USRE39464E1 - Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages - Google Patents

Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages Download PDF

Info

Publication number
USRE39464E1
USRE39464E1 US10/925,348 US92534804A USRE39464E US RE39464 E1 USRE39464 E1 US RE39464E1 US 92534804 A US92534804 A US 92534804A US RE39464 E USRE39464 E US RE39464E
Authority
US
United States
Prior art keywords
hydroxyl
compound
group
oligomeric compound
protected
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US10/925,348
Inventor
Phillip Dan Cook
Muthiah Manoharan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US09/115,027 external-priority patent/US6242589B1/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to US10/925,348 priority Critical patent/USRE39464E1/en
Application granted granted Critical
Publication of USRE39464E1 publication Critical patent/USRE39464E1/en
Assigned to IONIS PHARMACEUTICALS, INC. reassignment IONIS PHARMACEUTICALS, INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: ISIS PHARMACEUTICALS, INC.
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom

Definitions

  • This invention relates to the design and synthesis of nuclease resistant phosphorothioate oligonucleotides which are useful for therapeutics, diagnostics and as research reagents.
  • Phosphorothioate oligonucleotides are provided in which all of the internucleoside linkages are chiral. Such compounds are resistant to nuclease degradation and are capable of modulating the activity of DNA and RNA.
  • oligonucleotides especially oligonucleotides which are complementary to a specific target messenger RNA (mRNA) sequence.
  • mRNA target messenger RNA
  • oligonucleotides are currently undergoing clinical trials for such use.
  • Phosphorothioate oligonucleotides are presently being used as therapeutic agents in human clinical trials against various disease states, including use as antiviral agents.
  • oligonucleotides In addition to such use as both indirect and direct regulators of proteins, oligonucleotides also have found use in diagnostic tests. Such diagnostic tests can be performed using biological fluids, tissues, intact cells or isolated cellular components. As with gene expression inhibition, diagnostic applications utilize the ability of oligonucleotides to hybridize with a complementary strand of nucleic acid. Hybridization is the sequence specific hydrogen bonding of oligomeric compounds via Watson-Crick and/or Hoogsteen base pairs to RNA or DNA. The bases of such base pairs are said to be complementary to one another.
  • Oligonucleotides are also widely used as research reagents. They are useful for understanding the function of many other biological molecules as well as in the preparation of other biological molecules. For example, the use of oligonucleotides as primers in PCR reactions has given rise to an expanding commercial industry. PCR has become a mainstay of commercial and research laboratories, and applications of PCR have multiplied. For example, PCR technology now finds use in the fields of forensics, paleontology, evolutionary studies and genetic counseling. Commercialization has led to the development of kits which assist non-molecular biology-trained personnel in applying PCR. Oligonucleotides, both natural and synthetic, are employed as primers in such PCR technology.
  • Oligonucleotides are also used in other laboratory procedures. Several of these uses are described in common laboratory manuals such as Molecular Cloning, A Laboratory Manual. Second Ed., J. Sambrook, et al., Eds., Cold Spring Harbor Laboratory Press. 1989; and Current Protocols In Molecular Biology. F. M. Ausubel, et al., Eds., Current Publications, 1993. Such uses include as synthetic oligonucleotide probes, in screening expression libraries with antibodies and oligomeric compounds. DNA sequencing, in vitro amplification of DNA by the polymerase chain reaction, and in site-directed mutagenesis of cloned DNA. See Book 2 of Molecular Cloning. A Laboratory Manual, supra. See also “DNA-protein interactions and The Polymerase Chain Reaction” in Vol. 2 of Current Protocols In Molecular Biology, supra.
  • oligonucleotides have been introduced into oligonucleotides to increase their usefulness in diagnostics, as research reagents and as therapeutic entities.
  • modifications include those designed to increase binding to a target strand (i.e. increase melting temperatures, Tm), to assist in identification of an oligonucleotide OR an oligonucleotide-target complex, to increase cell penetration, to stabilize against nucleases and other enzymes that degrade or interfere with the structure or activity of the oligonucleotides, to provide a mode of disruption (terminating event) once sequence-specifically bound to a target, and to improve the pharmacokinetic properties of the oligonucleotide.
  • Tm melting temperatures
  • oligonucleotides The complementarity of oligonucleotides has been used for inhibition of a number of cellular targets. Complementary oligonucleotides are commonly described as being antisense oligonucleotides. Various-reviews describing the results of these studies have been published including Progress In Antisense Oligonucleotide Therapeutics, Crooke, S. T., and Bennett. C. F., Annu. Rev. Pharmacol. Toxicol., 1996, 36, 107-129. These oligonucleotides have proven to be powerful research tools and diagnostic agents. Certain oligonucleotides that have been shown to be efficacious are currently in human clinical trials.
  • oligonucleotides like other therapeutics, depends on a number of factors that influence the effective concentration of these agents at specific intracellular targets.
  • One important factor for oligonucleotides is the stability of the species in the presence of nucleases. It is unlikely that unmodified, naturally-occurring oligonucleotides will be useful therapeutic agents because they are rapidly degraded by nucleases.
  • the limitations of available methods for modification of the phosphate backbone of unmodified oligonucleotides have led to a continuing and long felt need for other modifications which provide resistance to nucleases and satisfactory hybridization properties for antisense oligonucleotide diagnostics and therapeutics.
  • Oligonucleotides having phosphorothioate modified backbones have shown therapeutic effects against numerous targets. This success is due in part to the increased nuclease resistance of the phosphorothioate backbone relative to the naturally occurring phosphodiester backbone.
  • the phosphorothioate linkage unlike the phosphodiester linkage has 2 enantiomers, R P and S P . It has been shown that a 3′-R P linkage is labile to at least one exonuclease in the cytosol of HUVEC cells (Kiziolkiewicz et al. Nucleosides and Nucleotides, 1997, vol. 16, pp. 1677-1682).
  • oligonucleotides as drugs are those they must be stable in vivo long enough to be effective. Consequently, much research has been focused on enhancing the stability of oligonucleotide therapeutics while maintaining their specific binding properties. Recently, several groups have reported that chiral phosphorothioate oligonucleotide analogs have enhanced binding properties (Rp isomer) to the target RNA as well as significant stabilization to exonucleases (Sp isomer) (See Koziolkiewicz et al., Antisense & Nucleic acid drug development, 1997, 7, 43-8; Burgers et al., J. Biol. Chem., 1979, 254, 6889-93; and Griffiths et al., Nucleic Acids Research, 1987, 15, 41452-62).
  • Rp isomer chiral phosphorothioate oligonucleotide analogs have enhanced binding properties (Rp isomer) to the target RNA as well as significant stabilization
  • the DNA-RNA complex containing the PS-oligo of [all-RP] configuration was found to be more susceptible to RNase H-dependent degradation of the pentadecarbonucleotide compared with hybrids containing either the [all-SP] counterpart or the so called ‘random mixture of diastereomers of the pentadeca(nucleoside phosphorothioate). This stereodependence of RNase H action was also observed for a polyribonucleotide (475 nt) hybridized with these phosphorothioate oligonucleotides.
  • 1,2-O-Cyclopentylidene-5-deoxy-5-isopropylamino-D-xylofuranose and its enantiomer were used as chiral auxiliaries to form, respectively, Sp and Rp dithymidine phosphorothioates in 98% diastereomeric excess, using phosphoramidite methodologies and 2-bromo-4.5-dicyanoimidazole as catalyst (Jin et al., J. Org. Chem., 1998, 63, 3647-3654).
  • Oligonucleotide phosphorothioates were synthesized using prokaryotic DNA polymerase and oligonucleotide template/primer (Lackey et al., Biotechnol. Lett., 1997, 19, 475-478). The method facilitates the recovery of DNA polymerase and template/primer and is successful at the milligram scale. Thus, reusable template/primers were designed to specify the synthesis of an oligonucleotide (GPs0193) complementary to a sequence in exon 7 of the human immunodeficiency virus genome.
  • GPs0193 oligonucleotide
  • Phosphorothioate oligodeoxyribonucleotides were tested for their ability to recognize double-helical DNA in two distinct triple helix motifs (Hacia et al., Biochemistry, 1994, 33, 5367-5369). Purine-rich oligonucleotides containing a diastereomeric mixture of phosphorothioate or stereoregular (all Rp) phosphorothioate linkages are shown to form triple-helical complexes with affinities similar to those of the corresponding natural phosphodiester oligonucleotides.
  • pyrimidine-rich phosphorothioate oligonucleotides containing a mixture of diastereomeric or stereoregular (all Rp) linkages do not bind to double-helical DNA with measurable affinity.
  • oligo(nucleoside phosphorothioate)s (PS-oligos) in HUVEC (human umbilical vein endothelial cells) has been studied (Koziolkiewicz et al., Nucleosides and Nucleotides, 1997, 16, 1677-1682). Cytosolic fraction of HUVEC possesses 3′-exo-nucleolytic activity which is responsible for degradation of natural and PS-oligomers.
  • the enzyme is Rp-specific, i.e. it cleaves internucleotide phosphorothioate function of Rp- and not Sp-configuration at phosphorus atom.
  • Extracellular bacterial endonuclease isolated from Serratia marcescens accepts PS-oligos as substrates and hydrolyzes phosphorothioate bonds of the [Rp] configuration, whereas internucleotide [Sp]-phosphorothioates are resistant to its action.
  • Cleavage experiments carried out with the use of unmodified and phosphorothioate oligonucleotides of different sequences demonstrate that the Serratia nuclease is more selective in recognition and hydrolysis of oligodeoxyribonucleotides than previously reported.
  • the substrate specificity exhibited by the enzyme is influenced not only by the nucleotide sequence at the cleavage site but also by the length and base sequence of flanking sequences.
  • the Serratia nuclease can be useful for analysis of diastereomeric purity of stereodefined phosphorothioate oligonucleotides, but because of its sequence preferences, the use of this enzyme in conjunction with svPDE is more reliable.
  • New monomers 5′-O-DMT-deoxyribonucleoside 3′-O-(2-thio-“spiro”-4,4-penta-methylene-1,3,2-oxathiaphospholane)s, were prepared and used for the stereo-controlled synthesis of PS-Oligos via the oxathiaphospholane approach (Stec et al., J. Am. Chem. Soc., 1998, 120, 7156-7167). These monomers and their 2-oxo analogs were used for the synthesis of “chimeric” constructs (PS/PO-Oligos) possessing phosphate and P-stereo-defined phosphorothioate inter-nucleotide linkages.
  • the yield of a single coupling step is approximately 92-95%, and resulting oligomers are free of nucleobase- and sugar-phosphorothioate backbone modifications.
  • Thermal dissociation studies showed that for hetero-duplexes formed by [Rp]-, [Sp]-, or [mix]-PS/PO-T10 with dA12, dA30, or poly(dA), for each template, the melting temperatures as well as free Gibbs' energies of dissociation process, are virtually equivalent.
  • Stereochemical evidence derived form crystallographic analysis of one of the oxathiaphospholane monomers strongly supports the participation of pentacoordinate intermediates in the mechanism of the oxathiaphospholane ring-opening condensation.
  • the oxathiaphospholane ring-opening condensation requires the presence of strong organic base, preferably DBU.
  • the yield of a single coupling step is ca. 95% and resulting S-Oligos are free of nucleobase- and sugar-phosphorothioate backbone modifications.
  • the diastereomeric purity of products was estimated on the basis of diastereoselective degradation with Nuclease P1 and a mixture of snake venom phosphodiesterase and Serratia marcescens endonuclease.
  • Thermal dissociation studies of heteroduplexes phosphorothioates/DNA and phosphorothioates/RNA showed that their stability is stereochemical- and sequence-dependent.
  • the structures 3, 8, 14, 18, 20, and 25 all have geminal disubstituents.
  • Use of this concept to synthesize chiral phosphorothioates with the concurrent formation of 4-membered cyclic thio compounds is novel.
  • Oligonucleotides that have chiral Sp phosphorothioate internucleotide linkages at the 3′-terminus are disclosed in International Application WO 99/05160, published by the PCT Feb. 4, 1999.
  • the present invention provides nuclease resistant phosphorothioate oligonucleotides which are useful for therapeutics, diagnostics and as research reagents.
  • the invention provides oligomeric compounds comprising a plurality of covalently-bound nucleosides, which have the formula: 5-T 1 —(Nu—Sp) n —(Nu—Lp) m —(NU—Sp) p Nu—T 2 -3′ wherein:
  • each R 1 is H or hydroxyl. In further preferred embodiments. R 1 is C 1 -C 10 O-alkyl or C 1 -C 10 substituted O-alkyl, with 2′-O-methoxyethyl or 2′-O-methyl being moire preferred.
  • each Nu is, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
  • p is 1 or 2. In further more preferred embodiments, n and p are each 1 and m is from 3 to about 20.
  • T 1 and T 2 are, independently, hydroxyl or a protected hydroxyl.
  • each Lp is an Rp phosphorothioate internucleoside linkage.
  • at least one Lp is a racemic phosphorothioate internucleoside linkage.
  • at least one Lp is an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage.
  • R 1 is a 2′-substituent group or a protected 2′-substituent group other than H, hydroxyl or a protected hydroxyl.
  • the present invention also provides compounds having the formula: wherein:
  • the chiral auxiliary group has one of formulas I, II, III, IV, V or VI:
  • Bx is adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
  • each R 1 is H or hydroxyl.
  • R 1 is C 1 -C 10 O-alkyl or C 1 -C 10 substituted O-alkyl, with 2′-O-methoxyethyl or 2′-O-methyl being more preferred.
  • At least one R 1 is 2′-O-methoxyethyl or 2′-O-methyl. In further preferred embodiments. R1 is a 2′-substituent group or a protected 2′-substituent group other than H, hydroxyl or a protected hydroxyl.
  • the present invention also provides pharmaceutical compositions comprising one or more compounds of the invention, and an acceptable pharmaceutical carrier.
  • the present invention also provides methods for preparing an oligomeric compound of formula: 5′-T 1 —(Nu—Sp) n —(Nu—Lp) m —(NU—Sp) p —Nu—T-0-2-3′ wherein:
  • the method further comprises the step of deblocking the product of step (i).
  • the Sp chiral auxiliary group has one of formulas I, II or III: or one of formulas IV, V or VI:
  • More preferred embodiments of the methods of the invention further comprise one or more capping steps, which include treatment with a capping agent.
  • capping steps are performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
  • the methods of the invention further comprising one or more oxidation steps: said oxidation steps comprising treatment with an oxidizing agent.
  • oxidiation steps are performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
  • said labile hydroxyl protecting group is dimethoxytrityl, monomethoxy trityl, trityl or 9-phenyl-xanthene.
  • said heterocyclic base moiety is a purine or a pyrimidine, which is preferably, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
  • the sum of n, m, and p is from 5 to about 50, with 8 to about 30 being more preferred, and with 10 to about 25 being even more preferred
  • T 1 and T 2 are, independently hydroxyl or a protected hydroxyl.
  • each Lp is a racemic phosphorothioate internucleoside linkage.
  • At least one Lp is a racemic phosphorothioate internucleoside linkage.
  • n and p are each 1 and m is from 3 to about 20. In further more preferred embodiments n and p are each 2 and m is from 3 to about 20.
  • p is 0.
  • At least one R is a 2′-substituent group or a protected 2′-substituent group other than H, hydroxyl or a protected hydroxyl.
  • the activated phosphorus group is a phosphoramidite, an H-phosphonate or a phosphate triester.
  • the covalent attachment to a solid support is a sarcosinyl-succinonyl linker.
  • each R 1 is H or hydroxyl. In further preferred embodiments, R 1 is C 1 -C 10 O-alkyl or C 1 -C 10 substituted O-alkyl, with 2′-O-methyl being preferred.
  • B is independently, adenine, guanidine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
  • q is 5 to about 50, with 8 to about 30 being preferred, and 10 to about 25 being more preferred. In some particularly preferred embodiments, q is 0 or 1.
  • Also provided by the present invention are methods of modulating the production or activity of a protein in an organism, comprising contacting said organism with a compound of the invention, and methods of treating an organism having a disease characterized by the undesired production of a protein, comprising contacting said organism with a compound of the invention.
  • the present invention further provides methods of assaying a nucleic acid, comprising contacting a solution suspected to contain said nucleic acid with a compound of the invention.
  • FIG. 1 shows the structure of an Rp and an Sp chiral phosphorothioate internucleotide linkage.
  • FIG. 2 shows the chiral adjuvant (R)-4-mercapto-4-methyl-2-pentanol and the chiral building block derived therefrom which leads to Rp chiral phosphorothioate internucleotide linkages.
  • FIG. 3 shows the chiral adjuvant (S)-4-mercapto-4-methyl-2-pentanol and the chiral building block derived therefrom which leads to Sp chiral phosphorothioate internucleotide linkages.
  • FIG. 4 shows (+)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol, which is obtained from (+)-pulegone, and the chiral building block derived therefrom which leads to Rp chiral phosphorothioate internucleotide linkages.
  • FIG. 5 shows ( ⁇ )-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol, which is obtained from ( ⁇ )-pulegone, and the chiral building block derive therefrom which leads to Sp chiral phosphorothioate internucleotide linkages.
  • FIG. 6 shows 5C-methyl-2t-[(1-methyl-1-benzylamino) ethyl]-cyclohexan-1t-ol which is obtained from (+)-pulegone, and the chiral building block derived therefrom which leads to Rp chiral phosphorothioate internucleoside linkages.
  • FIG. 7 shows 5C-methyl-2t-[(1-methyl-1-benzylamino) ethyl]-cyclohexan-1t-ol which is obtained from ( ⁇ )-pulegone, and the chiral building block derive therefrom which leads to Sp chiral phosphorothioate internucleotide linkages:
  • the present invention provides oligomeric compounds having a first 5′-region that has at least one chiral Sp internucleoside linkage, and a second region that has chiral Rp internucleoside linkages, racemic phosphorothioate internucleoside linkages or internucleoside linkages other than chiral or racemic phosphorothioate internucleoside linkages.
  • the present invention further provides oligomeric compounds having 3 regions where the first and second are as described above, and the third region has one or more Sp phosphorothioate internucleoside linkages. Also provided in accordance with the present invention are methods for the preparation of such oligomeric compounds having 2 or 3 regions.
  • the presence of Sp geometry at the 5′-end of the oligomeric compound (2 regions) or at the wings of the oligomeric compound (e.g. at the 3′ and 5′ ends of 3-region compounds) reduces the susceptibility of the compound to exonuclease degradation.
  • the presence of Rp geometry in the second region increases the affinity of the compound to complementary nucleic acid.
  • chimeric compounds are prepared having Rp and Sp internucleoside linkages of high chiral purity (i.e., “chiral Sp”. “chiral Rp” “Sp” or “Rp” linkages). High chiral purity as used here is meant to indicate a percentage of the indicated enantiomer of 90% or greater.
  • the preparation of timers and oligomers having Sp internucleoside linkages is described in U.S. Pat. Nos. 5,212,295, 5,587,361 and 5,599,797, the contents of which are incorporated herein by reference.
  • this invention concerns oligonucleotides that exhibit increased stability relative to their naturally occurring counterparts.
  • Extracellular and intracellular nucleases generally do not recognize (and, therefore, do not bind to) the compounds of the invention.
  • the present invention further includes methods of preparing oligomeric compounds having at least one Sp internucleoside linkage at the 5′ and at the 3′ ends.
  • the oligomeric compounds have one or more Sp internucleoside linkages at the 5′ and at the 3′ ends and the internal internucleoside linkages are all Rp phosphorothioate linkages.
  • Such oligomeric compounds are prepared by treating a solid support bound monomer with monomers having reactive phosphorus moieties that give defined stereochemistry at the resultant internucleoside linkages. The first monomer or monomers are selected to give Sp internucleotide linkages. The next section is prepared to have Rp or racemic internucleoside link-ages with the final section prepared as the first section to one or more Sp internucleoside linkages.
  • the monomers are prepared as illustrated in the examples below.
  • Gem dialkyl substitutents located in selected chiral auxiliary groups favor product formation with the release of 4-membered oxathiane, 6-membered oxazine or amide structures.
  • These compounds can be conveniently synthesized from (+)-pulegone and ( ⁇ )-pulegone ((R)-4-mercapto-4-methyl-2-pentanol and (S)-4-mercapto-4-methyl-2-pentanol).
  • methods are provided for preparing an oligomeric compound of formula: 5′-T 1 —(Nu Sp) n —(Nu—Lp) m —(Nu-Sp) p —Nu—T 2 -3′ wherein:
  • the coupling of nucleosidic monomeric units is preceded by deblocking (of the 5′-terminal hydroxyl (i.e., removal of the 5′-protecting group) of the growing chain.
  • deblocking cut be accomplished using a variety reagents known to those in the art.
  • One suitable reagent is a dichloromethane solution of 2% dichloroacetic acid (v/v), or toluene solution of 3% dichloroacetic acid (v/v).
  • the present invention include one or more capping steps in between couplings of successive nucleosidic monomers.
  • the capping step can be performed either prior to or after an oxidation step, and are preferably performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
  • a coupling step e.g., one or more of steps c, d, e, f, h, and/or i.
  • Such a capping step is generally known to be beneficial by preventing shortened oligomer chains, by blocking chains that have not reacted in the coupling cycle.
  • One representative capping reagent used for capping is acetic anhydride.
  • Other suitable capping reagents and methodologies can be found in U.S. Pat. No. 4,816,571, issued Mar. 28, 1989, hereby incorporated by reference in its entirety.
  • the methods of the invention further comprising one or more oxidation steps; said oxidation steps comprising treatment with an oxidizing agent.
  • Choice of oxidizing agent will determine whether the resulting linkage will be, for example, a phosphodiester, phosphorothioate, or phosphorodithioate linkage.
  • oxidizing steps are performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
  • Oxidizing agents used to produce phosphorothioate: and/or phosphorodithioate linkages include Beaucage reagent (see e.g. Iyer, R. P., et. al., J. Chem. Soc., 1990, 112, 1253-1254, and Iyer, R. P., et. al., J. Org. Chem., 1990, 55, 4693-4699); tetraethylthiuram disulfide (see e.g., Vu, H., Hirschbein, B.
  • Useful oxidizing agents used to form the phosphodiester or phosphorothioate linkages include iodine/tetrahydrofuran/water/pyridine or hydrogen peroxide/water or tert-butyl hydroperoxide or any peracid like m-chloroperbenzoic acid.
  • sulfurization the reaction is performed under anhydrous conditions with the exclusion of air, in particular oxygen whereas in the case of oxidation the reaction can be performed under aqueous conditions.
  • Solid supports are substrates which are capable of serving as the solid phase in solid phase synthetic methodologies, such as those described in Caruthers U.S. Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777;
  • Linkers are known in the art as short molecules which serve to connect a solid support to functional groups (e.g., hydroxyl groups) of initial synthon molecules in solid phase synthetic techniques. Suitable linkers are disclosed in, for example, Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, N.Y. 1991. Chapter 1, pages 1-23.
  • Solid supports according to the invention include those generally known in the art to be suitable for use in solid phase methodologies, including, for example, controlled pore glass (CPG), oxalyl-controlled pore glass (see, e.g., Alul, et al., Nucleic Acids Research 1991, 19, 1527, hereby incorporated by reference in its entirety).
  • CPG controlled pore glass
  • TentaGel Support an aminopolyethyleneglycol derivatized support (see, e.g., Wright, et al., Tetrahedron Letters 1993, 34, 3373, hereby incorporated by reference in its entirety) and Poros—a copolymer of polystyrene/divinylbenzene.
  • the Sp chiral auxiliary group has one of formulas I, II or III: or one of formulas IV, V or VI:
  • cleavage step which can precede or follow deprotection of protected functional groups, will in preferred embodiments yield a compound devoid of protecting groups, and chiral auxiliaries.
  • Suitable cleavage reagents include those that are known in the an such as, for example, NH 4 OH (2890) at 50° C. for 2 hours.
  • Oligonucleotides according to the present invention that are hybridizable to a target nucleic acid preferably comprise from about 5 to about 50 nucleosides. It is more preferred that such compounds comprise from about 8 to about nucleosides, with 10 to about 25 nucleosides being particularly preferred.
  • a target nucleic acid is any nucleic acid that can hybridize with a complementary nucleic acid-like compound. Further in the context of this invention, “hybridization” shall mean hydrogen bonding, which may be Watson-Crick. Hoogsteen or reversed Hoogsteen hydrogen bonding between complementary nucleobases. “Complementary” as used herein, refers to the capacity for precise pairing between two nucleobases.
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • “Complementary” and “specifically hybridizable,” as used herein, refer to precise pairing or sequence complementarity between a first and a second nucleic acid-like oligomers containing nucleoside subunits. For example, if a nucleobase at a certain position of the first nucleic acid is capable of hydrogen bonding with a nucleobase at the same position of the second nucleic acid, then the first nucleic acid and the second nucleic acid are considered to be complementary to each other at that position.
  • the first and second nucleic acids are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between a compound of the invention and a target RNA molecule. It is understood that an oligomeric compound of the invention need not be 100% complementary to its target RNA sequence to be specifically hybridizable.
  • An oligomeric compound is specifically hybridizable when binding of the oligomeric compound to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed.
  • chiral auxiliaries are meant to include groups that function as a protecting groups for phosphorus linkages during the course of the synthesis of oligomeric phosphorothioates.
  • Chiral auxiliaries will give either Sp or Rp chirality for the respective internucleoside linkage in the final oligomeric compound. Accordingly, chiral auxiliaries are allowed to remain on the growing chain, and are removed at the end of the iterative synthetic regime. Removal of chiral auxiliaries can be conveniently accomplished in a single treatment after the completion of the iterative synthesis.
  • Preferred chiral auxiliaries are shown as used to prepare monomers of the invention in the figures (see compounds 3, 8, 14, 18, 20 and 25).
  • heterocyclic base moieties useful in the compounds and methods described herein include adenine, guanine, cytosine, uridine, and thymine, as well as other non-naturally occurring and natural nucleobases such as xanthine, hypoxanthine.
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808 (Merigan, et al.), in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T.
  • nucleosidic base is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain “universal bases” that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Especially mentioned as a universal base is 3-nitropyrrole.
  • Preferred heterocyclic base moieties include adenine, N 6 -benzoyladenine, cytosine, N 4 -benzoylcytosine, 5-methylcytosine, N 4 -benzoyl-5-methylcytosine, thymine, uracil, guanine. N 2 -isobutyrylguanine and 2-aminoadenine.
