrGlyLysPheLysIleValLysGluIleAlaGluThrGlnHisGlyThrIleVal>

1910 1920 1930 1940 1950 1960 1970 1980 1990
2000
TTAGAGTACAATATGAAGGAGACGGCTCTCCATGCAAGATCCCCTTTGAGATAATGGATCTGGAAAAAAGACATGTTTTGGGCCGCCTGATCACAGTCAA
IleArgValGlnTyrGluGlyAspGlySerProCysLysIleProPheGluIleMetAspLeuGluLysArgHisValLeuGlyArgLeuIleThrValAsn>

2010 2020 2030 2040 2050 2060 2070 2080 2090
2100
CCCAATTGTAACAGAAAAGGACAGTCCAGTCAACATAGAAGCAGAACCTCCATTCGGAGACAGCTACATCATCATAGGAGTGGAACCAGGACAATTGAAG
ProIleValThrGluLysAspSerProValAsnIleGluAlaGluProProPheGlyAspSerTyrIleIleIleGlyValGluProGlyGlnLeuLys>

2110 2120 2130 2140 2150 2160 2170 2180 2190
2200
CTGGACTGGTTCAAGAAAGGAAGTTCCATCGGCCAAATGTTTGAGACAACAATGAGGGGAGCGAAAAGAATGGCCATTTTGGGTGACACAGCCTGGGATT
LeuAspTrpPheLysLysGlySerSerIleGlyGlnMetPheGluThrThrMetArgGlyAlaLysArgMetAlaIleLeuGlyAspThrAlaTrpAsp>

2210 2220 2230 2240 2250 2260 2270 2280 2290
2300
TTGGATCTCTGGGAGGAGTGTTCACATCAATAGGAAAGGCTCTCCACCAGGTTTTTGGAGCAATCTACGGGGCTGCTTTCAGTGGGGTCTCATGGACTAT
PheGlySerLeuGlyGlyValPheThrSerIleGlyLysAlaLeuHisGlnValPheGlyAlaIleTyrGlyAlaAlaPheSerGlyValSerTrpThrMet>

2310 2320 2330 2340 2350 2360 2370 2380 2390
2400
GAAGATCCTCATAGGAGTTATCATCACATGGATAGGAATGAACTCACGTAGCACTAGTCTGAGCGTGTCACTGGTGTTAGTGGGAATCGTGACACTTTAC
LysIleLeuIleGlyValIleIleThrTrpIleGlyMetAsnSerArgSerThrSerLeuSerValSerLeuValLeuValGlyIleValThrLeuTyr>

2410 2420 2430 2440 2450 2460 2470 2480 2490
2500
TTGGGAGTTATGGTGCAGGCCGATAGTGGTTGCGTTGTGAGCTGGAAGAACAAAGAACTAAAATGTGGCAGTGGAATATTCGTCACAGATAACGTGCATA
LeuGlyValMetValGlnAlaAspSerGlyCysValValSerTrpLysAsnLysGluLeuLysCysGlySerGlyIlePheValThrAspAsnValHis>

2510 2520 2530 2540 2550 2560 2570 2580 2590
2600
CATGGACAGAACAATACAAGTTCCAACCAGAATCCCCTTCAAAACTGGCCTCAGCCATCCAGAAAGCGCATGAAGAGGGCATCTGTGGAATCCGCTCAGT
ThrTrpThrGluGlnTyrLysPheGlnProGluSerProSerLysLeuAlaSerAlaIleGlnLysAlaHisGluGluGlyIleCysGlyIleArgSerVal>

2610 2620 2630 2640 2650 2660 2670 2680 2690
2700
AACAAGACTGGAAAATCTTATGTGGAAACAGATAACATCAGAATTGAATCATATTCTATCAGAAAATGAAGTGAAACTGACCATCATGACAGGAGACATC
ThrArgLeuGluAsnLeuMetTrpLysGlnIleThrSerGluLeuAsnHisIleLeuSerGluAsnGluValLysLeuThrIleMetThrGlyAspIle>

2710 2720 2730 2740 2750 2760 2770 2780 2790
2800
AAAGGAATCATGCAGGTAGGAAAACGATCTTTGCGGCCTCAACCCACTGAGTTGAGGTATTCATGGAAAACATGGGGTAAAGCGAAAATGCTCTCCACAG
LysGlyIleMetGlnValGlyLysArgSerLeuArgProGlnProThrGluLeuArgTyrserTrpLysThrTrpGlyLysAlaLysMetLeuSerThr>

2810 2820 2830 2840 2850 2860 2870 2880 2890
2900
AACTCCACAATCAGACCTTCCTCATTGATGGTCCCGAAACAGCAGAATGCCCCAACACAAACAGAGCTTGGAATTCACTGGAAGTTGAGGACTACGGCTT
GluLeuHisAsnGlnThrPheLeuIleAspGlyProGluThrAlaGluCysProAsnThrAsnArgAlaTrpAsnSerLeuGluValGluAspTyrGlyPhe>

2910 2920 2930 2940 2950 2960 2970 2980 2990
3000
TGGAGTATTCACTACCAATATATGGCTAAGATTGAGAGAAAAGCAGGATGTATTTTGTGACTCAAACTCATGTGCAGCGGCCATAAAGGACAACAGAGCC
GlyValPheThrThrAsnIleTrpLeuArgLeuArgGluLysGlnAspValPheCysAspSerLysLeuMetSreAlaAlaIleLysAspAsnArgAla>

3010 3020 3030 3040 3050 3060 3070 3080 3090
3100
GTCCATGCTGATATGGGTTATTGGATAGAAAGCGCACTCAATGATACATGGAAGATAGAGAAAGCTTCTTTCATTGAAGTCAAAAGTTGCCACTGGCCAA
ValHisAlaAspMetGlyTryTrpIleGluSerAlaLeuAsnAspThrTrpLysIleGluLysAlaSerPheIleGluValLysSerCysHisTrpPro>

3110 3120 3130 3140 3150 3160 3170 3180 3190
3200
AGTCACACACCCTATGGAGTAATGGAGTGCTAGAAAGCGAGATGGTCATTCCAAAGAATTTCGCTGGACCAGTGTCACAACATAATAACAGACCAGGCTA
LysSerHisThrLeuTrpSerAsnGlyValLeuGluSerGluMetValIleProLysAsnPheAlaGlyProValSerGlnHisAsnAsnArgProGlyTyr>

3210 3220 3230 3240 3250 3260 3270 3280 3290
3300
TTACACACAAACAGCAGGACCTTGGCATCTAGGCAAGCTTGAGATGGACTTTGATTTCTGCGAAGGGACTACAGTGGTGGTAACCGAGAACTGTGGAAAC
TyrThrGlnThrAlaGlyProTrpHisLeuGlyLysLeuGluMetAspPheAspPheCysGluGlyThrThrValValValThrGluAsnCysGlyAsn>

3310 3320 3330 3340 3350 3360 3370 3380 3390
3400
AGAGGGCCCTCTTTAAGAACAACCACTGCCTCAGGAAAACTCATAACGGAATGGTGTTGTCGATCTTGCACACTACCACCACTAAGATACAGAGGTGAGG
ArgGlyProSerLeuArgThrThrThrAlaSerGlyLysLeuIleThrGluTrpCysCysArgSerCysThrLeuProProLeuArgTyrArgGlyGlu>

3410 3420 3430 3440 3450 3460 3470 3480 3490
3500
ATGGATGTTGGTACGGGATGGAAATCAGACCATTGAAAGAGAAAGAAGAAAATCTGGTCAGTTCTCTGGTTACAGCCGGACATGGGCAGATTGACAATTT
AspGlyCysTrpTyrGlyMetGluIleArgProLeuLysGluLysGluGluAsnLeuValSerSerLeuValThrAlaGlyHisGlyGlnIleAspAsnPhe>

3510 3520 3530 3540 3550 3560 3570 3580 3590
3600
CTCATTAGGAATCTTGGGAATGGCACTGTTCCTTGAAGAAATGCTCAGGACTCGAGTAGGAACAAAACATGCAATATTACTCGTCGCAGTTTCTTTCGTG
SerLeuGlyIleLeuGlyMetAlaLeuPheLeuGluGluMetLeuArgThrArgValGlyThrLysHisAlaIleLeuLeuValAlaValSerPheVal>

3610 3620 3630 3640 3650 3660 3670 3680 3690
3700
ACGCTAATCACAGGGAACATGTCTTTTAGAGACCTGGGAAGAGTGATGGTTATGGTGGGTGCCACCATGACAGATGACATAGGCATGGGTGTGACTTATC
ThrLeuIleThrGlyAsnMetSerPheArgAspLeuGlyArgValMetValMetValGlyAlaThrMetThrAspAspIleGlyMetGlyValThrTyr>

3710 3720 3730 3740 3750 3760 3770 3780 3790
3800
TCGCTCTACTAGCAGCTTTTAGAGTCAGACCAACCTTTGCAGCTGGACTGCTCTTGAGAAAACTGACCTCCAAGGAATTAATGATGACTACCATAGGAAT
LeuAlaLeuLeuAlaAlaPheArgValArgProThrPheAlaAlaGlyLeuLeuLeuArgLysLeuThrSerLysGluLeuMetMetThrThrIleGlyIle>

3810 3820 3830 3840 3850 3860 3870 3880 3890
3900
CGTTCTTCTCTCCCAGAGTAGCATACCAGAGACCATTCTTGAACTGACCGACGCGTTAGCTCTAGGCATGATGGTCCTCAAGATGGTGAGAAACATGGAA
ValLeuLeuSerGlnSerSerIleProGluThrIleLeuGluLeuThrAspAlaLeuAlaLeuGlyMetMetValLeuLysMetValArgAsnMetGlu>

3910 3920 3930 3940 3950 3960 3970 3980 3990
4000
AAATATCAGCTGGCAGTGACCATCATGGCTATTTTGTGCGTCCCAAATGCTGTGATATTACAGAACGCATGGAAAGTGAGTTGCACAATATTGGCAGTGG
LysTyrGlnLeuAlaValThrIleMetAlaIleLeuCysValProAsnAlaValIleLeuGlnAsnAlaTrpLysValSerCysThrIleLeuAlaVal>

4010 4020 4030 4040 4050 4060 4070 4080 4090
4100
TGTCTGTTTCCCCCCTGCTCTTAACATCCTCACAACAGAAAGCGGACTGGATACCATTAGCGTTGACGATCAAAGGTCTTAATCCAACAGCCATTTTTCT
ValSerValSerProLeuLeuLeuThrSerSerGlnGlnLysAlaAspTrpIleProLeuAlaLeuThrIleLysGlyLeuAsnProThrAlaIlePheLeu>

4110 4120 4130 4140 4150 4160 4170 4180 4190
4200
AACAACCCTCTCAAGAACCAACAAGAAAAGGAGCTGGCCTTTAAATGAGGCCATCATGGCGGTTGGGATGGTGAGTATCTTGGCCAGCTCTCTCTTAAAG
ThrThrLeuSerArgThrAsnLysLysArgSerTrpProLeuAsnGluAlaIleMetAlaValGlyMetValSerIleLeuAlaSerSerLeuLeuLys>

4210 4220 4230 4240 4250 4260 4270 4280 4290
4300
AATGACATCCCCATGACAGGACCATTAGTGGCTGGAGGGCTCCTTACTGTGTGCTACGTGCTAACTGGGCGGTCAGCCGATCTGGAATTAGAGAGAGCTA
AsnAspIleProMetThrGlyProLeuValAlaGlyGlyLeuLeuThrValCysTyrValLeuThrGlyArgSerAlaAspLeuGluLeuGluArgAla>

4310 4320 4330 4340 4350 4360 4370 4380 4390
4400
CCGATGTCAAATGGGATGACCAGGCAGAGATATCAGGTAGCAGTCCAATCCTGTCAAGAACAATATCAGAAGATGGCAGCATGTCAATAAAGAATGAAGA
ThrAspValLysTrpAspAspGlnAlaGluIleSerGlySerSerProIleLeuSerIleThrIleSerGluAspGlySerMetSerlleLysAsnGluGlu>

4410 4420 4430 4440 4450 4460 4470 4480 4490
4500
GGAAGAGCAAACACTGACTATACTCATTAGAACAGGATTGCTTGTGATCTCAGGACTCTTTCCGGTATCAATACCAATTACAGCAGCAGCATGGTATCTG
GluGluGlnThrLeuTheIleLeuIleArgThrGlyLeuLeuValIleSerGlyLeuPheProValSerIleProIleThrAlaAlaAlaTrpTyrLeu>

4510 4520 4530 4540 4550 4560 4570 4580 4590
4600
TGGGAAGTAAAGAAACAACGGGCTGGAGTGCTGTGGGATGTCCCCTCACCACCACCCGTGGGAAAAGCTGAATTGGAAGATGGAGCCTACAGAATCAAGC
TrpGluValLysLysGlnArgAlaGlyValLeuTrpAspValProSerProProProValGlyLysAlaGluLeuGluAspGlyAlaTyrArgIleLys>

4610 4620 4630 4640 4650 4660 4670 4680 4690
4700
AAAAAGGAATCCTTGGATATTCCCAGATCGGAGCTGGAGTTTACAAAGAAGGAACATTTCACACAATGTGGCACGTCACACGTGGCGCTGTCCTAATGCA
GlnLysGlyIleLeuGlyTyrSerGlnIleGlyAlaGlyValTyrLysGluGlyThrPheHisThrMetTrpHisValThrArgGlyAlaValLeuMetHis>

4710 4720 4730 4740 4750 4760 4770 4780 4790
4800
TAAGGGGAAGAGGATTGAACCATCATGGGCGGACGTCAAGAAAGACTTAATATCATATGGAGGAGGTTGGAAGCTAGAAGGAGAATGGAAAGAAGGAGAA
LysGlyLysArgIleGluProSerTrpAlaAspValLysLysAspLeuIleSerTyrGlyGlyGlyTrpLysLeuGluGlyGluTrpLysGluGlyGlu>

4810 4820 4830 4840 4850 4860 4870 4880 4890
4900
GAAGTCCAGGTCTTGGCATTGGAGCCAGGGAAAAATCCAAGAGCCGTCCAAACAAAGCCTGGCCTTTTTAGAACCAACACTGGAACCATAGGTGCCGTAT
GluValGlnValLeuAlaLeuGluProGlyLysAsnProArgAlaValGlnThrLysProGlyLeuPheArgThrAsnThrGlyThrIleGlyAlaVal>

4910 4920 4930 4940 4950 4960 4970 4980 4990
5000
CTCTGGACTTTTCCCCTGGGACGTCAGGATCTCCAATCGTCGACAAAAAAGGAAAAGTTGTAGGTCTCTATGGCAATGGTGTCGTTACAAGGAGTGGAGC
SerLeuAspPheSerProGlyThrSerGlySerProIleValAspLysLysGlyLysValValGlyLeuTyrGlyAsnGlyValValThrArgSerGlyAla>

5010 5020 5030 5040 5050 5060 5070 5080 5090
5100
ATATGTGAGTGCCATAGCTCAGACTGAAAAAAGCATTGAAGACAATCCAGAGATTGAAGATGACATCTTTCGAAAGAGAAGATTGACTATCATGGATCTC
TyrValSerAlaIleAlaGlnThrGluLysSerIleGluAspAsnProGluIleGluAspAspIlePheArgLysArgArgLeuThrIleMetAspLeu>

5110 5120 5130 5140 5150 5160 5170 5180 5190
5200
CACCCAGGAGCAGGAAAGACAAAGAGATACCTCCCGGCCATAGTCAGAGAGGCCATAAAAAGAGGCTTGAGAACACTAATCCTAGCCCCCACTAGAGTCG
HisProGlyAlaGlyLysThrLysArgTyrLeuProAlaIleValArgGluAlaIleLysArgGlyLeuArgThrLeuIleLeuAlaProThrArgVal>

5210 5220 5230 5240 5250 5260 5270 5280 5290
5300
TGGCAGCTGAAATGGAGGAAGCCCTTAGAGGACTTCCAATAAGATACCAAACTCCAGCTATCAGGGCTGAGCACACCGGGCGGGAGATTGTAGACTTAAT
ValAlaAlaGluMetGluGluAlaLeuArgGlyLeuProIleArgTyrGlnThrProAlaIleArgAlaGluHisThrGlyArgGluIleValAspLeuMet>

5310 5320 5330 5340 5350 5360 5370 5380 5390
5400
GTGTCATGCCACATTTACCATGAGGCTGCTATCACCAATCAGGGTGCCAAATTACAACCTGATCATCATGGACGAAGCCCATTTTACAGATCCAGCAAGC
CysHisAlaThrPheThrMetArgLeuLeuSerProIleArgValProAsnTyrAsnLeuIleIleMetAspGluAlaHisPheThrAspProAlaSer>

5410 5420 5430 5440 5450 5460 5470 5480 5490
5500
ATAGCAGCTAGGGGATACATCTCAACTCGAGTGGAGATGGGGGAGGCAGCTGGAATTTTTATGACAGCCACTCCTCCGGGTAGTAGAGATCCATTTCCTC
IleAlaAlaArgGlyTyrIleSerThrArgValGluMetGlyGluAlaAlaGlyIlePheMetThrAlaThrProProGlySerArgAspProPhePro>

5510 5520 5530 5540 5550 5560 5570 5580 5590
5600
AGAGCAATGCACCAATTATGGACGAAGAAAGAGAAATTCCGGAACGTTCATGGAACTCTGGGCACGAGTGGGTCACGGATTTTAAAGGAAAGACTGTCTG
GlnSerAsnAlaProIleMetAspGluGluArgGluIleProGluArgSerTrpAsnSerGlyHisGluTrpValThrAspPheLysGlyLysThrValTrp>

5610 5620 5630 5640 5650 5660 5670 5680 5690
5700
GTTTGTTCCAAGCATAAAAACCGGAAATGACATAGCAGCCTGCCTGAGAAAGAATGGAAAGAGGGTGATACAACTCAGTAGGAAGACCTTTGATTCTGAA
PheValProSerIleLysThrGlyAsnAspIleAlaAlaCysLeuArgLysAsnGlyLysArgValIleGlnLeuSerArgLysThrPheAspSerGlu>

5710 5720 5730 5740 5750 5760 5770 5780 5790
5800
TATGTCAAGACTAGAACCAATGACTGGGATTTCGTGGTTACAACTGACATCTCGGAAATGGGCGCCAACTTTAAAGCTGAGAGGGTCATAGACCCCAGAC
TyrValLysThrArgThrAsnAspTrpAspPheValValThrThrAspIleSerGluMetGlyAlaAsnPheLysAlaGluArgValIleAspProArg>

5810 5820 5830 5840 5850 5860 5870 5880 5890
5900
GCTGCATGAAACCAGTTATATTGACAGACGGCGAAGAGCGGGTGATTCTGGCAGGACCCATGCCAGTGACCCACTCTAGTGCAGCACAAAGAAGAGGGAG
ArgCysMetLysProValIleLeuThrAspGlyGluGluArgValIleLeuAlaGluProMetProValThrHisSerSerAlaAlaGlnArgArgGlyArg>

5910 5920 5930 5940 5950 5960 5970 5980 5990
6000
AATAGGAAGGAATCCAAGGAATGAAAATGATCAATATATATATATGGGGGAACCACTGGAAAATGATGAAGACTGTGCGCACTGGAAGGAAGCTAAGATG
IleGlyArgAsnProArgAsnGluAsnAspGlnTyrIleTyrMetGlyGluProLeuGluAsnAspGluAspCysAlaHisTrpLysGluAlaLysMet>

6010 6020 6030 6040 6050 6060 6070 6080 6090
6100
CTCCTAGATAATATCAACACACCTGAAGGAATCATTCCCAGCTTGTTCGAGCCAGAGCGTGAAAAGGTGGATGCCATTGACGGTGAATATCGCTTGAGAG
LeuLeuAspAsnIleAsnThrProGluGlyIleIleProSerLeuPheGluProGluArgGluLysValAspAlaIleAspGlyGluTyrArgLeuArg>

6110 6120 6130 6140 6150 6160 6170 6180 6190
6200
GAGAAGCACGGAAAACTTTTGTGGACCTAATGAGAAGAGGAGACCTACCAGTCTGGTTGGCTTATAAAGTGGCAGCTGAAGGTATCAACTACGCAGACAG
GlyGluAlaArgLysThrPheValAspLeuMetArgArgGlyAspLeuProValTrpLeuAlaTyrLysValAlaAlaGluGlyIleAsnTyrAlaAspArg>

6210 6220 6230 6240 6250 6260 6270 6280 6290
6300
AAGATGGTGTTTTGACGGAACCAGAAACAATCAAATCTTGGAAGAAAATGTGGAAGTGGAAATCTGGACAAAGGAAGGGGAAAGGAAAAAATTGAAACCT
ArgTrpCysPheAspGlyThrArgAsnAsnGlnIleLeuGluGluAsnValGluValGluIleTrpThrLysGluGlyGluArgLysLysLeuLysPro>

6310 6320 6330 6340 6350 6360 6370 6380 6390
6400
AGATGGTTAGATGCTAGGATCTACTCCGACCCACTGGCGCTAAAAGAGTTCAAGGAATTTGCAGCCGGAAGAAAGTCCCTAACCCTGAACCTAATTACAG
ArgTrpLeuAspAlaArgIleTyrSerAspProLeuAlaLeuLysGluPheLysGluPheAlaAlaGlyArgLysSerLeuThrLeuAsnLeuIleThr>

6410 6420 6430 6440 6450 6460 6470 6480 6490
6500
AGATGGGCAGACTCCCAACTTTTATGACTCAGAAGGCCAGAGATGCACTAGACAACTTGGCGGTGCTGCACACGGCTGAAGCGGGTGGAAAGGCATACAA
GluMetGlyArgLeuProThrPheMetThrGlnLysAlaArgAspAlaLeuAspAsnLeuAlaValLeuHisThrAlaGluAlaGlyGlyLysAlaTyrAsn>

6510 6520 6530 6540 6550 6560 6570 6580 6590
6600
TCATGCTCTCAGTGAATTACCGGAGACCCTGGAGACATTGCTTTTGCTGACACTGTTGGCCACAGTCACGGGAGGAATCTTCCTATTCCTGATGAGCGGA
HisAlaLeuSerGluLeuProGluThrLeuGluThrLeuLeuLeuLeuThrLeuLeuAlaThrValThrGlyGlyIlePheLeuPheLeuMetSerGly>

6610 6620 6630 6640 6650 6660 6670 6680 6690
6700
AGGGGTATGGGGAAGATGACCCTGGGAATGTGCTGCATAATCACGGCCAGCATCCTCTTATGGTATGCACAAATACAGCCACATTGGATAGCAGCCTCAA
ArgGlyMetGlyLysMetThrLeuGlyMetCysCysIleIleThrAlaSerIleLeuLeuTryTyrAlaGlnIleGlnProHisTrpIleAlaAlaSer>

6710 6720 6730 6740 6750 6760 6770 6780 6790
6800
TAATATTGGAGTTCTTTCTCATAGTCTTGCTCATTCCAGAACCAGAAAAGCAGAGGACACCTCAGGATAATCAATTGACTTATGTCATCATAGCCATCCT
IleIleLeuGluPhePheLeuIleValLeuLeuIleProGluProGluLysGlnArgThrProGlnAspAsnGlnLeuThrTyrVallleIleAlaIleLeu>

6810 6820 6830 6840 6850 6860 6870 6880 6890
6900
CACAGTGGTGGCCGCAACCATGGCAAACGAAATGGGTTTTCTGGAAAAAACAAAGAAAGACCTCGGACTGGGAAACATTGCAACTCAGCAACCTGAGAGC
ThrValValAlaAlaThrMetAlaAsnGluMetGlyPheLeuGluLysThrLysLysAspLeuGlyLeuGlyAsnIleAlaThrGlnGlnProGluSer>

6910 6920 6930 6940 6950 6960 6970 6980 6990
7000
AACATTCTGGACATAGATCTACGTCCTGCATCAGCATGGACGTTGTATGCCGTGGCTACAACATTTATCACACCAATGTTGAGACATAGCATTGAAAATT
AsnIleLeuAspIleAspLeuArgProAlaSerAlaTrpThrLeuTyrAlaValAlaThrThrPheIleThrProMetLeuArgHisSerIleGluAsn>

7010 7020 7030 7040 7050 7060 7070 7080 7090
7100
CCTCAGTAAATGTGTCCCTAACAGCCATAGCTAACCAAGCCACAGTGCTAATGGGTCTCGGAAAAGGATGGCCATTGTCAAAGATGGACATTGGAGTTCC
SerSerValAsnValSerLeuThrAlaIleAlaAsnGlnAlaThrValLeuMetGlyLeuGlyLysGlyTrpProLeuSerLysMetAspIleGlyValPro>

7110 7120 7130 7140 7150 7160 7170 7180 7190
7200
CCTCCTTGCTATTGGGTGTTACTCACAAGTCAACCCTATAACCCTCACAGCGGCTCTTCTTTTATTGGTAGCACATTATGCCATCATAGGACCGGGACTT
LeuLeuAlaIleGlyCysTyrSerGlnValAsnProIleThrLeuThrAlaAlaLeuLeuLeuLeuValAlaHisTyrAlaIleIleGlyProGlyLeu>

7210 7220 7230 7240 7250 7260 7270 7280 7290
7300
CAAGCCAAAGCAACTAGAGAAGCTCAGAAAAGAGCAGCAGCGGGCATCATGAAAAACCCAACTGTGGATGGAATAACAGTGATAGATCTAGATCCAATAC
GlnAlaLysAlaThrArgGluAlaGlnLysArgAlaAlaAlaGlyIleMetLysAsnProThrValAspGlyIleThrValIleAspLeuAspProIle>

7310 7320 7330 7340 7350 7360 7370 7380 7390
7400
CCTATGATCCAAAGTTTGAAAAGCAGTTGGGACAAGTAATGCTCCTAGTCCTCTGCGTGACCCAAGTGCTGATGATGAGGACTACGTGGGCTTTGTGTGA
ProTyrAspProLysPheGluLysGlnLeuGlyGlnValMetLeuLeuValLeuCysValThrGlnValLeuMetMetArgThrThrTrpAlaLeuCysGlu>

7410 7420 7430 7440 7450 7460 7470 7480 7490
7500
AGCCTTAACTCTAGCAACTGGACCCGTGTCCACATTGTGGGAAGGAAATCCAGGGAGATTCTGGAACACAACCATTGCAGTGTCAATGGCAAACATCTTT
AlaLeuThrLeuAlaThrGlyProValSerThrLeuTrpGluGlyAsnProGlyArgPheTrpAsnThrThrIleAlaValSerMetAlaAsnIlePhe>

7510 7520 7530 7540 7550 7560 7570 7580 7590
7600
AGAGGGAGTTACCTGGCTGGAGCTGGACTTCTCTTTTCTATCATGAAGAACACAACCAGCACGAGAAGAGGAACTGGCAATATAGGAGAAACGTTAGGAG
ArgGlySerTyrLeuAlaGlyAlaGlyLeuLeuPheSerIleMetLysAsnThrThrSerThrArgArgGlyThrGlyAsnIleGlyGluThrLeuGly>

7610 7620 7630 7640 7650 7660 7670 7680 7690
7700
AGAAATGGAAAAGCAGACTGAACGCATTGGGGAAAAGTGAATTCCAGATCTACAAAAAAAGTGGAATTCAAGAAGTGGACAGAACCTTAGCAAAAGAAGG
GluLysTrpLysSerArgLeuAsnAlaLeuGlyLysSerGluPheGlnIleTyrLysLysSerGlyIleGlnGluValAspArgThrLeuAlaLysGluGly>

7710 7720 7730 7740 7750 7760 7770 7780 7790
7800
CATTAAAAGAGGAGAAACGGATCATCACGCTGTGTCGCGAGGCTCAGCAAAACTGAGATGGTTCGTTGAAAGGAATTTGGTCACACCAGAAGGGAAAGTA
IleLysArgGlyGluThrAspHisHisAlaValSerArgGlySerAlaLysLeuArgTrpPheValGluArgAsnLeuValThrProGluGlyLysVal>

7810 7820 7830 7840 7850 7860 7870 7880 7890
7900
GTGGACCTTGGTTGTGGCAGAGGGGGCTGGTCATACTATTGTGGAGGATTAAAGAATGTAAGAGAAGTTAAAGGCTTAACAAAAGGAGGACCAGGACACG
ValAspLeuGlyCysGlyArgGlyGlyTrpSerTyrTyrCysGlyGlyLeuLysAsnValArgGluValLysGlyLeuThrLysGlyGlyProGlyHis>

7910 7920 7930 7940 7950 7960 7970 7980 7990
8000
AAGAACCTATCCCTATGTCAACATATGGGTGGAATCTAGTACGCTTACAGAGCGGAGTTGATGTTTTTTTTGTTCCACCAGAGAAGTGTGACACATTGTT
GluGluProIleProMetSerThrTyrGlyTrpAsnLeuValArgLeuGlnSerGlyValAspValPhePheValProProGluLysCysAspThrLeuLeu>

8010 8020 8030 8040 8050 8060 8070 8080 8090
8100
GTGTGACATAGGGGAATCATCACCAAATCCCACGGTAGAAGCGGGACGAACACTCAGAGTCCTCAACCTAGTGGAAAATTGGCTGAACAATAACACCCAA
CysAspIleGlyGluSerSerProAsnProThrValGluAlaGlyArgThrLeuArgValLeuAsnLeuValGluAsnTrpLeuAsnAsnAsnThrGln>

8110 8120 8130 8140 8150 8160 8170 8180 8190
8200
TTTTGCGTAAAGGTTCTTAACCCGTACATGCCCTCAGTCATTGAAAGAATGGAAACCTTACAACGGAAATACGGAGGAGCCTTGGTGAGAAATCCACTCT
PheCysValLysValLeuAsnProTyrMetProSerValIleGluArgMetGluThrLeuGlnArgLysTyrGlyGlyAlaLeuValArgAsnProLeu>

8210 8220 8230 8240 8250 8260 8270 8280 8290
8300
CACGGAATTCCACACATGAGATGTACTGGGTGTCCAATGCTTCCGGGAACATAGTGTCATCAGTGAACATGATTTCAAGAATGCTGATCAACAGATTCAC
SerArgAsnSerThrHisGluMetTyrTrpValSerAsnAlaSerGlyAsnIleValSerSerValAsnMetIleSerArgMetLeuIleAsnArgPheThr>

8310 8320 8330 8340 8350 8360 8370 8380 8390
8400
TATGAGACACAAGAAGGCCACCTATGAGCCAGATGTCGACCTCGGAAGCGGAACCCGCAATATTGGAATTGAAAGTGAGACACCGAACCTAGACATAATT
MetArgHisLysLysAlaThrTyrGluProAspValAspLeuGlySerGlyThrArgAsnIleGlyIleGluSerGluThrProAsnLeuAspIleIle>

8410 8420 8430 8440 8450 8460 8470 8480 8490
8500
GGGAAAAGAATAGAAAAAATAAAACAAGAGCATGAAACGTCATGGCACTATGATCAAGACCACCCATACAAAACATGGGCTTACCATGGCAGCTATGAAA
GlyLysArgIleGluLysIleLysGlnGluHisGluThrSerTrpHisTyrAspGlnAspHisProTyrLysThrTrpAlaTyrHisGlySerTyrGlu>

8510 8520 8530 8540 8550 8560 8570 8580 8590
8600
CAAAACAGACTGGATCAGCATCATCCATGGTGAACGGAGTAGTCAGATTGCTGACAAAACCCTGGGACGTTGTTCCAATGGTGACACAGATGGCAATGAC
ThrLysGlnThrGlySerAlaSerSerMetValAsnGlyValValArgLeuLeuThrLysProTrpAspValValProMetValThrGlnMetAlaMetThr>

8610 8620 8630 8640 8650 8660 8670 8680 8690
8700
AGACACAACTCCTTTTGGACAACAGCGCGTCTTCAAAGAGAAGGTGGATACGAGAACCCAAGAACCAAAAGAAGGCACAAAAAAACTAATGAAAATCACG
AspThrThrPropheGlyGlnGlnArgValPheLysGluLysValAspThrArgThrGlnGluProLysGluGlyThrLysLysLeuMetLysIleThr>

8710 8720 8730 8740 8750 8760 8770 8780 8790
8800
GCAGAGTGGCTCTGGAAAGAACTAGGAAAGAAAAAGACACCTAGAATGTGTACCAGAGAAGAATTCACAAAAAAGGTGAGAAGCAATGCAGCCTTGGGGG
AlaGluTrpLeuTrpLysGluLeuGlyLysLysLysThrProArgMetCysThrArgGluGluPheThrLysLysValArgSerAsnAlaAlaLeuGly>

8810 8820 8830 8840 8850 8860 8870 8880 8890
8900
CCATATTCACCGATGAGAACAAGTGGAAATCGGCGCGTGAAGCCGTTGAAGATAGTAGGTTTTGGGAGCTGGTTGACAAGGAAAGGAACCTCCATCTTGA
AlaIlePheThrAspGluAsnLysTrpLysSerAlaArgGluAlaValGluAspSerArgPheTrpGluLeuValAspLySGluArgAsnLeuHisLeuGlu>