  • heterocyclic base moieties include those disclosed in U.S. Pat. No. 3,687,808 (Merigan et al.), in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993, in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613-722 (see, especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz, Ed., John Wiley & Sons, 1990, pages 858-859, Cook, P.
  • heterocyclic base moiety is further intended to include heterocyclic ring systems that can serve as nucleosidic bases including certain ‘universal bases’ that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Especially mentioned as a universal base is 3-nitropyrrole.
  • hetero denotes an atom other than carbon, preferably but not exclusively N, O, or S.
  • heterocycloalkyl denotes an alkyl ring system having one or more heteroatoms (i.e., non-carbon atoms).
  • Preferred heterocycloalkyl groups include, for example, morpholino groups.
  • heterocycloalkenyl denotes a ring system having one or more double bonds, and one or more heteroatoms.
  • Preferred heterocycloalkenyl groups include, for example, pyrrolidino groups.
  • the terms “2′-substituent group” or “5′ or 3′ substituent group” includes groups attached to the 2′-position of the ribofuranosyl moiety with or without an oxygen atom.
  • Sugar substituent groups amenable to the present invention include, but are not limited to, fluoro. O-alkyl, O-alkylamino, O-alkylalkoxy, protected O-alkylamino, O-alkylaminoalkyl, 6-alkyl imidazole and polyethers of the formula (O-alkyl) m , wherein m is 1 to about 10.
  • polyethers linear and cyclic polyethylene glycols (PEGS), and (PEG)-containing groups, such as crown ethers and those which are disclosed by Ouchi et al., Drug Design and Discovery 1992, 9, 93; Ravasio et al., J. Org. Chem, 1991, 56, 4329; and Delgardo et, al., Critical Reviews in Therapeutic Drug Carrier Systems 1992, 9, 249, each of which is hereby incorporated by reference in its entirety. Further sugar modifications are disclosed in Cook, P.
  • Additional sugar substituent groups amenable to the present invention include 2′-SR and 2′-NR, groups, wherein each R is, independently, hydrogen, a protecting group or substituted or unsubstituted alkyl, alkenyl, or alkynyl.
  • 2′-SR nucleosides are disclosed in U.S. Pat. No. 5,670,633, issued Sep. 23, 1997, hereby incorporated by reference in its entirety.
  • the incorporation of 2′-SR monomer synthons is disclosed by Hamm et al., J. Org. Chem., 1997, 62, 3415-3420
  • 2′-NR nucleosides are disclosed by Goettingen, M., J. Org.
  • Sugars having O-substitutions on the ribosyl ring are also amenable to the present invention.
  • Representative substitutions for ring O include, but are not limited to, S. CH 2 , CHF. and CF 2 , See, e.g., Secrist et al., Abstract 21. Program & Abstracts, Tenth International Roundtable, Nucleosides, Nucleotides and their Biological Applications, Park City, Utah, Sep. 16-20, 1992, hereby incorporated by reference in its entirety.
  • oligonucleotide may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide and the 5′-position of 5′ terminal nucleotide.
  • one additional modification of the oligonucleotides of the present invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
  • moieties include, but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
  • a phospholipid e.g., di-hexadecyl-rac-glycerol or triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl.
  • Acids Res., 1990, 18, 3777 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969), adamantane acetic acid (Manoharan et al., Tetrahedron Len., 1995, 36, 3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol Exp. Ther., 1996, 277, 923).
  • the monomers of the present invention can include appropriate activated phosphorus groups such as activated phosphate groups and activated phosphate groups.
  • activated phosphate and activated phosphite groups refer to activated monomers or oligomers that are reactive with a hydroxyl group of another monomeric or oligomeric compound to form a phosphorus-containing internucleotide linkage.
  • Such activated phosphorus groups contain activated phosphorus atoms in P′′′ or P V valency states.
  • Such activated phosphorus atoms are known in the art and include, but are not limited to, phosphoramdite, H-phosphonate and phosphate triesters.
  • a preferred synthetic solid phase synthesis utilizes phosphoramidites as activated phosphates.
  • the phosphoramidites utilize P′′′ chemistry.
  • the intermediate phosphite compounds are subsequently oxidized to the P V state using known methods to yield, in a preferred embodiment, phosphodiester or phosphorothioate internucleoside linkages. Additional activated phosphates and phosphites are disclosed in Tetrahedron Report Number 309 (Beaucage and Iyer. Tetrahedron, 1992, 48. 2223-2311).
  • Functional groups including those located on heterocyclic base moieties and 2′-sugar substituent groups are routinely blocked with protecting (blocking groups) during synthesis and subsequently deblocked.
  • a blocking group renders a chemical functionality of a molecule inert to specific reaction conditions and can later be removed from such functionality in a molecule without substantially damaging the remainder of the molecule.
  • amino groups can be blocked with nitrogen protecting groups such as phthalimido. 9-fluorenylmethoxycarbonyl (FMOC), triphenylmethylsulfenyl, t-BOC or benzyl groups.
  • Carboxyl groups can be protected as acetyl groups. Representative hydroxyl protecting groups are described by Beaucage et al., Tetrahedron 1992, 48, 2223. Preferred hydroxyl protecting groups are acid-labile groups, such as the trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 9-phenylxanthin-9-yl (Pixyl) and 9-(p-methoxyphenyl) xanthin-9-yl (MOX). Chemical functional groups can also be “blocked” by including them in a precursor form. That an azido group can be considered a “blocked” form of an arsine as the azido group is easily converted to the amine.
  • nucleoside refers to a unit made up of a heterocyclic base and its sugar.
  • nucleotide refers to a nucleotide having a phosphate group on its 3′ or 5′ sugar hydroxyl group.
  • oligonucleotide is intended to include both naturally occurring and non-naturally occurring (i.e., “synthetic”) oligomers of linked nucleosides. Although such linkages generally are between the 3′ carbon of one nucleoside and the 5′ carbon of a second nucleoside (i.e., 3′-5′ linkages), other linkages (such as 2′-5′ linkages) can be formed.
  • Naturally occurring oligonucleotides are those which occur in nature; for example ribose and deoxyribose phosphodiester oligonucleotides having adenine, guanine, cytosine, thymine and uracil nucleobases.
  • non-naturally occurring oligonucleotides are oligonucleotides that contain modified sugar, internucleoside linkage and/or nucleobase moieties. Such oligonucleotide analogs are typically structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic wild type oligonucleotides.
  • non-naturally occurring oligonucleotides include all such structures which function effectively to mimic the structure and/or function of a desired RNA or DNA strand, for example, by hybridizing to a target.
  • alkyl includes, but is not limited to., straight chain, branched chain and alicyclic hydrocarbon groups. Alkyl groups of the present invention may be substituted. Representative alkyl substituents are disclosed in U.S. Pat. No. 5,212,295, at column 12, lines 41-50, hereby incorporated by reference in its entirety. Substituent groups include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, hydroxyl, alkoxy, alcohol, benzyl. phenyl, nitro, thiol, thioalkoxy, thioalkyl, trifluoromethyl, halo, nitrile, trifluoromethoxy and azido. As used herein, the term “lower alkyl” is intended to mean an alkyl group having 10 or fewer carbons.
  • Alkenyl groups according to the invention are to straight chain, branch chain, and cyclic hydrocarbon groups containing at least one carbon-carbon double bond, and alkynyl groups are to straight chain, branch chain, and cyclic hydrocarbon groups containing at least one carbon-carbon triply bond. Alkenyl and alkynyl groups of the present invention can be substituted.
  • Aryl groups are substituted and unsubstituted aromatic cyclic moieties including but not limited to phenyl, naphthyl, anthracyl, phenanthryl, pyrenyl, and xylyl groups.
  • Alkaryl groups are those in which an aryl moiety links an alkyl moiety to a core structure, and aralkyl groups are those in which an alkyl moiety links an aryl moiety to a core structure.
  • oligonucleoside includes oligomers or polymers containing two or more nucleoside subunits having a non-phosphorous linking moiety. Oligonucleosides according to the invention have a ribofuranose moiety attached to a nucleobase through a glycosyl bond.
  • An oligonucleotide/nucleoside for the purposes of the present invention is a mixed backbone oligomer having at least two nucleosides covalently bound by a non-phosphate linkage and at least one phosphorous containing covalent bond with a nucleotide, wherein at least one of the monomeric nucleotide or nucleoside units is a 2′-O-substituted compound prepared using the process of the present invention.
  • An oligonucleotide/nucleoside can additionally have a plurality of nucleotides and nucleosides coupled through phosphorous containing and/or non-phosphorous containing linkages.
  • aralkyl denotes alkyl groups which bear aryl groups, for example, benzyl groups.
  • alkaryl denotes aryl groups which bear alkyl groups, for example, methylphenyl groups.
  • aryl denotes aromatic cyclic groups including, but not limited to, phenyl, naphthyl, anthracyl, phenanthryl and pyrenyl.
  • Preferred aryl and aralkyl groups include, but are not limited to, phenyl, benzyl, xylyl, naphthyl, toluyl, pyrenyl, anthracyl, azulyl, phenethyl, cinnamyl, benzhydryl, and mesityl.
  • Typical substituents for substitution include, but are not limited to, hydroxyl, alkoxy, alcohol, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, or alkyl, aryl, alkenyl, or alkynyl groups.
  • alkanoyl has its accustomed meaning as a group of formula —C( ⁇ O)-alkyl.
  • a preferred alkanoyl group is the acetyl group.
  • Phosphorothioate oligonucleotides having chirally pure intersugar linkages which are synthesized according to methods of the present invention may be analyzed in a number of ways. For example, configuration analysis of resulting sequence specific phosphorothioate oligonucleotides having subtantially chirally pure all-Sp or all-Rp intersugar linkages may be determined by the use of [ 31 P] NMR chemical shifts. Such chemical shifts have been used to identify the Rp epimer of a phosphorothioate di-nucleotide. See Ludwig and Eckstein. J. Org. Chem., 631-635(1989).
  • Methods of the present invention are useful for preparing oligomeric compounds having in addition to chiral Sp internucleoside linkages other chiral and achiral internucleoside linkages.
  • other chiral and achiral internucleoside linkages are meant to include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have phosphorus atoms in their internucleoside linkages can also be considered to be oligonucleosides.
  • Preferred modified oligonucleoside linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters. aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphonates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′.
  • Various salts, mixed salts and free acid forms are also included.
  • Preferred modified oligonucleoside linkages that do not include a phosphorus atom therein include alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH, component parts.
  • fidelity of sequences of phosphorothioate oligonucleotides of the invention can be determined using the sensitivities of heteroduplexes to S1 nuclease.
  • sequence of the phosphorothioate oligonucleotides can be further substatiated by labeling the 3′hydroxyls of phosphorothioate oligonucleotides with [alpha- 3 P] cordycepin triphosphate, i.e. 3′-deoxyadenosine-5′-triphosphate.
  • the resultant oligonucleotides may be subjected to enzymatic degradation.
  • the relative ability of phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages, as compared to the identical racemic sequence, to bind to complementary strands is compared by determining the melting temperature of a hybridization complex of each oligonucleotide with the complementary strand.
  • the melting temperature (T m ) a characteristic physical property of double helixes, denotes the temperature in degrees centigrade at which 50% helical versus coiled (unhybridized) forms are present.
  • T m is measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity).
  • Phosphorothioate oligonucleotides of the invention are also evaluated as to their resistance to the degradative ability of a variety of exonucleases and endonucleases.
  • Phosphorothioate oligonucleotides are treated with nucleases and then analyzed, as for instance, by polyacrylamide gel electrophoresis (PAGE) followed by staining with a suitable stain such as Stains AllTM (Sigma Chem. Co., St. Louis, Mo.). Degradation products are quantitated using laser densitometry.
  • a phosphorothioate oligonucleotide can be incubated with a radiolabeled target mRNA (synthesized as for instance via T7 RNA polymerase) at various temperatures for hybridization. Heteroduplexes can then be incubated at 37° C. with RNase H from E. coli according to the procedure of Minshull, J, and Hunt, T., Nuc. Acid Res., 1986. 6433-6451.
  • Products are then assessed for RNase H activity by Northern Blot analysis wherein products are electrophoresed on a 1.2% agarose/formaldehyde gel and transferred to nitrocellulose. Filters are then probed using a random primer [ 32 P]-labeled cDNA complementary to target mRNA and quantitated by autoradiography. The effect of chirality on the relative ability of a heteroduplex to act as a substrate for RNase H is then calculated for various phosphorothiuoate analogs.
  • Heteroduplexes are incubated in rabbit reticulocyte lysates under conditions of translation and assayed via Northern blot analysis for catalytic cleavage of mRNA by endogenous RNase H. This allows for determination of the effects of chirality on mammalian RNAse H activity.
  • the compounds of the present invention may be taken up in pharmaceutically acceptable carriers such as, for example, solutions, suspensions, tablets, capsules, ointments, elixirs and injectable compositions.
  • pharmaceutically acceptable carriers such as, for example, solutions, suspensions, tablets, capsules, ointments, elixirs and injectable compositions.
  • the dosage administered depends upon factors such as the nature and severity of the condition, the stage of the condition, and the condition of the patient.
  • An effective amount of oligonucleotide may be from about 10 ⁇ g/kg body weight to about 1000 ⁇ g/kg body weight.
  • the oligomeric compounds of the present invention can be used in diagnostics, therapeutics and as research reagents and kits.
  • the oligomeric compounds of the present invention can also be used in pharmaceutical compositions by including a suitable pharmaceutically acceptable diluent or cattier. These compounds can further be used for treating organisms having a disease characterized by the undesired production of a protein.
  • the organism is contacted with an oligonucleotide having a sequence that is capable of specifically hybridizing with a strand of nucleic acid encoding the undesirable protein. Treatments of this type can be practiced on a variety of organisms ranging from unicellular prokaryotic and eukaryotic organisms to multicellular eukaryotic organisms.
  • Any organism that utilizes DNA-RNA transcription or RNA-protein translation as a fundamental part of its hereditary, metabolic or cellular control is susceptible to therapeutic and/or prophylactic treatment in accordance with the invention. Seemingly diverse organisms such as bacteria, yeast, protozoa, algae, all plants and all higher animal forms, including warm-blooded animals, can be treated. Further, each cell of multicellular eukaryotes can be treated, as they include both DNA-RNA transcription and RNA-protein translation as integral parts of their cellular activity. Furthermore, many of the organelles (e.g., mitochondria and chloroplasts) of eukaryotic cells also include transcription and translation mechanisms. Thus, single ails, cellular populations or organelles can also be included within the definition of organisms that can be treated with therapeutic or diagnostic oligonucleotides.
  • organelles e.g., mitochondria and chloroplasts
  • a patient in need of such therapy is administered an oligomer in accordance with the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 ⁇ g to 100 g per kg of body weight depending on the age of the patient and the severity of the disease state being treated.
  • the treatment may be a single dose or may be a regimen that may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years.
  • the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disease state.
  • the dosage of the oligomer may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, or if the disease state has been ablated.
  • a patient being treated for AIDS may be administered an oligomer in conjunction with AZT, or a patient with atherosclerosis may be treated with an oligomer of the invention following angioplasty to prevent reocclusion of the treated arteries.
  • Dosing is dependent on severity and responsiveness of the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved.
  • Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates.
  • Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC 50 s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to several years.
  • the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligomer is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every several years.
  • compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.
  • Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.
  • Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.
  • Treatments of this type can be practiced on a variety of organisms, ranging from unicellular prokaryotic and eukaryotic organisms to multicellular eukaryotic organisms.
  • Any organism that utilizes DNA-RNA transcription or RNA-protein translation as a fundamental pan of its hereditary, metabolic or cellular control is susceptible to therapeutic and/or prophylactic treatment in accordance with the present invention. Seemingly diverse organisms such as bacteria, yeast, protozoa, algae, all plants and all higher animal forms, including warm-blooded animals, can be treated.
  • each cell of multicellular eukaryotes can be treated, as they include both DNA-RNA transcription and RNA-protein translation as integral parts of their cellular activity.
  • organelles e.g., mitochondria and chloroplasts
  • organelles e.g., mitochondria and chloroplasts
  • single cells, cellular populations or organelles can also be included within the definition of organisms that can be treated with therapeutic or diagnostic oligonucleotides.
  • Psoriasis is a common chronic and recurrent disease characterized by dry, well-circumscribed, silvery, scaling papules and plaques of various sizes. The disease varies in severity from a few lesions to widespread dermatosis with disabling arthritis or exfoliation. The ultimate cause of psoriasis is not known, but the thick scaling that occurs is probably due to increased epidermal cell proliferation (The Merck Manual of Diagnosis and Therapy. 15th Ed., pp. 2283-2285, Berkow et al., eds., Rahway. N.J., 1987).
  • PKC Protein Kinase C
  • Some antipsoriasis drugs such as cyclosporin A and anthralin, have been shown to inhibit PKC, and inhibition of PKC has been suggested as a therapeutic approach to the treatment of psoriasis (Hegemann, L. and G. Mahrle. Pharmacology of the Skin, H. Mukhtar, ed., pp. 357-368. CRC Press, Boca Raton. Fla., 1992).
  • Antisense compounds targeted to Protein Kinase C (PKC) proteins are described in U.S. Pat. No. 5,620,963 to Cook et al, and U.S. Pat. No. 5,681,747 to Boggs et al.
  • Another type of therapeutic indication of interest is inflammatory disorders of the skin. These occur in a variety of forms including, for example, lichen planus, toxic epidermal necrolyis (TEN), ertythema multiforme and the like (The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 2286-2292, Berkow et al., eds., Rahway, N.J., 1987), Expression of ICAM-1 has been associated with a variety of inflammatory skin disorders such as allergic contact dermatitis, fixed drug eruption, lichen planus and psoriasis (Ho et al., J. Am. Acad Dermatol., 1990, 22, 64; Grifths et al., Am. J.
  • VCAM-1 and PECAM-1 Other antisense targets for skin inflammatory disorders are VCAM-1 and PECAM-1, lntraperitoneal administration of a monoclonal antibody to VCAM-1 decreases ovalbumin-induced eosinophil infiltration into the skin of mice (Hakugawa et al., J. Dermarol., 1997, 24, 73).
  • Antisense compounds targeted to VCAM-1 are described in U.S. Pat. Nos. 5,514,788 and 5,591,623.
  • PECAM-1 proteins are glycoproteins which are expressed on the surfaces of a variety of cell types (for reviews, see Newman, J. Clin. Invest., 1997, 99, 3 and DeLisser et al., Immunol. Today, 1994, 15, 490).
  • PECAM-1 In addition to directly participating in cell-cell interactions, PECAM-1 apparently also regulates the activity and/or expression of other molecules involved in cellular interactions (Litwin et al., J. Cell Biol., 1997, 139, 219) and is thus a key mediator of several cell:cell interactions. Antisense compounds targeted to PECAM-1 are described in co-pending U.S. patent application Ser. No. 09/044,506, filed Mar, 19, 1998, by Bennett et al.
  • oligonucleotides encompasses a variety of cancers of the skin.
  • Representative skin cancers include benign tumors (warts, moles and the like) and malignant tumors such as, for example, basal cell carcinoma, squamous cell carcinoma, malignant melanoma, Pagers disease, Kaposi's sarcoma and the like (The Merci Manual of Diagnosis and Therapy, 15th Ed., pp. 2301-2310, Berkow et al., eds., Rahway, N.J., 1987).
  • a number of molecular targets involved in tumorigenesis, maintenance of the hyperproliferative state and metastasis are targeted to prevent or inhibit skin cancers, or to prevent their spread to other tissues.
  • the ras oncogenes are guanine-binding proteins that have been implicated in cancer by, e.g., the fact that activated ras oncogenes have been found in about 30% of human tumors generally; this figure approached 100% in carcinomas of the exocrine pancreas (for a review, see Downward, Trends it Biol. Sci., 1990, 15, 469).
  • Antisense compounds targeted to H-ras and K-ras are described in U.S. Pat. No. 5,582,972 to Lima et al., U.S. Pat. No. 5,582,986 to Monia et al, and U.S. Pat. No. 5,661,134 to Cook et al., and in published PCT application WO 94/08003.
  • PKC Protein Kinase C
  • Antisense compounds targeted to Protein Kinase C (PKC) proteins are described in U.S. Pat. No. 5,620,963 to Cook et al, and U.S. Pat. No. 5,681,747 to Boggs et al.
  • AP-1 subunits and JNK proteins are also of interest, particularly in regard to their roles in tumorigenesis and metastasis.
  • the process of metastasis involves a sequence of events wherein (1) a cancer cell detaches from its extracellular matrices, (2) the detached cancer cell migrates to another portion of an animal's body, often via the circulatory system, and (3) attaches to a distal and inappropriate extracellular matrix, thereby created a focus from which a secondary tumor can arise.
  • Normal cells do not possess the ability to invade or metastasize and/or undergo apoptosis (programmed cell death) if such events occur (Ruoslahti, Sci. Amen., 1996, 275, 72).
  • MMPs matrix metalloproteinases
  • MMP-9 matrix metalloproteinase-9
  • AP-1 transcription factor Several studies have shown that regulation of the MMP-9 gene may be controlled by the AP-1 transcription factor (Kerr et al., Science, 1988, 242, 1242; Kerr et al., Cell, 1990, 61, 267; Gum et al., J. Biol. Chem., 1996,271, 10672; Hua et al., Cancer Res., 1996,56,5279). Inhibition of AP-1 function has been shown to attenuate MMP-9 expression (U.S. Pat. No. 5,985,558). AP-1 is a heterodimeric protein having two subunits, the gene products of fos and jun. Antisense compounds targeted to c-fos and c-jun are described in Dean et al. U.S. Pat. No. 5,985,558.
  • JNKs Jun N-terminal kinases
  • Infectious diseases of the skin are caused by viral, bacterial or fungal agents.
  • Lyme disease the tick home causative agent thereof, the spirochete Borrelia burgdorferi, up-regulates the expression of ICAM-1, VCAM-1 and ELAM-1 on endothelial cells in vitro (Boggemeyer et al., Cell Adhes. Comm., 1994, 2, 145).
  • the mediation of the disease by the anti-inflammatory agent prednisolone is due in part to mediation of this up-regulation of adhesion molecules (Hurtenbach et al., Int., J. Immunopharmac., 1996, 18, 281).
  • potential targets for therapeutic mediation (or prevention) of Lyme disease include ICAM-1, VCAM-1 and ELAM-1 (supra).
  • infectious disease of the skin which are tractable to treatment using the compositions and methods of the invention include disorders resulting from infection by bacterial, viral or fungal agents (The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 2263-2277, Berkow et al., eds., Rahway. N.J., 1987).
  • U.S. Pat. No. 5,691,461 provides antisense compounds for inhibiting the growth of Candida albicans.
  • U.S. Pat. Nos. 5,166,195, 5,523,389 and 5,591,600 provide oligonucleotide inhibitors of Human Immunodeficiency Virus (HIV).
  • U.S. Pat. No. 5,004,810 provides oligomers capable of hybridizing to herpes simplex virus Vmw65 mRNA and inhibiting its replication.
  • U.S. Pat. No. 5,194,428 and 5,580,767 provide antisense compounds having antiviral activity against influenzavirus.
  • U.S. Pat. No. 4,806,463 provides antisense compounds and methods using them to inhibit HTLV III replication.
  • CMV cytomegalovirus
  • U.S. Pat. No. 5,242,906 provides antisense compounds useful in the treatment of latent Epstein-Barr virus (EBV) infections.
  • U.S. Pat. Nos. 5,248,670, 5,514,577 and 5,658,891 provide antisense compounds useful in the treatment of herpesvirus infections.
  • U.S. Pat. Nos. 5,457,189 and 5,681,944 provide antisense compounds useful in the treatment of papillomavirus infections.
  • the antisense compounds disclosed in these patents, which are herein incorporated by reference, may be used with the compositions of the invention to effect prophylactic, palliative or therapeutic relief from diseases caused or exacerbated by the indicated pathogenic agents.
  • Antisense oligonucleotides employed in the compositions of the present invention may also be used to determine the nature, function and potential relationship of various genetic components of the body to disease or body states in animals.
  • the function of a gene has been chiefly examined by the construction of loss-of-function mutations in the gene (i.e., “knock-out” mutations) in an animal (e.g., a transgenic mouse).
  • knock-out mutations loss-of-function mutations in the gene
  • an animal e.g., a transgenic mouse.
  • Such tasks are difficult, time-consuming and cannot be accomplished for genes essential to animal development since the “knock-out” mutation would produce a lethal phenotype.
  • the loss-of-function phenotype cannot be transiently introduced during a particular part of the animal's life cycle or disease state: the “knock-out” mutation is always present.
  • Antisense knockouts that is, the selective modulation of expression of a gene by antisense oligonucleotides, rather than by direct genetic manipulation, overcomes these limitations (see, for example, Albert et al., Trends in Pharmacological Sciences, 1994, 15, 250).
  • some genes produce a variety of mRNA transcripts as a result of processes such as alternative splicing; a “knock-out” mutation typically removes all forms of mRNA transcripts produced from such genes and thus cannot be used to examine the biological role of a particular mRNA transcript.
  • Antisense oligonucleotides have been systemically administered to rats in order to study the role of the N-methyl-D-aspartame receptor in neuronal death, to mice in order to investigate the biological role of protein kinase C-a, and to rats in order to examine the role of the neuropeptide Y1 receptor in anxiety (Wahlestedt et al., Nature, 1993, 363:260; Dean et al., Proc. Natl. Acad. Sci. U.S.A., 1994, 91:11762; and Wahlestedt et al., Science, 1993, 259:528, respectively). In instances where complex families of related proteins are being investigated.
  • antisense knockouts i.e., inhibition of a gene by systemic administration of antisense oligonucleotides
  • the present invention overcomes these and other shortcomings.
  • compositions comprising the oligonucleotides of the invention are believed to be within the skill of those in the art.
  • a patient in need of therapy or prophylaxis is administered a composition comprising a compound of the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 ⁇ g to 100 g per kg of body weight depending on the age of the patient and the severity of the disorder or disease state being treated. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution or prevention of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient.
  • Optimum dosages may vary depending on the relative potency of individual antisense compounds, and can generally be estimated based on EC 50 s found to be effective in in vitro and in vivo animal models.
  • treatment regimen is meant to encompass therapeutic, palliative and prophylactic modalities of administration of one or more compositions of the invention.
  • a particular treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease or disorder, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years.
  • the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disorder or disease state.
  • the dosage of the composition may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disorder or disease state is observed, or if the disorder or disease state has been ablated.
  • An optimal dosing schedule is used to deliver a therapeutically effective amount of the oligonucleotide of the invention.
  • the term “therapeutically effective amount,” for the purposes of the invention refers to the amount of oligonucleotide-containing pharmaceutical composition which is effective to achieve an intended purpose without undesirable side effects (such as toxicity, irritation or allergic response). Although individual needs may vary, determination of optimal ranges for effective amounts of pharmaceutical compositions is within the skill of the art. Human doses can be extrapolated from animal studies (Katocs et al., Chapter 27 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990).
  • the dosage required to provide an effective amount of a pharmaceutical composition will vary depending on the age, health, physical condition, weight, type and extent of the disease or disorder of the recipient, frequency of treatment, the nature of concurrent therapy (if any) and the nature and scope of the desired effect(s) (Nies et al., Chapter 3 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics. 9th Ed., Hardman et al., eds., McGraw-Hill. New York. N.Y., 1996).
  • the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the bioactive agent is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • maintenance doses ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • preventative doses ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • an individual may be made less susceptible to an inflammatory condition that is expected to occur as a result of some medical treatment, e.g., graft versus host disease resulting front the transplantation of cells, tissue or an organ into the individual.
  • Prophylactic modalities for high risk individuals are also encompassed by the invention.
  • the term “high risk individual” is meant to refer to an individual for whom it has been determined, via, e.g., individual or family history or genetic testing, that there is a significantly higher than normal probability of being susceptible to the onset or recurrence of a disease or disorder.
  • a subject animal could have a personal and/or family medical history that includes frequent occurrences of a particular disease or disorder.
  • a subject animal could have had such a susceptibility determined by genetic screening according to techniques known in the art (see, e.g., U.S. Congress, Office of Technology Assessment.
  • prophylactically effective amount is meant to refer to an amount of a pharmaceutical composition which produces an effect observed as the prevention of the onset or recurrence of a disease or disorder.
  • Prophylactically effective amounts of a pharmaceutical composition are typically determined by the effect they have compared to the effect observed when a second pharmaceutical composition lacking the active agent is administered to a similarly situated individual.
  • the oligonucleotide analog is administered to an animal suffering from a disease modulated by some protein. It is preferred to administer to patients suspected of suffering from such a disease an amount of oligonucleotide analog that is effective to reduce the symptomology of that disease.
  • One skilled in the art can determine optimum dosages and treatment schedules for such treatment regimens.
  • RNA or DNA portion which is to be modulated be preselected to comprise that portion of DNA or RNA which codes for the protein whose formation or activity is to be modulated.
  • the targeting portion of the composition to be employed is, thus, selected to be complementary to the preselected portion of DNA or RNA, that is to be an antisense oligonucleotide for that portion.
  • the compounds of the invention hybridize to HIV mRNA encoding the tat protein, or to the TAR region of HIV mRNA. In another preferred embodiment, the compounds mimic the secondary structure of the TAR region of HIV mRNA, and by doing so bind the tat protein.
  • administer the therapeutic agents in accordance with this invention internally such as orally, intravenously, or intramuscularly.
  • Other forms of administration such as transdermally, topically, or intralesionally may also be useful.
  • Inclusion in suppositories may also be useful.
  • Use of pharmacologically acceptable carriers is also preferred for some embodiments.
  • This invention is also directed to methods for the selective binding of RNA for research and diagnostic purposes. Such selective, strong binding is accomplished by interacting such RNA or DNA with compositions of the invention which are resistant to degradative nucleases and which hybridize more strongly and with greater fidelity than known oligonucleotides or oligonucleotide analogs.
  • R4-mercapto-4-methyl-2-pentanol and S-4-mercapto-4-methyl-2-pentanol are synthesized according to the procedure of Eliel and Morris-Natschke (Eliel, E. L., Morris-Natschke, S., J.Am.Chem.Soc, 1984, 106, 2937-2942).
  • PCl 3 (1.3 mL, 15 mmol) is introduced via a syringe into a dry 100-mL round-bottomed flask containing 20 mL of dry THF that has been flushed with argon and sealed with a septum.
  • the flask is cooled to ⁇ 78° C. in a dry ice/acetone bath, and a solution of (R)-4-mercapto-4-methyl-2-pentanol (15 mmol) in THF (15 mL) containing triethylamine (6.9 mL, 50 mmol) is added via a syringe.
  • the reaction mixture is stirred for 30 min at ⁇ 78° C. and then warmed to 0° C. for 1 hour.
  • the reaction mixture is partitioned between CH 2 Cl 2 and saturated NaHCO 3 and washed with saturated NaCl and dried over anhydrous Na 2 SO 4 to give the title compound.
  • Thymidine was attached to solid support following a literature procedure (Damha et al., Nucleic Acids Res., 1990, 18, 3813-3821). To a dry 6 mL Hypovial was added 5′-O-DMT thymidine (109 mg, 0.2 mmol). CPG with sarcosinyl-succinonyl linker (Brown et al., J. Chem. Soc. Chem. Comm. 1989, 891) (1.0 g), 4-DMAP (12 mg, 0.1 mmol), triethylamine (80 ⁇ L), DEC (384 mg. 2.0 mmol), and anhydrous pyridine (5 mL). The mixture was shaken at room temperature for 24 h.
  • Pentachlorophenol (134 mg, 0.5 mmol) was added, and the mixture was shaken for an additional period of 16 h.
  • the CPG was filtered off and washed successively with pyridine, CH 2 Cl 2 , and ether.
  • the CPG was treated with reagent grade piperidine (5 mL), and the slurry was shaken for 10 min.
  • the resulting CPG was filtered off, washed successively with CH 2 Cl 2 and ether, and dried under vacuum.
  • the dried CPG was mixed with equal parts of two solutions of 0.5 M acetic anhydride in THF and 0.5 M 4DMAP/2,4,6-trimethylpyridine in THF (4 mL each).
  • the slurry was shaken for 2 hours and washed successively with pyridine, CH 2 Cl 2 , THF and ether.
  • the loading amount was measured by′ Trityl Analysis, 37.9 mol/g. Detritylation with 3% trichloroacetic acid in 1,2-dichloroethane afforded the immobilized thymidine.
  • Compound 4 is treated with NH 4 OH (28%) at 50° C. For 2 h. The solution is evaporated to dryness, and the residue is dissolved in water (1 mL) and filtered. The resulting crude material which has been cleaved from the solid support, is purified and analyzed by HPLC to give Compound 5, a TT dimer having a chiral Rp internucleoside linkage.
  • Compound 6 is prepared following the procedures used to prepare Compound 1, Example 2, S-4-mercapto-4-methyl-2-pentanol (15 mmol) is treated with PCl 3 (15 mmol l to give upon purification Compound 6.
  • Compound 9 is treated with NH 4 OH (28%) at 50° C. for 2 h. The solution is evaporated to dryness, and the residue is dissolved in water (1 mL) and filtered. Compound 10 is purified and analyzed using HPLC. The four membered thiane formation facilitates the formation of the product (Compound 10).
  • Compound 14 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 15 as described above for Compound 4.
  • Dimers having Structure 15 are treated as per the procedure of Example 7 to cleave the dimer from the CPG and to deblock the phosphorus thereby giving the free deblocked dimer having Structure 15a.
  • Compound 18 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 18 as described above for Compound 4. Diners prepared from Compound 18 are cleaved from the CPG and deblocked thereby giving the free deblocked Sp chiral dimer.
  • the title compound is synthesized according to a literature procedure using (+)-pulegone (He et al., J. Org. Chem., 1990, 55, 2114-2119) by first preparing 5c-Methyl-2t [(1-methyl-1-benzylamino) ethyl]-cyclohexan-1r-ol. This compound is subjected to hydrogenolysis by Pd/H 2 to give the corresponding amino alcohol (removal of benzyl group). The amino alcohol is then treated with 1 equivalent of HCHO followed by NaCNBH 3 reduction to give the title Compound.
  • Compound 20 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 21 as described above for Compound 4.
  • a capping step is added to cap the free amine formed.
  • Compound 21 is treated with concentrated ammonium hydroxide for 16 hours to give the cleaved deblocked dimer as the Rp isomer and the chiral adjuvant derived products 22 and 23.
  • Compound 19 is treated with PCl 3 (1 equivalent) with excess of Hunig base in THF solvent at ⁇ 5° C. for 10 minutes.
  • the resulting chloro compound is treated with a selected 2′-deoxy-5-O-DMT-nucleoside having a free 31-OH group (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT thymidine or modified optionally protected 5-O-DMT-nucleoside).
  • Purified compound 20 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside (such as 2′-O-deoxy-6-N-benzoyl adenosine, 2′-O-deoxy-4-N-benzoyl cytidine, 2′-O-deoxy-2-N-isobutyryl guanosine or other modified optionally protected 5′-OH′-3′-CPG-nucleoside), for 2 hours using tetrazole as the coupling agent.
  • the resultant free amine is capped with acetic anhydride, and the dimer is oxidized with Beaucage reagent to give Compound 21.
  • Compound 21 is cleaved from the solid support and deprotected by treatment with concentrated ammonium hydroxide (30%, 12 hours). The chiral auxiliary is removed as compound 22 or 23 and the oligomer is purified by HPLC. The nucleoside dimer is treated with 80% aqueous acetic acid to remove the 5′-triyl group.
  • the Rp configuration is assigned as described below in the procedures.
  • Compound 25 is synthesized from compound 24 as described for compound 20. Compound 25 on coupling with nucleoside-CPG and purification as previously described for the Rp isomer gives the Sp isomer.
  • the product is washed with acetonitrile followed by the addition of a 0.2 M solution of Beaucage reagent in acetonitrile with reaction allowed to progress at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes.
  • the support is washed with acetonitrile, and then a solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added to cap any unreacted 5′-hydroxyl groups.
  • the product is washed with acetonitrile.
  • the product is washed with acetonitrile and a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes.
  • the support is washed with acetonitrile, and then a solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added to cap any unreacted 5′-hydroxyl groups followed by washing with acetonitrile.
  • the support is washed with acetonitrile, a solution of acetic anhydride/lutidine/THF (11:8) and a solution of N-methyl imidazole/THF are aided to cap any unreacted 5′-hydroxyl groups.
  • the product is washed with acetonitrile.
  • a solution of 3% dichloroacetic acid in toluene (v/v) is added to deprotect the 5′-hydroxyl groups and the product is washed with acetonitrile.
  • the desired tetamer is deblocked and cleaved from the solid support by treatment with a 30% aqueous solution of ammonium hydroxide for 90 minutes at room temperature followed by heating to 55° C. for 12 hours.
  • the aqueous solution is filtered and concentrated under reduced pressure to give the title phosphorothioate tetramer of 5′-dG Sp -dA Rp dC Sp T-3′.
  • oligonucleotides listed in Table 1 are synthesized by following the procedures described above. For generating chirally mixed (Rp and Sp) sites, commercial amidites (Perseptive Biosystems) are used and standard synthesis conditions are used.
  • the solid support employed is controlled pore glass CPG with sarcosinyl-succinonyl linker (Brown et al., J. Chem. Soc. Chem. Comm., 1989, 891).
  • the sulfurization reagent employed is 3H-1,2-benzodithiole-3-one-1.1-dioxide (2% in CH 3 CN, Iyer ibid).
  • oligonucleotide is deprotected (trityl on) in 1-5 mL 28.0-30% ammonium hydroxide NH 4 OH for approximately 16 hours at 55° C. (small scale). For larger scale synthesis of oligonucleotides (20 ⁇ mol/synthesis) 20 mL of 28.0-30% ammonium hydroxide is used. In general, oligonucleotides are cleaved and deprotected in 5-20 mL 28.0-30% NH 4 OH at 55° C. for approximately 16 hours.
  • the crude oligonucleotides are filtered from CPG using Gelman 0.45 ⁇ m nylon acrodisc syringe filters. Excess NH 4 OH is evaporated away in a Savant AS160 automatic speed vac. The crude yield is measured on a Hewlett Packard 8452A Diode Array Spectrophotometer at 260 nm. Crude samples are then analyzed by mass spectrometry (MS) on a Hewlett Packard electrospray mass spectrometer and by capillary gel electrophoresis (CGE) on a Beckmann P/ACE system 5000.
  • MS mass spectrometry
  • CGE capillary gel electrophoresis
  • Trityl-on oligonucleotides are purified by reverse phase preparative high performance liquid chromatography (HPLC). HPLC conditions are as follows: Waters 600E with 991 detector; Waters Delta Pak C4 column (7.8 ⁇ 300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100% acetonitrile; 2.5 mL/min flow rate; Gradient: 5% B for first five minutes with linear increase in B to 60% during the next 55 minutes.
  • HPLC conditions are as follows: Waters 600E with 991 detector; Waters Delta Pak C4 column (7.8 ⁇ 300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100% acetonitrile; 2.5 mL/min flow rate; Gradient: 5% B for first five minutes with linear increase in B to 60% during the next 55 minutes.
  • TEA-Ac triethyl
  • oligo yields from the larger 20 ⁇ mol syntheses are purified on larger HPLC columns (Waters Bondapak HC18HA) and the flow rate is increased to 5.0 mL/min Appropriate fractions are collected and solvent is removed via speed vac. Oligonucleotides are detritylated in 80% acetic acid for approximately 45 minutes and lyophilized again. Free trityl and excess salt are removed by passing detritylated oligonucleotides through Sephadex G-25 (size exclusion chromatography) and collecting appropriate samples with a Pharmacia fraction collector.
  • the Rp and Sp configuration of chiral thioates are determined according to the reported procedure (Slim, G., Gait, M. J., Nucleic Acids Res., 1991 19, 1183-1188).
  • the Rp isomer elutes in reverse phase column in HPLC as the “fast eluent. (Fraction I)” It is resistant to P1 nuclease but hydrolyzed by snake venom phosphodiesterase.
  • the Sp isomer elutes in HPLC reverse phase column as the “slow” eluent (Fraction II). This stereochemistry gives protection from snake venom phosphodiesterase (SVPD), but this isomer gets hydrolyzed by PI nuclease.
  • SVPD snake venom phosphodiesterase
  • each P ⁇ S oligonucleotide dimer (2 ODs) is digested with nuclease P1 (2.0 ⁇ g, Boehringer) in distilled water (120 ⁇ L) for 1 hour at 37° C.
  • the solution is buffered with 16 ⁇ L.
  • the product is analyzed by reverse phase HPLC. In this case, the Sp isomer is degraded while the Rp isomer is resistant to nuclease.
  • mice For each oligonucleotide tested 9 male BALE/c mice (Charles River, Wilmington, Mass.), weighing about 25 g are used (Crooke et al., J. Pharmacol. Exp. Ther, 1996, 277, 923). Following a 1-week acclimation, mice receive a single tail vein injection of oligonucleotide (5 mg/kg) administered in phosphate buffered saline (PBS), pH 7.0 One retro-orbital bleed (either 0.25. 0.5, 2 or 4 lv post dose) and a terminal bleed (either 1, 3, 8 or 24 h post dose) are collected from each group.
  • PBS phosphate buffered saline
  • One retro-orbital bleed either 0.25. 0.5, 2 or 4 lv post dose
  • a terminal bleed either 1, 3, 8 or 24 h post dose
  • the terminal bleed (approximately 0.6-0.8 ml) is collected by cardiac: puncture following ketamine/xylazine anesthesia.
  • the blood is transferred to an EDTA-coated collection tube and centrifuged to obtain plasma.
  • the liver and kidneys are collected from each mouse. Plasma and tissues homogenates are used for analysis for determination of intact oligonucleotide content by CGE. All samples are immediately frozen on dry ice after collection and stored at ⁇ 80° C. until analysis.
  • SEQ ID NO: 5 was used in a comparative study to determine the effect of chiral internucleotide linkages at predetermined positions compared to the same sequence having racemic linkages at each position.
  • the capillary gel electrophoretic analysis indicated the relative nuclease resistance of Chiral 3′-Sp-capped oligomers compared to ISIS 3082 (XVI, uniform 2′-deoxy phosphorothioate). Because of the resistance of Sp linkage to nucleases, Compounds XVII and XVIII are found to be stable in plasma, kidney and liver while XVI (3082) is not.
  • the oligoribonucleotide (sense strand) is Y-end labeled with 32 P using [ 32 P]ATP, T4 polynucleotide kinase, and standard procedures (Ausubel et al., Current Protocols in Molecular Biology, John Wiley, New York (1989)).
  • the labeled RNA is purified by electrophoresis on 12% denaturing PAGE (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. Plainview (1989)).
  • the specific activity of the labeled oligonucleotide is approximately 6000 cpm/fmol.
  • Hybridization reactions were prepared in 120 ⁇ L of reaction buffer [20 mM Tris-HCl (pH 7.5), 20 mM KCl. 10 mM MgCl 2 , 0.1 mM DTT] containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm 32 P-labeled sense oligoribonucleotide. Reactions were heated at 90° C. for 5 minutes and 1 unit of Inhibit-ACE is added. Samples were incubated overnight at 37° C. degrees. Hybridization reactions were incubated at 37° C. with 1.5 ⁇ 10.8 ⁇ 8 mg of E.
  • Hybridization reactions were prepared in 120 ⁇ L, of reaction buffer [20 mM Tris-HC (pH 7.5), 20 mM KCl, 10 mM MgCl 2 , 0.1 mM DTT] containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm 32P-labeled sense oligoribonucleotide. Reactions were heated at 90° C. for 5 min and 1 unit of Inhibit-ACE is added. Samples were incubated overnight at 37° C. degrees. Hybridization reactions were incubated at 37° C. with 1.5 ⁇ 10.8 ⁇ 8 mg of E.
  • H-ras targeted antisense oligonucleotides were tested for the ability to specifically reduce H-ras mRNA in T-24 cells (ATCC. Manassas, Va.). T-24 cells were routinely maintained in complete growth media. DMEM supplemented with 10% fetal calf serum and 100 units per milliliter penicillin and 100 micrograms per milliliter streptomycin (Lifetechnologies, Grand Island, N.Y.) in a humidified incubator at 37° C. For antisense experiments T-24 cells were plated in 6-well plates (Becton Dickinson Labware, Franklin Lakes, NJ.) at a density of 2 ⁇ 10 5 cells per well in complete growth medium and incubated as above.
  • Oligonucleotides were formulated in serum free Optimem and Lipofectin (Lifetechnologies, Grand Island, N.Y) at a constant ratio of 3 micrograms per milliliter Lipofectin per 100 nanomolar oligonucleotide.
  • serum free Optimem and Lipofectin Lifetechnologies, Grand Island, N.Y
  • two milliliters of formulated oligonucleotide is added to each well and the cells were incubated for four hours at 37° C. Following incubation the formulated oligonucleotide is aspirated from the monolayer, replaced with growth media, and incubated overnight.
  • RNAzol TEL-TEST, Inc., Friendswood, Tex.
  • RNA is fractionated through 1.2% agarose-formaldehyde gels and transferred to nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) following standard protocols (Sambrook et al. Molecular Cloning a Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989).
  • Nylon membranes were probed for H-ras (Oncogene Research Products, Cambridge, Mass.) using standard 32P random priming labeling and hybridization protocols (Sambrook et al.
  • oligomers II and III When ICAM-1 expression is tested with oligomers I. II and III, it is observed that the ICAM-1 expression data reveal that the oligomers II and III are more efficacious than oligomer I in HUVEC cells. The oligomers are presumably working by a improved nuclease resistance in case of oligomer II and enhanced RNaseH activity and improved nuclease resistance in the case of oligomer III.
  • an animal suspected of having a disease characterized by excessive or abnormal supply of 5-lipoxygenase is treated by administering the macromolecule of the invention.
  • Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Such treatment is generally continued until either a cure is effected or a diminution in the diseased state is achieved. Long term treatment is likely for some diseases.
  • the oligonucleotides of this invention will also be useful as research reagents when used to cleave or otherwise modulate 5-lipoxygenase mRNA in crude cell lysates or in partially purified or wholly purified RNA preparations.
  • This application of the invention is accomplished for example, by lysing cells by standard methods, optimally extracting the RNA and then treating it with a composition at concentrations ranging, for instance, from about 100 to about 500 ng per 10 Mg of total RNA in a buffer consisting, for example, of 50 mm phosphate, pH ranging from about 4-10 at a temperature from about 30° to about 50° C.
  • the cleaved 5-lipoxygenase RNA can be analyzed by agarose gel electrophoresis and hybridization with radiolabeled DNA probes or by other standard methods.
  • oligonucleotides of the invention will also be useful in diagnostic applications, particularly for the determination of the expression of specific mRNA species in various tissues or the expression of abnormal or mutant RNA species.
  • the macromolecules target a abnormal mRNA by being designed complementary to the abnormal sequence, they would not hybridize to normal mRNA.
  • Tissue samples can be homogenized, and RNA extracted by standard methods.
  • the crude homogenate or extract can be treated for example to effect cleavage of the target RNA.
  • the product can then be hybridized to a solid support which contains a bound oligonucleotide complementary to a region on the 5′ side of the cleavage site. Both the normal and abnormal 5′ region of the mRNA would bind to the solid support. The 3′ region of the abnormal RNA, which is cleaved, would not be bound to the support and therefore would be separated from the normal mRNA.
  • Targeted mRNA species for modulation relates to 5-lipoxygenase: however, persons of ordinary skill in the art will appreciate that the present invention is not so limited and it is generally applicable.
  • the inhibition or modulation of production of the enzyme 5-lipoxygenase is expected to have significant therapeutic benefits in the treatment of disease.
  • an assay or series of assays is required.
  • the cellular assays for 5-lipoxygenase preferably use the human promyelocytic leukemia cell line HL-60. These cells can be induced to differentiate into either a monocyte like cell or neutrophil like cell by various known agents. Treatment of the cells with 1.3% dimethyl sulfoxide, DMSO, is known to promote differentiation of the cells into neutrophils. It has now been found that basal HL-60 cells do not synthesize detectable levels of 5-6-lipoxygenase protein or secrete leukotrienes (a downstream product of 5-lipoxygenase).
  • a second test system for oligonucleotides makes use of the fact that 5-lipoxygenase is a “suicide” enzyme in that it inactivates itself upon reacting with substrate.
  • 5-lipoxygenase is a “suicide” enzyme in that it inactivates itself upon reacting with substrate.
  • Treatment of differentiated HL-60 or other cells expressing 5 lipoxygenase, with 10 ⁇ M A23187, a calcium ionophore promotes translocation of 5-lipoxygenase from the cytosol to the membrane with subsequent activation of the enzyme. Following activation and several rounds of catalysis, the enzyme becomes catalytically inactive.
  • treatment of the cells with calcium ionophore inactivates endogenous 5-lipoxygenase.
  • Macromolecules directed against 5-lipoxygenase can be tested for activity in two HL-60 model systems using the following quantitative assays. The assays are described from the most direct measurement of inhibition of 5-lipoxygenase protein synthesis in intact cells to more downstream events such as measurement of 5-lipoxygenase activity in intact cells.
  • a direct effect which oligonucleotides can exert on intact cells and which can be easily be quantitated is specific inhibition of 5-lipoxygenase protein synthesis.
  • cells can be labeled with 35 S-methionine (50 ⁇ Ci/mL) for 2 hours at 37° C. to label newly synthesizes protein.
  • Cells are extracted to solubilize total cellular proteins and 5-lipoxygenase is immunoprecipitated with 5-lipoxygenase antibody .followed by elution from protein A Sepharose beads.
  • the immunoprecipitated proteins an resolved by SDS-polyacrylamide gel electrophoresis and exposed for autoradiography.
  • the amount of immunoprecipitated 5-lipoxygenase is quantitated by scanning densitometry.
  • Cytosolic proteins are incubated with 10 ⁇ M 14 C-arachidonic acid, 2 mM ATP 50 ⁇ M free calcium, 100 ⁇ g/mL phosphatidylcholine, and 50 mM bis-Tris buffer, pH 7.0, for 5 min at 37° C.
  • the reactions are quenched by the addition of an equal volume of acetone and the fatty acids extracted with ethyl acetate.
  • the substrate and reaction products are separated by reverse phase HPLC on a Novapak C18 column (Waters Inc., Millford, Mass.). Radioactive peaks are detected by a Beckman model 171 radiochromatography detector. The amount of arachidonic acid converted into di-HETE's and mono-HETE's is used as a measure of 5-lipoxygenase activity.
  • a predicted result for treatment of DMSO differentiated HL-60 cells for 72 hours with effective the macromolecules of the invention at 1 ⁇ M, 10 ⁇ M, and 30 ⁇ M would be as follows. Control cells oxidize 200 pmol arachidonic acid/5 min/10 6 cells. Cells treated with 1 ⁇ M, 10 ⁇ M, and 30 ⁇ M of an effective oligonucleotide would oxidize 195 pmol, 140 pmol, and 60 pmol of arachidonic acid/5 min/10 6 cells respectively.
  • ELISA quantitative competitive enzyme linked immunosorbant assay
  • Cell extracts (0.2% Triton X-100, 12,000 ⁇ g for 30 min.) or purified 5-lipoxygenase were incubated with a 1:4000 dilution of 5-lipoxygenase polyclonal antibody in a total volume of 100 ⁇ L in the microtiter wells for 90 min.
  • the antibodies are prepared by immunizing rabbits with purified human recombinant 5-lipoxygenase.
  • the wells are washed with TBS containing 0.05% tween 20 (TBST), then incubated with 100 ⁇ L, of a 1:1000 dilution of peroxidase conjugated goat anti-rabbit IgG (Cappel Laboratories, Malvern, Pa.) for 60 min at 25° C.
  • the wells are washed with TBST and the amount of peroxidase labeled second antibody determined by development with tetramethylbenzidine.
  • a net effect of inhibition of 5-lipoxygenase biosynthesis is a diminution in the quantities of leukotrienes released from stimulated cells.
  • DMSO-differentiated HL-60 cells release leukotriene B4 upon stimulation with the calcium ionophore A23187.
  • Leukotriene B4 released into the cell medium can be quantitated by radioimmunoassay using commercially available diagnostic kits (New England Nuclear, Boston, Mass.).
  • Leukotriene B4 production can be detected in HL-60 cells 48 hours following addition of DMSO to differentiate the cells into a neutrophil-like cell. Cells (2 ⁇ 10 5 cells/mL) will he treated with increasing concentrations of the macromolecule for 48-72 hours in the presence of 1.3% DMSO.
  • the cells are washed and resuspended at a concentration of 2 ⁇ 10 6 cell/mL in Dulbecco's phosphate buffered saline containing 1% delipidated bovine serum albumin. Cells are stimulated with 10 ⁇ M, calcium ionophore A23187 for 15 min and the quantity of LTB 4 produced from 5 ⁇ 10 5 cell determined by radioimmunoassay as described by the manufacturer.
  • the edematous response is quantitated by measurement of ear thickness and wet weight of a punch biopsy. Measurement of leukotriene B 4 produced in biopsy specimens is performed as a direct measurement of 5-lipoxygenase activity in the tissue. Oligonucleotides will be applied topically to both ears 12 to 24 hours prior to administration of arachidonic acid to allow optimal activity of the compounds. Both ears are pretreated for 24 hours with either 0.1 ⁇ mol, 0.3 ⁇ mol, or 1.0 ⁇ mol of the macromolecule prior to challenge with arachidonic acid. Values are expressed as the mean for three animals per concentration. Inhibition of polymorphonuclear cell infiltration for 0.1 ⁇ mol.
  • 0.3 ⁇ mol, and 1 ⁇ mol is expected to be about 10%, 75% and 92% of control activity, respectively.
  • Inhibition of edema is expected to be about 3%, 58% and 90%, respectively while inhibition of leukotriene B 4 production would be expected to be about 15%, 79% and 99%, respectively.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)