8910 8920 8930 8940 8950 8960 8970 8980 8990
9000
AGGGAAATGTGAAACATGTGTATACAACATGATGGGGAAAAGAGAGAAAAAACTAGGAGAGTTTGGTAAAGCAAAAGGCAGCAGAGCCATATGGTACATG
GlyLysCysGluThrCysValTyrAsnMetMetGlyLysArgGluLysLysLeuGlyGluPheGlyLysAlaLysGlySerArgAlaIleTrpTyrMet>

9010 9020 9030 9040 9050 9060 9070 9080 9090
9100
TGGCTCGGAGCACGCTTCTTAGAGTTTGAAGCCCTAGGATTTTTGAATGAAGACCATTGGTTCTCCAGAGAGAACTCCCTGAGTGGAGTGGAAGGAGAAG
TrpLeuGlyAlaArgPheLeuGluPheGluAlaLeuGlyPheLeuAsnGluAspHisTrpPheSerArgGluAsnSerLeuSerGlyValGluGlyGlu>

9110 9120 9130 9140 9150 9160 9170 9180 9190
9200
GGCTGCATAAGCTAGGTTACATCTTAAGAGAGGTGAGCAAGAAAGAAGGAGGAGCAATGTATGCCGATGACACCGCAGGCTGGGACACAAGAATCACAAT
GlyLeuHisLysLeuGlyTyrIleLeuArgGluValSerLysLysGluGlyGlyAlaMetTyrAlaAspAspThrAlaGlyTrpAspThrArgIleThrIle>

9210 9220 9230 9240 9250 9260 9270 9280 9290
9300
AGAGGATTTGAAAAATGAAGAAATGATAACGAACCACATGGCAGGAGAACACAAGAAACTTGCCGAGGCCATTTTTAAATTGACGTACCAAAACAAGGTG
GluAspLeuLysAsnGluGluMetIleThrAsnHisMetAlaGlyGluHisLysLysLeuAlaGluAlaIlePheLysLeuThrTyrGlnAsnLysVal>

9310 9320 9330 9340 9350 9360 9370 9380 9390
9400
GTGCGTGTGCAAAGACCAACACCAAGAGGCACAGTAATGGACATCATATCGAGAAGAGACCAAAGGGGTAGTGGACAAGTTGGCACCTATGGCCTCAACA
ValArgValGlnArgProThrProArgGlyThrValMetAspIleIleSerArgArgAspGlnArgGlySerGlyGlnValGlyThrTyrGlyLeuAsn>

9410 9420 9430 9440 9450 9460 9470 9480 9490
9500
CTTTCACCAACATGGAAGCACAACTAATTAGGCAAATGGAGGGGGAAGGAATCTTCAAAAGCATCCAGCACTTGACAGCCTCAGAAGAAATCGCTGTGCA
ThrPheThrAsnMetGluAlaGlnLeuIleArgGlnMetGluGlyGluGlyIlePheLysSerIleGlnHisLeuThrAlaSerGluGluIleAlaValGln>

9510 9520 9530 9540 9550 9560 9570 9580 9590
9600
AGATTGGCTAGTAAGAGTAGGGCGTGAAAGGTTGTCAAGAATGGCCATCAGTGGAGATGATTGTGTTGTGAAACCTTTAGATGATAGATTTGCAAGAGCT
AspTrpLeuValArgValGlyArgGluArgLeuSerArgMetAlaIleSerGlyAspAspCysValValLysProLeuAspAspArgPheAlaArgAla>

9610 9620 9630 9640 9650 9660 9670 9680 9690
9700
CTAACAGCTCTAAATGACATGGGAAAGGTTAGGAAGGACATACAGCAATGGGAGCCCTCAAGAGGATGGAACGACTGGACGCAGGTGCCCTTCTGTTCAC
LeuThrAlaLeuAsnAspMetGlyLysValArgLysAspIleGlnGlnTrpGluProSerArgGlyTrpAsnAspTrpThrGlnValProPheCysSer>

9710 9720 9730 9740 9750 9760 9770 9780 9790
9800
ACCATTTTCACGAGTTAATTATGAAAGATGGTCGCACACTCGTAGTTCCATGCAGAAACCAAGATGAATTGATCGGCAGAGCCCGAATTTCCCAGGGAGC
HisHisPheHisGluLeuIleMetLysAspGlyArgThrLeuValValProCysArgAsnGlnAspGluLeuIleGlyArgAlaArgIleSerGlnGlyAla>

9810 9820 9830 9840 9850 9860 9870 9880 9890
9900
TGGGTGGTCTTTACGGGAGACGGCCTGTTTGGGGAAGTCTTACGCCCAAATGTGGAGCTTGATGTACTTCCACAGACGTGATCTCAGGCTAGCGGCAAAT
GlyTrpSerLeuArgGluThrAlaCysLeuGlyLysSerTyrAlaGlnMetTrpSerLeuMetTyrPheHisArgArgAspLeuArgLeuAlaAlaAsn>

9910 9920 9930 9940 9950 9960 9970 9980 9990
10000
GCCATCTGCTCGGCAGTCCCATCACACTGGATTCCAACAAGCCGGACAACCTGGTCCATACACGCCAGCCATGAATGGATGACGACGGAAGACATGTTGA
AlaIleCysSerAlaValProSerHisTrpIleProThrSerArgThrThrTrpSerIleHisAlaSerHisGluTrpMetThrThrGluAspMetLeu>

10010 10020 10030 10040 10050 10060 10070 10080 10090
10100
CAGTTTGGAACAGAGTGTGGATCCTAGAAAATCCATGGATGGAAGACAAAACTCCAGTGGAATCATGGGAGGAAATCCCATACCTGGGAAAAAGAGAAGA
ThrValTrpAsnArgValTrpIleLeuGluAsnProTrpMetGluAspLysThrProValGluSerTrpGluGluIleProTyrLeuGlyLysArgGluAsp>

10110 10120 10130 10140 10150 10160 10170 10180 10190
10200
CCAATGGTGCGGCTCGCTGATTGGGCTGACAAGCAGAGCCACCTGGGCGAAGAATATCCAGACAGCAATAAACCAAGTCAGATCCCTCATTGGCAATGAG
GlnTrpCysGlySerLeuIleGlyLeuThrSerArgAlaThrTrpAlaLysAsnIleGlnThrAlaIleAsnGlnValArgSerLeuIleGlyAsnGlu>

10210 10220 10230 10240 10250 10260 10270 10280 10290
10300
GAATACACAGATTACATGCCATCCATGAAAAGATTCAGAAGAGAAGAGGAAGAGGCAGGAGTTTTGTGGTAGAAAAACATGAAACAAAACAGAAGTCAGG
GluTyrThrAspTyrMetProSerMetLysArgPheArgArgGluGluGluGluAlaGlyValLeuTrp***>

10310 10320 10330 10340 10350 10360 10370 10380 10390
10400
TCGGATTAAGCCATAGTACGGGAAAAACTATGCTACCTGTGAGCCCCGTCCAAGGACGTTAAAAGAAGTCAGGCCATTTTGATGCCATAGCTTGAGCAAA

10410 10420 10430 10440 10450 10460 10470 10480 10490
10500
CTGTGCAGCCTGTAGCTCCACCTGAGAAGGTGTAAAAAATCCGGGAGGCCACAAACCATGGAAGCTGTACGCATGGCGTAGTGGACTAGCGGTTAGAGGA

10510 10520 10530 10540 10550 10560 10570 10580 10590
10600
GACCCCTCCCTTACAGATCGCAGCAACAATGGGGGCCCAAGGTGAGATGAAGCTGTAGTCTCACTGGAAGGACTAGAGGTTAGAGGAGACCCCCCCAAAA

10610 10620 10630 10640 10650 10660 10670 10680 10690
10700
CAAAAAACAGCATATTGACGCTGGGAAAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGGACGCCAGAAAATGGAATGGTGCTGTTGA

10710 10720 10730 10740 10750 10760 10770 10780 10790
10800
ATCAACAGGTTCTGGTACCGGTAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG

10810 10820 10830 10840 10850 10860 10870 10880 10890
10900
ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCA

10910 10920 10930 10940 10950 10960 10970 10980 10990
11000
CTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGA

11010 11020 11030 11040 11050 11060 11070 11080 11090
11100
GTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC

11110 11120 11130 11140 11150 11160 11170 11180 11190
11200
AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA

11210 11220 11230 11240 11250 11260 11270 11280 11290
11300
AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATC

11310 11320 11330 11340 11350 11360 11370 11380 11390
11400
AGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT

11410 11420 11430 11440 11450 11460 11470 11480 11490
11500
CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGA

11510 11520 11530 11540 11550 11560 11570 11580 11590
11600
TAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTC

11610 11620 11630 11640 11650 11660 11670 11680 11690
11700
ACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGC

11710 11720 11730 11740 11750 11760 11770 11780 11790
11800
TGCTGGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACT

11810 11820 11830 11840 11850 11860 11870 11880 11890
11900
TGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCG

11910 11920 11930 11940 11950 11960 11970 11980 11990
12000
GTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCC

12010 12020 12030 12040 12050 12060 12070 12080 12090
12100
CCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAAT

12110 12120 12130 12140 12150 12160 12170 12180 12190
12200
GCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCA

12210 12220 12230 12240 12250 12260 12270 12280 12290
12300
CTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGA

12310 12320 12330 12340 12350 12360 12370 12380 12390
12400
TCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTAT

12410 12420 12430 12440 12450 12460 12470 12480 12490
12500
CGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGC

12510 12520 12530 12540 12550 12560 12570 12580 12590
12600
ATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTT

12610 12620 12630 12640 12650 12660 12670 12680 12690
12700
CGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTG

12710 12720 12730 12740 12750 12760 12770 12780 12790
12800
CCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAG

12810 12820 12830 12840 12850 12860 12870 12880 12890
12900
CCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTC

12910 12920 12930 12940 12950 12960 12970 12980 12990
13000
GGGCAGCGTTGGGTCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAA

13010 13020 13030 13040 13050 13060 13070 13080 13090
13100
TCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTC

13110 13120 13130 13140 13150 13160 13170 13180 13190
13200
TGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAA

13210 13220 13230 13240 13250 13260 13270 13280 13290
13300
GCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCA

13310 13320 13330 13340 13350 13360 13370 13380 13390
13400
TCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGG

13410 13420 13430 13440 13450 13460 13470 13480 13490
13500
AAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTG

13510 13520 13530 13540 13550 13560 13570 13580 13590
13600
TGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACG

13610 13620 13630 13640 13650 13660 13670 13680 13690
13700
GTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCAC

13710 13720 13730 13740 13750 13760 13770 13780 13790
13800
GTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTA

13810 13820 13830 13840 13850 13860 13870 13880 13890
13900
AGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGG

13910 13920 13930 13940 13950 13960 13970 13980 13990
14000
CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCT

14010 14020 14030 14040 14050 14060 14070 14080 14090
14100
GGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCG

14110 14120 14130 14140 14150 14160 14170 14180 14190
14200
TTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTC

14210 14220 14230 14240 14250 14260 14270 14280 14290
14300
ATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATC

14310 14320 14330 14340 14350 14360 14370 14380 14390
14400
CGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGT

14410 14420 14430 14440 14450 14460 14470 14480 14490
14500
GCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAATCCAGTTACCTTCGGAAAAAGAG

14510 14520 14530 14540 14550 14560 14570 14580 14590
14600
TTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGA

14610 14620 14630 14640 14650 14660 14670 14680 14690
14700
TCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATC

14710 14720 14730 14740 14750 14760 14770 14780 14790
14800
CTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAG

14810 14820 14830 14840 14850 14860 14870 14880 14890
14900
CGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT

14910 14920 14930 14940 14950 14960 14970 14980 14990
15000
ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCC

15010 15020 15030 15040 15050 15060 15070 15080 15090
15100
ATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAAGATCTGGCTAGCGAT

15110 15120 15130 15140 15150
GACCCTGCTGATTGGTTCGCTGACCATTTCCGGGCGCGCCGATTTAGGTGACACTATAG

Bases 1 to 10713: DEN2 virus genome cDNA
Bases 97 to 10269: DEN2 polyprotein ORF
Bases 97 to 438: C protein ORF
Bases 439 to 936: prM protein ORF
Bases 937 to 2421: E protein ORF
Bases 2422 to 3477: NS1 protein ORF
Bases 3478 to 4131: NS2A protein ORF
Bases 4132 to 4521: NS2B protein ORF
Bases 4522 to 6375: NS3 protein ORF
Bases 6376 to 6756: NS4A protein ORF
Bases 6757 to 6825: 2K protein ORF
Bases 6826 to 7569: NS4B protein ORF
Bases 7570 to 10269: NS5 protein ORF

APPENDIX 2

Nucleotide and amino acid sequence of DEN3 (S1eman/78) cDNA plasmid p3

10 20 30 40 50 60 70 80 90 100

AGTTGTTAGTCTACGTGGACCGACAAGAACAGTTTCGACTCGGAAGCTTGCTTAACGTAGTACTGACAGTTTTTTATTAGAGAGCAGATCTCTGATGAACMet

Asn>

110 120 130 140 150 160 170 180 190 200

AACCAACGGAAAAAGACGGGAAAACCGTCTATCAATATGCTGAAACGCGTGAGAAACCGTGTGTCAACTGGATCACAGTTGGCGAAGAGATTCTCAAGAG

AsnGlnArgLysLysThrGlyLysProSerIleAsnMetLeuLysArgValArgAsnArgValSerThrGlySerGlnLeuAlaLysArgPheSerArg>

210 220 230 240 250 260 270 280 290 300

GACTGCTGAACGGCCAAGGACCAATGAAATTGGTTATGGCGTTCATAGCTTTCCTCAGATTTCTAGCCATTCCACCGACAGCAGGAGTCTTGGCTAGATG

GlyLeuLeuAsnGlyGlnGlyProMetLysLeuValMetAlaPheIleAlaPheLeuArgPheLeuAlaIleProProThrAlaGlyValLeuAlaArgTrp>

310 320 330 340 350 360 370 380 390 400

GGGAACCTTTAAGAAGTCGGGGGCTATTAAGGTCCTGAGAGGCTTCAAGAAGGAGATCTCAAACATGCTGAGCATTATCAACAGACGGAAAAAGACATCG

GlyThrPheLysLysSerGlyAlaIleLysValLeuArgGlyPheLysLysGluIleSerAsnMetLeuSerIleIleAsnArgArgLysLysThrSer>

410 420 430 440 450 460 470 480 490 500

CTCTGTCTCATGATGATGTTACCAGCAACACTTGCTTTCCACTTGACTTCACGAGATGGAAGCCGCGCATGATTGTGGGGAAGAATGAAAGAGGAAAAT

LeuCysLeuMetMetLeuProAlaThrLeuAlaPheHisLeuThrSerArgAspGlyGluProArgMetIleValGlyLysAsnGluArgGlyLys>

510 520 530 540 550 560 570 580 590 600

CCCTACTTTTTAAGACAGCCTCTGGAATCAACATGTGCACACTCATAGCCATGGATTTGGGAGAGATGTGTGATGACACGGTCACCTACAAATGCCCCCT

SerLeuLeuPheLysThrAlaSerGlyIleAsnMetCysThrLeuIleAlaMetAspLeuGlyGluMetCysAspAspThrValThrTyrLysCysProLeu>

610 620 630 640 650 660 670 680 690 700

CATTACTGAAGTGGAGCCTGAAGACATTGACTGCTGGTGCAACCTTACATCGACATGGGTGACCTACGGAACGTGCAATCAAGCTGGAGAGCACAGACGC

IleThrGluValGluProGluAspIleAspCysTrpCysAsnLeuThrSerThrTrpValThrTyrGlyThrCysAsnGlnAlaGlyGluHisArgArg>

710 720 730 740 750 760 770 780 790 800

GACAAAAGATCGGTGGCGTTAGCTCCCCATGTCGGCATGGGACTGGACACACGCACCCAAACCTGGATGTCGGCTGAAGGAGCTTGGAGACAGGTCGAGA

AspLysArgSerValAlaLeuAlaProHisValGlyMetGlyLeuAspThrArgThrGlnThrTrpMetSerAlaGluGlyAlaTrpArgGlnValGlu>