Abstract

Novel chiral compounds that mimic and/or modulate the activity of wild-type nucleic acids are disclosed. In general, the compounds are phosphorothioate oligonucleotides wherein the 5′, and the 3′-terminal internucleoside linkages are chirally Sp and internal internucleoside linkages are chirally Rp.

Description

CROSS REFERENCE TO RELATED APPLICATIONS
This patent application is a continuation-in-part of application Ser. No. 09/115,027, filed Jul. 14, 1998, now U.S. Pat. No. 6,242,589 entitled “Phosphorothioate Oligonucleotides Having Modified Internucleotide Linkages”, the content of which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
This invention relates to the design and synthesis of nuclease resistant phosphorothioate oligonucleotides which are useful for therapeutics, diagnostics and as research reagents. Phosphorothioate oligonucleotides are provided in which all of the internucleoside linkages are chiral. Such compounds are resistant to nuclease degradation and are capable of modulating the activity of DNA and RNA.
BACKGROUND OF THE INVENTION
It is well known that most of the bodily states in multi-cellular organisms, including most disease states, are effected by proteins. Such proteins, either acting directly or through their enzymatic or other functions, contribute in major proportion to many diseases and regulatory functions in animals and man. For disease states, classical therapeutics has generally focused upon interactions with such proteins in efforts to moderate their disease-causing or disease-potentiating functions. In newer therapeutic approaches, modulation of the actual production of such proteins is desired. By interfering with the production of proteins, the maximum therapeutic effect can be obtained with minimal side effects. It is therefore a general object of such therapeutic approaches to interfere with or other-wise modulate gene expression, which would lead to undesired protein formation.
One method for inhibiting specific gene expression is with the use of oligonucleotides, especially oligonucleotides which are complementary to a specific target messenger RNA (mRNA) sequence. Several oligonucleotides are currently undergoing clinical trials for such use. Phosphorothioate oligonucleotides are presently being used as therapeutic agents in human clinical trials against various disease states, including use as antiviral agents.
In addition to such use as both indirect and direct regulators of proteins, oligonucleotides also have found use in diagnostic tests. Such diagnostic tests can be performed using biological fluids, tissues, intact cells or isolated cellular components. As with gene expression inhibition, diagnostic applications utilize the ability of oligonucleotides to hybridize with a complementary strand of nucleic acid. Hybridization is the sequence specific hydrogen bonding of oligomeric compounds via Watson-Crick and/or Hoogsteen base pairs to RNA or DNA. The bases of such base pairs are said to be complementary to one another.
Oligonucleotides are also widely used as research reagents. They are useful for understanding the function of many other biological molecules as well as in the preparation of other biological molecules. For example, the use of oligonucleotides as primers in PCR reactions has given rise to an expanding commercial industry. PCR has become a mainstay of commercial and research laboratories, and applications of PCR have multiplied. For example, PCR technology now finds use in the fields of forensics, paleontology, evolutionary studies and genetic counseling. Commercialization has led to the development of kits which assist non-molecular biology-trained personnel in applying PCR. Oligonucleotides, both natural and synthetic, are employed as primers in such PCR technology.
Oligonucleotides are also used in other laboratory procedures. Several of these uses are described in common laboratory manuals such as Molecular Cloning, A Laboratory Manual. Second Ed., J. Sambrook, et al., Eds., Cold Spring Harbor Laboratory Press. 1989; and Current Protocols In Molecular Biology. F. M. Ausubel, et al., Eds., Current Publications, 1993. Such uses include as synthetic oligonucleotide probes, in screening expression libraries with antibodies and oligomeric compounds. DNA sequencing, in vitro amplification of DNA by the polymerase chain reaction, and in site-directed mutagenesis of cloned DNA. See Book 2 of Molecular Cloning. A Laboratory Manual, supra. See also “DNA-protein interactions and The Polymerase Chain Reaction” in Vol. 2 of Current Protocols In Molecular Biology, supra.
A number of chemical modifications have been introduced into oligonucleotides to increase their usefulness in diagnostics, as research reagents and as therapeutic entities. Such modifications include those designed to increase binding to a target strand (i.e. increase melting temperatures, Tm), to assist in identification of an oligonucleotide OR an oligonucleotide-target complex, to increase cell penetration, to stabilize against nucleases and other enzymes that degrade or interfere with the structure or activity of the oligonucleotides, to provide a mode of disruption (terminating event) once sequence-specifically bound to a target, and to improve the pharmacokinetic properties of the oligonucleotide.
The complementarity of oligonucleotides has been used for inhibition of a number of cellular targets. Complementary oligonucleotides are commonly described as being antisense oligonucleotides. Various-reviews describing the results of these studies have been published including Progress In Antisense Oligonucleotide Therapeutics, Crooke, S. T., and Bennett. C. F., Annu. Rev. Pharmacol. Toxicol., 1996, 36, 107-129. These oligonucleotides have proven to be powerful research tools and diagnostic agents. Certain oligonucleotides that have been shown to be efficacious are currently in human clinical trials.
The pharmacological activity of oligonucleotides, like other therapeutics, depends on a number of factors that influence the effective concentration of these agents at specific intracellular targets. One important factor for oligonucleotides is the stability of the species in the presence of nucleases. It is unlikely that unmodified, naturally-occurring oligonucleotides will be useful therapeutic agents because they are rapidly degraded by nucleases. The limitations of available methods for modification of the phosphate backbone of unmodified oligonucleotides have led to a continuing and long felt need for other modifications which provide resistance to nucleases and satisfactory hybridization properties for antisense oligonucleotide diagnostics and therapeutics.
Oligonucleotides having phosphorothioate modified backbones have shown therapeutic effects against numerous targets. This success is due in part to the increased nuclease resistance of the phosphorothioate backbone relative to the naturally occurring phosphodiester backbone. The phosphorothioate linkage unlike the phosphodiester linkage has 2 enantiomers, RP and SP. It has been shown that a 3′-RP linkage is labile to at least one exonuclease in the cytosol of HUVEC cells (Kiziolkiewicz et al. Nucleosides and Nucleotides, 1997, vol. 16, pp. 1677-1682). See also Koziolkiewicz et al., Antisense Nucleic Acid Drug Dev., 1997, 7, 43-48; Koziolkiewicz, Maria, Gendaszewska. Edyta, Maszewska, Maria, Stability of Stereoregular Oligo (nucleoside phosphorothioate)s in Human Cells; Diastereo-selectivity of Cellular 3′-Exonuclease, Nucleosides Nucleotides 1997, 16(7-9) 1677-1682.
A specific feature of oligonucleotides as drugs is that they must be stable in vivo long enough to be effective. Consequently, much research has been focused on enhancing the stability of oligonucleotide therapeutics while maintaining their specific binding properties. Recently, several groups have reported that chiral phosphorothioate oligonucleotide analogs have enhanced binding properties (Rp isomer) to the target RNA as well as significant stabilization to exonucleases (Sp isomer) (See Koziolkiewicz et al., Antisense & Nucleic acid drug development, 1997, 7, 43-8; Burgers et al., J. Biol. Chem., 1979, 254, 6889-93; and Griffiths et al., Nucleic Acids Research, 1987, 15, 41452-62).
Presently, there is no method to prepare P-chiral oligonucleotides in large scale. Current methods include synthesis and chromatographic isolation of stereoisomers of the chiral building blocks. (Stec et al., Angers: Chem. Int. Ed. Engl., 1994, 33, 709; Stec et al., J. Am. Chem. Soc., 1995, 117, 12019; and Stec W. J., Protocols for Oligonucleotides and Analogs: Synthesis and Properties, edited by Sudhir Agrawal, p. 63-80, (1993, Humana Press) and references cited therein). This method suffers from the non-stereospecific synthesis of the synthon. Recently, Just and coworkers presented the use of a chiral auxiliary to form dinucleotide phosphorothioate triesters in 97% ee (Wang, J. C., and Just G., Tetrahedron Letters, 1997, 38, 705-708). However, there was reported difficulty in removing the chiral auxiliary protecting group at phosphorous. This method has yet to be tested for convenient large scale automated synthesis.
Stereoregular phosphorothioate analogs of pentadecamer 5′-d(AGATGTITGA GCTCT)-3′ were synthesized by the oxathiaphospholane method (Koziolkiewicz et al., Nucleic Acids Res., 1995, 23, 5000-5005). There diastereomeric purity was assigned by means of enzymic degradation with nuclease P1 and independently, with snake venom phosphodiesterase. DNA-RNA hybrids formed by phosphorothioate oligonucleotides (PS-oligos) with the corresponding complementary pentadecarbonucleotide were treated with bacterial RNase H. The DNA-RNA complex containing the PS-oligo of [all-RP] configuration was found to be more susceptible to RNase H-dependent degradation of the pentadecarbonucleotide compared with hybrids containing either the [all-SP] counterpart or the so called ‘random mixture of diastereomers of the pentadeca(nucleoside phosphorothioate). This stereodependence of RNase H action was also observed for a polyribonucleotide (475 nt) hybridized with these phosphorothioate oligonucleotides. The results of melting studies of PS-oligo-RNA hybrids allowed a rationalization of the observed stereodifferentiation in terms of the higher stability of heterodimers formed between oligoribonucleotides and [all-RP]-oligo(nucleoside phosphorothioates), compared with the less stable heterodimers formed with [all-SP]-oligo(nucleoside phosphorothioates) or the random mixture of diastereomers.
(S)-1-(indol-2-yl)-propan-2-ol was used as a chiral auxiliary to form a dinucleotide phosphorothioate triester in 97% ee (Wang et al., Tetrahedron Lett., 1997, 38, 705-708).
A stereoselective preparation of dinucleotide phosphorothioates with a diastereomeric excess of >98%, using hydroxy(indolyl)butyronitrile 1 as chiral auxiliaries, is reported (Wang et al., Tetrahedron Lett., 1997, 38, 3797-3800).
1,2-O-Cyclopentylidene-5-deoxy-5-isopropylamino-D-xylofuranose and its enantiomer were used as chiral auxiliaries to form, respectively, Sp and Rp dithymidine phosphorothioates in 98% diastereomeric excess, using phosphoramidite methodologies and 2-bromo-4.5-dicyanoimidazole as catalyst (Jin et al., J. Org. Chem., 1998, 63, 3647-3654).
Oligonucleotide phosphorothioates were synthesized using prokaryotic DNA polymerase and oligonucleotide template/primer (Lackey et al., Biotechnol. Lett., 1997, 19, 475-478). The method facilitates the recovery of DNA polymerase and template/primer and is successful at the milligram scale. Thus, reusable template/primers were designed to specify the synthesis of an oligonucleotide (GPs0193) complementary to a sequence in exon 7 of the human immunodeficiency virus genome. Extension of the 3′-terminus by DNA polymerase utilizing dNTPS(Rp+Sp) substrates produced the specified oligonucleotide phosphorothioate with the chirally pure (Rp) stereochem. The biochemical synthesis was essentially complete within 60 min (compared with 24 h for automated solid phase synthesis). and produced <5% intermediate length oligonucleotide products, corresponding to a stepwise yield of >99.7% for the addition of each nucleotide.
Phosphorothioate oligodeoxyribonucleotides were tested for their ability to recognize double-helical DNA in two distinct triple helix motifs (Hacia et al., Biochemistry, 1994, 33, 5367-5369). Purine-rich oligonucleotides containing a diastereomeric mixture of phosphorothioate or stereoregular (all Rp) phosphorothioate linkages are shown to form triple-helical complexes with affinities similar to those of the corresponding natural phosphodiester oligonucleotides. In contrast, pyrimidine-rich phosphorothioate oligonucleotides containing a mixture of diastereomeric or stereoregular (all Rp) linkages do not bind to double-helical DNA with measurable affinity. These observations have implications for triple helix structure and for biological applications.
An enzymatic protocol has been established for the synthesis of Stereoregular (all Rp) oligodeoxyribonucleotide phosphorothioates. A 25-mer oligodeoxynucleotide phosphorothioate has been synthesized and studied for biophysical and biochemical properties (Tang et al., Nucleosides and Nucleotides, 1995, 14, 985-990).
Stability of oligo(nucleoside phosphorothioate)s (PS-oligos) in HUVEC (human umbilical vein endothelial cells) has been studied (Koziolkiewicz et al., Nucleosides and Nucleotides, 1997, 16, 1677-1682). Cytosolic fraction of HUVEC possesses 3′-exo-nucleolytic activity which is responsible for degradation of natural and PS-oligomers. The enzyme is Rp-specific, i.e. it cleaves internucleotide phosphorothioate function of Rp- and not Sp-configuration at phosphorus atom.
Enzymatic hydrolysis of stereoregular oligodeoxyribonucleoside phosphorothioates (PS-oligos) synthesized via the oxathiaphospholane method has been used for assignment of their diastereomeric purity (Koziolkiewicz et al., Antisense Nucleic Acid Drug Dev., 1999, 9, 171-181). For this purpose, two well-known enzymes of established diastereoselectivity, nuclease P1 and snake venom phosphodiesterase (svPDE) have been used. However, because of some disadvantageous properties of svPDE, a search for other [Rp]-specific endonucleases was undertaken. Extracellular bacterial endonuclease isolated from Serratia marcescens accepts PS-oligos as substrates and hydrolyzes phosphorothioate bonds of the [Rp] configuration, whereas internucleotide [Sp]-phosphorothioates are resistant to its action. Cleavage experiments carried out with the use of unmodified and phosphorothioate oligonucleotides of different sequences demonstrate that the Serratia nuclease is more selective in recognition and hydrolysis of oligodeoxyribonucleotides than previously reported. The substrate specificity exhibited by the enzyme is influenced not only by the nucleotide sequence at the cleavage site but also by the length and base sequence of flanking sequences. The Serratia nuclease can be useful for analysis of diastereomeric purity of stereodefined phosphorothioate oligonucleotides, but because of its sequence preferences, the use of this enzyme in conjunction with svPDE is more reliable.
The first NMR solution structure of a DNA/RNA hybrid containing stereoregular Rp-phosphorothioate modifications of all DNA backbone linkages is presented.
The complex of the enzymically synthesized phosphorothioate DNA octamer (all-Rp)-d(GCGTCAGG) and its complementary RNA r(CCUGACGC) had an overall conformation within the A-form family (Bachelin et al., Nat. Struct. Biol., 1998, 5, 271-276). Most helical parameters and the sugar puckers of the DNA strand assume values intermediate between A- and B-form. The close structural similarity with the unmodified DNA/RNA hybrid of the same sequence may explain why both the natural and the sulfur-substituted complex can be recognized and digested by RNase H.
New monomers, 5′-O-DMT-deoxyribonucleoside 3′-O-(2-thio-“spiro”-4,4-penta-methylene-1,3,2-oxathiaphospholane)s, were prepared and used for the stereo-controlled synthesis of PS-Oligos via the oxathiaphospholane approach (Stec et al., J. Am. Chem. Soc., 1998, 120, 7156-7167). These monomers and their 2-oxo analogs were used for the synthesis of “chimeric” constructs (PS/PO-Oligos) possessing phosphate and P-stereo-defined phosphorothioate inter-nucleotide linkages. The yield of a single coupling step is approximately 92-95%, and resulting oligomers are free of nucleobase- and sugar-phosphorothioate backbone modifications. Thermal dissociation studies showed that for hetero-duplexes formed by [Rp]-, [Sp]-, or [mix]-PS/PO-T10 with dA12, dA30, or poly(dA), for each template, the melting temperatures as well as free Gibbs' energies of dissociation process, are virtually equivalent. Stereochemical evidence derived form crystallographic analysis of one of the oxathiaphospholane monomers strongly supports the participation of pentacoordinate intermediates in the mechanism of the oxathiaphospholane ring-opening condensation.
The DBU-assisted 1,3,2-oxathiaphospholane ring opening condensation of the separate diastereomers of 5′-O-DMT-2′-O-TBDMS-ribonucleoside-3′-O-(2-thiono-1,3,2-oxathiaphospholane)s with 2′-TBDMSi-protected ribonucleoside bound to the solid support via the 3′-oxygen occurs with 96-100% stereospecificity and gives, after deprotection, [Rp]- or [SP]-diribonucleoside 3′,5′-phosphorothioates I (B=adenine, cytosine, guanine, uracil) in 65-97% yield (Sierzcha-la et al., J. Org. Chem. 1996,61, 6713-6716). Attempts to improve these yields by increasing either the coupling time or DBU concentration were unsuccessful. The absolute configuration at phosphorus of the dimers (1) was assigned by treatment with the stereospecific nucleases snake venom PDE or nuclease P 1. Discrimination of [Rp]- vs [Sp]-diastereomers of the following dimer by nuclease P1 is much less profound than that observed for dideoxyribonucleoside 3′,5′-phosphorothioates.
Figure USRE039464-20070109-C00001
Diastereomerically pure 5′-O-DMT nucleoside 3′-O-(2-thio-1,3.2-oxathiaphospholanes) (B=T, Adebz, Cytbz) were used for the synthesis of stereo-regular phosphorothioates (Stet et al., J. Am. Chem. Soc., 1995, 117, 12019-12029). The oxathiaphospholane ring-opening condensation requires the presence of strong organic base, preferably DBU. The yield of a single coupling step is ca. 95% and resulting S-Oligos are free of nucleobase- and sugar-phosphorothioate backbone modifications. The diastereomeric purity of products was estimated on the basis of diastereoselective degradation with Nuclease P1 and a mixture of snake venom phosphodiesterase and Serratia marcescens endonuclease. Thermal dissociation studies of heteroduplexes phosphorothioates/DNA and phosphorothioates/RNA showed that their stability is stereochemical- and sequence-dependent.
Figure USRE039464-20070109-C00002
It has been previously reported that four membered cyclic sulfur compounds are kinetically and thermodynamically facile compounds to form (Eliel et al., J. Am. Chem. Soc., 1985, 107, 2946-2952). A combination of product and rate studies including Hammett LFER for k and ks for p-substituted 3-(arylthio)-3-methyl-1-Bu tosylates and the solvent and salt effects on product ratio indicate that anchimeric assistance in the solvolysis of branched 3-(alkylthio) and (3-arylthio)propyl tosylates is real and that a marked Thorpe-lngold effect is evident. This observation led us to design compounds shown in FIGS. 2 to 7 as chiral auxillaries to synthesize chiral phosphorothioates. In a similar publication the neighboring group participation of oxygen in the solvolysis of acyclic-alkoxy substituted p-toluenesulfonates was illustrated (Eliel et al., J. Org. Chem, 1985, 50, 2707-2711). Methanolysis of PhCH2OCRR1CR2R3CHR4OTs (R=Me, R1-R4=H; R=R1=Me, R2-R4=H, R=R1=R4=Me, R2=R3=H; R=R1=R3=R4=H, R2=Me; R=R1=R4=H, R2=R3═Me; Ts=O2SC6H4Me−p) proceeds with partial rearrangement. implying neighboring-group participation, only when there are geminal Me groups in the 2- or 3-position (R2=R3=Me or R=R 1=Me).
In a recent review article entitled “New gem- and vic-disubstituent effects on cyclizations”. (Jung, Michael E., Synlett, 1999, 843-846 a summary of several new gem-disubstituent effects on cyclisations are illustrated, e.g., the gem-dialkoxy, -dicarboalkoxy, and -dithioalkoxy effects, have been discovered. In addition they have also observed a new vicinal disubstituent effect. A novel ring size effect of ketals on radical cyclizations has been investigated. In a similar article by the same author it was disclosed that while reaction of the bromoalkene with a 5-membered ketal I (R=Br, n=1) with tributyltin hydride gave only the acyclic product I (R=H, n=1), reaction of the corresponding bromoalkene with a 6-membered ketal I (R=Br, N=2) gave good yields of the cyclobutane II, in a novel ketal ring size effect. Also the gem-dicarboalkoxy effect was operative in these systems, e.g., cyclization of the bromo alkene triester, (E)-MeO2CCH:CHCH2C(CO2Et)2CH2OC(:S)OPh, afforded reasonable yields of the cyclobutane III.
Figure USRE039464-20070109-C00003
In accordance with this theory, the structures 3, 8, 14, 18, 20, and 25 all have geminal disubstituents. Use of this concept to synthesize chiral phosphorothioates with the concurrent formation of 4-membered cyclic thio compounds is novel.
Oligonucleotides that have chiral Sp phosphorothioate internucleotide linkages at the 3′-terminus are disclosed in International Application WO 99/05160, published by the PCT Feb. 4, 1999.
SUMMARY OF THE INVENTION
The present invention provides nuclease resistant phosphorothioate oligonucleotides which are useful for therapeutics, diagnostics and as research reagents. In preferred embodiments, the invention provides oligomeric compounds comprising a plurality of covalently-bound nucleosides, which have the formula:
5-T1—(Nu—Sp)n—(Nu—Lp)m—(NU—Sp)pNu—T2-3′
wherein:
    • T1 and T2 are each, independently, hydroxyl, a protected hydroxyl, a covalent attachment to a solid support, a nucleoside, an oligonueleoside, a nucleotide, an oligonucleotide, a conjugate group or a 5′ or 3′ substituent group;
    • each Sp is a chiral Sp phosphorothioate internucleoside linkage;
    • each Lp is, independently, a chiral Rp phosphorothioate internucleoside linkage, a racemic phosphorothioate internucleoside linkage or an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage.;
    • each n and m is, independently, from 1 to 100;
    • each p is from 0 to 100, where the sum of n, m and 1) is from 3 to about 200;
    • each Nu independently, has the formula:
      Figure USRE039464-20070109-C00004

      wherein:
    • Bx is a heterocyclic base moiety; and
    • R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group.
In some preferred embodiments, each R1 is H or hydroxyl. In further preferred embodiments. R1 is C1-C10 O-alkyl or C1-C10 substituted O-alkyl, with 2′-O-methoxyethyl or 2′-O-methyl being moire preferred.
In some preferred embodiments, each Nu is, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
In some more preferred embodiments, p is 1 or 2. In further more preferred embodiments, n and p are each 1 and m is from 3 to about 20.
In some preferred embodiments, T1 and T2 are, independently, hydroxyl or a protected hydroxyl. In further preferred embodiments, each Lp is an Rp phosphorothioate internucleoside linkage. In still further preferred embodiments, at least one Lp is a racemic phosphorothioate internucleoside linkage. In still further preferred embodiments, at least one Lp is an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage.
In some preferred embodiments, R1 is a 2′-substituent group or a protected 2′-substituent group other than H, hydroxyl or a protected hydroxyl.
The present invention also provides compounds having the formula:
Figure USRE039464-20070109-C00005

wherein:
    • Bx is a heterocyclic base moiety;
    • R4 is a hydroxyl protecting group;
    • R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group; and
    • R2 is an Sp chiral auxiliary group.
In some preferred embodiments, the chiral auxiliary group has one of formulas I, II, III, IV, V or VI:
Figure USRE039464-20070109-C00006
In further preferred embodiments, Bx is adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
In further preferred embodiments, each R1 is H or hydroxyl. In still further preferred embodiments, R1 is C1-C10 O-alkyl or C1-C10 substituted O-alkyl, with 2′-O-methoxyethyl or 2′-O-methyl being more preferred.
In some preferred embodiments, at least one R1 is 2′-O-methoxyethyl or 2′-O-methyl. In further preferred embodiments. R1 is a 2′-substituent group or a protected 2′-substituent group other than H, hydroxyl or a protected hydroxyl.
The present invention also provides pharmaceutical compositions comprising one or more compounds of the invention, and an acceptable pharmaceutical carrier.
The present invention also provides methods for preparing an oligomeric compound of formula:
5′-T1—(Nu—Sp)n—(Nu—Lp)m—(NU—Sp)p—Nu—T-0-2-3′
wherein:
    • each T1 and T2 is, independently, hydroxyl, a protected hydroxyl, a covalent attachment to a solid support, a nucleoside, an oligonucleotide, a nucleotide or an oligonucleotide, a conjugate group or a 5′ or 3′ substituent group;
    • each Sp is an Sp phosphorothioate internucleoside linkage;
    • each Lp is, independently, an Rp phosphorothioate internucleoside linkage, a racemic phosphorothioate internucleoside linkage or an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage;
    • each n and m is, independently, from 1 to 100;
    • each p is from 0 to 100 where the sum of n, m and p is from 3 to about 200;
    • each Nu independently, has the formula:
      Figure USRE039464-20070109-C00007
wherein:
    • Bx is a heterocyclic base moiety; and
    • R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group;
    • comprising the steps of:
      • (a) providing a compound of formula:
        Figure USRE039464-20070109-C00008
      • wherein:
    • R4 is a labile hydroxyl protecting group;
    • R3 is a covalent attachment to a solid support;
      • (b) deblocking said labile hydroxyl protecting group to form a deblocked hydroxyl group;
      • (c) optionally treating said deblocked hydroxyl group with a further compound having the formula:
        Figure USRE039464-20070109-C00009
      • wherein:
    • R2 is an Sp chiral auxiliary group;
    • and a condensing reagent to form an extended compound:
      • (d) optionally repeating steps (b) and (c);
      • (e) treating said deblocked hydroxyl group with a compound having the formula:
        Figure USRE039464-20070109-C00010
      • wherein:
    • R5 is an Rp chiral auxiliary group or an activated phosphorus group;
    • and a condensing reagent to form a further extended compound;
      • (f) optionally repeating steps (e) and (f) to add further nucleosides;
      • (g) deblocking said labile hydroxyl protecting group to form a deblocked hydroxyl group;
      • (h) treating said deblocked hydroxyl group with a further compound having the formula:
        Figure USRE039464-20070109-C00011
      • wherein:
    • R2 is an Sp chiral auxiliary group;
    • and a condensing reagent to form a protected oligomeric compound; and
      • (i) optionally repeating steps (h) and (i) to add at additional nucleosides thereby forming a further protected oligomeric compound.
Preferably, the method further comprises the step of deblocking the product of step (i).
In some preferred embodiments of the methods of the invention, the Sp chiral auxiliary group has one of formulas I, II or III:
Figure USRE039464-20070109-C00012

or one of formulas IV, V or VI:
Figure USRE039464-20070109-C00013
More preferred embodiments of the methods of the invention, further comprise one or more capping steps, which include treatment with a capping agent. Preferably, such capping steps are performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
In some preferred embodiments, the methods of the invention further comprising one or more oxidation steps: said oxidation steps comprising treatment with an oxidizing agent. In some preferred embodiments, such oxidiation steps are performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
In some preferred embodiments of the methods of the invention, said labile hydroxyl protecting group is dimethoxytrityl, monomethoxy trityl, trityl or 9-phenyl-xanthene. In further preferred embodiments of the methods of the invention, said heterocyclic base moiety is a purine or a pyrimidine, which is preferably, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
In some preferred embodiments of the compounds and methods of the invention, the sum of n, m, and p is from 5 to about 50, with 8 to about 30 being more preferred, and with 10 to about 25 being even more preferred
In further preferred embodiments of the methods of the invention, T1 and T2 are, independently hydroxyl or a protected hydroxyl.
In still further preferred embodiments of the methods of the invention, each Lp is a racemic phosphorothioate internucleoside linkage.
In still further preferred embodiments of the methods of the invention, at least one Lp is a racemic phosphorothioate internucleoside linkage.
In some more preferred embodiments, of the methods of the invention, n and p are each 1 and m is from 3 to about 20. In further more preferred embodiments n and p are each 2 and m is from 3 to about 20.
In further preferred embodiments, p is 0.
In some preferred embodiments, at least one R, is a 2′-substituent group or a protected 2′-substituent group other than H, hydroxyl or a protected hydroxyl.
In further preferred embodiments, the activated phosphorus group is a phosphoramidite, an H-phosphonate or a phosphate triester.
In still further preferred embodiments, the covalent attachment to a solid support is a sarcosinyl-succinonyl linker.
In further preferred embodiments, compounds are provided having the formula:
Figure USRE039464-20070109-C00014

wherein:
    • R62 is H or a hydroxyl protecting group;
    • R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group;
    • B is a heterocyclic base moiety; and
    • R62 is a chiral auxiliary selected from formulas I-V:
      Figure USRE039464-20070109-C00015
Also provided in accordance with the invention are compounds having the formula:
Figure USRE039464-20070109-C00016

wherein:
    • q is 0 to about 50;
    • R62 is H or a hydroxyl protecting group;
    • R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group;
    • R64 is H, a hydroxyl protecting group, or a linker to a solid support;
    • R63 is a radical selected from the group consisting of
      Figure USRE039464-20070109-C00017
In some preferred embodiments, each R1 is H or hydroxyl. In further preferred embodiments, R1 is C1-C10 O-alkyl or C1-C10 substituted O-alkyl, with 2′-O-methyl being preferred.
In some preferred embodiments. B is independently, adenine, guanidine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
In further preferred embodiments, q is 5 to about 50, with 8 to about 30 being preferred, and 10 to about 25 being more preferred. In some particularly preferred embodiments, q is 0 or 1.
Also provided by the present invention are methods of modulating the production or activity of a protein in an organism, comprising contacting said organism with a compound of the invention, and methods of treating an organism having a disease characterized by the undesired production of a protein, comprising contacting said organism with a compound of the invention.
The present invention further provides methods of assaying a nucleic acid, comprising contacting a solution suspected to contain said nucleic acid with a compound of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the structure of an Rp and an Sp chiral phosphorothioate internucleotide linkage.
FIG. 2 shows the chiral adjuvant (R)-4-mercapto-4-methyl-2-pentanol and the chiral building block derived therefrom which leads to Rp chiral phosphorothioate internucleotide linkages.
FIG. 3 shows the chiral adjuvant (S)-4-mercapto-4-methyl-2-pentanol and the chiral building block derived therefrom which leads to Sp chiral phosphorothioate internucleotide linkages.
FIG. 4 shows (+)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol, which is obtained from (+)-pulegone, and the chiral building block derived therefrom which leads to Rp chiral phosphorothioate internucleotide linkages.
FIG. 5 shows (−)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol, which is obtained from (−)-pulegone, and the chiral building block derive therefrom which leads to Sp chiral phosphorothioate internucleotide linkages.
FIG. 6 shows 5C-methyl-2t-[(1-methyl-1-benzylamino) ethyl]-cyclohexan-1t-ol which is obtained from (+)-pulegone, and the chiral building block derived therefrom which leads to Rp chiral phosphorothioate internucleoside linkages.
FIG. 7 shows 5C-methyl-2t-[(1-methyl-1-benzylamino) ethyl]-cyclohexan-1t-ol which is obtained from (−)-pulegone, and the chiral building block derive therefrom which leads to Sp chiral phosphorothioate internucleotide linkages:
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides oligomeric compounds having a first 5′-region that has at least one chiral Sp internucleoside linkage, and a second region that has chiral Rp internucleoside linkages, racemic phosphorothioate internucleoside linkages or internucleoside linkages other than chiral or racemic phosphorothioate internucleoside linkages. The present invention further provides oligomeric compounds having 3 regions where the first and second are as described above, and the third region has one or more Sp phosphorothioate internucleoside linkages. Also provided in accordance with the present invention are methods for the preparation of such oligomeric compounds having 2 or 3 regions. The presence of Sp geometry at the 5′-end of the oligomeric compound (2 regions) or at the wings of the oligomeric compound (e.g. at the 3′ and 5′ ends of 3-region compounds) reduces the susceptibility of the compound to exonuclease degradation. The presence of Rp geometry in the second region increases the affinity of the compound to complementary nucleic acid.
In one aspect of the invention chimeric compounds are prepared having Rp and Sp internucleoside linkages of high chiral purity (i.e., “chiral Sp”. “chiral Rp” “Sp” or “Rp” linkages). High chiral purity as used here is meant to indicate a percentage of the indicated enantiomer of 90% or greater. The preparation of timers and oligomers having Sp internucleoside linkages is described in U.S. Pat. Nos. 5,212,295, 5,587,361 and 5,599,797, the contents of which are incorporated herein by reference.
As will be recognized, this invention concerns oligonucleotides that exhibit increased stability relative to their naturally occurring counterparts. Extracellular and intracellular nucleases generally do not recognize (and, therefore, do not bind to) the compounds of the invention.
The present invention further includes methods of preparing oligomeric compounds having at least one Sp internucleoside linkage at the 5′ and at the 3′ ends. In preferred embodiments the oligomeric compounds have one or more Sp internucleoside linkages at the 5′ and at the 3′ ends and the internal internucleoside linkages are all Rp phosphorothioate linkages. Such oligomeric compounds are prepared by treating a solid support bound monomer with monomers having reactive phosphorus moieties that give defined stereochemistry at the resultant internucleoside linkages. The first monomer or monomers are selected to give Sp internucleotide linkages. The next section is prepared to have Rp or racemic internucleoside link-ages with the final section prepared as the first section to one or more Sp internucleoside linkages. The monomers are prepared as illustrated in the examples below.
Gem dialkyl substitutents located in selected chiral auxiliary groups favor product formation with the release of 4-membered oxathiane, 6-membered oxazine or amide structures. These compounds can be conveniently synthesized from (+)-pulegone and (−)-pulegone ((R)-4-mercapto-4-methyl-2-pentanol and (S)-4-mercapto-4-methyl-2-pentanol).
In some preferred embodiments, methods are provided for preparing an oligomeric compound of formula:
5′-T1—(Nu Sp)n—(Nu—Lp)m—(Nu-Sp)p —Nu—T 2-3′
wherein:
    • each T1 and T2 is, independently, hydroxyl, a protected hydroxyl, a covalent attachment to a solid support, a nucleoside, an oligonucleotide, a nucleotide or an oligonucleotide, a conjugate group or a 5′ or 3′ substituent group;
    • each Sp is an Sp phosphorothioate internucleoside linkage;
    • each Lp is, independently, an Rp phosphorothioate internucleoside linkage, a racemic phosphorothioate inter-nucleoside linkage or an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage;
    • each n and m is, independently, from 1 to 100;
    • each p is from 0 to 100 where the sum of n, m and p is from 3 to about 200;
    • each Nu, independently, has the formula:
      Figure USRE039464-20070109-C00018
      • wherein:
    • Bx is a heterocyclic base moiety; and
    • R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group;
    • comprising the steps of:
      • (a) providing a compound of formula:
        Figure USRE039464-20070109-C00019
      • wherein:
    • R4 is a labile hydroxyl protecting group;
    • R3 is a covalent attachment to a solid support;
      • (b) deblocking said labile hydroxyl protecting group to form a deblocked hydroxyl group;
      • (c) optionally treating said deblocked hydroxyl group with a further compound having the formula:
        Figure USRE039464-20070109-C00020
      • wherein:
    • R4 is an Sp chiral auxiliary group;
    • and a condensing reagent to form an extended compound;
      • (d) optionally repeating steps (b) and (c);
      • (e) treating said deblocked hydroxyl group with a compound having the formula:
        Figure USRE039464-20070109-C00021
      • wherein:
    • R5 is an Rp chiral auxiliary group or an activated phosphorus group;
    • and a condensing reagent to form a further extended compound;
      • (f) optionally repeating steps (e) and (f) to add further nucleosides;
      • (g) deblocking said labile hydroxyl protecting group to form a deblocked hydroxyl group;
      • (h) treating said deblocked hydroxyl group with a further compound having the formula:
        Figure USRE039464-20070109-C00022
      • wherein:
    • R2 is an Sp chiral auxiliary group;
    • and a condensing reagent to form a protected oligomeric compound; and
      • (i) optionally repeating steps (h) and (i) to add at additional nucleosides thereby forming a further protected oligomeric compound.
In the methods of the invention, the coupling of nucleosidic monomeric units is preceded by deblocking (of the 5′-terminal hydroxyl (i.e., removal of the 5′-protecting group) of the growing chain. Such “deblocking” cut be accomplished using a variety reagents known to those in the art. One suitable reagent is a dichloromethane solution of 2% dichloroacetic acid (v/v), or toluene solution of 3% dichloroacetic acid (v/v).
It is preferred that the present invention include one or more capping steps in between couplings of successive nucleosidic monomers. The capping step can be performed either prior to or after an oxidation step, and are preferably performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i. Such a capping step is generally known to be beneficial by preventing shortened oligomer chains, by blocking chains that have not reacted in the coupling cycle. One representative capping reagent used for capping is acetic anhydride. Other suitable capping reagents and methodologies can be found in U.S. Pat. No. 4,816,571, issued Mar. 28, 1989, hereby incorporated by reference in its entirety.
In some preferred embodiments, the methods of the invention further comprising one or more oxidation steps; said oxidation steps comprising treatment with an oxidizing agent. Choice of oxidizing agent will determine whether the resulting linkage will be, for example, a phosphodiester, phosphorothioate, or phosphorodithioate linkage. In some preferred embodiments, oxidizing steps are performed after a coupling step, e.g., one or more of steps c, d, e, f, h, and/or i.
Oxidizing agents used to produce phosphorothioate: and/or phosphorodithioate linkages (also known as “sulfurizing reagents”) include Beaucage reagent (see e.g. Iyer, R. P., et. al., J. Chem. Soc., 1990, 112, 1253-1254, and Iyer, R. P., et. al., J. Org. Chem., 1990, 55, 4693-4699); tetraethylthiuram disulfide (see e.g., Vu, H., Hirschbein, B. L., Tetrahedron Lett., 1991, 32, 3005-3008); dibenzoyl tetrasulfide (see e.g., Rao, M. V., et.al., Tetrahedron Lett., 1992, 33, 4839-4842); di(phenylacetyl)disulfide (see e.g., Kamer, P. C. J., Tetrahedron Lett., 1989, 30, 6757-6760), Bis(O,O-diisopropoxy phosphinothioyl)disulfide (see Stec et al., Tetrahedron Lett., 1993, 34, 5317-5320); 3-ethoxy-1,2,4-dithiazoline-5-one (see Nucleic Acids Research, 1996 24, 1602-1607, and Nucleic Acids Research, 1996 24, 3643-3644); Bis(p-chlorobenzenesulfonyl)disulfide (see NucleicAcids Research, 1995 23,4029-4033); sulfur, sulfur in combination with ligands like triaryl, trialkyl, triaralkyl, or trialkaryl phosphines. The foregoing references are hereby incorporated by reference in their entirety.
Useful oxidizing agents used to form the phosphodiester or phosphorothioate linkages include iodine/tetrahydrofuran/water/pyridine or hydrogen peroxide/water or tert-butyl hydroperoxide or any peracid like m-chloroperbenzoic acid. In the case of sulfurization the reaction is performed under anhydrous conditions with the exclusion of air, in particular oxygen whereas in the case of oxidation the reaction can be performed under aqueous conditions.
Solid supports are substrates which are capable of serving as the solid phase in solid phase synthetic methodologies, such as those described in Caruthers U.S. Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777;
4,973,679, and 5,132,418: and Koster U.S. Pat. Nos. 4,725,677 and Re. 34,069. Linkers are known in the art as short molecules which serve to connect a solid support to functional groups (e.g., hydroxyl groups) of initial synthon molecules in solid phase synthetic techniques. Suitable linkers are disclosed in, for example, Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, N.Y. 1991. Chapter 1, pages 1-23.
Solid supports according to the invention include those generally known in the art to be suitable for use in solid phase methodologies, including, for example, controlled pore glass (CPG), oxalyl-controlled pore glass (see, e.g., Alul, et al., Nucleic Acids Research 1991, 19, 1527, hereby incorporated by reference in its entirety). TentaGel Support—an aminopolyethyleneglycol derivatized support (see, e.g., Wright, et al., Tetrahedron Letters 1993, 34, 3373, hereby incorporated by reference in its entirety) and Poros—a copolymer of polystyrene/divinylbenzene.
In some preferred embodiments of the methods of the invention, the Sp chiral auxiliary group has one of formulas I, II or III:
Figure USRE039464-20070109-C00023

or one of formulas IV, V or VI:
Figure USRE039464-20070109-C00024
Upon completion of addition of monomeric synthons, the completed oligomer is cleaved from the solid support. The cleavage step, which can precede or follow deprotection of protected functional groups, will in preferred embodiments yield a compound devoid of protecting groups, and chiral auxiliaries. Suitable cleavage reagents include those that are known in the an such as, for example, NH4OH (2890) at 50° C. for 2 hours.
Oligonucleotides according to the present invention that are hybridizable to a target nucleic acid preferably comprise from about 5 to about 50 nucleosides. It is more preferred that such compounds comprise from about 8 to about nucleosides, with 10 to about 25 nucleosides being particularly preferred. As used herein, a target nucleic acid is any nucleic acid that can hybridize with a complementary nucleic acid-like compound. Further in the context of this invention, “hybridization” shall mean hydrogen bonding, which may be Watson-Crick. Hoogsteen or reversed Hoogsteen hydrogen bonding between complementary nucleobases. “Complementary” as used herein, refers to the capacity for precise pairing between two nucleobases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. “Complementary” and “specifically hybridizable,” as used herein, refer to precise pairing or sequence complementarity between a first and a second nucleic acid-like oligomers containing nucleoside subunits. For example, if a nucleobase at a certain position of the first nucleic acid is capable of hydrogen bonding with a nucleobase at the same position of the second nucleic acid, then the first nucleic acid and the second nucleic acid are considered to be complementary to each other at that position. The first and second nucleic acids are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between a compound of the invention and a target RNA molecule. It is understood that an oligomeric compound of the invention need not be 100% complementary to its target RNA sequence to be specifically hybridizable. An oligomeric compound is specifically hybridizable when binding of the oligomeric compound to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed.
As used herein the term “chiral auxiliary” is meant to include groups that function as a protecting groups for phosphorus linkages during the course of the synthesis of oligomeric phosphorothioates. Chiral auxiliaries will give either Sp or Rp chirality for the respective internucleoside linkage in the final oligomeric compound. Accordingly, chiral auxiliaries are allowed to remain on the growing chain, and are removed at the end of the iterative synthetic regime. Removal of chiral auxiliaries can be conveniently accomplished in a single treatment after the completion of the iterative synthesis. Preferred chiral auxiliaries are shown as used to prepare monomers of the invention in the figures (see compounds 3, 8, 14, 18, 20 and 25).
Representative heterocyclic base moieties useful in the compounds and methods described herein include adenine, guanine, cytosine, uridine, and thymine, as well as other non-naturally occurring and natural nucleobases such as xanthine, hypoxanthine. 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine. 5-halo uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo uracil), 4-thiouracil, 8-halo, oxa, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine. Further naturally and non naturally occurring nucleobases include those disclosed in U.S. Pat. No. 3,687,808 (Merigan, et al.), in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu. CRC Press, 1993, in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613-722 (see especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley & Sons, 1990, pages 858-859, Cook, Anti-Cancer Drug Design 1991, 6, 585-607, each of which are hereby incorporated by reference in their entirety). The term “nucleosidic base” is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain “universal bases” that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Especially mentioned as a universal base is 3-nitropyrrole.
Preferred heterocyclic base moieties include adenine, N6-benzoyladenine, cytosine, N4-benzoylcytosine, 5-methylcytosine, N4-benzoyl-5-methylcytosine, thymine, uracil, guanine. N2-isobutyrylguanine and 2-aminoadenine.
Further naturally- and non-naturally-occurring heterocyclic base moieties include those disclosed in U.S. Pat. No. 3,687,808 (Merigan et al.), in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993, in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613-722 (see, especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz, Ed., John Wiley & Sons, 1990, pages 858-859, Cook, P. D., Anti-Cancer Drug Design, 1991, 6, 585-607, each of which is hereby incorporated by reference in its entirety. The term “heterocyclic base moiety” is further intended to include heterocyclic ring systems that can serve as nucleosidic bases including certain ‘universal bases’ that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Especially mentioned as a universal base is 3-nitropyrrole.
In general, the term “hetero” denotes an atom other than carbon, preferably but not exclusively N, O, or S. Accordingly, the term “heterocycloalkyl” denotes an alkyl ring system having one or more heteroatoms (i.e., non-carbon atoms). Preferred heterocycloalkyl groups include, for example, morpholino groups. As used herein, the term “heterocycloalkenyl” denotes a ring system having one or more double bonds, and one or more heteroatoms. Preferred heterocycloalkenyl groups include, for example, pyrrolidino groups.
As used herein, the terms “2′-substituent group” or “5′ or 3′ substituent group” includes groups attached to the 2′-position of the ribofuranosyl moiety with or without an oxygen atom. Sugar substituent groups amenable to the present invention include, but are not limited to, fluoro. O-alkyl, O-alkylamino, O-alkylalkoxy, protected O-alkylamino, O-alkylaminoalkyl, 6-alkyl imidazole and polyethers of the formula (O-alkyl)m, wherein m is 1 to about 10. Preferred among these polyethers are linear and cyclic polyethylene glycols (PEGS), and (PEG)-containing groups, such as crown ethers and those which are disclosed by Ouchi et al., Drug Design and Discovery 1992, 9, 93; Ravasio et al., J. Org. Chem, 1991, 56, 4329; and Delgardo et, al., Critical Reviews in Therapeutic Drug Carrier Systems 1992, 9, 249, each of which is hereby incorporated by reference in its entirety. Further sugar modifications are disclosed in Cook, P. D., Anti-Cancer Drug Design, 1991, 6, 585-607, Fluoro, O-alkyl, O-alkylamino, O-alkyl imidazole, O-alkylaminoalkyl, and alkyl amino substitution is described in U.S. patent application Ser. No. 08/398,901, filed Mar. 6, 1995, entitled “Oligomeric Compounds having Pyrimidine Nucleotide(s) with 2′ and 5′ Substitutions,” hereby incorporated by reference in its entirety.
Additional sugar substituent groups amenable to the present invention include 2′-SR and 2′-NR, groups, wherein each R is, independently, hydrogen, a protecting group or substituted or unsubstituted alkyl, alkenyl, or alkynyl. 2′-SR nucleosides are disclosed in U.S. Pat. No. 5,670,633, issued Sep. 23, 1997, hereby incorporated by reference in its entirety. The incorporation of 2′-SR monomer synthons is disclosed by Hamm et al., J. Org. Chem., 1997, 62, 3415-3420, 2′-NR nucleosides are disclosed by Goettingen, M., J. Org. Chem., 1996, 61, 6273-6281; and Polushin et al., Tetrahedron Lett., 1996, 37, 3227-3230. Further representative sugar substituent groups amenable to the present invention include those having one of formula XI or XII:
Figure USRE039464-20070109-C00025