810 820 830 840 850 860 870 880 890 900

AGGTAGAGACATGGGCCTTTAGGCACCCAGGGTTCACAATACTAGCCCTATTTCTTGCCCATTACATAGGCACTTCCTTGACCCAGAAAGTGGTTATTTT

LysValGluThrTrpAlaPheArgHisProGlyPheThrIleLeuAlaLeuPheLeuAlaHisTyrIleGlyThrSerLeuThrGlnLysValValIlePhe>

910 920 930 940 950 960 970 980 990 1000

CATACTACTAATGCTGGTCACCCCATCCATGACAATGAGATGCGTGGGAGTAGGAAACAGAGATTTTGTGGAAGGCCTATCAGGAGCTACGTGGGTTGAC

IleLeuLeuMetLeuValThrProSerMetThrMetArgCysValGlyValGlyAsnArgAspPheValGluGlyLeuSerGlyAlaThrTrpValAsp>

1010 1020 1030 1040 1050 1060 1070 1080 1090 1100

GTGGTGCTCGAGCACGGTGGGTGTGTGACTACCATGGCTAAGAACAAGCCCACGCTGGATATAGAGCTCCAGAAGACCGAGGCCACCCAACTGGCGACCC

ValValLeuGluHisGlyGlyCysValThrThrMetAlaLysAsnLysProThrLeuAspIleGluLeuGlnLysThrGluAlaThrGlnLeuAlaThr>

1110 1120 1130 1140 1150 1160 1170 1180 1190 1200

TAAGGAAACTATGTATTGAGGGAAAAATTACCAACGTAACAACCGACTCAAGGTGCCCCACCCAAGGGGAAGCGATTTTACCTGAGGAGCAGGACCAGAA

LeuArgLysLeuCysIleGluGlyLysIleThrAsnValThrThrAspSerArgCysProThrGlnGlyGluAlaIleLeuProGluGluGlnAspGlnAsn>

1210 1220 1230 1240 1250 1260 1270 1280 1290 1300

CCACGTGTGCAAGCACACATACGTGGACAGAGGCTGGGGAAACGGTTGTGGTTTGTTTGGCAAGGGAAGCCTGGTAACATGCGCGAAATTTCAATGTTTG

HisValCysLysHisThrTyrValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlySerLeuValThrCysAlaLysPheGlnCysLeu>

1310 1320 1330 1340 1350 1360 1370 1380 1390 1400

GAATCAATAGAGGGAAAAGTGGTGCAGCATGAGAACCTCAAATACACCGTCATCATCACAGTGCACACAGGAGATCAACACCAGGTGGGAAATGAAACGC

GluSerIleGluGlyLysValValGlnHisGluAsnLeuLysTyrThrValIleIleThrValHisThrGlyAspGlnHisGlnValGlyAsnGluThr>

1410 1420 1430 1440 1450 1460 1470 1480 1490 1500

AGGGAGTCACGGCTGAGATAACACCCCAGGCATCAACCGTTGAAGCCATCTTACCTGAATATGGAACCCTTGGGCTAGAATGCTCACCACGGACAGGTTT

GlnGlyValThrAlaGluIleThrProGlnAlaSerThrValGluAlaIleLeuProGluTyrGlyThrLeuGlyLeuGluCysSerProArgThrGlyLeu>

1510 1520 1530 1540 1550 1560 1570 1580 1590 1600

AGATTTCAATGAAATGATTTTGTTGACAATGAAGAACAAAGCATGGATGGTACATAGACAATGGTTTTTTGACCTACCTTTACCATGGACATCAGGAGCT

AspPheAsnGluMetIleLeuLeuThrMetLysAsnLysAlaTrpMetValHisArgGlnTrpPhePheAspLeuProLeuProTrpThrSerGlyAla>

1610 1620 1630 1640 1650 1660 1670 1680 1690 1700

ACAACAGAAACACCAACCTGGAATAAGAAAGAGCTTCTTGTGACATTCAAAAACGCACATGCAAAAAAGCAAGAAGTAGTAGTCCTTGGATCGCAAGAGG

ThrThrGluThrProThrTrpAsnLysLysGluLeuLeuValThrPheLysAsnAlaHisAlaLysLysGlnGluValValValLeuGlySerGlnGlu>

1710 1720 1730 1740 1750 1760 1770 1780 1790 1800

GAGCAATGCACACAGCACTGACAGGAGCTACAGAGATCCAAACCTCAGGAGGCACAAGTATTTTTGCGGGGCACTTAAAATGTAGACTCAAGATGGACAA

GlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnThrSerGlyGlyThrSerIlePheAlaGlyHisLeuLysCysArgLeuLysMetAspLys>

1810 1820 1830 1840 1850 1860 1870 1880 1890 1900

ATTGGAACTCAAGGGGATGAGCTATGCAATGTGCTTGAATGCCTTTGTGTTGAAGAAAGAAGTCTCCGAAACGCAACATGGGACAATACTCATCAAGGTT

LeuGluLeuLysGlyMetSerTyrAlaMetCysLeuAsnAlaPheValLeuLysLysGluValSerGluThrGlnHisGlyThrIleLeuIleLysVal>

1910 1920 1930 1940 1950 1960 1970 1980 1990 2000

GAGTACAAAGGGGAAGATGCACCTTGCAAGATTCCTTTCTCCACGGAGGATGGACAAGGGAAAGCCCACAATGGCAGACTGATCACAGCTAACCCAGTGG

GluTyrLysGlyGluAspAlaProCysLysIleProPheSerThrGluAspGlyGlnGlyLysAlaHisAsnGlyArgLeuIleThrAlaAsnProVal>

2010 2020 2030 2040 2050 2060 2070 2080 2090 2100

TGACCAAGAAGGAGGAGCCTGTCAATATTGAGGCAGAACCTCCTTTTGGGGAAAGCAATATAGTAATTGGAATTGGAGACAAAGCCTTGAAAATCAACTG

ValThrLysLysGluGluProValAsnIleGluAlaGluProProPheGlyGluSerAsnIleValIleGlyIleGlyAspLysAlaLeuLysIleAsnTrp>

2110 2120 2130 2140 2150 2160 2170 2180 2190 2200

GTACAAGAAGGGAAGCTCGATTGGGAAGATGTTCGAGGCCACTGCCAGAGGTGCAAGGCGCATGGCCATCTTGGGAGACACAGCCTGGGACTTTGGATCA

TyrLysLysGlySerSerIleGlyLysMetPheGluAlaThrAlaArgGlyAlaArgArgMetAlaIleLeuGlyAspThrAlaTrpAspPheGlySer>

2210 2220 2230 2240 2250 2260 2270 2280 2290 2300

GTAGGTGGTGTTTTAAATTCATTAGGAAAAATGGTGCACCAAATATTTGGAAGTGCTTACACAGCCCTATTTAGTGGAGTCTCCTGGATAATGAAAATTG

ValGlyGlyValLeuAsnSerLeuGlyLysMetValHisGlnIlePheGlySerAlaTyrThrAlaLeuPheSerGlyValSerTrpIleMetLysIle>

2310 2320 2330 2340 2350 2360 2370 2380 2390 2400

GAATAGGTGTCCTTTTAACCTGGATAGGGTTGAATTCAAAAAACACTAGTATGAGCTTTAGCTGCATTGTGATAGGAATCATTACACTCTATCTGGGAGC

GlyIleGlyValLeuLeuThrTrpIleGlyLeuAsnSerLysAsnThrSerMetSerPheSerCysIleValIleGlyIleIleThrLeuTyrLeuGlyAla>

2410 2420 2430 2440 2450 2460 2470 2480 2490 2500

CGTGGTGCAAGCTGACATGGGGTGTGTCATAAACTGGAAAGGCAAAGAACTCAAATGTGGAAGTGGAATTTTCGTCACTAATGAGGTCCACACCTGGACA

ValValGlnAlaAspMetGlyCysValIleAsnTrpLysGlyLysGluLeuLysCysGlySerGlyIlePheValThrAsnGluValHisThrTrpThr>

2510 2520 2530 2540 2550 2560 2570 2580 2590 2600

GAGCAATACAAATTTCAAGCAGACTCCCCCAAAAGACTGGCGACAGCCATTGCAGGCGCTTGGGAGAATGGAGTGTGCGGAATCAGGTCGACAACCAGAA

GluGlnTyrLysPheGlnAlaAspSerProLysArgLeuAlaThrAlaIleAlaGlyAlaTrpGluAsnGlyValCysGlyIleArgSerThrThrArg>

2610 2620 2630 2640 2650 2660 2670 2680 2690 2700

TGGAGAACCTCTTGTGGAAGCAAATAGCCAATGAACTGAACTACATATTATGGGAAAACAACATCAAATTAACGGTAGTTGTGGGTGATATAATTGGGGT

MetGluAsnLeuLeuTrpLysGlnIleAlaAsnGluLeuAsnTyrIleLeuTrpGluAsnAsnIleLysLeuThrValValValGlyAspIleIleGlyVal>

2710 2720 2730 2740 2750 2760 2770 2780 2790 2800

CTTAGAGCAAGGGAAAAGAACACTAACACCACAACCCATGGAACTAAAATATTCATGGAAAACATGGGGAAAGGCGAAGATAGTGACAGCTGAAACACAA

LeuGluGlnGlyLysArgThrLeuThrProGlnProMetGluLeuLysTyrSerTrpLysThrTrpGlyLysAlaLysIleValThrAlaGluThrGln>

2810 2820 2830 2840 2850 2860 2870 2880 2890 2900

AATTCCTCTTTCATAATAGATGGGCCAAACACACCAGAGTGTCCAAGTGCCTCAAGAGCATGGAATGTGTGGGAGGTGGAAGATTACGGGTTCGGAGTCT

AsnSerSerPheIleIleAspGlyProAsnThrProGluCysProSerAlaSerArgAlaTrpAsnValTrpGluValGluAspTyrGlyPheGlyVal>

2910 2920 2930 2940 2950 2960 2970 2980 2990 3000

TCACAACTAACATATGGCTGAAACTCCGAGAGATGTACACCCAACTATGTGACCACAGGCTAATGTCGGCAGCCGTTAAGGATGAGAGGGCCGTACACGC

PheThrThrAsnIleTrpLeuLysLeuArgGluMetTyrThrGlnLeuCysAspHisArgLeuMetSerAlaAlaValLysAspGluArgAlaValHisAla>

3010 3020 3030 3040 3050 3060 3070 3080 3090 3100

CGACATGGGCTATTGGATAGAAAGCCAAAAGAATGGAAGTTGGAAGCTAGAAAAGGCATCCCTCATAGAGGTAAAAACCTGCACATGGCCAAAATCACAC

AspMetGlyTyrTrpIleGluSerGlnLysAsnGlySerTrpLysLeuGluLysAlaSerLeuIleGluValLysThrCysThrTrpProLysSerHis>

3110 3120 3130 3140 3150 3160 3170 3180 3190 3200

ACTCTTTGGAGCAATGGTGTGCTAGAGAGTGACATGATCATCCCAAAGAGTCTGGCTGGTCCCATTTCGCAACACAACTACAGGCCCGGATACCACACCC

ThrLeuTrpSerAsnGlyValLeuGluSerAspMetIleIleProLysSerLeuAlaGlyProIleSerGlnHisAsnTyrArgProGlyTyrHisThr>

3210 3220 3230 3240 3250 3260 3270 3280 3290 3300

AAACGGCAGGACCCTGGCACTTAGGAAAATTGGAGCTGGACTTCAACTATTGTGAAGGAACAACAGTTGTCATCACAGAAAATTGTGGGACAAGAGGCCC

GlnThrAlaGlyProTrpHisLeuGlyLysLeuGluLeuAspPheAsnTyrCysGluGlyThrThrValValIleThrGluAsnCysGlyThrArgGlyPro>

3310 3320 3330 3340 3350 3360 3370 3380 3390 3400

ATCACTGAGAACAACAACAGTGTCAGGGAAGTTGATACACGAATGGTGTTGCCGCTCGTGTACACTTCCTCCCCTGCGATACATGGGAGAAGACGGCTGC

SerLeuArgThrThrThrValSerGlyLysLeuIleHisGluTrpCysCysArgSerCysThrLeuProProLeuArgTyrMetGlyGluAspGlyCys>

3410 3420 3430 3440 3450 3460 3470 3480 3490 3500

TrpTyrGlyMetGluIleArgProIleAsnGluLysGluGluAsnMetValLysSerLeuValSerAlaGlySerGlyLysValAspAsnPheThrMet>

TGGTATGGCATGGAAATTAGACCCATTAATGAGAAAGAAGAGAACATGGTAAAGTCTTTAGTCTCAGCAGGGAGTGGAAAGGTGGATAACTTCACAATGG

3510 3520 3530 3540 3550 3560 3570 3580 3590 3600

GTGTCTTGTGTTTGGCAATCCTTTTTGAAGAGGTGATGAGAGGAPAATTTGGGAPAAAGCACATGATTGCAGGGGTTCTCTTCACGTTTGTACTCCTCT

GlyValLeuCysLeuAlaIleLeuPheGluGluValMetArgGlyLysPheGlyLysLysHisMetIleAlaGlyValLeuPheThrPheValLeuLeuLeu>

3610 3620 3630 3640 3650 3660 3670 3680 3690 3700

CTCAGGGCAAATAACATGGAGAGACATGGCGCACACACTCATAATGATTGGGTCCAACGCCTCTGACAGAATGGGAATGGGCGTCACTTACCTAGCATTG

SerGlyGlnIleThrTrpArgAspMetAlaHisThrLeuIleMetIleGlySerAsnAlaSerAspArgMetGlyMetGlyValThrTyrLeuAlaLeu>

3710 3720 3730 3740 3750 3760 3770 3780 3790 3800

ATTGCAACATTTAAAATTCAGCCATTTTTGGCTTTGGGATTCTTCCTGAGGAAACTGACATCTAGAGAAAATTTATTGTTGGGAGTTGGGTTGGCCATGG

IleAlaThrPheLysIleGlnProPheLeuAlaLeuGlyPhePheLeuArgLysLeuThrSerArgGluAsnLeuLeuLeuGlyValGlyLeuAlaMet>

3810 3820 3830 3840 3850 3860 3870 3880 3890 3900

CAACAACGTTACAACTGCCAGAGGACATTGAACAAATGGCGAATGGAATAGCTTTAGGGCTCATGGCTCTTAAATTAATAACACAATTTGAAACATACCA

AlaThrThrLeuGlnLeuProGluAspIleGluGlnMetAlaAsnGlyIleAlaLeuGlyLeuMetAlaLeuLysLeuIleThrGlnPheGluThrTyrGln>

3910 3920 3930 3940 3950 3960 3970 3980 3990 4000

ACATGGACGGCATTAGTCTCCCTAATGTGTTCAAATACAATTTTCACGTTGACTGTTGCCTGGAGAACAGCCACCCTGATTTTGGCCGGAATTTCTCTT

LeuTrpThrAlaLeuValSerLeuMetCysSerAsnThrIlePheThrLeuThrValAlaTrpArgThrAlaThrLeuIleLeuAlaGlyIleSerLeu>

4010 4020 4030 4040 4050 4060 4070 4080 4090 4100

TTGCCAGTGTGCCAGTCTTCGAGCATGAGGAAAACAGATTGGCTCCCAATGGCTGTGGCAGCTATGGGAGTTCCACCCCTACCACTTTTTATTTTCAGTT

LeuProValCysGlnSerSerSerMetArgLysThrAspTrpLeuProMetAlaValAlaAlaMetGlyValProProLeuProLeuPheIlePheSer>

4110 4120 4130 4140 4150 4160 4170 4180 4190 4200

TGAAAGATACGCTCAAAAGGAGAAGCTGGCCACTGAATGAGGGGGTGATGGCTGTTGGACTTGTGAGTATTCTAGCTAGTTCTCTCCTTAGGAATGACGT

LeuLysAspThrLeuLysArgArgSerTrpProLeuAsnGluGlyValMetAlaValGlyLeuValSerIleLeuAlaSerSerLeuLeuArgAsnAspVal>

4210 4220 4230 4240 4250 4260 4270 4280 4290 4300

GCCCATGGCTGGACCATTAGTGGCTGGGGGCTTGCTGATAGCGTGCTACGTCATAACTGGCACGTCAGCAGACCTCACTGTAGAAAAAGCAGCAGATGTC

ProMetAlaGlyProLeuValAlaGlyGlyLeuLeuIleAlaCysTyrValIleThrGlyThrSerAlaAspLeuThrValGluLysAlaAlaAspVal>

4310 4320 4330 4340 4350 4360 4370 4380 4390 4400

ACATGGGAGGAAGAGGCTGAGCAAACAGGAGTGTCCCACAATTTAATGATCACAGTTGATGACGATGGAACAATGAGAATAAAAGATGATGAGACTGAGA

ThrTrpGluGluGluAlaGluGlnThrGlyValSerHisAsnLeuMetIleThrValAspAspAspGlyThrMetArgIleLysAspAspGluThrGlu>

4410 4420 4430 4440 4450 4460 4470 4480 4490 4500

ACATCTTAACAGTGCTTTTGAAAACAGCATTACTAATAGTGTCAGGCATTTTTCCATACTCCATACCCGCAACACTGTTGGTCTGGCACACTTGGCAAAA

AsnIleLeuThrValLeuLeuLysThrAlaLeuLeuIleValSerGlyIlePheProTyrSerIleProAlaThrLeuLeuValTrpHisThrTrpGlnLys>

4510 4520 4530 4540 4550 4560 4570 4580 4590 4600

GCAAACCCAAAGATCCGGTGTCCTATGGGACGTTCCCAGCCCCCCAGAGACACAGAAAGCAGAACTGGAAGAAGGGGTTTATAGGATCAAGCAGCAAGGA

GlnThrGlnArgSerGlyValLeuTrpAspValProSerProProGluThrGlnLysAlaGluLeuGluGluGlyValTyrArgIleLysGlnGlnGly>

4610 4620 4630 4640 4650 4660 4670 4680 4690 4700

ATTTTTGGGAAAACCCAAGTGGGGGTTGGAGTACAAAAAGAAGGAGTTTTCCACACCATGTGGCACGTCACAAGAGGAGCAGTGTTGACACACAATGGGA

IlePheGlyLysThrGlnValGlyValGlyValGlnLysGluGlyValPheHisThrMetTrpHisValThrArgGlyAlaValLeuThrHisAsnGly>

4710 4720 4730 4740 4750 4760 4770 4780 4790 4800

AAAGACTGGAACCAAACTGGGCTAGCGTGAAAAAAGATCTGATTTCATACGGAGGAGGATGGAAATTGAGTGCACAATGGCAAAAAGGAGAGGAGGTGCA

LysArgLeuGluProAsnTrpAlaSerValLysLysAspLeuIleSerTyrGlyGlyGlyTrpLysLeuSerAlaGlnTrpGlnLysGlyGluGluValGln>

4810 4820 4830 4840 4850 4860 4870 4880 4890 4900

GGTTATTGCCGTAGAGCCTGGGAAGAACCCAAAGAACTTTCAAACCATGCCAGGCATTTTCCAGACAACAACAGGGGGAGATAGGAGCGATTGCACTGGAC

ValIleAlaValGluProGlyLysAsnProLysAsnPheGlnThrMetProGlyIlePheGlnThrThrThrGlyGluIleGlyAlaIleAlaLeuAsp>

4910 4920 4930 4940 4950 4960 4970 4980 4990 5000

TTCAAGCCTGGAACTTCAGGATCTCCCATCATAAACAGAGAGGGAAAGGTACTGGGATTGTATGGCAATGGAGTGGTCACAAAGAATGGTGGCTATGTCA

PheLysProGlyThrSerGlySrProIleIleAsnArgGluGlyLysValLeuGlyLeuTyrGlyAsnGlyValValThrLysAsnGlyGlyTyrVal>

5010 5020 5030 5040 5050 5060 5070 5080 5090 5100

GTGGAATAGCACAAACAAATGCAGAACCAGACGGACCGACACCAGAGTTGGAAGAAGAGATGTTCAAAAAGCGAAATCTAACCATAATGGATCTCCATCC

SerGlyIleAlaGlnThrAsnAlaGluProAspGlyProThrProGluLeuGluGluGluMetPheLysLysArgAsnLeuThrIleMetAspLeuHisPro>

5110 5120 5130 5140 5150 5160 5170 5180 5190 5200

CGGGTCAGGAAAGACGCGGAAATATCTTCCAGCTATTGTTAGAGAGGCAATCAAGAGACGCTTAAGGACTCTAATTTTGGCACCAACAAGGGTAGTTGCA

GlySerGlyLysThrArgLysTyrLeuProAlaIleValArgGluAlaIleLysArgArgLeuArgThrLeuIleLeuAlaProThrArgValValAla>

5210 5220 5230 5240 5250 5260 5270 5280 5290 5300

GCTGAGATGGAAGAAGCATTGAAAGGGCTCCCAATAAGGTATCAAACAACTGCAACAAAATCTGAACACACAGGGAGAGAGATTGTTGATCTAATGTGCC

AlaGluyMetGluGluAlaLeuLysGlyLeuProIleArgTyrGlnThrThrAlaThrLysSerGluHisThrGlyArgGluIleValAspLeuMetCys>

5310 5320 5330 5340 5350 5360 5370 5380 5390 5400

ACGCAACGTTCACAATGCGTTTGCTGTCACCAGTCAGGGTTCCAAACTACAACTTGATAATAATGGATGAGGCTCATTTCACAGACCCAGCCAGTATAGC

HisAlaThrPheThrMetArgLeuLeuSerProValArgValProAsnTyrAsnLeuIleIleMetAspGluAlaHisPheThrAspProAlaSerIleAla>

5410 5420 5430 5440 5450 5460 5470 5480 5490 5500

GGCTAGAGGGTACATATCAACTCGTGTAGGAATGGGAGAGGCAGCCGCAATTTTCATGACAGCCACACCCCCTGGAACAGCTGATGCCTTTCCTCAGAGC

AlaArgGlyTyrIleSerThrArgValGlyMetGlyGluAlaAlaAlaIlePheMetThrAlaThrProProGlyThrAlaAspAlaPheProGlnSer>

5510 5520 5530 5540 5550 5560 5570 5580 5590 5600

AACGCTCCAATTCAAGATGAAGAAAGAGACATACCAGAACGCTCATGGAATTCAGGCAATGAATGGATTACCGACTTTGCCGGGAAGACGGTGTGGTTTG

AsnAlaProIleGlnAspGluGluArgAspIleProGluArgSerTrpAsnSerGlyAsnGluTrpIleThrAspPheAlaGlyLysThrValTrpPhe>

5610 5620 5630 5640 5650 5660 5670 5680 5690 5700

TCCCTAGCATCAAAGCTGGAAATGACATAGCAAACTGCTTGCGGAAAAATGGAAAAAAGGTCATTCAACTTAGTAGGAAGACTTTTGACACAGAATATCA

ValProSerIleLysAlaGlyAsnAspIleAlaAsnCysLeuArgLysAsnGlyLysLysValIleGlnLeuSerArgLysThrPheAspThrGluTyrGln>

5710 5720 5730 5740 5750 5760 5770 5780 5790 5800

AAAGACTAAACTAAATGATTGGGACTTTGTGGTGACAACAGACATTTCAGAAATGGGAGCCAATTTCAAAGCAGACAGAGTGATCGACCCAAGAAGATGT

LysThrLysLeuAsnAspTrpAspPheValValThrThrAspIleSerGluMetGlyAlaAsnPheLysAlaAspArgValIleAspProArgArgCys>

5810 5820 5830 5840 5850 5860 5870 5880 5890 5900

CTCAAGCCAGTGATTTTGACAGACGGACCCGAGCGCGTGATCCTGGCGGGACCAATGCCAGTCACCGTAGCGAGCGCTGCGCAAAGGAGAGGGAGAGTTG

LeuLysProValIleLeuThrAspGlyProGluArgValIleLeuAlaGlyProMetProValThrValAlaSerAlaAlaGlnArgArgGlyArgVal>

5910 5920 5930 5940 5950 5960 5970 5980 5990 6000

GCAGGAACCCACAAAAAGAAAATGACCAATACATATTCATGGGCCAGCCCCTCAATAATGATGAAGACCATGCTCACTGGACAGAAGCAAAAATGCTGCT

GlyArgAsnProGlnLysGluAsnAspGlnTyrIlePheMetGlyGlnProLeuAsnAsnAspGluAspHisAlaHisTrpThrGluAlaLysMetLeuLeu>

6010 6020 6030 6040 6050 6060 6070 6080 6090 6100

AGACAACATCAACACACCAGAAGGGATCATACCAGCTCTCTTTGAACCAGAAAGGGAGAAGTCAGCCGCCATAGACGGCGAATACCGCCTGAAGGGTGAG

AspAsnIleAsnThrProGluGlyIleIleProAlaLeuPheGluProGluArgGluLysSerAlaAlaIleAspGlyGluTyrArgLeuLysGlyGlu>

6110 6120 6130 6140 6150 6160 6170 6180 6190 6200

TCCAGGAAGACCTTCGTGGAACTCATGAGGAGGGGTGACCTCCCAGTTTGGCTAGCCCATAAAGTAGCATCAGAAGGGATCAAATATACAGATAGAAAGT

SerArgLysThrPheValGluLeuMetArgArgGlyAspLeuProValTrpLeuAlaHisLysValAlaSerGluGlyIleLysTyrThrAspArgLys>

6210 6220 6230 6240 6250 6260 6270 6280 6290 6300

GGTGTTTTGATGGAGAACGCAACAATCAAATTTTAGAGGAGAATATGGATGTGGAAATCTGGACAAAGGAAGGAGAAAAGAAAAAATTGAGACCTAGGTG

TrpCysPheAspGlyGluArgAsnAsnGlnIleLeuGluGluAsnMetAspValGluIleTrpThrLysGluGlyGluLysLysLysLeuArgProArgTrp>

6310 6320 6330 6340 6350 6360 6370 6380 6390 6400

GCTTGATGCCCGCACTTATTCAGATCCCTTAGCGCTCAAGGAATTCAAGGACTTTGCGGCTGGTAGAAAGTCAATTGCCCTTGATCTTGTGACAGAAATA

LeuAspAlaArgThrTyrSerAspProLeuAlaLeuLysGluPheLysAspPheAlaAlaGlyArgLysSerIleAlaLeuAspLeuValThrGluIle>

6410 6420 6430 6440 6450 6460 6470 6480 6490 6500

GGAAGAGTGCCTTCACACTTAGCTCACAGAACGAGAAACGCCCTGGACAATCTGGTGATGTTGCACACGTCAGAACATGGCGGGAGGGCCTACAGGCATG

GlyArgValProSerHisLeuAlaHisArgThrArgAsnAAlaLeuAspAsnLeuValMetLeuHisThrSerGLuHisGlyGlyArgAlaTyrArgHis>

6510 6520 6530 6540 6550 6560 6570 6580 6590 6600

CAGTGGAGGAACTACCAGAAACAATGGAAACACTCTTACTCCTGGGACTCATGATCCTGTTAACAGGTGGAGCAATGCTTTTCTTGATATCAGGTAAAGG

AlaValGluGluLeuProGluThrMetGluThrLeuLeuLeuLeuGlyLeuMetIleLeuLeuThrGlyGlyAlaMetLeuPheLeuIleSerGlyLysGly>

6610 6620 6630 6640 6650 6660 6670 6680 6690 6700

GATTGGAAAGACTTCAATAGGACTCATTTGTGTAGCTGCTTCCAGCGGTATGTTATGGATGGCTGATGTCCCACTCCAATGGATCGCGTCTGCCATAGTC

IleGlyLysThrSerIleGLyLeuIleCysValAlaAlaSerSerGlyMetLeuTrpMetAlaAspValProLeuGlnTrpIleAlaSerAlaIleVal>

6710 6720 6730 6740 6750 6760 6770 6780 6790 6800

CTGGAGTTTTTTATGATGGTGTTACTTATACCAGAACCAGAAAAGCAGAGAACTCCCCAAGACAATCAACTCGCATATGTCGTGATAGGCATACTCACAC

LeuGluPhePheMetMetValLeuLeuIleProGluProGluLysGlnArgThrProGlnAspAsnGlnLeuAlaTyrValValIleGlyIleLeuThr>

6810 6820 6830 6840 6850 6860 6870 6880 6890 6900

TGGCTGCAATAGTAGCAGCCAATGAAATGGGACTGTTGGAAACCACAAAGAGAGATTTAGGAATGTCCAAAGAACCAGGTGTTGTTTCTCCAACCAGCTA

LeuAlaAlaIleValAlaAlaAsnGluMetGlyLeuLeuGluThrThrLysArgAspLeuGlyMetSerLysGluProGlyValValSerProThrSerTyr>

6910 6920 6930 6940 6950 6960 6970 6980 6990 7000

TTTGGATGTGGACTTGCACCCAGCATCAGCCTGGACATTGTACGCTGTGGCCACAACAGTAATAACACCAATGTTGAGACATACCATAGAGAATTCCACA

LeuAspValAspLeuHisProAlaSerAlaTrpThrLeuTyrAlaValAlaThrThrValIleThrProMetLeuArgHisThrIleGluAsnSerThr>

7010 7020 7030 7040 7050 7060 7070 7080 7090 7100

GCAAATGTGTCCCTGGCAGCTATAGCCAACCAGGCAGTGGTCCTGATGGGTTTAGACAAAGGATGGCCGATATCGAAAATGGACTTAGGCGTGCCACTAT

AlaAsnValSerLeuAlaAlaIleAlaAsnGlnAlaValValLeuMetGlyLeuAspLysGlyTrpProIleSerLysMetAspLeuGLyValProLeu>

7110 7120 7130 7140 7150 7160 7170 7180 7190 7200

TGGCACTGGGTTGTTATTCACAAGTGAACCCACTAACTCTCACAGCGGCAGTTCTCCTGCTAGTCACGCATTATGCTATTATAGGTCCAGGATTGCAGGC

LeuAlaLeuGlyCysTyrSerGlnValAsnProLeuThrLeuThrAlaAlaValLeuLeuLeuValThrHisTyrAlaIleIleGlyProGlyLeuGlnAla>

7210 7220 7230 7240 7250 7260 7270 7280 7290 7300

AAAAGCCACTCGTGAAGCTCAAAAAAGGACAGCTGCTGGAATAATGAAGAATCCAACGGTGGATGGGATAATGACAATAGACCTAGATCCTGTAATATAC

LysAlaThrArgGluAlaGlnLysArgThrAlaAlaGlyIleMetLysAsnProThrValAspGlyIleMetThrIleAspLeuAspProValIleTyr>

7310 7320 7330 7340 7350 7360 7370 7380 7390 7400

GATTCAAAATTTGAAAAGCAACTAGGACAGGTTATGCTCCTGGTTCTGTGTGCAGTTCAACTTTTGTTAATGAGAACATCATGGGCTTTTTGTGAAGCTC

AspSerLysPheGluLysGlnLeuGlyGlnValMetLeuLeuValLeuCysAlaValGlnLeuLeuLeuMetArgThrSerTrpAlaPheCysGluAla>

7410 7420 7430 7440 7450 7460 7470 7480 7490 7500

TAACCCTAGCCACAGGACCAATAACAACACTCTGGGAAGGATCACCTGGGAAGTTCTGGAACACCACGATAGCTGTTTCCATGGCGAACATCTTTAGAGG

LeuThrLeuAlaThrGlyProIleThrThrLeuTrpGluGlySerProGlyLysPheTrpAsnThrThrIleAlaValSerMetAlaAsnIlePheArgGly>

7510 7520 7530 7540 7550 7560 7570 7580 7590 7600

GAGCTATTTAGCAGGAGCTGGGCTTGCTTTTTCTATCATGAAATCAGTTGGAACAGGAAAGAGAGGGACAGGGTCACAGGGTGAAACCTTGGGAGAAAAG

SerTyrLeuAlaGlyAlaGlyLeuAlaPheSerIleMetLysSerValGlyThrGlyLysArgGlyThrGlySerGlnGlyGluThrLeuGlyGluLys>

7610 7620 7630 7640 7650 7660 7670 7680 7690 7700

TGGAAAAAGAAATTGAATCAATTACCCCGGAAAGAGTTTGACCTTTACAAGAAATCCGGAATCACTGAAGTGGATAGAACAGAAGCCAAAGAAGGGTTGA

TrpLysLysLysLeuAsnGlnLeuProArgLysGluPheAspLeuTyrLysLysSerGlyIleThrGluValAspArgThrGluAlaLysGluGlyLeu>

7710 7720 7730 7740 7750 7760 7770 7780 7790 7800

AAAGAGGAGAAATAACACACCATGCCGTGTCCAGAGGCAGCGCAAAACTTCAATGGTTCGTGGAGAGAAACATGGTCATCCCCGAAGGAAGAGTCATAGA

LysArgGlyGluIleThrHisHisAlaValSerArgGlySerAlaLysLeuGlnTrpPheValGluArgAsnMetValIleProGluGlyArgValIleAsp>