wherein:
    • Z0 is O, S or NH;
    • E is C1-C10 alkyl, N (Q1) (Q2) or N═C (Q1) (Q2)
    • each Q1 and Q2 is, independently. H, C1-C10 alkyl, substituted alkyl, dialkylaminoalkyl, a nitrogen protecting group, a tethered or untethered conjugate group, a linker to a solid support;
or Q1 and Q2, together, are joined in a nitrogen protecting group or a ring structure that can include at least one additional heteroatom selected from N and O;
    • q1 is from 1 to 10:
    • q2 is from 1 to 10;
    • q3 is zero or 1;
    • q4 is zero, 1 or 2;
    • q5 is 1 to 10;
    • each M, is, independently, H, C1-C8 alkyl. C1-C8 haloalkyl, C(═NH)N(H)M2, C(═O)N(H)M2 or OC(═O)N(H)M2;
    • M2 is H or C1-C8 alkyl;
    • Z1, Z2 and Z3 comprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein said heteroatoms are selected from oxygen, nitrogen and sulfur and wherein said ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic; and
    • Z4 is OM1, SM1 or N(M1)2;
    • Z5 is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms. N (Q1) (Q2), OQ1, halo, SQ1 or CN.
Representative 2′-O-sugar substituent groups of formula XI are disclosed in U.S. Pat. No. 6,172,209 which is hereby incorporated by reference in its entirety.
Representative cyclic 2′-O-sugar substituent groups of formula XII are disclosed in U.S. patent application Ser. No. 09/123,108, filed Jul. 27, 1998, entitled “RNA Targeted 2′-Modified Oligonucleotides that are Conformationally Preorganized.” hereby incorporated by reference in its entirety.
Sugars having O-substitutions on the ribosyl ring are also amenable to the present invention. Representative substitutions for ring O include, but are not limited to, S. CH2, CHF. and CF2, See, e.g., Secrist et al., Abstract 21. Program & Abstracts, Tenth International Roundtable, Nucleosides, Nucleotides and their Biological Applications, Park City, Utah, Sep. 16-20, 1992, hereby incorporated by reference in its entirety.
Additional modifications may also be made at other positions on the oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide and the 5′-position of 5′ terminal nucleotide. For example, one additional modification of the oligonucleotides of the present invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Len., 1994. 4, 1053), a thioether, e.g., hexyl-5-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660. 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov et al., FEES Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993. 75, 49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res., 1990, 18, 3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969), adamantane acetic acid (Manoharan et al., Tetrahedron Len., 1995, 36, 3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol Exp. Ther., 1996, 277, 923).
The monomers of the present invention can include appropriate activated phosphorus groups such as activated phosphate groups and activated phosphate groups. As used herein, the terms activated phosphate and activated phosphite groups refer to activated monomers or oligomers that are reactive with a hydroxyl group of another monomeric or oligomeric compound to form a phosphorus-containing internucleotide linkage. Such activated phosphorus groups contain activated phosphorus atoms in P′″ or PV valency states. Such activated phosphorus atoms are known in the art and include, but are not limited to, phosphoramdite, H-phosphonate and phosphate triesters. A preferred synthetic solid phase synthesis utilizes phosphoramidites as activated phosphates. The phosphoramidites utilize P′″ chemistry. The intermediate phosphite compounds are subsequently oxidized to the PV state using known methods to yield, in a preferred embodiment, phosphodiester or phosphorothioate internucleoside linkages. Additional activated phosphates and phosphites are disclosed in Tetrahedron Report Number 309 (Beaucage and Iyer. Tetrahedron, 1992, 48. 2223-2311).
Functional groups including those located on heterocyclic base moieties and 2′-sugar substituent groups are routinely blocked with protecting (blocking groups) during synthesis and subsequently deblocked. In general, a blocking group renders a chemical functionality of a molecule inert to specific reaction conditions and can later be removed from such functionality in a molecule without substantially damaging the remainder of the molecule. See, Green and Wuts, Protective Groups in Organic Synthesis, 2d edition. John Wiley & Sons, New York, 1991. For example, amino groups can be blocked with nitrogen protecting groups such as phthalimido. 9-fluorenylmethoxycarbonyl (FMOC), triphenylmethylsulfenyl, t-BOC or benzyl groups. Carboxyl groups can be protected as acetyl groups. Representative hydroxyl protecting groups are described by Beaucage et al., Tetrahedron 1992, 48, 2223. Preferred hydroxyl protecting groups are acid-labile groups, such as the trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 9-phenylxanthin-9-yl (Pixyl) and 9-(p-methoxyphenyl) xanthin-9-yl (MOX). Chemical functional groups can also be “blocked” by including them in a precursor form. That an azido group can be considered a “blocked” form of an arsine as the azido group is easily converted to the amine. Further representative protecting groups utilized in oligonucleotide synthesis are discussed in Agrawal et al., Protocols for Oligonucleotide Conjugates, Eds., Humana Press, New Jersey, 1994, Vol. 26, pp. 1-72.
The term “nucleoside” as used in connection with this invention refers to a unit made up of a heterocyclic base and its sugar. The term “nucleotide” refers to a nucleotide having a phosphate group on its 3′ or 5′ sugar hydroxyl group.
As used herein, the term “oligonucleotide” is intended to include both naturally occurring and non-naturally occurring (i.e., “synthetic”) oligomers of linked nucleosides. Although such linkages generally are between the 3′ carbon of one nucleoside and the 5′ carbon of a second nucleoside (i.e., 3′-5′ linkages), other linkages (such as 2′-5′ linkages) can be formed.
Naturally occurring oligonucleotides are those which occur in nature; for example ribose and deoxyribose phosphodiester oligonucleotides having adenine, guanine, cytosine, thymine and uracil nucleobases. As used herein, non-naturally occurring oligonucleotides are oligonucleotides that contain modified sugar, internucleoside linkage and/or nucleobase moieties. Such oligonucleotide analogs are typically structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic wild type oligonucleotides. Thus, non-naturally occurring oligonucleotides include all such structures which function effectively to mimic the structure and/or function of a desired RNA or DNA strand, for example, by hybridizing to a target.
As used herein, the term “alkyl” includes, but is not limited to., straight chain, branched chain and alicyclic hydrocarbon groups. Alkyl groups of the present invention may be substituted. Representative alkyl substituents are disclosed in U.S. Pat. No. 5,212,295, at column 12, lines 41-50, hereby incorporated by reference in its entirety. Substituent groups include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, hydroxyl, alkoxy, alcohol, benzyl. phenyl, nitro, thiol, thioalkoxy, thioalkyl, trifluoromethyl, halo, nitrile, trifluoromethoxy and azido. As used herein, the term “lower alkyl” is intended to mean an alkyl group having 10 or fewer carbons.
Alkenyl groups according to the invention are to straight chain, branch chain, and cyclic hydrocarbon groups containing at least one carbon-carbon double bond, and alkynyl groups are to straight chain, branch chain, and cyclic hydrocarbon groups containing at least one carbon-carbon triply bond. Alkenyl and alkynyl groups of the present invention can be substituted.
Aryl groups are substituted and unsubstituted aromatic cyclic moieties including but not limited to phenyl, naphthyl, anthracyl, phenanthryl, pyrenyl, and xylyl groups. Alkaryl groups are those in which an aryl moiety links an alkyl moiety to a core structure, and aralkyl groups are those in which an alkyl moiety links an aryl moiety to a core structure.
As used herein, the term “oligonucleoside” includes oligomers or polymers containing two or more nucleoside subunits having a non-phosphorous linking moiety. Oligonucleosides according to the invention have a ribofuranose moiety attached to a nucleobase through a glycosyl bond. An oligonucleotide/nucleoside for the purposes of the present invention is a mixed backbone oligomer having at least two nucleosides covalently bound by a non-phosphate linkage and at least one phosphorous containing covalent bond with a nucleotide, wherein at least one of the monomeric nucleotide or nucleoside units is a 2′-O-substituted compound prepared using the process of the present invention. An oligonucleotide/nucleoside can additionally have a plurality of nucleotides and nucleosides coupled through phosphorous containing and/or non-phosphorous containing linkages.
As used herein, the term “aralkyl” denotes alkyl groups which bear aryl groups, for example, benzyl groups. The term “alkaryl” denotes aryl groups which bear alkyl groups, for example, methylphenyl groups. As used herein, the term “aryl” denotes aromatic cyclic groups including, but not limited to, phenyl, naphthyl, anthracyl, phenanthryl and pyrenyl. Preferred aryl and aralkyl groups include, but are not limited to, phenyl, benzyl, xylyl, naphthyl, toluyl, pyrenyl, anthracyl, azulyl, phenethyl, cinnamyl, benzhydryl, and mesityl. Typical substituents for substitution include, but are not limited to, hydroxyl, alkoxy, alcohol, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, or alkyl, aryl, alkenyl, or alkynyl groups.
As used herein, the term “alkanoyl” has its accustomed meaning as a group of formula —C(═O)-alkyl. A preferred alkanoyl group is the acetyl group.
Phosphorothioate oligonucleotides having chirally pure intersugar linkages which are synthesized according to methods of the present invention may be analyzed in a number of ways. For example, configuration analysis of resulting sequence specific phosphorothioate oligonucleotides having subtantially chirally pure all-Sp or all-Rp intersugar linkages may be determined by the use of [31P] NMR chemical shifts. Such chemical shifts have been used to identify the Rp epimer of a phosphorothioate di-nucleotide. See Ludwig and Eckstein. J. Org. Chem., 631-635(1989).
Methods of the present invention are useful for preparing oligomeric compounds having in addition to chiral Sp internucleoside linkages other chiral and achiral internucleoside linkages. As defined in this specification, other chiral and achiral internucleoside linkages are meant to include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have phosphorus atoms in their internucleoside linkages can also be considered to be oligonucleosides.
Preferred modified oligonucleoside linkages include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters. aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, phosphonates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included.
Representative United States patents that each the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131: 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
Preferred modified oligonucleoside linkages that do not include a phosphorus atom therein include alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH, component parts.
Representative United States patents that reach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257, 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference.
The fidelity of sequences of phosphorothioate oligonucleotides of the invention can be determined using the sensitivities of heteroduplexes to S1 nuclease.
The sequence of the phosphorothioate oligonucleotides can be further substatiated by labeling the 3′hydroxyls of phosphorothioate oligonucleotides with [alpha-3P] cordycepin triphosphate, i.e. 3′-deoxyadenosine-5′-triphosphate. The resultant oligonucleotides may be subjected to enzymatic degradation.
The relative ability of phosphorothioate oligonucleotides having substantially chirally pure intersugar linkages, as compared to the identical racemic sequence, to bind to complementary strands is compared by determining the melting temperature of a hybridization complex of each oligonucleotide with the complementary strand. The melting temperature (Tm), a characteristic physical property of double helixes, denotes the temperature in degrees centigrade at which 50% helical versus coiled (unhybridized) forms are present. Tm is measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Consequently a reduction in UV absorption indicates a higher Tm. The higher the Tm, the greater the strength of the binding of the strands. Non Watson-Crick base pairing has a strong destabilizing effect on the Tm. Consequently, as close to optimal fidelity of base pairing as possible is desired to have optimal binding of an oligonucleotide to its targeted RNA.
Phosphorothioate oligonucleotides of the invention are also evaluated as to their resistance to the degradative ability of a variety of exonucleases and endonucleases. Phosphorothioate oligonucleotides are treated with nucleases and then analyzed, as for instance, by polyacrylamide gel electrophoresis (PAGE) followed by staining with a suitable stain such as Stains All™ (Sigma Chem. Co., St. Louis, Mo.). Degradation products are quantitated using laser densitometry.
The sensitivity of phosphorothioate oligonucleotide-RNA heteroduplexes to catalytic activity of RNase H is also easily assessed. A phosphorothioate oligonucleotide can be incubated with a radiolabeled target mRNA (synthesized as for instance via T7 RNA polymerase) at various temperatures for hybridization. Heteroduplexes can then be incubated at 37° C. with RNase H from E. coli according to the procedure of Minshull, J, and Hunt, T., Nuc. Acid Res., 1986. 6433-6451. Products are then assessed for RNase H activity by Northern Blot analysis wherein products are electrophoresed on a 1.2% agarose/formaldehyde gel and transferred to nitrocellulose. Filters are then probed using a random primer [32P]-labeled cDNA complementary to target mRNA and quantitated by autoradiography. The effect of chirality on the relative ability of a heteroduplex to act as a substrate for RNase H is then calculated for various phosphorothiuoate analogs.
Comparisons of the susceptibility of heteroduplexes to the catalytic action of E. coli RNase H and mammalian RNAse H are performed. Heteroduplexes are incubated in rabbit reticulocyte lysates under conditions of translation and assayed via Northern blot analysis for catalytic cleavage of mRNA by endogenous RNase H. This allows for determination of the effects of chirality on mammalian RNAse H activity.
For therapeutic or pharmaceutical use, the compounds of the present invention may be taken up in pharmaceutically acceptable carriers such as, for example, solutions, suspensions, tablets, capsules, ointments, elixirs and injectable compositions. The dosage administered depends upon factors such as the nature and severity of the condition, the stage of the condition, and the condition of the patient. An effective amount of oligonucleotide may be from about 10 μg/kg body weight to about 1000 μg/kg body weight.
The oligomeric compounds of the present invention can be used in diagnostics, therapeutics and as research reagents and kits. The oligomeric compounds of the present invention can also be used in pharmaceutical compositions by including a suitable pharmaceutically acceptable diluent or cattier. These compounds can further be used for treating organisms having a disease characterized by the undesired production of a protein. For this purpose, the organism is contacted with an oligonucleotide having a sequence that is capable of specifically hybridizing with a strand of nucleic acid encoding the undesirable protein. Treatments of this type can be practiced on a variety of organisms ranging from unicellular prokaryotic and eukaryotic organisms to multicellular eukaryotic organisms. Any organism that utilizes DNA-RNA transcription or RNA-protein translation as a fundamental part of its hereditary, metabolic or cellular control is susceptible to therapeutic and/or prophylactic treatment in accordance with the invention. Seemingly diverse organisms such as bacteria, yeast, protozoa, algae, all plants and all higher animal forms, including warm-blooded animals, can be treated. Further, each cell of multicellular eukaryotes can be treated, as they include both DNA-RNA transcription and RNA-protein translation as integral parts of their cellular activity. Furthermore, many of the organelles (e.g., mitochondria and chloroplasts) of eukaryotic cells also include transcription and translation mechanisms. Thus, single ails, cellular populations or organelles can also be included within the definition of organisms that can be treated with therapeutic or diagnostic oligonucleotides.
The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the an. In general, for therapeutics, a patient in need of such therapy is administered an oligomer in accordance with the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 μg to 100 g per kg of body weight depending on the age of the patient and the severity of the disease state being treated. Further, the treatment may be a single dose or may be a regimen that may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disease state. The dosage of the oligomer may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, or if the disease state has been ablated.
In some cases it may be more effective to treat a patient with an oligomer of the invention in conjunction with other traditional therapeutic modalities. For example, a patient being treated for AIDS may be administered an oligomer in conjunction with AZT, or a patient with atherosclerosis may be treated with an oligomer of the invention following angioplasty to prevent reocclusion of the treated arteries.
Dosing is dependent on severity and responsiveness of the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to several years.
Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligomer is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every several years.
The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration.
Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.
Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.
Treatments of this type can be practiced on a variety of organisms, ranging from unicellular prokaryotic and eukaryotic organisms to multicellular eukaryotic organisms. Any organism that utilizes DNA-RNA transcription or RNA-protein translation as a fundamental pan of its hereditary, metabolic or cellular control is susceptible to therapeutic and/or prophylactic treatment in accordance with the present invention. Seemingly diverse organisms such as bacteria, yeast, protozoa, algae, all plants and all higher animal forms, including warm-blooded animals, can be treated. Further, each cell of multicellular eukaryotes can be treated, as they include both DNA-RNA transcription and RNA-protein translation as integral parts of their cellular activity. Furthermore, many of the organelles (e.g., mitochondria and chloroplasts) of eukaryotic cells also include transcription and translation mechanisms. Thus, single cells, cellular populations or organelles can also be included within the definition of organisms that can be treated with therapeutic or diagnostic oligonucleotides.
Those skilled in the art will appreciate that numerous changes and modifications may be made to the preferred embodiments of the invention and that such changes and modifications may be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.
There are a many therapeutic indications and general uses for compounds of the present invention. Representative indications and uses include the following:
One therapeutic indication of particular interest is psoriasis. Psoriasis is a common chronic and recurrent disease characterized by dry, well-circumscribed, silvery, scaling papules and plaques of various sizes. The disease varies in severity from a few lesions to widespread dermatosis with disabling arthritis or exfoliation. The ultimate cause of psoriasis is not known, but the thick scaling that occurs is probably due to increased epidermal cell proliferation (The Merck Manual of Diagnosis and Therapy. 15th Ed., pp. 2283-2285, Berkow et al., eds., Rahway. N.J., 1987). Inhibitors of Protein Kinase C (PKC) have been shown to have both antiproliferative and anti-inflammatory effects in vitro. Some antipsoriasis drugs, such as cyclosporin A and anthralin, have been shown to inhibit PKC, and inhibition of PKC has been suggested as a therapeutic approach to the treatment of psoriasis (Hegemann, L. and G. Mahrle. Pharmacology of the Skin, H. Mukhtar, ed., pp. 357-368. CRC Press, Boca Raton. Fla., 1992). Antisense compounds targeted to Protein Kinase C (PKC) proteins are described in U.S. Pat. No. 5,620,963 to Cook et al, and U.S. Pat. No. 5,681,747 to Boggs et al.
Another type of therapeutic indication of interest is inflammatory disorders of the skin. These occur in a variety of forms including, for example, lichen planus, toxic epidermal necrolyis (TEN), ertythema multiforme and the like (The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 2286-2292, Berkow et al., eds., Rahway, N.J., 1987), Expression of ICAM-1 has been associated with a variety of inflammatory skin disorders such as allergic contact dermatitis, fixed drug eruption, lichen planus and psoriasis (Ho et al., J. Am. Acad Dermatol., 1990, 22, 64; Grifths et al., Am. J. Pathology, 1989, 135, 1045; Lisby et al., Br. J. Dermatol., 1989,120,479; Shiohara et al., Arch. Dermatol., 1989, 125, 1371; Regezi et al., Oral Surg. Oral Med. Oral Pathol., 1996, 81, 682). Moreover, intraperitoneal administration of a monoclonal antibody to ICAM-1 decreases ovalbumin-induced eosinophil infiltration into skin of mice (Hakugawa et al., J. Dermatol., 1997, 24, 73). Antisense compounds targeted to ICAM-1 are described in U.S. Pat. Nos. 5,514,788 and 5,591,623, and co-pending U.S. patent applications Ser. Nos. 09/009,490 and 09/062,416, Jan. 20, 1998 and Apr. 17, 1998, respectively, all to Bennett et al.
Other antisense targets for skin inflammatory disorders are VCAM-1 and PECAM-1, lntraperitoneal administration of a monoclonal antibody to VCAM-1 decreases ovalbumin-induced eosinophil infiltration into the skin of mice (Hakugawa et al., J. Dermarol., 1997, 24, 73). Antisense compounds targeted to VCAM-1 are described in U.S. Pat. Nos. 5,514,788 and 5,591,623. PECAM-1 proteins are glycoproteins which are expressed on the surfaces of a variety of cell types (for reviews, see Newman, J. Clin. Invest., 1997, 99, 3 and DeLisser et al., Immunol. Today, 1994, 15, 490). In addition to directly participating in cell-cell interactions, PECAM-1 apparently also regulates the activity and/or expression of other molecules involved in cellular interactions (Litwin et al., J. Cell Biol., 1997, 139, 219) and is thus a key mediator of several cell:cell interactions. Antisense compounds targeted to PECAM-1 are described in co-pending U.S. patent application Ser. No. 09/044,506, filed Mar, 19, 1998, by Bennett et al.
Another type of therapeutic indication of interest for oligonucleotides encompasses a variety of cancers of the skin. Representative skin cancers include benign tumors (warts, moles and the like) and malignant tumors such as, for example, basal cell carcinoma, squamous cell carcinoma, malignant melanoma, Pagers disease, Kaposi's sarcoma and the like (The Merci Manual of Diagnosis and Therapy, 15th Ed., pp. 2301-2310, Berkow et al., eds., Rahway, N.J., 1987). A number of molecular targets involved in tumorigenesis, maintenance of the hyperproliferative state and metastasis are targeted to prevent or inhibit skin cancers, or to prevent their spread to other tissues.
The ras oncogenes are guanine-binding proteins that have been implicated in cancer by, e.g., the fact that activated ras oncogenes have been found in about 30% of human tumors generally; this figure approached 100% in carcinomas of the exocrine pancreas (for a review, see Downward, Trends it Biol. Sci., 1990, 15, 469). Antisense compounds targeted to H-ras and K-ras are described in U.S. Pat. No. 5,582,972 to Lima et al., U.S. Pat. No. 5,582,986 to Monia et al, and U.S. Pat. No. 5,661,134 to Cook et al., and in published PCT application WO 94/08003.
Protein Kinase C (PKC) proteins have also been implicated in tumorigenesis. Antisense compounds targeted to Protein Kinase C (PKC) proteins are described in U.S. Pat. No. 5,620,963 to Cook et al, and U.S. Pat. No. 5,681,747 to Boggs et al.
Also of interest are AP-1 subunits and JNK proteins, particularly in regard to their roles in tumorigenesis and metastasis. The process of metastasis involves a sequence of events wherein (1) a cancer cell detaches from its extracellular matrices, (2) the detached cancer cell migrates to another portion of an animal's body, often via the circulatory system, and (3) attaches to a distal and inappropriate extracellular matrix, thereby created a focus from which a secondary tumor can arise. Normal cells do not possess the ability to invade or metastasize and/or undergo apoptosis (programmed cell death) if such events occur (Ruoslahti, Sci. Amen., 1996, 275, 72). However, many human tumors have elevated levels of activity of one or more matrix metalloproteinases (MMPs) (Stetler-Stevenson et al., Annu. Rev. Cell Biol., 1993, 9, 541; Bernhard et al., Proc. Natl. Acad. Sci. (U.S.A.), 1994, 91, 4293. The MMPs are a family of enzymes which have the ability to degrade components of the extracellular matrix (Birkedal-Hansen, Current Op. Biol., 1995, 7, 728). In particular, one member of this family, matrix metalloproteinase-9 (MMP-9), is often found to be expressed only in tumors and other diseased tissues (Himelstein et al., Invasion & Metastasis, 1994, 14, 246).
Several studies have shown that regulation of the MMP-9 gene may be controlled by the AP-1 transcription factor (Kerr et al., Science, 1988, 242, 1242; Kerr et al., Cell, 1990, 61, 267; Gum et al., J. Biol. Chem., 1996,271, 10672; Hua et al., Cancer Res., 1996,56,5279). Inhibition of AP-1 function has been shown to attenuate MMP-9 expression (U.S. Pat. No. 5,985,558). AP-1 is a heterodimeric protein having two subunits, the gene products of fos and jun. Antisense compounds targeted to c-fos and c-jun are described in Dean et al. U.S. Pat. No. 5,985,558.
Furthermore, AP-1 is itself activated in certain circumstances by phosphorylation of the Jun subunit at an amino-terminal position by Jun N-terminal kinases (JNKs). Thus, inhibition of one or more JNKs is expected to result in decreased AP-1 activity and, consequentially, reduced MMP expression. Antisense compounds targeted to JNKs are described in Dean et al. U.S. Pat. No. 5,877,309.
Infectious diseases of the skin are caused by viral, bacterial or fungal agents. In the case of Lyme disease, the tick home causative agent thereof, the spirochete Borrelia burgdorferi, up-regulates the expression of ICAM-1, VCAM-1 and ELAM-1 on endothelial cells in vitro (Boggemeyer et al., Cell Adhes. Comm., 1994, 2, 145). Furthermore, it has been proposed that the mediation of the disease by the anti-inflammatory agent prednisolone is due in part to mediation of this up-regulation of adhesion molecules (Hurtenbach et al., Int., J. Immunopharmac., 1996, 18, 281). Thus, potential targets for therapeutic mediation (or prevention) of Lyme disease include ICAM-1, VCAM-1 and ELAM-1 (supra).
Other infectious disease of the skin which are tractable to treatment using the compositions and methods of the invention include disorders resulting from infection by bacterial, viral or fungal agents (The Merck Manual of Diagnosis and Therapy, 15th Ed., pp. 2263-2277, Berkow et al., eds., Rahway. N.J., 1987).
With regards to infections of the skin caused by fungal agents, U.S. Pat. No. 5,691,461 provides antisense compounds for inhibiting the growth of Candida albicans.
With regards to infections of the skin caused by viral agents, U.S. Pat. Nos. 5,166,195, 5,523,389 and 5,591,600 provide oligonucleotide inhibitors of Human Immunodeficiency Virus (HIV). U.S. Pat. No. 5,004,810 provides oligomers capable of hybridizing to herpes simplex virus Vmw65 mRNA and inhibiting its replication. U.S. Pat. No. 5,194,428 and 5,580,767 provide antisense compounds having antiviral activity against influenzavirus. U.S. Pat. No. 4,806,463 provides antisense compounds and methods using them to inhibit HTLV III replication. U.S. Pat. Nos. 4,689,320, 5,442,049, 5,591,720 and 5,607,923 are directed to antisense compounds as antiviral agents specific to cytomegalovirus (CMV). U.S. Pat. No. 5,242,906 provides antisense compounds useful in the treatment of latent Epstein-Barr virus (EBV) infections. U.S. Pat. Nos. 5,248,670, 5,514,577 and 5,658,891 provide antisense compounds useful in the treatment of herpesvirus infections. U.S. Pat. Nos. 5,457,189 and 5,681,944 provide antisense compounds useful in the treatment of papillomavirus infections. The antisense compounds disclosed in these patents, which are herein incorporated by reference, may be used with the compositions of the invention to effect prophylactic, palliative or therapeutic relief from diseases caused or exacerbated by the indicated pathogenic agents.
Antisense oligonucleotides employed in the compositions of the present invention may also be used to determine the nature, function and potential relationship of various genetic components of the body to disease or body states in animals. Heretofore, the function of a gene has been chiefly examined by the construction of loss-of-function mutations in the gene (i.e., “knock-out” mutations) in an animal (e.g., a transgenic mouse). Such tasks are difficult, time-consuming and cannot be accomplished for genes essential to animal development since the “knock-out” mutation would produce a lethal phenotype. Moreover, the loss-of-function phenotype cannot be transiently introduced during a particular part of the animal's life cycle or disease state: the “knock-out” mutation is always present. “Antisense knockouts,” that is, the selective modulation of expression of a gene by antisense oligonucleotides, rather than by direct genetic manipulation, overcomes these limitations (see, for example, Albert et al., Trends in Pharmacological Sciences, 1994, 15, 250). In addition, some genes produce a variety of mRNA transcripts as a result of processes such as alternative splicing; a “knock-out” mutation typically removes all forms of mRNA transcripts produced from such genes and thus cannot be used to examine the biological role of a particular mRNA transcript. Antisense oligonucleotides have been systemically administered to rats in order to study the role of the N-methyl-D-aspartame receptor in neuronal death, to mice in order to investigate the biological role of protein kinase C-a, and to rats in order to examine the role of the neuropeptide Y1 receptor in anxiety (Wahlestedt et al., Nature, 1993, 363:260; Dean et al., Proc. Natl. Acad. Sci. U.S.A., 1994, 91:11762; and Wahlestedt et al., Science, 1993, 259:528, respectively). In instances where complex families of related proteins are being investigated. “antisense knockouts” (i.e., inhibition of a gene by systemic administration of antisense oligonucleotides) may represent the most accurate means for examining a specific member of the family (see, generally. Albert et al., Trends Pharmacol. Sci., 1994, 15:250). By providing compositions and methods for the simple non-parenteral delivery of oligonucleotides and other nucleic acids, the present invention overcomes these and other shortcomings.
The administration of therapeutic or pharmaceutical compositions comprising the oligonucleotides of the invention is believed to be within the skill of those in the art. In general, a patient in need of therapy or prophylaxis is administered a composition comprising a compound of the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 μg to 100 g per kg of body weight depending on the age of the patient and the severity of the disorder or disease state being treated. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution or prevention of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual antisense compounds, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models.
In the context of the invention, the term “treatment regimen” is meant to encompass therapeutic, palliative and prophylactic modalities of administration of one or more compositions of the invention. A particular treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease or disorder, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disorder or disease state. The dosage of the composition may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disorder or disease state is observed, or if the disorder or disease state has been ablated.
An optimal dosing schedule is used to deliver a therapeutically effective amount of the oligonucleotide of the invention. The term “therapeutically effective amount,” for the purposes of the invention, refers to the amount of oligonucleotide-containing pharmaceutical composition which is effective to achieve an intended purpose without undesirable side effects (such as toxicity, irritation or allergic response). Although individual needs may vary, determination of optimal ranges for effective amounts of pharmaceutical compositions is within the skill of the art. Human doses can be extrapolated from animal studies (Katocs et al., Chapter 27 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990). Generally, the dosage required to provide an effective amount of a pharmaceutical composition, which can be adjusted by one skilled in the art, will vary depending on the age, health, physical condition, weight, type and extent of the disease or disorder of the recipient, frequency of treatment, the nature of concurrent therapy (if any) and the nature and scope of the desired effect(s) (Nies et al., Chapter 3 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics. 9th Ed., Hardman et al., eds., McGraw-Hill. New York. N.Y., 1996).
Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the bioactive agent is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years. For example, in the case of in individual known or suspected of being prone to an autoimmune or inflammatory condition, prophylactic effects may be achieved by administration of preventative doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every 20 years. In like fashion, an individual may be made less susceptible to an inflammatory condition that is expected to occur as a result of some medical treatment, e.g., graft versus host disease resulting front the transplantation of cells, tissue or an organ into the individual.
Prophylactic modalities for high risk individuals are also encompassed by the invention. As used herein, the term “high risk individual” is meant to refer to an individual for whom it has been determined, via, e.g., individual or family history or genetic testing, that there is a significantly higher than normal probability of being susceptible to the onset or recurrence of a disease or disorder. For example, a subject animal could have a personal and/or family medical history that includes frequent occurrences of a particular disease or disorder. As another example, a subject animal could have had such a susceptibility determined by genetic screening according to techniques known in the art (see, e.g., U.S. Congress, Office of Technology Assessment. Chapter 5 In: Genetic Monitoring and Screening in the Workplace, OTA-BA-455, U.S. Government Printing Office, Washington, D.C., 1990, pages 75-99). As part of a treatment regimen for a high risk individual, the individual can be prophylactically treated to prevent the onset or recurrence of the disease or disorder. The term “prophylactically effective amount” is meant to refer to an amount of a pharmaceutical composition which produces an effect observed as the prevention of the onset or recurrence of a disease or disorder. Prophylactically effective amounts of a pharmaceutical composition are typically determined by the effect they have compared to the effect observed when a second pharmaceutical composition lacking the active agent is administered to a similarly situated individual.
For therapeutic use the oligonucleotide analog is administered to an animal suffering from a disease modulated by some protein. It is preferred to administer to patients suspected of suffering from such a disease an amount of oligonucleotide analog that is effective to reduce the symptomology of that disease. One skilled in the art can determine optimum dosages and treatment schedules for such treatment regimens.
It is preferred that the RNA or DNA portion which is to be modulated be preselected to comprise that portion of DNA or RNA which codes for the protein whose formation or activity is to be modulated. The targeting portion of the composition to be employed is, thus, selected to be complementary to the preselected portion of DNA or RNA, that is to be an antisense oligonucleotide for that portion.
In accordance with one preferred embodiment of this invention, the compounds of the invention hybridize to HIV mRNA encoding the tat protein, or to the TAR region of HIV mRNA. In another preferred embodiment, the compounds mimic the secondary structure of the TAR region of HIV mRNA, and by doing so bind the tat protein. Other preferred compounds complementary sequences for herpes, papilloma and other viruses.
It is generally preferred to administer the therapeutic agents in accordance with this invention internally such as orally, intravenously, or intramuscularly. Other forms of administration, such as transdermally, topically, or intralesionally may also be useful. Inclusion in suppositories may also be useful. Use of pharmacologically acceptable carriers is also preferred for some embodiments.
This invention is also directed to methods for the selective binding of RNA for research and diagnostic purposes. Such selective, strong binding is accomplished by interacting such RNA or DNA with compositions of the invention which are resistant to degradative nucleases and which hybridize more strongly and with greater fidelity than known oligonucleotides or oligonucleotide analogs.
EXAMPLES General
Solvents were dried by distillation:
THF over sodium benzophenone ketyl; acetonitrile and triethylamine over calcium hydride; and pyridine over barium oxide. DBU is distilled under vacuum and then stored over 4 A Linde molecular sieves under argon. PCl, is first degassed by refluxing for 2 h under argon followed by fractional distillation and storage under argon. Water is HPLC grade obtained from Aldrich Chemical Co. Inc.
Example 1 Isomerically Pure R and S Isomers of 4-mercapto-4methyl-2-pentanol
R4-mercapto-4-methyl-2-pentanol and S-4-mercapto-4-methyl-2-pentanol are synthesized according to the procedure of Eliel and Morris-Natschke (Eliel, E. L., Morris-Natschke, S., J.Am.Chem.Soc, 1984, 106, 2937-2942).
Example 2 Rp Precursor, Compound 1
PCl3 (1.3 mL, 15 mmol) is introduced via a syringe into a dry 100-mL round-bottomed flask containing 20 mL of dry THF that has been flushed with argon and sealed with a septum. The flask is cooled to −78° C. in a dry ice/acetone bath, and a solution of (R)-4-mercapto-4-methyl-2-pentanol (15 mmol) in THF (15 mL) containing triethylamine (6.9 mL, 50 mmol) is added via a syringe. The reaction mixture is stirred for 30 min at −78° C. and then warmed to 0° C. for 1 hour. The reaction mixture is partitioned between CH2Cl2 and saturated NaHCO3 and washed with saturated NaCl and dried over anhydrous Na2SO4 to give the title compound.
Example 3 Compound 2
Compound 1 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and Compound 2 is purified by silica gel column chromatography.
Example 4 General Procedure for the Synthesis of Monomers Used for Synthesizing Rp Linkages, Structure 3
To a sample of 2′-deoxy-5′-O-DMT nucleoside (2′-O-deoxy, 5′-O-DMT6-N-benzoyl adenosine, 2′-Q-deoxy, 5′-O-DMT-4-N-benzoyl cytidine. 2′-O-deoxy-5′-O-DMT-2-N-isobutyl guanosine, 2′-O-deoxy-5′-O-DMT thymidine or a modified optionally protected 5-O-DMT-nucleoside) 10 mmol in dry CH2Cl2 at −78° C. is added 20 mL of a 15 mmol solution of 1H-tetrazole (11 mmol), in THF via syringe. The reaction mixture is stirred at −78° C. for 30 min, the cooling bath is removed, and the solution is warmed to room temperature. To this solution is added Compound 2 in THF (11 mmol) dropwise with stirring for 2-4 hours. The sulfurization reagent 3H-1,2-benzodithiole-3-one-1,1-dioxide (2% in CH3CN), (Iyer et al. , J. Am. Chem. Soc, 1990, 112, 1253) is added with stirring for 1 hour. The solvent is evaporated and the nucleoside oxathiane intermediate is purified by silica gel column chromatography to afford the respective monomeric compound having Structure 3.
Example 5 Attachment of Thymidine to Solid Support (5′-HO-T-CPG)