7810 7820 7830 7840 7850 7860 7870 7880 7890 7900

CTTAGGCTGTGGAAGAGGAGGCTGGTCATATTATTGTGCAGGACTGAAAAAAGTTACAGAAGTGCGAGGATACACAAAAGGCGGCCCAGGACATGAAGAA

LeuGlyCysGlyArgGlyGlyTrpSerTyrTyrCysAlaGlyLeuLysLysValThrGluValArgGlyTyrThrLysGlyGlyProGlyHisGluGlu>

7910 7920 7930 7940 7950 7960 7970 7980 7990 8000

CCAGTACCTATGTCTACATACGGATGGAACATAGTCAAGTTAATGAGTGGAAAGGATGTGTTTTATCTTCCACCTGAAAAGTGTGATACTCTATTGTGTG

ProValProMetSerThrTyrGlyTrpAsnIleValLysLeuMetSerGlyLysAspValPheTyrLeuProProGluLysCysAspThrLeuLeuCys>

8010 8020 8030 8040 8050 8060 8070 8080 8090 8100

ACATTGGAGAATCTTCACCAAGCCCAACAGTGGAAGAAAGCAGAACCATAAGAGTCTTGAAGATGGTTGAACCATGGCTAAAAAATAACCAGTTTTGCAT

AspIleGlyGluSerSerProSerProThrValGluGluSerArgThrIleArgValLeuLysMetValGluProTrpLeuLysAsnAsnGlnPheCysIle>

8110 8120 8130 8140 8150 8160 8170 8180 8190 8200

TAAAGTATTGAACCCTTACATGCCAACTGTGATTGAGCACCTAGAAAGACTACAAAGGAAACATGGAGGAATGCTTGTGAGAAATCCACTCTCACGAAAC

LysValLeuAsnProTyrMetProThrValIleGluHisLeuGluArgLeuGlnArgLysHisGlyGlyMetLeuValArgAsnProLeuSerArgAsn>

8210 8220 8230 8240 8250 8260 8270 8280 8290 8300

TCCACGCACGAAATGTACTGGATATCTAATGGCACAGGCAATATCGTTTCTTCAGTCAACATGGTATCCAGATTGCTACTTAACAGATTCACAATGACAC

SerThrHisGLuMetTyrTrpIleSerAsnGlyThrGlyAsnIleValSerSerValAsnMetValSerArgLeuLeuLeuAsnArgPheThrMetThr>

8310 8320 8330 8340 8350 8360 8370 8380 8390 8400

ATAGGAGACCCACCATAGAGAAAGATGTGGATTTAGGAGCGGGGACCCGACATGTCAATGCGGAACCAGAAACACCCAACATGGATGTCATTGGGGAAAG

HisArgArgProThrIleGluLysAspValAspLeuGlyAlaGlyThrArgHisValAsnAlaGluProGluThrProAsnMetAspValIleGlyGluArg>

8410 8420 8430 8440 8450 8460 8470 8480 8490 8500

AATAAGAAGGATCAAGGAGGAGCATAGTTCAACATGGCACTATGATGATGAAAATCCTTATAAAACGTGGGCTTACCATGGATCCTATGAAGTTAAGGCC

IleArgArgIleLysGluGluHisSerSerThrTrpHisTyrAspAspGluAsnProTyrLysThrTrpAlaTyrHisGlySerTyrGluValLysAla>

8510 8520 8530 8540 8550 8560 8570 8580 8590 8600

ACAGGCTCAGCCTCCTCCATGATAAATGGAGTCGTGAAACTCCTCACGAAACCATGGGATGTGGTGCCCATGGTGACACAGATGGCAATGACGGATACAA

ThrGlySerAlaSerSerMetIleAsnGlyValValLysLeuLeuThrLysProTrpAspValValProMetValThrGlnMetAlaMetThrAspThr>

8610 8620 8630 8640 8650 8660 8670 8680 8690 8700

CCCCATTCGGCCAGCAAAGGGTTTTTAAAGAGAAAGTGGACACCAGGACACCCAGACCTATGCCAGGAACAAGAAAGGTTATGGAGATCACAGCGGAATG

ThrProPheGlyGlnGlnArgValPheLysGluLysValAspThrArgThrProArgProMetProGlyThrArgLysValMetGluIleThrAlaGluTrp>

8710 8720 8730 8740 8750 8760 8770 8780 8790 8800

GCTTTGGAGAACCCTGGGAAGGAACAAAAGACCCAGATTATGTACGAGAGAGGAGTTCACAAAAAAGGTCAGAACCAACGCAGCTATGGGCGCCGTTTTT

LeuTrpArgThrLeuGlyArgAsnLysArgProArgLeuCysThrArgGluGluPheThrLysLysValArgThrAsnAlaAlaMetGlyAlaValPhe>

8810 8820 8830 8840 8850 8860 8870 8880 8890 8900

ACAGAGGAGAACCAATGGGACAGTGCTAGAGCTGCTGTTGAGGATGAAGAATTCTGGAAACTCGTGGACAGAGAACGTGAACTCCACAAATTGGGCAAGT

ThrGluGluAsnGlnTrpAspSerAlaArgAlaAlaValGluAspGluGluPheTrpLysLeuValAspArgGluArgGluLeuHisLysLeuGlyLys

8910 8920 8930 8940 8950 8960 8970 8980 8990 9000

GTGGAAGCTGCGTTTACAACATGATGGGCAAGAGAGAGAAGAAACTTGGAGAGTTTGGCAAAGCAAAAGGCAGTAGAGCCATATGGTACATGTGGTTGGG

CysGlySerCysValTyrAsnMetMetGlyLysArgGluLysLysLeuGlyGluPheGlyLysAlaLysGlySerArgAlaIleTrpTyrMetTrpLeuGly>

9010 9020 9030 9040 9050 9060 9070 9080 9090 9100

AGCCAGATACCTTGAGTTCGAAGCACTCGGATTCTTAAATGAAGACCATTGGTTCTCGCGTGAAAACTCTTACAGTGGAGTAGAAGGAGAAGGACTGCAC

AlaArgTyrLeuGluPheGluAlaLeuGlyPheLeuAsnGluAspHisTrpPheSerArgGluAsnSerTyrSerGlyValGluGlyGluGlyLeuHis>

9110 9120 9130 9140 9150 9160 9170 9180 9190 9200

AAGCTGGGATACATCTTAAGAGACATTTCCAGATACCCGGAGGAGCTATGTATGCTGATGACACAGCTGGTTGGGACACAAGAATTAACAGAAGATGACC

LysLeuGlyTyrIleLeuArgAspIleSerLysIleProGlyGlyAlaMetTyrAlaAspAspThrAlaGlyTrpAspThrArgIleThrGluAspAsp>

9210 9220 9230 9240 9250 9260 9270 9280 9290 9300

TGCACAATGAGGAAAAAATCACACAGCAAATGGACCCTGAACACAGGCAGTTAGCAAACGCTATATTCAAGCTCACATACCAAAACAAAGTGGTCAAAGT

LeuHisAsnGluGluLysIleThrGlnGlnMetAspProGluHisArgGlnLeuAlaAsnAlaIlePheLysLeuThrTyrGlnAsnLysValValLysVal>

9310 9320 9330 9340 9350 9360 9370 9380 9390 9400

TCAACGACCAACTCCAAAGGGCACGGTAATGGACATCATATCTAGGAAAGACCAAAGAGGCAGTGGACAGGTGGGAACTTATGGTCTGAATACATTCACC

GlnArgProThrProLysGlyThrValMetAspIleIleSerArgLysAspGlnArgGlySerGlyGlnValGlyThrTyrGlyLeuAsnThrPheThr>

9410 9420 9430 9440 9450 9460 9470 9480 9490 9500

AACATGGAAGCCCAGTTAATCAGACAAATGGAAGGAGAAGGTGTGTTGTCGAAGGCAGACCTCGAGAACCCTCATCTGCTAGAGAAGAAAGTTACACAAT

AsnMetGluAlaGlnLeuIleArgGlnMetGluGlyGluGlyValLeuSerLysAlaAspLeuGluAsnProHisLeuLeuGluLysLysValThrGln>

9510 9520 9530 9540 9550 9560 9570 9580 9590 9600

GGTTGGAAACAAAAGGAGTGGAGAGGTTAAAAAGAATGGCCATCAGCGGGGATGATTGCGTGGTGAAACCAATTGATGACAGGTTCGCCAATGCCCTGCT

TrpLeuGluThrLysGlyValGluArgLeuLysArgMetAlaIleSerGlyAspAspCysValValLysProIleAspAspArgPheAlaAsnAlaLeuLeu>

9610 9620 9630 9640 9650 9660 9670 9680 9690 9700

TGCCCTGAATGACATGGGAAAAGTTAGGAAGGACATACCTCAATGGCAGCCATCAAAGGGATGGCATGATTGGCAACAGGTCCCTTTCTGCTCCCACCAC

AlaLeuAsnAspMetGlyLysValArgLysAspIleProGlnTrpGlnProSerLysGlyTrpHisAspTrpGLnGlnValProPheCysSerHisHis>

9710 9720 9730 9740 9750 9760 9770 9780 9790 9800

TTTCATGAATTGATCATGAAAGATGGAAGAAAGTTGGTAGTTCCCTGCAGACCTCAGGATGAATTAATCGGGAGAGCGAGAATCTCTCAAGGAGCAGGAT

PheHisGluLeuIleMetLysAspGlyArgLysLeuValValProCysArgProGlnAspGluLeuIleGlyArgAlaArgIleSerGlnGlyAlaGly>

9810 9820 9830 9840 9850 9860 9870 9880 9890 9900

GGAGCCTTAGAGAAACTGCATGCCTAGGGAAAGCCTACGCCCAAATGTGGACTCTCATGTACTTTCACAGAAGAGATCTTAGACTAGCATCCAACGCCAT

TrpSerLeuArgGluThrAlaCysLeuGlyLysAlaTyrAlaGlnMetTrpThrLeuMetTyrPheHisArgArgAspLeuArgLeuAlaSerAsnAlaIle>

9910 9920 9930 9940 9950 9960 9970 9980 9990 10000

ATGTTCAGCAGTACCAGTCCATTGGGTCCCCACAAGCAGAACGACGTGGTCTATTCATGCTCACCATCAGTGGATGACTACAGAAGACATGCTTACTGTT

CysSerAlaValProValHisTrpValProThrSerArgThrThrTrpSerIleHisAlaHisHisGlnTrpMetThrThrGluAspMetLeuThrVal>

10010 10020 10030 10040 10050 10060 10070 10080 10090 10100

TGGAACAGGGTGTGGATAGAGGATAATCCATGGATGGAAGACAAAACTCCAGTCAAAACCTGGGAAGATGTTCCATATCTAGGGAAGAGAGAAGACCAAT

TrpAsnArgValTrpIleGluAspAsnProTrpMetGluAspLysThrProValLysThrTrpGluAspValProTyrLeuGlyLysArgGluAspGln>

10110 10120 10130 10140 10150 10160 10170 10180 10190 10200

GGTGCGGATCACTCATTGGTCTCACTTCCAGAGCAACCTGGGCCCAGAACATACTTACGGCAATCCAACAGGTGAGAAGCCTTATAGGCAATGAAGAGTT

TrpCysGlySerLeuIleGlyLeuThrSerArgAlaThrTrpAlaGlnAsnIleLeuThrAlaIleGlnGlnValArgSerLeuIleGlyAsnGluGluPhe>

10210 10220 10230 10240 10250 10260 10270 10280 10290 10300

TCTGGACTACATGCCTTCGATGAAGAGATTCAGGAAGGAGGAGGAGTCAGAGGGAGCCATTTGGTAAACGTAGGAAGTGAAAAAGAGGCAAACTGTCAGG

LeuAspTyrMetProSerMetLysArgPheArgLysGluGluGluSerGluGlyAlaIleTrp***>

10310 10320 10330 10340 10350 10360 10370 10380 10390 10400

CCACCTTAAGCCACAGTACGGAAGAAGCTGTGCAGCCTGTGAGCCCCGTCCAAGGACGTTAAAAGAAGAAGTCAGGCCCAAAAGCCACGGTTTGAGCAAA

10410 10420 10430 10440 10450 10460 10470 10480 10490 10500

CCGTGCTGCCTGTGGCTCCGTCGTGGGGACGTAAAACCTGGGAGGCTGCAAACTGTGGAAGCTGTACGCACGGTGTAGCAGACTAGCGGTTAGAGGAGAC

10510 10520 10530 10540 10550 10560 10570 10580 10590 10600

CCCTCCCATGACACAACGCAGCAGCGGGGCCCGAGCTCTGAGGGAAGCTGTACCTCCTTGCAAAGGACTAGAGGTTAGAGGAGACCCCCCGCAAATAAAA

10610 10620 10630 10640 10650 10660 10670 10680 10690 10700

ACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAAC

10710 10720 10730 10740 10750 10760 10770 10780 10790 10800

AGGTTCTGGTACCGGTAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCC

10810 10820 10830 10840 10850 10860 10870 10880 10890 10900

CATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCAT

10910 10920 10930 10940 10950 10960 10970 10980 10990 11000

AATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCT

11010 11020 11030 11040 11050 11060 11070 11080 11090 11100

CTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGAT

11110 11120 11130 11140 11150 11160 11170 11180 11190 11200

CTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACA

11210 11220 11230 11240 11250 11260 11270 11280 11290 11300

GGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTT

11310 11320 11330 11340 11350 11360 11370 11380 11390 11400

ATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGA

11410 11420 11430 11440 11450 11460 11470 11480 11490 11500

AACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATAAGCT

11510 11520 11530 11540 11550 11560 11570 11580 11590 11600

TTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTG

11610 11620 11630 11640 11650 11660 11670 11680 11690 11700

GATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTGG

11710 11720 11730 11740 11750 11760 11770 11780 11790 11800

CGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGC

11810 11820 11830 11840 11850 11860 11870 11880 11890 11900

CACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCT

11910 11920 11930 11940 11950 11960 11970 11980 11990 12000

GGCGCCTATATCGCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTTGGCAGGCCCCGTGG

12010 12020 12030 12040 12050 12060 12070 12080 12090 12100

CCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGA

12110 12120 12130 12140 12150 12160 12170 12180 12190 12200

GTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATG

12210 12220 12230 12240 12250 12260 12270 12280 12290 12300

ACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCC

12310 12320 12330 12340 12350 12360 12370 12380 12390 12400

TGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTCGGCGAGAAGCAGGCCATTATCGCCGG

12410 12420 12430 12440 12450 12460 12470 12480 12490 12500

CATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGG

12510 12520 12530 12540 12550 12560 12570 12580 12590 12600

ATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCA

12610 12620 12630 12640 12650 12660 12670 12680 12690 12700

CTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCC

12710 12720 12730 12740 12750 12760 12770 12780 12790 12800

CGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATC

12810 12820 12830 12840 12850 12860 12870 12880 12890 12900

AATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAG

12910 12920 12930 12940 12950 12960 12970 12980 12990 13000

CGTTGGGTCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCG

13010 13020 13030 13040 13050 13060 13070 13080 13090 13100

ATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAA

13110 13120 13130 13140 13150 13160 13170 13180 13190 13200

CGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTG

13210 13220 13230 13240 13250 13260 13270 13280 13290 13300

GCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTA

13310 13320 13330 13340 13350 13360 13370 13380 13390 13400

ACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGGAAAAAA

13410 13420 13430 13440 13450 13460 13470 13480 13490 13500

CCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATC

13510 13520 13530 13540 13550 13560 13570 13580 13590 13600

GCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACA

13610 13620 13630 13640 13650 13660 13670 13680 13690 13700

GCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCG

13710 13720 13730 13740 13750 13760 13770 13780 13790 13800

ATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGA

13810 13820 13830 13840 13850 13860 13870 13880 13890 13900

AAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAA

13910 13920 13930 13940 13950 13960 13970 13980 13990 14000

TACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT

14010 14020 14030 14040 14050 14060 14070 14080 14090 14100

TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCC

14110 14120 14130 14140 14150 14160 14170 14180 14190 14200

CCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCT

14210 14220 14230 14240 14250 14260 14270 14280 14290 14300

CACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAA

14310 14320 14330 14340 14350 14360 14370 14380 14390 14400

CTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACA

14410 14420 14430 14440 14450 14460 14470 14480 14490 14500

GAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTA

14510 14520 14530 14540 14550 14560 14570 14580 14590 14600

GCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTT

14610 14620 14630 14640 14650 14660 14670 14680 14690 14700

GATCTTTTCTACGGGGTCTGACGCTCATTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTA

14710 14720 14730 14740 14750 14760 14770 14780 14790 14800

AATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCT

14810 14820 14830 14840 14850 14860 14870 14880 14890 14900

GTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCG

14910 14920 14930 14940 14950 14960 14970 14980 14990 15000

AGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAG

15010 15020 15030 15040 15050 15060 15070 15080 15090 15100

TCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAAGATCTGGCTAGCGATGACCCT

15110 15120 15130 15140 15150

GCTGATTGGTTCGCTGACCATTTCCGGGCGCGCCGATTTAGGTGACACTATAG

Bases 1 to 10707: DEN3 virus genome cDNA

Bases 95 to 10264: DEN3 polyprotein ORF

Bases 95 to 436: C protein ORF

Bases 437 to 934: prM protein ORF

Bases 935 to 2413: E protein ORF

Bases 2414 to 3469: NS1 protein ORF

Bases 3470 to 4123: NS2A protein ORF

Bases 4124 to 4513: NS2B protein ORF

Bases 4514 to 6370: NS3 protein ORF

Bases 6371 to 6751: NS4A protein ORF

Bases 6752 to 6820: 2K protein ORF

Bases 6821 to 7564: NS4B protein ORF

Bases 7575 to 10264 NS5 protein ORF

APPENDIX 3

Nucleotide and amino acid sequence of DEN1 (Puerto Rico/94) CME chimeric region

10 20 30 40 50 60 70 80 90 100

AGTTGTTAGTCTGTGTGGACCGACAAGGACAGTTCCAAATCGGAAGCTTGCTTAACACAGTTCTAACAGTTTGTTTGAATAGAGAGCAGATCTCTGGAAA

110 120 130 140 150 160 170 180 190 200

AATGAACAACCAACGGAAAAAGACGGGTCGACCGTCTTTCAATATGCTGAAACGCGCGAGAAACCGCGTGTCAACTGGTTCACAGTTGGCGAAGAGATTC

MetAsnAsnGlnArgLysLysThrGlyArgProSerPheAsnMetLeuLysArgAlaArgAsnArgValSerThrGlySerGlnLeuAlaLysArgPhe>

210 220 230 240 250 260 270 280 290 300

TCAAAAGGATTGCTTTCAGGCCAAGGACCCATGAAATTGGTGATGGCTTTCATAGCATTTCTAAGATTTCTAGCCATACCCCCAACAGCAGGAATTTTGG

SerLysGlyLeuLeuSerGlyGlnGlyProMetLysLeuValMetAlaPheIleAlaPheLeuArgPheLeuAlaIleProProThrAlaGlyIleLeu>

310 320 330 340 350 360 370 380 390 400

CTAGATGGAGCTCATTCAAGAAGAATGGAGCGATCAAAGTGTTACGGGGTTTCAAAAAAGAGATCTCAAGCATGTTGAACATTATGAACAGGAGGAAAAA

AlaArgTrpSerSerPheLysLysAsnGlyAlaIleLysValLeuArgGlyPheLysLysGluIleSerSerMetLeuAsnIleMetAsnArgArgLysLys>

410 420 430 440 450 460 470 480 490 500

ATCTGTGACCATGCTCCTCATGCTGCTGCCCACAGCCCTGGCGTTCCATTTGACCACACGAGGGGGAGAGCCACACATGATAGTTAGTAAGCAGGAAAGA

SerValThrMetLeuLeuMetLeuLeuProThrAlaLeuAlaPheHisLeuThrThrArgGlyGlyGluProHisMetIleValSerLysGlnGluArg>

510 520 530 540 550 560 570 580 590 600

GGAAAGTCACTGTTGTTTAAGACCTCTGCAGGCATCAATATGTGCACTCTCATTGCGATGGATTTGGGAGAGTTATGCGAGGACACAATGACCTACAAAT

GlyLysSerLeuLeuPheLysThrSerAlaGlyIleAsnMetCysThrLeuIleAlaMetAspLeuGlyGluLeuCysGluAspThrMetThrTyrLys>

610 620 630 640 650 660 670 680 690 700

GCCCCCGGATCACTGAGGCGGAACCAGATGACGTTGACTGCTGGTGCAATGCCACAGACACATGGGTGACCTATGGGACGTGTTCTCAAACCGGCGAACA

CysProArgIleThrGluAlaGluProAspAspValAspCysTrpCysAsnAlaThrAspThrTrpValThrTyrGlyThrCysSerGlnThrGlyGluHis>

710 720 730 740 750 760 770 780 790 800

CCGACGAGACAAACGTTCCGTGGCACTGGCCCCACACGTGGGACTTGGTCTAGAAACAAGAACCGAAACATGGATGTCCTCTGAAGGTGCCTGGAAACAA

ArgArgAspLysArgSerValAlaLeuAlaProHisValGlyLeuGlyLeuGluThrArgThrGluThrTrpMetSerSerGluGlyAlaTrpLysGln>

810 820 830 840 850 860 870 880 890 900

GTACAAAAAGTGGAGACTTGGGCTTTGAGACACCCAGGATTCACGGTGACAGCCCTTTTTTTAGCACATGCCATAGGAACATCCATTACTCAGAAAGGGA

ValGlnLysValGluThrTrpAlaLeuArgHisProGlyPheThrValThrAlaLeuPheLeuAlaHisAlaIleGlyThrSerIleThrGlnLysGly>

910 920 930 940 950 960 970 980 990 1000

TCATTTTCATTCTGCTGATGCTAGTAACACCATCAATGGCCATGCGATGTGTGGGAATAGGCAACAGAGACTTCGTTGAAGGACTGTCAGGAGCAACGTG

IleIlePheIleLeuLeuMetLeuValThrProSerMetAlaMetArgCysValGlyIleGlyAsnArgAspPheValGluGlyLeuSerGlyAlaThrTrp>

1010 1020 1030 1040 1050 1060 1070 1080 1090 1100

GGTGGACGTGGTATTGGAGCATGGAAGCTGCGTCACCACCATGGCAAAAGATAAACCAACATTGGACATTGAACTCTTGAAGACGGAGGTCACAAACCCT

ValAspValValLeuGluHisGlySerCysValThrThrMetAlaLysAspLysProThrLeuAspIleGluLeuLeuLysThrGluValThrAsnPro>

1110 1120 1130 1140 1150 1160 1170 1180 1190 1200

GCCGTCTTGCGCAAACTGTGCATTGAAGCTAAAATATCAAACACCACCACCGATTCAAGGTGTCCAACACAAGGAGAGGCTACACTGGTGGAAGAACAGG

AlaValLeuArgLysLeuCysIleGluAlaLysIleSerAsnThrThrThrAspSerArgCysProThrGlnGlyGluAlaThrLeuValGluGluGln>

1210 1220 1230 1240 1250 1260 1270 1280 1290 1300

ACTCGAACTTTGTGTGTCGACGAACGTTTGTGGACAGAGGCTGGGGTAATGGCTGCGGACTATTTGGAAAAGGAAGCCTACTGACGTGTGCTAAGTTCAA

AspSerAsnPheValCysArgArgThrPheValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlySerLeuLeuThrCysAlaLysPheLys>

1310 1320 1330 1340 1350 1360 1370 1380 1390 1400

GTGTGTGACAAAACTAGAAGGAAAGATAGTTCAATATGAAAACTTAAAATATTCAGTGATAGTCACTGTCCACACTGGGGACCAGCACCAGGTGGGAAAC

CysValThrLysLeuGluGlyLysIleValGlnTyrGluAsnLeuLysTyrSerValIleValThrValHisThrGlyAspGlnHisGlnValGlyAsn>

1410 1420 1430 1440 1450 1460 1470 1480 1490 1500

GAGACTACAGAACATGGAACAATTGCAACCATAACACCTCAAGCTCCTACGTCGGAAATACAGCTGACTGACTACGGAGCCCTCACATTGGACTGCTCGC

GluThrThrGluHisGlyThrIleAlaThrIleThrProGlnAlaProThrSerGluIleGlnLeuThrAspTyrGlyAlaLeuThrLeuAspCysSer>

1510 1520 1530 1540 1550 1560 1570 1580 1590 1600

CTAGAACAGGGCTGGACTTTAATGAGATGGTTCTATTGACAATGAAAGAAAAATCATGGCTTGTCCACAAACAATGGTTTCTAGACTTACCACTGCCTTG

ProArgThrGlyLeuAspPheAsnGluMetValLeuLeuThrMetLysGluLysSerTrpLeuValHisLysGlnTrpPheLeuAspLeuProLeuProTrp>

1610 1620 1630 1640 1650 1660 1670 1680 1690 1700

GACTTCAGGAGCTTCAACATCTCAAGAGACTTGGAACAGACAAGATTTGCTGGTCACATTCAAGACAGCTCATGCAAAGAAACAGGAAGTAGTCGTACTG

ThrSerGlyAlaSerThrSerGlnGluThrTrpAsnArgGlnAspLeuLeuValThrPheLysThrAlaHisAlaLysLysGlnGluValValValLeu>

1710 1720 1730 1740 1750 1760 1770 1780 1790 1800

GGATCACAGGAAGGAGCAATGCACACTGCGTTGACTGGGGCGACAGAAATCCAGACGTCAGGAACGACAACAATCTTTGCAGGACACCTGAAATGCAGAC

GlySerGlnGluGlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnThrSerGlyThrThrThrIlePheAlaGlyHisLeuLysCysArg>

1810 1820 1830 1840 1850 1860 1870 1880 1890 1900

TAAAAATGGATAAACTGACTTTAAAAGGGAGTCATATGTAATGTGCACAGGCTCATTTAAGCTAGAGAAGGAAGTGGCTGAGACCCAGCATGGAACTGT

LeuLysMetAspLysLeuThrLeuLysGlyMetSerTyrValMetCysThrGlySerPheLysLeuGluLysGluValAlaGluThrGlnHisGlyThrVal>

1910 1920 1930 1940 1950 1960 1970 1980 1990 2000

TTTAGTGCAGGTTAAATACGAAGGAACAGATGCGCCATGCAAGATCCCTTTTTCGGCCCAAGATGAGAAAGGAGTGACCCAGAATGGGAGATTGATAACA

LeuValGlnValLysTyrGluGlyThrAspAlaProCysLysIleProPheSerAlaGlnAspGluLysGlyValThrGlnAsnGlyArgLeuIleThr>

2010 2020 2030 2040 2050 2060 2070 2080 2090 2100

GCCAACCCCATAGTCACTGACAAAGAAAAACCAGTCAACATTGAGACAGAACCACCTTTTGGTGAGAGCTACATCGTGGTAGGGGCAGGTGAAAAAGCTT

AlaAsnProIleValThrAspLysGluLysProValAsnIleGluThrGluProProPheGlyGluSerTyrIleValValGlyAlaGlyGluLysAla>

2110 2120 2130 2140 2150 2160 2170 2180 2190 2200

TGAAACTGAGCTGGTTCAAGAAAGGGAGCAGCATAGGGAAAATGTTCGAAGCAACTGCCCGAGGAGCGCGAAGGATGGCTATCCTGGGAGACACCGCATG

LeuLysLeuSerTrpPheLysLysGlySerSerIleGlyLysMetPheGluAlaThrAlaArgGlyAlaArgArgMetAlaIleLeuGlyAspThrAlaTrp>

2210 2220 2230 2240 2250 2260 2270 2280 2290 2300

GGACTTTGGCTCTATAGGAGGAGTGTTCACATCAGTGGGAAAATTGGTACACCAGGTTTTTGGAGCCGCATATGGGGTTCTGTTCAGCGGTGTTTCTTGG

AspPheGlySerIleGlyGlyValPheThrSerValGlyLysLeuValHisGlnValPheGlyAlaAlaTyrGlyValLeuPheSerGlyValSerTyr>

2310 2320 2330 2340 2350 2360 2370 2380 2390 2400

ACCATGAAAATAGGAATAGGGATTCTGCTGACATGGCTAGGATTAAACTCGAGGAACACTTCAATGGCTATGACGTGCATAGCTGTTGGAGGAATCACTC

ThrMetLysIleGlyIleGlyIleLeuLeuThrTrpLeuGlyLeuAsnSerArgAsnThrSerMetAlaMetThrCysIleAlaValGlyGlyIleThr>

2410 2420

TGTTTCTGGGCTTCACAGTTCAAGCA

LeuPheLeuGlyPheThrValGlnAla>

Bases 1 to 88 (BglII): DEN4

Bases 89 (BglII) to 2348 (XhoI): DEN1

Bases 2349 (XhoI) to 2426: DEN4

Bases 102 to 443: C protein ORF

Bases 444 to 941: prM protein ORF

Bases 942 to 2426: E protein ORF

APPENDIX 4

Nucleotide and amino acid sequence of DEN1 (Puerto Rico/94) ME chimeric region

10 20 30 40 50 60 70 80 90 100

110 120 130 140 150 160 170 180 190 200

AATGAACCAACGAAAAAAGGTGGTTAGACCACCTTTCAATATGCTGAAACGCGAGAGAAACCGCGTATCAACCCCTCAAGGGTTGGTGAAGAGATTCTCA

MetAsnGlnArgLysLysValValArgProProPheAsnMetLeuLysArgGluArgAsnArgValSerThrProGlnGlyLeuValLysArgPheSer>

210 220 230 240 250 260 270 280 290 300

ACCGGACTTTTTTCTGGGAAAGGACCCTTACGGATGGTGCTAGCATTCATCACGTTTTTGCGAGTCCTTTCCATCCCACCAACAGCAGGGATTCTGAAGA

ThrGlyLeuPheSerGlyLysGlyProLeuArgMetValLeuAlaPheIleThrPheLeuArgValLeuSerIleProProThrAlaGlyIleLeuLys>

310 320 330 340 350 360 370 380 390 400

GATGGGGACAGTTGAAGAAAAATAAGGCCATCAAGATACTGATTGGATTCAGGAAGGAGATAGGCCGCATGCTGAACATCTTGAACGGGAGAAAAAGGTC

ArgTrpGlyGlnLeuLysLysAsnLysAlaIleLysIleLeuIleGlyPheArgLysGluIleGlyArgMetLeuAsnIleLeuAsnGlyArgLysArgSer>

410 420 430 440 450 460 470 480 490 500

TGCAGCCATGCTCCTCATGCTGCTGCCCACAGCCCTGGCGTTCCATTTGACCACACGAGGGGGAGAGCCACACATGATAGTTAGTAAGCAGGAAAGAGGA

AlaAlaMetLeuLeuMetLeuLeuProThrAlaLeuAlaPheHisLeuThrThrArgGlyGlyGluProHisMetIleValSerLysGlnGluArgGly>

510 520 530 540 550 560 570 580 590 600

AAGTCACTGTTGTTTAAGACCTCTGCAGGCATCAATATGTGCACTCTCATTGCGATGGATTTGGGAGAGTTATGCGAGGACACAATGACCTACAAATGCC

LysSerLeuLeuPheLysThrSerAlaGlyIleAsnMetCysThrLeuIleAlaMetAspLeuGlyGluLeuCysGluAspThrMetThrTyrLysCys>

610 620 630 640 650 660 670 680 690 700

CCCGGATCACTGAGGCGGAACCAGATGACGTTGACTGCTGGTGCAATGCCACAGACACATGGGTGACCTATGGGACGTGTTCTCAAACCGGCGAACACCG

ProArgIleThrGluAlaGluProAspAspValAspCysTrpCysAsnAlaThrAspThrTrpValThrTyrGlyThrCysSerGlnThrGlyGluHisArg>

710 720 730 740 750 760 770 780 790 800

ACGAGACAAACGTTCCGTGGCACTGGCCCCACACGTGGGACTTGGTCTAGAAACAAGAACCGAAACATGGATGTCCTCTGAAGGTGCCTGGAAACAAGTA

ArgAspLysArgSerValAlaLeuAlaProHisValGlyLeuGlyLeuGluThrArgThrGluThrTrpMetSerSerGluGlyAlaTrpLysGlnVal>

810 820 830 840 850 860 870 880 890 900

CAAAAAGTGGAGACTTGGGCTTTGAGACACCCAGGATTCACGGTGACAGCCCTTTTTTTAGCACATGCCATAGGAACATCCATTACTCAGAAAGGGATCA

GlnLysValGluThrTrpAlaLeuArgHisProGlyPheThrValThrAlaLeuPheLeuAlaHisAlaIleGlyThrSerIleThrGlnLysGlyIle>

910 920 930 940 950 960 970 980 990 1000

TTTTCATTCTGCTGATGCTAGTAACACCATCAATGGCCATGCGATGTGTGGGAATAGGCAACAGAGACTTCGTTGAAGGACTGTCAGGAGCAACGTGGGT

IlePheIleLeuLeuMetLeuValThrProSerMetAlaMetArgCysValGlyIleGlyAsnArgAspPheValGluGlyLeuSerGlyAlaThrTrpVal>