Thymidine was attached to solid support following a literature procedure (Damha et al., Nucleic Acids Res., 1990, 18, 3813-3821). To a dry 6 mL Hypovial was added 5′-O-DMT thymidine (109 mg, 0.2 mmol). CPG with sarcosinyl-succinonyl linker (Brown et al., J. Chem. Soc. Chem. Comm. 1989, 891) (1.0 g), 4-DMAP (12 mg, 0.1 mmol), triethylamine (80 μL), DEC (384 mg. 2.0 mmol), and anhydrous pyridine (5 mL). The mixture was shaken at room temperature for 24 h. Pentachlorophenol (134 mg, 0.5 mmol) was added, and the mixture was shaken for an additional period of 16 h. The CPG was filtered off and washed successively with pyridine, CH2Cl2, and ether. The CPG was treated with reagent grade piperidine (5 mL), and the slurry was shaken for 10 min. The resulting CPG was filtered off, washed successively with CH2Cl2 and ether, and dried under vacuum. The dried CPG was mixed with equal parts of two solutions of 0.5 M acetic anhydride in THF and 0.5 M 4DMAP/2,4,6-trimethylpyridine in THF (4 mL each). The slurry was shaken for 2 hours and washed successively with pyridine, CH2Cl2, THF and ether. The loading amount was measured by′ Trityl Analysis, 37.9 mol/g. Detritylation with 3% trichloroacetic acid in 1,2-dichloroethane afforded the immobilized thymidine.
Example 6 Solid Support Bound T- Rp-T Dimer, Compound 4
To a sintered glass funnel are added 5′-HO-TCPG (27 mg, 1 mol) and a solution of Structure 3, where the base is thymine, in acetonitrile (0.2 mL, 0.1 M) followed by 30 μL of DBU (0.2 mmol) added by syringe. After 15 minutes, the solid support is washed with acetonitrile (3×2 mL), and then Besucage's reagent (0.2 mL, 0.1 M in THF) is added. The solid support on washing with anhydrous CH3CN gives the title dimer.
Example 7 T-Rp-T Dimer, Compound 5
Compound 4 is treated with NH4OH (28%) at 50° C. For 2 h. The solution is evaporated to dryness, and the residue is dissolved in water (1 mL) and filtered. The resulting crude material which has been cleaved from the solid support, is purified and analyzed by HPLC to give Compound 5, a TT dimer having a chiral Rp internucleoside linkage.
Example 8 Compound 6
Compound 6 is prepared following the procedures used to prepare Compound 1, Example 2, S-4-mercapto-4-methyl-2-pentanol (15 mmol) is treated with PCl3 (15 mmol l to give upon purification Compound 6.
Example 9 Compound 7
Compound 6 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stiffed at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and Compound 7 is purified by silica gel column chromatography.
Example 10 Monomers used for Sp Linkages, Structure 8
Compound 7 is reacted with a 5′-O-DMT nucleoside in the presence of tetrazole followed by addition of sulfur (Beaucage reagent) to give the desired oxathiane phosphorous derivative compound 8. This procedure is illustrated for the Rp isomer in Example 4 above. Compound 8 is purified by silica gel column chromatography.
Example 11 Solid Support Bound T Sp-T Dimer, Compound 9
To a sintered glass funnel are added 5′-HO-T-CPG (Example 5) (27 mg, 1 mmol), a solution of compound 8 in acetonitrile (0.2 mL, 0.1 M), and 30 μL of DBU (0.2 mmol, via syringe). After 15 minutes, the solid support is washed with acetonitrile (3×2 mL), and then Beaucage's reagent (0.2 mL, 0.1M in THF) is added. The solid support on standing for 10 minutes followed by washing with anhydrous CH3CN gives the title dimer.
Example 12 T-Sp-T Dimer, Compound 10
Compound 9 is treated with NH4OH (28%) at 50° C. for 2 h. The solution is evaporated to dryness, and the residue is dissolved in water (1 mL) and filtered. Compound 10 is purified and analyzed using HPLC. The four membered thiane formation facilitates the formation of the product (Compound 10).
Example 13 5-methyl-2-(1-methyl-1-thioethyl) Cyclohexanol, Compound 11
Compound 11, is obtained from (+)-pulegone, readily available in enantiomerically pure form following a literature procedure (Lynch et al., Tetrahedron Lett., 1981, 22, 2855-2888 and Lynch et al., J. Am. Chem. Soc., 1984, 106, 2943-2948).
Example 14 Compound 12
Compound 11 and phosphorous trichloride are added in equimolar proportions to CH2Cl2, containing two equivalents of pyridine at −78. After stirring for 1 hour, pyridinium hydrochloride is filtered off, and the solution is concentrated and purified to give Compound 12.
Example 15 Compound 13
Compound 12 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration and Compound 13 is purified by silica gel column chromatography.
Example 16 Chiral Monomers Used for Rp Linkages, Structure 14
To a selected 2′-deoxy-5-O-DMT nucleoside (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine. 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine. 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or modified optionally protected 5-O-DMT-nucleoside) 10 mmol in dry CH2Cl2, is added 1H tetrazole (11 mmol). Compound 13 (11 mmol) is added dropwise with stirring for 2-4 hours. The resulting intermediate is oxidized with Beaucage reagent as described above for Compound 3. The nucleoside oxathiane intermediate is purified by silica gel column chromatography,
Example 17 General Procedure for Preparing Chiral Dimers Having Structure 15
Compound 14 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 15 as described above for Compound 4. Dimers having Structure 15 are treated as per the procedure of Example 7 to cleave the dimer from the CPG and to deblock the phosphorus thereby giving the free deblocked dimer having Structure 15a.
Example 18 Compound 16
Starting from (−)-pulegone, commercially available from Fluka, the isomer of (−)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol is obtained following literature procedures (Lynch ibid). The compound (−)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol is treated with PCl3 in CH2Cl2 containing two equivalents of pyridine at −78° C. After stirring for 1 hour, pyridinium hydrochloride is filtered off, and the solution is concentrated and purified to give Compound 16.
Example 19 Compound 17
Compound 16 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and Compound 17 is purified by silica gel column chromatography.
Example 20 Synthesis of Monomers Having Structure 18
To a selected 2′-deoxy-5-O-DMT-nucleoside (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT thymidine or modified optionally protected 5-O-DMT-nucleoside) 10 mmol in dry CH2Cl2 is added 1H tetrazole (11 mmol) followed by dropwise addition of Compound 17 (11 mmol) and stirring for 2-4 hours. The sulfurization reagent 3H-1, 2-benzodithiole-3-one-1,1-dioxide (2% in CH3CN, Iyer ibid), is added and stirred for 1 hour. Solvent is evaporated and the crude material is purified by silica gel column chromatography to give Compound 18.
Example 21 General Procedure for Preparing Sp Diners Using Compound 18
Compound 18 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 18 as described above for Compound 4. Diners prepared from Compound 18 are cleaved from the CPG and deblocked thereby giving the free deblocked Sp chiral dimer.
Example 22 5c-Methyl-2t [(1-methyl-1-methylamino) Ethyl]-cyclohexan-1r-ol
The title compound is synthesized according to a literature procedure using (+)-pulegone (He et al., J. Org. Chem., 1990, 55, 2114-2119) by first preparing 5c-Methyl-2t [(1-methyl-1-benzylamino) ethyl]-cyclohexan-1r-ol. This compound is subjected to hydrogenolysis by Pd/H2 to give the corresponding amino alcohol (removal of benzyl group). The amino alcohol is then treated with 1 equivalent of HCHO followed by NaCNBH3 reduction to give the title Compound.
Example 23 Compound 20
Compound 19 and phosphorous trichloride are added in equimolar proportions to CH2Cl2 containing two equivalents of pyridine at −78° C. After stirring for 1 hour, pyridinium hydrochloride is filtered off, and the solution is concentrated and purified to give a chloro-intermediate compound. The chloro-intermediate compound in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and the morpholino compound is purified by silica gel column chromatography.
To a selected 2′-deoxy-5-O-DMT-nucleoside (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or modified optionally protected 5-O-DMT-nucleoside) 10 mmol in dry CH2Cl2 is added 1H tetrazole (11 mmol) followed by dropwise addition of the morpholino compound (11 mmol) and stirring for 2-4 hours. The sulfurization reagent 3H-1,2-benzodithiole-3-one-1,1-dioxide (2% in CH3CN, Iyer ibid), is added and stirred for 1 hour. Solvent is evaporated and the nucleoside oxathiane intermediate Compound 20 is purified by silica gel column chromatography.
Example 24 Compound 21
Compound 20 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 21 as described above for Compound 4. A capping step is added to cap the free amine formed.
Example 25 Generation of Rp Diner 21a From Compound 21
Compound 21 is treated with concentrated ammonium hydroxide for 16 hours to give the cleaved deblocked dimer as the Rp isomer and the chiral adjuvant derived products 22 and 23.
Example 26 Compound 24
From the naturally occuring (−)-pulegone (available from Fluka), compound 24 is obtained as a Chiral Adjuvant following a literature procedure (He et al., Tetrahedron, 1987, 43, 4979-4987). Following the procedures illustrated for compound 19, compound 24 is obtained.
Example 27 Monomer, Compound 20
Compound 19 is treated with PCl3 (1 equivalent) with excess of Hunig base in THF solvent at −5° C. for 10 minutes. The resulting chloro compound is treated with a selected 2′-deoxy-5-O-DMT-nucleoside having a free 31-OH group (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT thymidine or modified optionally protected 5-O-DMT-nucleoside). TLC and 13C NMR analysis is used to reveal the formation of a single diastereomer. The crude material is washed with saturated sodium bicarbonate and dried over anhydrous sodium sulfate. The resulting material is purified either by crystallization or by silica gel column chromatography.
Example 28 Protected Dimer. Compound 21
Purified compound 20 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside (such as 2′-O-deoxy-6-N-benzoyl adenosine, 2′-O-deoxy-4-N-benzoyl cytidine, 2′-O-deoxy-2-N-isobutyryl guanosine or other modified optionally protected 5′-OH′-3′-CPG-nucleoside), for 2 hours using tetrazole as the coupling agent. The resultant free amine is capped with acetic anhydride, and the dimer is oxidized with Beaucage reagent to give Compound 21. Compound 21 is cleaved from the solid support and deprotected by treatment with concentrated ammonium hydroxide (30%, 12 hours). The chiral auxiliary is removed as compound 22 or 23 and the oligomer is purified by HPLC. The nucleoside dimer is treated with 80% aqueous acetic acid to remove the 5′-triyl group. The Rp configuration is assigned as described below in the procedures.
Example 29 Sp Dimer, Compound 25
Compound 25 is synthesized from compound 24 as described for compound 20. Compound 25 on coupling with nucleoside-CPG and purification as previously described for the Rp isomer gives the Sp isomer.
Example 30 Synthesis of Chirally Pure 5′-TSpTRpTRpTRpTRpTSpT-3′ Phosphorothioate Heptamer
50 milligram (2 μmole of 5′-O-dimethoxytritylthymidine bound to CPG (controlled pore glass) through an ester linkage is taken up in a glass reactor, and a toluene solution of 39% dichloroacetic acid (v/v) is added to deprotect the 5′-hydroxyl group. The product is washed with acetonitrile and a 0.2 M solution of Compound 8 (B═T) in acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (200 fold excess) is added and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile followed by the addition of a 0.2 M solution of Beaucage reagent in acetonitrile with reaction allowed to progress at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile, and then a solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added to cap any unreacted 5′-hydroxyl groups. The product is washed with acetonitrile.
In the next cycle Compound 3 (B═T) is used as the incoming monomer and the cycle is repeated. This complete cycle is repeated four more times to introduce the Rp linkages. In the final cycle Compound 8 is used as the incoming monomer which introduces the terminal Sp linkage. The solid support containing the heptamer is treated with 30% aqueous ammonium hydroxide solution for 90 minutes at room temperature. The aqueous solution is filtered, and concentrated under reduced pressure to give the chirally pure phosphorothioate heptamer.
Example 31 Synthesis of Chirally Pure 5′-d(GSpARpCSpT)-3′ Phosphorothioate Tetramer
50 milligram (2 μmole) of 5′-O-dimethoxytritylthymidine bound to CPG (controlled pore glass) through an ester linkage is taken up in a glass reactor, and a toluene solution of 3% dichloroacetic acid in toluene (volume/volume) is added to deprotect the 5′-hydroxyl group. The product is washed with acetonitrile, a 0.2 M solution of Compound 8 with B═dCBz in acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (200 fold excess) are added, and allowed to react at room temperature for 15 20 minutes. The product is washed with acetonitrile and a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile, and then a solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added to cap any unreacted 5′-hydroxyl groups followed by washing with acetonitrile.
In the next cycle Compound 3 (B═dABz) is used as the incoming monomer and the cycle is repeated. Thus, a 0.2 30 M solution of Compound 3 with B═dABz in acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (200 fold excess) is added and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile and a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile, a solution of acetic anhydride/lutidine/THF (11:8) and a solution of N-methyl imidazole/THF are aided to cap any unreacted 5′-hydroxyl groups. The product is washed with acetonitrile. A solution of 3% dichloroacetic acid in toluene (v/v) is added to deprotect the 5′-hydroxyl groups and the product is washed with acetonitrile.
Compound 8 (0.2 M solution) with B═dGiBu in acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (200 fold excess) are added and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile, and then a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile and then a solution of acetic anhydride/lutidine/THF (1:1:8) and a solution of N-methyl imidazole/THF are added to cap any unreacted 5′-hydroxyl groups. The product is washed with acetonitrile.
The desired tetamer is deblocked and cleaved from the solid support by treatment with a 30% aqueous solution of ammonium hydroxide for 90 minutes at room temperature followed by heating to 55° C. for 12 hours. The aqueous solution is filtered and concentrated under reduced pressure to give the title phosphorothioate tetramer of 5′-dGSp-dARpdCSpT-3′.
Example 32 Oligonucleotide Synthesis: General Procedures
The oligonucleotides listed in Table 1 are synthesized by following the procedures described above. For generating chirally mixed (Rp and Sp) sites, commercial amidites (Perseptive Biosystems) are used and standard synthesis conditions are used.
For introducing Rp linkages with appropriate nucleobases monomers 3, 14 or 20 are used.
For introducing Sp linkages with appropriate nucleobases monomers 8, 18 or 25 are used.
The solid support employed is controlled pore glass CPG with sarcosinyl-succinonyl linker (Brown et al., J. Chem. Soc. Chem. Comm., 1989, 891).
The sulfurization reagent employed is 3H-1,2-benzodithiole-3-one-1.1-dioxide (2% in CH3CN, Iyer ibid).
A solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added mixture to cap any unreacted 5′-hydroxyl group.
The preferred reagents have been listed above for the synthesis of chirally pure oligonucleotides. Those skilled in the art will realize that many other reagents and materials are equally amenable to the present invention and that this list is not exclusive.
TABLE I
Compound Sequence ISIS #/Target
I GCCCAAGCTG GCATCCGTCA (ISIS-2302)/Human ICAM-1
II GSpCCCAAGCTG GCATCCGTC5#A
III GSpCRpCRpCRpARpARpGRpCRpTRpGRpGRpCRpARpTRpCRpCRpGRpTRpCSpA
IV TCCGTCATCGCTCCTCAGGG (ISIS-2503)/Human H-ras
V TSpCCGTCATCGCTCCTCAGGSpG
VI TSpCRpCRpGRpTRpCRpARpTRpCRpGRpCRpTRpCRpCRpTRpCRpARpGRpGSpG
VII GTTCTCGCTGGTGAGTTTCA (ISIS-3521)/Human PKC-α
VIII GSpTTCTCGCTGGTGAGTTTCSpA
IX GSpTRpTRpCRpTRpCRpGRpCRpTRpGRpGRpTRpGRpARpGRpTRpTRpTRpCSpA
X TCCCGCCTGTGACATGCATT (ISIS-5312)/Human C-raf
XI TSpCCCGCCTGTGACATGCATSpT
XII TSpCRpCRpCRpGRpCRpCRpTRpGRpTRpGRpARpCRpARpTRpGRpCRpARpCSpT
XIII GTGCTCATGGTGCACGGTCT (ISIS-14803)/Human HCV
XIV GSpTGCTCATGGTGCACGGTCSpT
XV GSpTRpGRpCRpTRpCRpARpTRpGRpGRpTRpGRpCRpARpCRpGRpGRpTRpCSpT
XVI TGCATCCCCCAGGCCACCAT (ISIS-3082)/Murine
ICAM-1
XVII TSpGCATCCCCCAGGCCACCASpT
XVIII TSpGRpCRpARpTRpCRpCRpCRpCRpCRpARpGRpGRpCRpCRpARpCRpCRpASpT
TABLE II
SEQ
ID
NO: Oligo # Sequence ISIS #
1 I GCCCAAGCTG GCATCCGTCA (ISIS-2302)
2 IV TCCGTCATCG CTCCTCAGGG (ISIS-2503)
3 VII GTTCTCGCTG GTGAGTTTCA (ISIS-3521)
4 X TCCCGCCTGT GACATGCATT (ISIS-5312)
5 XIII GTGCTCATGG TGCACGGTCT (ISIS-14803).
Example 33 General Procedure for Oligonucleotide Purification
After the final monomer or blockmer has been added the solid support bound oligonucleotide is deprotected (trityl on) in 1-5 mL 28.0-30% ammonium hydroxide NH4OH for approximately 16 hours at 55° C. (small scale). For larger scale synthesis of oligonucleotides (20 μmol/synthesis) 20 mL of 28.0-30% ammonium hydroxide is used. In general, oligonucleotides are cleaved and deprotected in 5-20 mL 28.0-30% NH4OH at 55° C. for approximately 16 hours.
Following cleavage and deprotection the crude oligonucleotides are filtered from CPG using Gelman 0.45 μm nylon acrodisc syringe filters. Excess NH4OH is evaporated away in a Savant AS160 automatic speed vac. The crude yield is measured on a Hewlett Packard 8452A Diode Array Spectrophotometer at 260 nm. Crude samples are then analyzed by mass spectrometry (MS) on a Hewlett Packard electrospray mass spectrometer and by capillary gel electrophoresis (CGE) on a Beckmann P/ACE system 5000. Trityl-on oligonucleotides are purified by reverse phase preparative high performance liquid chromatography (HPLC). HPLC conditions are as follows: Waters 600E with 991 detector; Waters Delta Pak C4 column (7.8×300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100% acetonitrile; 2.5 mL/min flow rate; Gradient: 5% B for first five minutes with linear increase in B to 60% during the next 55 minutes. Larger oligo yields from the larger 20 μmol syntheses are purified on larger HPLC columns (Waters Bondapak HC18HA) and the flow rate is increased to 5.0 mL/min Appropriate fractions are collected and solvent is removed via speed vac. Oligonucleotides are detritylated in 80% acetic acid for approximately 45 minutes and lyophilized again. Free trityl and excess salt are removed by passing detritylated oligonucleotides through Sephadex G-25 (size exclusion chromatography) and collecting appropriate samples with a Pharmacia fraction collector. Concentration of selected fractions gives the purified oligonucleotides which are analyzed for purity by CGE, HPLC (flow rate: 1.5 mL/min Waters Delta Pak C4 column, 3.9×300 mm), and MS. The final yield is determined by spectrophotometer at 260 nm.
Procedure 1 Determination of Configuration of Chiral Thioates
The Rp and Sp configuration of chiral thioates are determined according to the reported procedure (Slim, G., Gait, M. J., Nucleic Acids Res., 1991 19, 1183-1188). The Rp isomer elutes in reverse phase column in HPLC as the “fast eluent. (Fraction I)” It is resistant to P1 nuclease but hydrolyzed by snake venom phosphodiesterase. On the other hand, the Sp isomer elutes in HPLC reverse phase column as the “slow” eluent (Fraction II). This stereochemistry gives protection from snake venom phosphodiesterase (SVPD), but this isomer gets hydrolyzed by PI nuclease.
Digestion by Snake Venom Phosphodiesterase
An aliquot (2 OD)of each P═S oligonucleotide dimer (both earlier and later eluting peaks by reversed-phase) HPLC is treated for 8 hours at 37° C. with snake venom phosphodiesterase (0.1 μg. Boehringer) and calf alkaline phosphatase (6.0 μg, Boehringer) in 0.1 M Tris. HCl (pH 8.5). 0.3 mM dithiothreotol (DTT), 0.3 mM MgCl2 in a reaction volume of 150 μL. The products are analyzed by reverse phase HPLC. The Rp isomer (the earlier eluting peak) is hydrolyzed while the Sp isomer remains intact.
Digestion by Nuclease P1
An aliquot of each P═S oligonucleotide dimer (2 ODs) is digested with nuclease P1 (2.0 μg, Boehringer) in distilled water (120 μL) for 1 hour at 37° C. The solution is buffered with 16 μL. 0.1 M Tris HCl (pH 8.5) and digested with calf alkaline phosphatase (6.0 μg, Boehringer) for 1 hour at 37° C. The product is analyzed by reverse phase HPLC. In this case, the Sp isomer is degraded while the Rp isomer is resistant to nuclease.
Procedure 2 Evaluation of In Vivo Stability of Chimeric Chiral Oligonucleotides Mouse Experiment Procedures
For each oligonucleotide tested 9 male BALE/c mice (Charles River, Wilmington, Mass.), weighing about 25 g are used (Crooke et al., J. Pharmacol. Exp. Ther, 1996, 277, 923). Following a 1-week acclimation, mice receive a single tail vein injection of oligonucleotide (5 mg/kg) administered in phosphate buffered saline (PBS), pH 7.0 One retro-orbital bleed (either 0.25. 0.5, 2 or 4 lv post dose) and a terminal bleed (either 1, 3, 8 or 24 h post dose) are collected from each group. The terminal bleed (approximately 0.6-0.8 ml) is collected by cardiac: puncture following ketamine/xylazine anesthesia. The blood is transferred to an EDTA-coated collection tube and centrifuged to obtain plasma. At termination, the liver and kidneys are collected from each mouse. Plasma and tissues homogenates are used for analysis for determination of intact oligonucleotide content by CGE. All samples are immediately frozen on dry ice after collection and stored at −80° C. until analysis.
Evaluation of In Vivo Stability of Chimeric Chiral Oligonucleotides
SEQ ID NO: 5 was used in a comparative study to determine the effect of chiral internucleotide linkages at predetermined positions compared to the same sequence having racemic linkages at each position. The capillary gel electrophoretic analysis indicated the relative nuclease resistance of Chiral 3′-Sp-capped oligomers compared to ISIS 3082 (XVI, uniform 2′-deoxy phosphorothioate). Because of the resistance of Sp linkage to nucleases, Compounds XVII and XVIII are found to be stable in plasma, kidney and liver while XVI (3082) is not. On the other hand, the data from 5′,-3′-bis Sp capped oligomers show total exonucleolytic stability in plasma as well as in tissues (liver and kidney). Compounds are stable at various time points such as 1. 3, and 24 hours. The fact that no degradation is detected proved that 5′-exonucleases and 3′-exonuclease are prevalent in tissues and endonucleases are not active. Furthermore, a single Chiral linkage (Sp thioate linkage) is sufficient as a gatekeeper against nucleases at the termini.
Procedure 3 RNase H Studies With Chimeric Rp and Sp Modified Oligonucleotides 32P Labeling of Oligonucleotides
The oligoribonucleotide (sense strand) is Y-end labeled with 32P using [32P]ATP, T4 polynucleotide kinase, and standard procedures (Ausubel et al., Current Protocols in Molecular Biology, John Wiley, New York (1989)). The labeled RNA is purified by electrophoresis on 12% denaturing PAGE (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. Plainview (1989)). The specific activity of the labeled oligonucleotide is approximately 6000 cpm/fmol.
Determination of RNase H Cleavage Patterns
Hybridization reactions were prepared in 120 μL of reaction buffer [20 mM Tris-HCl (pH 7.5), 20 mM KCl. 10 mM MgCl2, 0.1 mM DTT] containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm 32P-labeled sense oligoribonucleotide. Reactions were heated at 90° C. for 5 minutes and 1 unit of Inhibit-ACE is added. Samples were incubated overnight at 37° C. degrees. Hybridization reactions were incubated at 37° C. with 1.5×10.8−8 mg of E. coli RNase H enzyme for initial rate determinations and then quenched at specific time points. Samples were analyzed by trichloroacetic acid (TCA) assay or by denaturing polyacrylamide gel electro-phoresis as previously described [Crooke, S. T, Lemonidis, K. M., Neilson, L., Griffey, R., Lesnik. E. A., and Moria, B. P., Kinetic characteristics of Escherichia coli RNase H1; cleavage of various antisense oligonucleotide-RNA duplexes. Biochem J, 312, 599 (1995); Lima. W. F, and Crooke. S. T., Biochemistry 36, 390-398, 1997]. In these assays chirally pure Compounds of the type Sp-(Rp)n-Sp showed better Rnase H cleavage activity than diasteromeric mixture Compounds.
Hybridization reactions were prepared in 120 μL, of reaction buffer [20 mM Tris-HC (pH 7.5), 20 mM KCl, 10 mM MgCl2, 0.1 mM DTT] containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm 32P-labeled sense oligoribonucleotide. Reactions were heated at 90° C. for 5 min and 1 unit of Inhibit-ACE is added. Samples were incubated overnight at 37° C. degrees. Hybridization reactions were incubated at 37° C. with 1.5×10.8−8 mg of E. coli RNase H enzyme for initial rate determinations and then quenched at specific time points. Samples were analyzed by trichloroacetic acid (TCA) assay or by denaturing polyacrylamide gel electrophoresis as previously described (Crooke et al., Biochem J., 1995, 312, 599; Lima, W. F, and Crooke, S. T., Biochemistry, 1997, 36, 390-398).
Procedure 4 Control of H-ras Gene Expression With Chirally Defined Phosphorothioate Oligomers
H-ras targeted antisense oligonucleotides were tested for the ability to specifically reduce H-ras mRNA in T-24 cells (ATCC. Manassas, Va.). T-24 cells were routinely maintained in complete growth media. DMEM supplemented with 10% fetal calf serum and 100 units per milliliter penicillin and 100 micrograms per milliliter streptomycin (Lifetechnologies, Grand Island, N.Y.) in a humidified incubator at 37° C. For antisense experiments T-24 cells were plated in 6-well plates (Becton Dickinson Labware, Franklin Lakes, NJ.) at a density of 2×105 cells per well in complete growth medium and incubated as above. Twenty-four hours after plating the growth media is aspirated and the monolayer is washed once with serum free media (Optimem. Lifetechnologies, Grand Island. N.Y.). Oligonucleotides were formulated in serum free Optimem and Lipofectin (Lifetechnologies, Grand Island, N.Y) at a constant ratio of 3 micrograms per milliliter Lipofectin per 100 nanomolar oligonucleotide. For oligonucleotide treatment two milliliters of formulated oligonucleotide is added to each well and the cells were incubated for four hours at 37° C. Following incubation the formulated oligonucleotide is aspirated from the monolayer, replaced with growth media, and incubated overnight. Twenty-four hours after treatment total RNA is prepared using RNAzol (TEL-TEST, Inc., Friendswood, Tex.) following manufactures protocol. RNA is fractionated through 1.2% agarose-formaldehyde gels and transferred to nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) following standard protocols (Sambrook et al. Molecular Cloning a Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989). Nylon membranes were probed for H-ras (Oncogene Research Products, Cambridge, Mass.) using standard 32P random priming labeling and hybridization protocols (Sambrook et al. Molecular Cloning a Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989). Following hybridization membranes were imaged using a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.) and the images quantified using Image Quant 5.0 software (Molecular Dynamics, Sunnyvale, Calif.). Following image analysis membranes were striped of H-ras probe and reprobed for G3PDH (Clonetech, Palo Alto, Calif.) and analyzed as above. H-ras signal is normalized to G3PDH. The mean normalized percent control of triplicates and standard deviation for H-ras signal is calculated. Using this procedure Compounds IV, V and VI are tested. Compounds V and VI show faster efficient reduction of H-ras messages.
Procedure 5 Determination of ICAM-1 Expression Oligonucleotide Treatment of HUVECs
Cells were washed three times with Opti-MEM (Lift Technologies, Inc.) prewarmed to 37° C. Oligonucleotide were premixed with 10 g/mL Lipofectin (Life Technologies Inc.) in Opti-MEM, serially diluted to the desired concentrations, and applied to washed cells. Basal and untreated (no oligonucleotide) control cells were also treated with Lipofectin. Cells were incubated for 4 hours at 37° C., at which time the medium is removed and replaced with standard growth medium with or without 5 mg/mL TNF-α (R & D Systems). Incubation at 37° C. is continued until the indicated times.
Quantitation of ICAM-1 Protein Expression by Fluorescence-activated Cell Sorter
Cells were removed from plate surfaces by brief trypsinization with 0.25% trypsin in PBS. Trypsin activity is quenched with a solution of 2% bovine serum albumin and 0.2% sodium azide in PBS (+Mg/Ca). Cells were pelleted by centrifugation (1000 rpm. Beckman GPR centrifuge), resuspended in PBS. and stained with 3 1/105 cells of the ICAM-1 specific antibody. CD54-PE (Pharmingin). Antibodies were incubated with the cells for 30 min at 4C in the dark, under gently agitation. Cells were washed by centrifugation procedures and then resuspended in 0.3 ml of FacsFlow buffer (Becton Dickinson) with 0.5% formaldehyde (Polysciences). Expression of cell surface ICAM-1 is then determined by flow cytometry using a Becton Dickinson FACScan. Percentage of the control ICAM-1 expression is calculated as follows: [(oligonucleotide-treated ICAM-1 value)—(basal ICAM-1 value)/(non-treated ICAM-1 value)—(basal ICAM-1 value)]. (Baker et al., The Journal of Biological Chemistry, 1997, 272, 11994-12000).
When ICAM-1 expression is tested with oligomers I. II and III, it is observed that the ICAM-1 expression data reveal that the oligomers II and III are more efficacious than oligomer I in HUVEC cells. The oligomers are presumably working by a improved nuclease resistance in case of oligomer II and enhanced RNaseH activity and improved nuclease resistance in the case of oligomer III.
Procedure 6 5-Lipoxygenase Analysis and Assays
A. Therapeutics For therapeutic use, an animal suspected of having a disease characterized by excessive or abnormal supply of 5-lipoxygenase is treated by administering the macromolecule of the invention. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Such treatment is generally continued until either a cure is effected or a diminution in the diseased state is achieved. Long term treatment is likely for some diseases.
B. Research Reagents The oligonucleotides of this invention will also be useful as research reagents when used to cleave or otherwise modulate 5-lipoxygenase mRNA in crude cell lysates or in partially purified or wholly purified RNA preparations. This application of the invention is accomplished for example, by lysing cells by standard methods, optimally extracting the RNA and then treating it with a composition at concentrations ranging, for instance, from about 100 to about 500 ng per 10 Mg of total RNA in a buffer consisting, for example, of 50 mm phosphate, pH ranging from about 4-10 at a temperature from about 30° to about 50° C. The cleaved 5-lipoxygenase RNA can be analyzed by agarose gel electrophoresis and hybridization with radiolabeled DNA probes or by other standard methods.
C. Diagnostics The oligonucleotides of the invention will also be useful in diagnostic applications, particularly for the determination of the expression of specific mRNA species in various tissues or the expression of abnormal or mutant RNA species. In this example, while the macromolecules target a abnormal mRNA by being designed complementary to the abnormal sequence, they would not hybridize to normal mRNA.
Tissue samples can be homogenized, and RNA extracted by standard methods. The crude homogenate or extract can be treated for example to effect cleavage of the target RNA. The product can then be hybridized to a solid support which contains a bound oligonucleotide complementary to a region on the 5′ side of the cleavage site. Both the normal and abnormal 5′ region of the mRNA would bind to the solid support. The 3′ region of the abnormal RNA, which is cleaved, would not be bound to the support and therefore would be separated from the normal mRNA.
Targeted mRNA species for modulation relates to 5-lipoxygenase: however, persons of ordinary skill in the art will appreciate that the present invention is not so limited and it is generally applicable. The inhibition or modulation of production of the enzyme 5-lipoxygenase is expected to have significant therapeutic benefits in the treatment of disease. In order to assess the effectiveness of the compositions, an assay or series of assays is required.
D. In Vitro Assays The cellular assays for 5-lipoxygenase preferably use the human promyelocytic leukemia cell line HL-60. These cells can be induced to differentiate into either a monocyte like cell or neutrophil like cell by various known agents. Treatment of the cells with 1.3% dimethyl sulfoxide, DMSO, is known to promote differentiation of the cells into neutrophils. It has now been found that basal HL-60 cells do not synthesize detectable levels of 5-6-lipoxygenase protein or secrete leukotrienes (a downstream product of 5-lipoxygenase). Differentiation of the cells with DMSO causes an appearance of 5-lipoxygenase protein and leukotriene biosynthesis 48 hours after addition of DMSO. Thus induction of 5-lipoxygenase protein synthesis can be utilized as a test system for analysis of oligonucleotides which interfere with 5-lipoxygenase synthesis in these cells.
A second test system for oligonucleotides makes use of the fact that 5-lipoxygenase is a “suicide” enzyme in that it inactivates itself upon reacting with substrate. Treatment of differentiated HL-60 or other cells expressing 5 lipoxygenase, with 10 μM A23187, a calcium ionophore, promotes translocation of 5-lipoxygenase from the cytosol to the membrane with subsequent activation of the enzyme. Following activation and several rounds of catalysis, the enzyme becomes catalytically inactive. Thus, treatment of the cells with calcium ionophore inactivates endogenous 5-lipoxygenase. It takes the cells approximately 24 hours to recover from A23187 treatment as measured by their ability to synthesize leukotriene B4. Macromolecules directed against 5-lipoxygenase can be tested for activity in two HL-60 model systems using the following quantitative assays. The assays are described from the most direct measurement of inhibition of 5-lipoxygenase protein synthesis in intact cells to more downstream events such as measurement of 5-lipoxygenase activity in intact cells.
A direct effect which oligonucleotides can exert on intact cells and which can be easily be quantitated is specific inhibition of 5-lipoxygenase protein synthesis. To perform this technique, cells can be labeled with 35S-methionine (50 μCi/mL) for 2 hours at 37° C. to label newly synthesizes protein. Cells are extracted to solubilize total cellular proteins and 5-lipoxygenase is immunoprecipitated with 5-lipoxygenase antibody .followed by elution from protein A Sepharose beads. The immunoprecipitated proteins an resolved by SDS-polyacrylamide gel electrophoresis and exposed for autoradiography. The amount of immunoprecipitated 5-lipoxygenase is quantitated by scanning densitometry.
A predicted result from these experiments would be a follows. The amount of 5-lipoxygenase protein immunoprecipitated from control cells would be normalized to 100% Treatment of the cells with 1 μM, 10 μM, and 30 μM of the macromolecules of the invention for 48 hours would reduce immunoprecipitated 5-lipoxygenase by 5%, 25% and 75% of control, respectively.
Measurement of 5-lipoxygenase enzyme activity in cellular homogenates could also be used to quantitate the amount of enzyme present which is capable of synthesizing leukotrienes. A radiometric assay has now been developed for quantitating 5-lipoxygenase enzyme activity in cell homogenates using reverse phase HPLC. Cells are broken by sonication in a buffer containing protease inhibitors and EDTA. The cell homogenate is centrifuged at 10.000×g for 30 min and the supernatants analyzed for 5-lipoxygenase activity. Cytosolic proteins are incubated with 10 μM 14C-arachidonic acid, 2 mM ATP 50 μM free calcium, 100 μg/mL phosphatidylcholine, and 50 mM bis-Tris buffer, pH 7.0, for 5 min at 37° C. The reactions are quenched by the addition of an equal volume of acetone and the fatty acids extracted with ethyl acetate. The substrate and reaction products are separated by reverse phase HPLC on a Novapak C18 column (Waters Inc., Millford, Mass.). Radioactive peaks are detected by a Beckman model 171 radiochromatography detector. The amount of arachidonic acid converted into di-HETE's and mono-HETE's is used as a measure of 5-lipoxygenase activity.
A predicted result for treatment of DMSO differentiated HL-60 cells for 72 hours with effective the macromolecules of the invention at 1 μM, 10 μM, and 30 μM, would be as follows. Control cells oxidize 200 pmol arachidonic acid/5 min/106 cells. Cells treated with 1 μM, 10 μM, and 30 μM of an effective oligonucleotide would oxidize 195 pmol, 140 pmol, and 60 pmol of arachidonic acid/5 min/106 cells respectively.
A quantitative competitive enzyme linked immunosorbant assay (ELISA) for the measurement of total 5-lipoxygenase protein in cells has been developed. Human 5-lipoxygenase expressed in E. coli and purified by extraction. Q-Sepharose, hydroxyapatite, and reverse phase HPLC is used as a standard and as the primary antigen to coat microtiter plates. 25 ng of purified 5-lipoxygenase is bound to the microtiter plates overnight at 4° C. The wells are blocked for 90 min with 5% goat serum diluted in 20 mM Tris.HCL buffer, pH 7.4, in the presence of 150 mM NaCl (TBS). Cell extracts (0.2% Triton X-100, 12,000×g for 30 min.) or purified 5-lipoxygenase were incubated with a 1:4000 dilution of 5-lipoxygenase polyclonal antibody in a total volume of 100 μL in the microtiter wells for 90 min. The antibodies are prepared by immunizing rabbits with purified human recombinant 5-lipoxygenase. The wells are washed with TBS containing 0.05% tween 20 (TBST), then incubated with 100 μL, of a 1:1000 dilution of peroxidase conjugated goat anti-rabbit IgG (Cappel Laboratories, Malvern, Pa.) for 60 min at 25° C. The wells are washed with TBST and the amount of peroxidase labeled second antibody determined by development with tetramethylbenzidine.
Predicted results from such an assay using a 30 mer oligonucleotide at 1 μM, 10 μM, and 30 μM, would be 30 ng, 18 ng and 5 ng of 5-lipoxygenase per 106 cells, respectively with untreated cells containing about 34 ng 5-lipoxygenase.
A net effect of inhibition of 5-lipoxygenase biosynthesis is a diminution in the quantities of leukotrienes released from stimulated cells. DMSO-differentiated HL-60 cells release leukotriene B4 upon stimulation with the calcium ionophore A23187. Leukotriene B4 released into the cell medium can be quantitated by radioimmunoassay using commercially available diagnostic kits (New England Nuclear, Boston, Mass.). Leukotriene B4 production can be detected in HL-60 cells 48 hours following addition of DMSO to differentiate the cells into a neutrophil-like cell. Cells (2×105 cells/mL) will he treated with increasing concentrations of the macromolecule for 48-72 hours in the presence of 1.3% DMSO. The cells are washed and resuspended at a concentration of 2×106 cell/mL in Dulbecco's phosphate buffered saline containing 1% delipidated bovine serum albumin. Cells are stimulated with 10 μM, calcium ionophore A23187 for 15 min and the quantity of LTB4 produced from 5×105 cell determined by radioimmunoassay as described by the manufacturer.
Using this assay the following results would likely be obtained with an oligonucleotide directed to the 5-LO mRNA. Cells will be treated for 72 hours with either 1 μM. 10 μM, or 30 μM, of the macromolecule in the presence of 1.3% DMSO. The quantity of LTB4 produced from 5×105 cells would be expected to be about 75 μg, 50 μg, and 35 μg, respectively with untreated differentiated cells producing 75 pg LTB4.
E. In Vivo Assay Inhibition of the production of 5-lipoxygenase in the mouse can be demonstrated in accordance with the following protocol. Topical application of arachidonic acid results in the rapid production of leukotriene B4, leukotriene C4 and prostaglandin E2 in the skin followed by edema and cellular infiltration. Certain inhibitors of 5-lipoxygenase have been known to exhibit activity in this assay. For the assay, 2 mg of arachidonic acid is applied to a mouse ear with the contralateral ear serving as a control. The polymorphonuclear cell infiltrate is assayed by myeloperoxidase activity in homogenates taken from a biopsy 1 hour following the administration of arachidonic acid. The edematous response is quantitated by measurement of ear thickness and wet weight of a punch biopsy. Measurement of leukotriene B4 produced in biopsy specimens is performed as a direct measurement of 5-lipoxygenase activity in the tissue. Oligonucleotides will be applied topically to both ears 12 to 24 hours prior to administration of arachidonic acid to allow optimal activity of the compounds. Both ears are pretreated for 24 hours with either 0.1 μmol, 0.3 μmol, or 1.0 μmol of the macromolecule prior to challenge with arachidonic acid. Values are expressed as the mean for three animals per concentration. Inhibition of polymorphonuclear cell infiltration for 0.1 μmol. 0.3 μmol, and 1 μmol is expected to be about 10%, 75% and 92% of control activity, respectively. Inhibition of edema is expected to be about 3%, 58% and 90%, respectively while inhibition of leukotriene B4 production would be expected to be about 15%, 79% and 99%, respectively.
It is intended that each of the patents, applications, printed publications, and other published documents mentioned or referred to in this specification be herein incorporated by reference in their entirety.
Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention. It is therefore intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.