1010 1020 1030 1040 1050 1060 1070 1080 1090 1100

GGACGTGGTATTGGAGCATGGAAGCTGCGTCACCACCATGGCAAAAGATAAACCAACATTGGACATTGAACTCTTGAAGACGGAGGTCACAAACCCTGCC

AspValValLeuGluHisGlySerCysValThrThrMetAlaLysAspLysProThrLeuAspIleGluLeuLeuLysThrGluValThrAsnProAla>

1110 1120 1130 1140 1150 1160 1170 1180 1190 1200

GTCTTGCGCAAACTGTGCATTGAAGCTAAAATATCAAACACCACCACCGATTCAAGGTGTCCAACACAAGGAGAGGCTACACTGGTGGAAGAACAGGACT

ValLeuArgLysLeuCysIleGluAlaLysIleSerAsnThrThrThrAspSerArgCysProThrGlnGlyGluAlaThrLeuValGluGluGlnAsp>

1210 1220 1230 1240 1250 1260 1270 1280 1290 1300

CGAACTTTGTGTGTCGACGAACGTTTGTGGACAGAGGCTGGGGTAATGGCTGCGGACTATTTGGAAAAGGAAGCCTACTGACGTGTGCTAAGTTCAAGTG

SerAsnPheValCysArgArgThrPheValAspArgGlyTrpGlyAsnGlyCysGlyLeuPheGlyLysGlySerLeuLeuThrCysAlaLysPheLysCys>

1310 1320 1330 1340 1350 1360 1370 1380 1390 1400

TGTGACAAAACTAGAAGGAAAGATAGTTCAATATGAAAACTTAAAATATTCAGTGATAGTCACTGTCCACACTGGGGACCAGCACCAGGTGGGAAACGAG

ValThrLysLeuGluGlyLysIleValGlnTyrGluAsnLeuLysTyrSerValIleValThrValHisThrGlyAspGlnHisGlnValGlyAsnGlu>

1410 1420 1430 1440 1450 1460 1470 1480 1490 1500

ACTACAGAACATGGAACAATTGCAACCATAACACCTCAAGCTCCTACGTCGGAAATACAGCTGACTGACTACGGAGCCCTCACATTGGACTGCTCGCCTA

ThrThrGluHisGlyThrIleAlaThrIleThrProGlnAlaProThrSerGluIleGlnLeuThrAspTyrGlyAlaLeuThrLeuAspCysSerPro>

1510 1520 1530 1540 1550 1560 1570 1580 1590 1600

GAACAGGGCTGGACTTTAATGAGATGGTTCTATTGACAATGAAAGAAAAATCATGGCTTGTCCACAAACAATGGTTTCTAGACTTACCACTGCCTTGGAC

ArgThrGlyLeuAspPheAsnGluMetValLeuLeuThrMetLysGluLysSerTrpLeuValHisLysGlnTrpPheLeuAspLeuProLeuProTrpThr>

1610 1620 1630 1640 1650 1660 1670 1680 1690 1700

TTCAGGAGCTTCAACATCTCAAGAGACTTGGAACAGACAAGATTTGCTGGTCACATTCAAGACAGCTCATGCAAAGAAACAGGAAGTAGTCGTACTGGGA

SerGlyAlaSerThrSerGlnGluThrTrpAsnArgGlnAspLeuLeuValThrPheLysThrAlaHisAlaLysLysGlnGluValValValLeuGly>

1710 1720 1730 1740 1750 1760 1770 1780 1790 1800

TCACAGGAAGGAGCAATGCACACTGCGTTGACTGGGGCGACAGAAATCCAGACGTCAGGAACGACAACAATCTTTGCAGGACACCTGAAATGCAGACTAA

SerGlnGluGlyAlaMetHisThrAlaLeuThrGlyAlaThrGluIleGlnThrSerGlyThrThrThrIlePheAlaGlyHisLeuLysCysArgLeu>

1810 1820 1830 1840 1850 1860 1870 1880 1890 1900

AAATGGATAAACTGACTTTAAAAGGGATGTCATATGTAATGTGCACAGGCTCATTTAAGCTAGAGAAGGAAGTGGCTGAGACCCAGCATGGAACTGTTTT

LysMetAspLysLeuThrLeuLysGlyMetSerTyrValMetCysThrGlySerPheLysLeuGluLysGluValAlaGluThrGlnHisGlyThrValLeu>

1910 1920 1930 1940 1950 1960 1970 1980 1990 2000

AGTGCAGGTTAAATACGAAGGAACAGATGCGCCATGCAAGATCCCTTTTTCGGCCCAAGATGAGAAAGGAGTGACCCAGAATGGGAGATTGATAACAGCC

ValGlnValLysTyrGluGlyThrAspAlaProCysLysIleProPheSerAlaGlnAspGluLysGlyValThrGlnAsnGlyArgLeuIleThrAla>

2010 2020 2030 2040 2050 2060 2070 2080 2090 2100

AACCCCATAGTCACTGACAAAGAAAAACCAGTCAACATTGAGACAGAACCACCTTTTGGTGAGAGCTACATCGTGGTAGGGGCAGGTGAAAAAGCTTTGA

AsnProIleValThrAspLysGluLysProValAsnIleGluThrGluProProPheGlyGluSerTyrIleValValGlyAlaGlyGluLysAlaLeu>

2110 2120 2130 2140 2150 2160 2170 2180 2190 2200

AACTGAGCTGGTTCAAGAAAGGGAGCAGCATAGGGAAAATGTTCGAAGCAACTGCCCGAGGAGCGCGAAGGATGGCTATCCTGGGAGACACCGCATGGGA

LysLeuSerTrpPheLysLysGlySerSerIleGlyLysMetPheGluAlaThrAlaArgGlyAlaArgArgMetAlaIleLeuGlyAspThrAlaTrpAsp>

2210 2220 2230 2240 2250 2260 2270 2280 2290 2300

CTTTGGCTCTATAGGAGGAGTGTTCACATCAGTGGGAAAATTGGTACACCAGGTTTTTGGAGCCGCATATGGGGTTCTGTTCAGCGGTGTTTCTTGGACC

PheGlySerIleGlyGlyValPheThrSerValGlyLysLeuValHisGlnValPheGlyAlaAlaTyrGlyValLeuPheSerGlyValSerTrpThr>

2310 2320 2330 2340 2350 2360 2370 2380 2390 2400

ATGAAAATAGGAATAGGGATTCTGCTGACATGGCTAGGATTAAACTCGAGGAACACTTCAATGGCTATGACGTGCATAGCTGTTGGAGGAATCACTCTGT

MetLysIleGlyIleGlyIleLeuLeuThrTrpLeuGlyLeuAsnSerArgAsnThrSerMetAlaMetThrCysIleAlaValGlyGlyIleThrLeu>

2410 2420

TTCTGGGCTTCACAGTTCAAGCA

PheLeuGlyPheThrValGlnAla

Bases 1 to 404 (PstI): DEN4

Bases 405 (PstI) to 2345 (XhoI): DEN1

Bases 2346 (XhoI) to 2423: DEN4

Bases 102 to 440: C protein ORF

Bases 441 to 938: prM protein ORF

Bases 939 to 2423: E protein ORF

While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.

Claims

What is claimed is:

1. A tetravalent immunogenic composition comprising

a) a first attenuated virus that is immunogenic against dengue serotype 1,

b) a second attenuated virus that is immunogenic against dengue serotype 2,

c) a third attenuated virus that is immunogenic against dengue serotype 3, and

d) a fourth attenuated virus that is immunogenic against dengue serotype 4,

wherein each of a), b), c) and d) comprises a nucleic acid comprising

i) a first nucleotide sequence encoding at least one structural protein from a first dengue virus,

ii) a second nucleotide sequence encoding nonstructural proteins from the first dengue virus or a second dengue virus, and

iii) a 3′ untranslated region, wherein the 3′ untranslated region contains a deletion of about 30 nucleotides corresponding to the TL2 stem-loop structure, and wherein both the 3′ untranslated region and the second nucleotide sequence encoding nonstructural proteins are from either the first dengue virus or the second dengue virus;

wherein the tetravalent immunogenic composition is not rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30.

2. The tetravalent immunogenic composition of claim 1, wherein the nucleic acid of at least one of a), b), c) or d) further comprises a mutation that confers a phenotype wherein the phenotype is temperature sensitivity in Vero cells or the human liver cell line HuH-7, host-cell restriction in mosquito cells or the human liver cell line HuH-7, host-cell adaptation for improved replication in Vero cells, or attenuation in mice or monkeys.

3. The composition of claim 1, wherein the first nucleotide sequence encoding at least one structural protein and the second nucleotide sequence encoding nonstructural proteins of at least one of a), b), c) and d) are from the first dengue virus.

4. The composition of claim 3, wherein the deletion of a) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 1 genome corresponding to the TL2 stem-loop structure between about nucleotides 10562-10591.

5. The composition of claim 3, wherein the deletion of b) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 2 genome corresponding to the TL2 stem-loop structure between about nucleotides 10541-10570.

6. The composition of claim 3, wherein the deletion of c) is by a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 3 genome corresponding to the TL2 stem-loop structure between about nucleotides 10535-10565.

7. The composition of claim 3, herein the deletion of d) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 4 genome corresponding to the TL2 stem-loop structure between about nucleotides 10478-10507.

8. The composition of claim 1, wherein the first nucleotide sequence encoding at least one structural protein of at least one of a), b), c), and d) is from the first dengue virus and the second nucleotide sequence encoding nonstructural proteins of at least one of a), b), c), and d) is from the second dengue virus, wherein the serotype of the first dengue virus and the second dengue virus are different.

9. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 1.

10. The composition of claim 9, wherein the serotype of the first dengue virus of b) is type 2.

11. The composition of claim 9, wherein the serotype of the first dengue virus of c) is type 3.

12. The composition of claim 9, wherein the serotype of the first dengue virus of d) is type 4.

13. The composition of claim 9, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

14. The composition of claim 13, wherein the structural proteins are prM and E proteins.

15. The composition of claim 9, wherein the deletion of a) is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 1 genome corresponding to the TL2 stem-loop structure between about nucleotides 10562 and 10591.

16. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 2.

17. The composition of claim 16, wherein the serotype of the first dengue virus of a) is type 1.

18. The composition of claim 16, wherein the serotype of the first dengue virus of c) is type 3.

19. The composition of claim 16, wherein the serotype of the first dengue of d) virus is type 4.

20. The composition of claim 16, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

21. The composition of claim 20, wherein the structural proteins are prM and E proteins.

22. The composition of claim 16, wherein the deletion is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 2 genome corresponding to the TL2 stem-loop structure between about nucleotides 10541 and 10570.

23. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 3.

24. The composition of claim 23, wherein the serotype of the first dengue virus of a) is type 1.

25. The composition of claim 23, wherein the serotype of the first dengue virus of b) is type 2.

26. The composition of claim 23, wherein the serotype of the first dengue virus of d) is type 4.

27. The composition of claim 23, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

28. The composition of claim 27, wherein the structural proteins are prM and E proteins.

29. The composition of claim 23, wherein the deletion is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 3 genome corresponding to the TL2 stem-loop structure between about nucleotides 10535 and 10565.

30. The composition of claim 8, wherein the serotype of the second dengue virus having the deletion is type 4.

31. The composition of claim 30, wherein the serotype of the first dengue virus of a) is type 1.

32. The composition of claim 30, wherein the serotype of the first dengue virus of b) is type 2.

33. The composition of claim 30, wherein the serotype of the first dengue virus of c) is type 3.

34. The composition of claim 30, wherein the first nucleotide sequence encodes at least two structural proteins of the first dengue virus.

35. The composition of claim 34, wherein the structural proteins are prM and E proteins.

36. The composition of claim 30, wherein the deletion is a deletion of about 30 nucleotides from the 3′ untranslated region of the dengue type 4 genome corresponding to the TL2 stem-loop structure between about nucleotides 10478 and 10507.

37. A method of inducing an immune response in a subject comprising administering an effective amount of the composition of claim 1 to the subject.

38. The method of claim 37 wherein the subject is a human.

39. A tetravalent vaccine comprising the composition of claim 1.

40. A method of preventing disease caused by dengue virus in a subject comprising administering an effective amount of the vaccine of claim 39 to the subject.

41. The method of claim 40 wherein the subject is a human.

42. The tetravalent immunogenic composition defined in claim 1, selected from the group consisting of:

(1) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(2) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(3) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(4) rDEN1Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(5) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(6) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(7) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(8) rDEN1Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(9) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(10) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(11) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(12) rDEN1Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(13) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(14) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(15) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(16) rDEN1Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(17) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(18) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(19) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(20) rDEN1Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(21) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(22) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(23) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(24) rDEN1Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(25) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(26) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(27) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(28) rDEN1Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(29) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(30) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(31) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(32) rDEN1Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(33) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(34) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(35) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(36) rDEN1Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(37) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(38) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(39) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(40) rDEN1Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(41) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(42) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(43) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(44) rDEN1Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(45) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(46) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(47) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(48) rDEN1Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(49) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(50) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(51) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(52) rDEN1Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(53) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(54) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(55) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(56) rDEN1Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(57) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(58) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(59) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(60) rDEN1Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(61) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30,

(62) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(63) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(64) rDEN1Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(65) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(66) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(67) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(68) rDEN1/2Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(69) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(70) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(71) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(72) rDEN1/2Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(73) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(74) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(75) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(76) rDEN1/2Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(77) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(78) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(79) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(80) rDEN1/2Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(81) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(82) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(83) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(84) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(85) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(86) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(87) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(88) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(89) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(90) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(91) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(92) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(93) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(94) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(95) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(96) rDEN1/2Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(97) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(98) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(99) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(100) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(101) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(102) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(103) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(104) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(105) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(106) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(107) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(108) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(109) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(110) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(111) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(112) rDEN1/2Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(113) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(114) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(115) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(116) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(117) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(118) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(119) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(120) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(121) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(122) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(123) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(124) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(125) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30,

(126) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(127) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(128) rDEN1/2Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(129) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(130) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(131) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(132) rDEN1/3Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(133) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(134) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(135) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(136) rDEN1/3Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(137) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(138) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(139) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(140) rDEN1/3Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(141) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(142) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(143) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(144) rDEN1/3Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(145) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(146) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(147) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(148) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(149) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(150) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(151) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(152) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(153) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(154) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(155) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(156) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(157) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(158) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(159) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(160) rDEN1/3Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(161) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(162) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(163) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(164) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(165) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(166) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(167) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(168) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(169) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(170) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(171) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(172) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(173) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(174) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(175) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(176) rDEN1/3Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(177) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(178) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(179) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(180) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(181) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(182) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(183) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(184) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(185) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(186) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(187) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(188) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(189) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4Δ30,

(190) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(191) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(192) rDEN1/3Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(193) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4Δ30,

(194) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/1Δ30,

(195) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/2Δ30,

(196) rDEN1/4Δ30, rDEN2Δ30, rDEN3Δ30, rDEN4/3Δ30,

(197) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4Δ30,

(198) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(199) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(200) rDEN1/4Δ30, rDEN2Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(201) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4Δ30,

(202) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(203) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(204) rDEN1/4Δ30, rDEN2Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(205) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4Δ30,

(206) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(207) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(208) rDEN1/4Δ30, rDEN2Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(209) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4Δ30,

(210) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/1Δ30,

(211) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/2Δ30,

(212) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3Δ30, rDEN4/3Δ30,

(213) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4Δ30,

(214) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(215) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(216) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(217) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4Δ30,

(218) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(219) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(220) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(221) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4Δ30,

(222) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(223) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(224) rDEN1/4Δ30, rDEN2/1Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(225) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4Δ30,

(226) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/1Δ30,

(227) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/2Δ30,

(228) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3Δ30, rDEN4/3Δ30,

(229) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4Δ30,

(230) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(231) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(232) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(233) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4Δ30,

(234) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(235) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(236) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(237) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4Δ30,

(238) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(239) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/2Δ30,

(240) rDEN1/4Δ30, rDEN2/3Δ30, rDEN3/4Δ30, rDEN4/3Δ30,

(241) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4Δ30,

(242) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/1Δ30,

(243) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/2Δ30,

(244) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3Δ30, rDEN4/3Δ30,

(245) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4Δ30,

(246) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/1Δ30,

(247) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/2Δ30,

(248) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/1Δ30, rDEN4/3Δ30,

(249) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4Δ30,

(250) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/1Δ30,

(251) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/2Δ30,

(252) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/2Δ30, rDEN4/3Δ30,

(254) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/1Δ30,

(255) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/2Δ30, and

(256) rDEN1/4Δ30, rDEN2/4Δ30, rDEN3/4Δ30, rDEN4/3Δ30.