Claims (64)

1. An oligomeric compound comprising a plurality of covalently-bound nucleosides; said compound having the formula:

5′-T1—(Nu—Sp)n—(Nu—Lp)m—(NU—Sp)p—Nu—T2-3′
wherein:
T1 and T2 are each, independently, hydroxyl, a protected hydroxyl, a covalent attachment to a solid support, a nucleoside, an oligonucleoside, a nucleotide, an oligonucleotide, a conjugate group or a 5′ or 3′ substituent group;
each Sp is a chiral Sp phosphorothioate internucleoside linkage;
each Lp is, independently, a chiral Rp phosphorothioate internucleoside linkage, a racemic phosphorothioate internucleoside linkage or an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage;
each n and m is, independently, from 1 to 100;
each p is from 0 to 100; where the sum of n, m and p is from 3 to about 200;
each Nu independently, has the formula:
Figure USRE039464-20070109-C00026
 wherein:
Bx is a heterocyclic base moiety; and
R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group.
2. The oligomeric compound of claim 1 wherein each R, is H or hydroxyl.
3. The oligomeric compound of claim 1 wherein R1 is C1-C10 O-alkyl or C1-C10 substituted O-alkyl.
4. The oligomeric compound of claim 3 wherein R1 is 2′-O-methoxyethyl or 2′-O-methyl.
5. The oligomeric compound of claim 1 wherein each Nu is, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
6. The oligomeric compound of claim 1 wherein the sum of n, m, and p is from 5 to about 50.
7. The oligomeric compound of claim 1 wherein the sum of n, m, and p is from 8 to about 30.
8. The oligomeric compound of claim 1 wherein the sum of n, m, and p is from 10 to about 25.
9. The oligomeric compound of claim 1 wherein p is 1 or 2.
10. The oligomeric compound of claim 1 wherein n and p are each 1 and m is from 3 to about 20.
11. The oligomeric compound of claim 1 wherein T1 and T2 are, independently, hydroxyl or a protected hydroxyl.
12. The oligomeric compound of claim 1 wherein each Lp is an Rp phosphorothioate internucleoside linkage.
13. The oligomeric Compound of claim 1 wherein at least one Lp is a racemic phosphorothioate internucleoside linkage.
14. The oligomeric Compound of claim 1 wherein at least one Lp is an internucleoside linkage other than a chiral phosphorothioate internucleoside linkage.
15. The oligomeric Compound of claim 1 wherein R1 is a 2′-substituent group or a protected 2′-substituent group.
16. A pharmaceutical composition comprising a compound of claim 1 and an acceptable pharmaceutical carrier.
17. A nucleoside having the formula:
Figure USRE039464-20070109-C00027
wherein:
Bx is a heterocyclic base moiety;
R4 is a hydroxyl protecting group;
R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group; and
R2 is an Sp chiral auxiliary group.
18. The nucleoside of claim 17 wherein said chiral auxiliary group has one of formulas I, II, III, IV, V or VI:
Figure USRE039464-20070109-C00028
19. The nucleoside of claim 17 wherein Bx is adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
20. The nucleoside of claim 17 wherein each R1 is H or hydroxyl.
21. The nucleoside of claim 17 wherein R1 is C1-C10 alkyl or C1-C10 substituted alkyl.
22. The nucleoside of claim 21 wherein R1 is 2′-O-methoxyethyl or 2′-O-methyl.
23. The nucleoside of claim 17 wherein at least one R1 is 2′-O-methoxyethyl or 2′-O-methyl.
24. The nucleoside of claim 17 wherein R1 is a 2′-substituent group or a protected 2′-substituent group.
25. A method of preparing an oligomeric compound of formula:

5′-T1—(Nu—Sp)n—(NU—Lp)m—(NU—Sp)p—Nu—T2-3′
wherein:
each T1 and T2 is, independently, hydroxyl, a protected hydroxyl, a covalent attachment to a solid support, a nucleoside, an oligonucleotide, a nucleotide or an oligonucleotide, a conjugate group or a 5′ or 3′ substituent group;
each Sp is an Sp phosphorothioate internucleoside linkage;
each Lp is, independently, an Rp phosphorothioate internucleoside linkage, a racemic phosphorothioate internucleoside linkage or an internucleoside linkage other than a chiral Rp phosphorothioate internucleoside linkage;
each n and m is, independently, from 1 to 100;
each p is from 0 to 100 where the sum of n, m and p is from 3 to about 200:
each Nu, independently, has the formula:
Figure USRE039464-20070109-C00029
 wherein
Bx is a heterocyclic base moiety; and
R1 is H, hydroxy, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group;
comprising the steps of:
(a) providing a compound of formula:
Figure USRE039464-20070109-C00030
wherein:
R4 is a labile hydroxyl protecting group;
R3 is a covalent attachment to a solid support;
(b) deblocking said labile hydroxyl protecting group to form a deblocked hydroxyl group;
(c) optionally treating said deblocked hydroxyl group with a further compound having the formula:
Figure USRE039464-20070109-C00031
wherein:
R2 is an Sp chiral auxiliary group;
and a condensing reagent to form an extended compound:
(d) optionally repeating steps (b) and (c);
(e) treating said deblocked hydroxyl group with a compound having the formula:
Figure USRE039464-20070109-C00032
wherein:
R5 is an Rp chiral auxiliary group or an activated phosphorus group;
and a condensing reagent to form a further extended compound;
(f) optionally repeating steps (e) and (f) to add further nucleosides;
(g) deblocking said labile hydroxyl protecting group to form a deblocked hydroxyl group;
(h) treating said deblocked hydroxyl group with a further compound having the formula:
Figure USRE039464-20070109-C00033
wherein:
R1 is an Sp chiral auxiliary group;
and a condensing reagent to form a protected oligomeric compound; and
(i) optionally repeating steps (h) and (i) to add at additional nucleosides thereby forming a further protected oligomeric compound.
26. The method of claim 25 further comprising the step of deblocking the product of step (i).
27. The method of claim 25 wherein said Sp chiral auxiliary group has one of formulas I, II or III:
Figure USRE039464-20070109-C00034
28. The method of claim 25 wherein said Rp chiral auxiliary group has one of formulas IV, V or VI:
Figure USRE039464-20070109-C00035
29. The method of claim 25 further comprising one or more capping steps after steps c, d, e, f, h, or i; said capping steps comprising treatment with a capping agent.
30. The method of claim 25 further comprising one or more oxidation steps; said oxidation steps comprising treatment with an oxidizing agent.
31. The method of claim 25 wherein said labile hydroxyl protecting group is dimethoxytrityl, monomethoxy trityl, trityl or 9-phenyl-xanthene.
32. The method of claim 25 wherein said heterocyclic base moiety is a purine or a pyrimidine.
33. The method of claim 32 wherein said purine or pyrimidine is, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
34. The method of claim 25 wherein the sum of n, m, and p is from 5 to about 50.
35. The method of claim 25 wherein the sum of n, m, and p is from 8 to about 30.
36. The method of claim 25 wherein the sum of n, m, and p is from 10 to about 25.
37. The method of claim 25 wherein T1 and T2 are, independently hydroxyl or a protected hydroxyl.
38. The method of claim 25 wherein each Lp is an Rp phosphorothioate internucleoside linkage.
39. The method of claim 25 wherein at least one Lp is a racemic phosphorothioate internucleoside linkage.
40. The method of claim 25 wherein n and p are each 1 and m is from 3 to about 20.
41. The method of claim 25 wherein n and p are each 2 and m is from 3 to about 20.
42. The method of claim 25 wherein p is 0.
43. The method of claim 25 wherein at least one R1 is a 2′-substituent group or a protected 2′-substituent group.
44. The method of claim 25 wherein said activated phosphorus group is a phosphoramidite, an H-phosphonate or a phosphate triester.
45. The method of claim 25 wherein said covalent attachment to a solid support is a sarcosinyl-succinonyl linker.
46. A method of modulating the production or activity of a protein in an organism, comprising contacting said organism with a compound of claim 1, wherein said protein is protein kinase C, ICAM-1, VCAM-1, PECAM-1, ELAM-1, H-ras, K-ras, AP-1, a Jun N-terminal kinase, or a matrix metalloproteinase.
47. A method of treating an organism having a disease characterized by the undesired production of a protein, comprising contacting said organism with a compound of claim 1, wherein said disease is psoriasis, an inflammatory disorder of the skin, an infectious disease of the skin, or skin cancer.
48. The oligomeric compound of claim 47 wherein R1 is 2′-O-methoxyethyl or 2′-O-methyl.
49. A compound of formula:
Figure USRE039464-20070109-C00036
wherein:
R62 is H or a hydroxyl protecting group;
R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected 2′-substituent group;
B is a heterocyclic base moiety; and
R61 is a chiral auxiliary selected from formulas I-VI:
Figure USRE039464-20070109-C00037
50. The oligomeric compound of claim 49 wherein each R1 is H or hydroxyl.
51. The oligomeric compound of claim 49 wherein R1 is C1-C10 O-alkyl or C1-C10 substituted O-alkyl.
52. The oligomeric compound of claim 51 wherein R1 is 2′-O-methoxyethyl or 2′-O-methyl.
53. The oligomeric compound of claim 49 wherein each Nu is, independently, adenosine, guanosine, uridine, 5-methyluridine, cytidine, 5-methylcytidine or thymine.
54. A compound having the formula:
Figure USRE039464-20070109-C00038
wherein:
B is a heterocyclic base moiety;
q is 0 to about 50;
R62 is H or a hydroxyl protecting group;
R1 is H, hydroxyl, a protected hydroxyl, a 2′-substituent group or a protected) 2′-substituent group;
R64 is H, a hydroxyl protecting group, or a linker to a solid support;
R63 is a radical selected from the group consisting of
Figure USRE039464-20070109-C00039
55. The oligomeric compound of claim 54 wherein each R1 is H or hydroxyl.
56. The oligomeric compound of claim 54 wherein R1 is C1-C10 O-alkyl or C1-C10 substituted O-alkyl.
57. The oligomeric compound of claim 54 wherein R1 is 2′-O-methoxyethyl or 2′-O-methyl.
58. The oligomeric compound of claim 54 wherein each Nu is, independently, adenosine, guanosine, uridine. 5-methyluridine, cytidine 5-methylcytidine or thymine.
59. The oligomeric compound of claim 54 wherein q is 5 to about 50.
60. The oligomeric compound of claim 54 wherein q is from 8 to about 30.
61. The oligomeric compound of claim 54 wherein q is from 10 to about 25.
62. The oligomeric compound of claim 54 wherein q is 1.
63. The oligomeric compound of claim 54 wherein q is 0.
64. A compound having the formula:
Figure USRE039464-20070109-C00040
wherein:
B is a heterocyclic base moiety;
q is 1 to about 50;
R 62 is H or a hydroxyl protecting group;
R 1 is H, hydroxyl, a protected hydroxyl, a 2-substituent group or a protected 2-substituent group;
R 64 is H, a hydroxyl protecting group, or a linker to a solid support;
R 63 is a radical selected from the group consisting of
Figure USRE039464-20070109-C00041
US10/925,348 1998-07-14 2004-08-24 Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages Expired - Lifetime USRE39464E1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/925,348 USRE39464E1 (en) 1998-07-14 2004-08-24 Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US09/115,027 US6242589B1 (en) 1998-07-14 1998-07-14 Phosphorothioate oligonucleotides having modified internucleoside linkages
US09/352,058 US6440943B1 (en) 1998-07-14 1999-07-14 Oligonucleotides having site specific chiral phosphorothioate internucleoside linkages
US10/925,348 USRE39464E1 (en) 1998-07-14 2004-08-24 Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/352,058 Reissue US6440943B1 (en) 1998-07-14 1999-07-14 Oligonucleotides having site specific chiral phosphorothioate internucleoside linkages

Publications (1)

Publication Number Publication Date
USRE39464E1 true USRE39464E1 (en) 2007-01-09

Family

ID=34277944

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/438,989 Expired - Lifetime US6867294B1 (en) 1998-07-14 1999-11-12 Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US10/925,348 Expired - Lifetime USRE39464E1 (en) 1998-07-14 2004-08-24 Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US09/438,989 Expired - Lifetime US6867294B1 (en) 1998-07-14 1999-11-12 Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages

Country Status (1)

Country Link
US (2) US6867294B1 (en)

Cited By (186)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7314936B2 (en) 2002-01-07 2008-01-01 Eisai Co., Ltd. Deazapurines and uses thereof
WO2011153323A2 (en) 2010-06-02 2011-12-08 Alnylam Pharmaceuticals, Inc. Compositions and methods directed to treating liver fibrosis
WO2012079046A2 (en) 2010-12-10 2012-06-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of klf-1 and bcl11a genes
WO2012078967A2 (en) 2010-12-10 2012-06-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for increasing erythropoietin (epo) production
WO2012138453A1 (en) 2011-04-03 2012-10-11 The General Hospital Corporation Efficient protein expression in vivo using modified rna (mod-rna)
WO2012178033A2 (en) 2011-06-23 2012-12-27 Alnylam Pharmaceuticals, Inc. Serpina1 sirnas: compositions of matter and methods of treatment
WO2012177784A2 (en) 2011-06-21 2012-12-27 Alnylam Pharmaceuticals Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof
WO2013019857A2 (en) 2011-08-01 2013-02-07 Alnylam Pharmaceuticals, Inc. Method for improving the success rate of hematopoietic stem cell transplants
WO2013155204A2 (en) 2012-04-10 2013-10-17 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
WO2014012081A3 (en) * 2012-07-13 2014-03-06 Ontorii, Inc. Chiral control
WO2014071358A2 (en) 2012-11-05 2014-05-08 Foundation Medicine, Inc. Novel ntrk1 fusion molecules and uses thereof
WO2014130922A1 (en) 2013-02-25 2014-08-28 Trustees Of Boston University Compositions and methods for treating fungal infections
WO2014190137A1 (en) 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2014190157A1 (en) 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. Tmprss6 compositions and methods of use thereof
WO2014197835A2 (en) 2013-06-06 2014-12-11 The General Hospital Corporation Methods and compositions for the treatment of cancer
WO2015050990A1 (en) 2013-10-02 2015-04-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2015061091A1 (en) 2013-10-21 2015-04-30 The General Hospital Corporation Methods relating to circulating tumor cell clusters and the treatment of cancer
WO2015095527A1 (en) 2013-12-20 2015-06-25 The General Hosptial Corporation Methods and assays relating to circulating tumor cells
WO2015123264A1 (en) 2014-02-11 2015-08-20 Alnylam Pharmaceuticals, Inc. Ketohexokinase (khk) irna compositions and methods of use thereof
WO2015175510A1 (en) 2014-05-12 2015-11-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating a serpinc1-associated disorder
WO2015179724A1 (en) 2014-05-22 2015-11-26 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2015187541A1 (en) 2014-06-02 2015-12-10 Children's Medical Center Corporation Methods and compositions for immunomodulation
WO2016040589A1 (en) 2014-09-12 2016-03-17 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
WO2016057893A1 (en) 2014-10-10 2016-04-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression
WO2016061487A1 (en) 2014-10-17 2016-04-21 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof
WO2016069694A2 (en) 2014-10-30 2016-05-06 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
WO2016077321A1 (en) 2014-11-10 2016-05-19 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
WO2016081444A1 (en) 2014-11-17 2016-05-26 Alnylam Pharmaceuticals, Inc. Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
WO2016130806A2 (en) 2015-02-13 2016-08-18 Alnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
WO2016164746A1 (en) 2015-04-08 2016-10-13 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2016176745A1 (en) 2015-05-06 2016-11-10 Benitec Biopharma Limited Reagents for treatment of hepatitis b virus (hbv) infection and use thereof
WO2016201301A1 (en) 2015-06-12 2016-12-15 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
WO2016205323A1 (en) 2015-06-18 2016-12-22 Alnylam Pharmaceuticals, Inc. Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
WO2016209862A1 (en) 2015-06-23 2016-12-29 Alnylam Pharmaceuticals, Inc. Glucokinase (gck) irna compositions and methods of use thereof
WO2017011286A1 (en) 2015-07-10 2017-01-19 Alnylam Pharmaceuticals, Inc. Insulin-like growth factor binding protein, acid labile subunit (igfals) and insulin-like growth factor 1 (igf-1) irna compositions and methods of use thereof
WO2017040078A1 (en) 2015-09-02 2017-03-09 Alnylam Pharmaceuticals, Inc. PROGRAMMED CELL DEATH 1 LIGAND 1 (PD-L1) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
WO2017184689A1 (en) 2016-04-19 2017-10-26 Alnylam Pharmaceuticals, Inc. High density lipoprotein binding protein (hdlbp/vigilin) irna compositions and methods of use thereof
WO2017214518A1 (en) 2016-06-10 2017-12-14 Alnylam Pharmaceuticals, Inc. COMPLETMENT COMPONENT C5 iRNA COMPOSTIONS AND METHODS OF USE THEREOF FOR TREATING PAROXYSMAL NOCTURNAL HEMOGLOBINURIA (PNH)
EP3312281A2 (en) 2013-03-14 2018-04-25 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
CN108135921A (en) * 2015-07-22 2018-06-08 波涛生命科学有限公司 Oligonucleotide compositions and methods thereof
WO2018112320A1 (en) 2016-12-16 2018-06-21 Alnylam Pharmaceuticals, Inc. Methods for treating or preventing ttr-associated diseases using transthyretin (ttr) irna compositions
WO2018195165A1 (en) 2017-04-18 2018-10-25 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (hbv) infection
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
WO2019014530A1 (en) 2017-07-13 2019-01-17 Alnylam Pharmaceuticals Inc. Lactate dehydrogenase a (ldha) irna compositions and methods of use thereof
WO2019089922A1 (en) 2017-11-01 2019-05-09 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof
WO2019099610A1 (en) 2017-11-16 2019-05-23 Alnylam Pharmaceuticals, Inc. Kisspeptin 1 (kiss1) irna compositions and methods of use thereof
WO2019100039A1 (en) 2017-11-20 2019-05-23 Alnylam Pharmaceuticals, Inc. Serum amyloid p component (apcs) irna compositions and methods of use thereof
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
WO2019126097A1 (en) 2017-12-18 2019-06-27 Alnylam Pharmaceuticals, Inc. High mobility group box-1 (hmgb1) irna compositions and methods of use thereof
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
WO2019222166A1 (en) 2018-05-14 2019-11-21 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2020037125A1 (en) 2018-08-16 2020-02-20 Alnylam Pharmaceuticals Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2020036862A1 (en) 2018-08-13 2020-02-20 Alnylam Pharmaceuticals, Inc. HEPATITIS B VIRUS (HBV) dsRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2020060986A1 (en) 2018-09-18 2020-03-26 Alnylam Pharmaceuticals, Inc. Ketohexokinase (khk) irna compositions and methods of use thereof
WO2020132521A1 (en) 2018-12-20 2020-06-25 Praxis Precision Medicines, Inc. Compositions and methods for the treatment of kcnt1 related disorders
WO2020132346A1 (en) 2018-12-20 2020-06-25 Vir Biotechnology, Inc. Combination hbv therapy
EP3674409A1 (en) 2011-03-29 2020-07-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of tmprss6 gene
WO2020150431A1 (en) 2019-01-16 2020-07-23 Genzyme Corporation Serpinc1 irna compositions and methods of use thereof
US10724035B2 (en) 2016-05-04 2020-07-28 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
EP3693463A1 (en) 2013-10-04 2020-08-12 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
WO2020232024A1 (en) 2019-05-13 2020-11-19 Vir Biotechnology, Inc. Compositions and methods for treating hepatitis b virus (hbv) infection
WO2021022108A2 (en) 2019-08-01 2021-02-04 Alnylam Pharmaceuticals, Inc. CARBOXYPEPTIDASE B2 (CPB2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021022109A1 (en) 2019-08-01 2021-02-04 Alnylam Pharmaceuticals, Inc. SERPIN FAMILY F MEMBER 2 (SERPINF2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US10913951B2 (en) 2018-10-31 2021-02-09 University of Pittsburgh—of the Commonwealth System of Higher Education Silencing of HNF4A-P2 isoforms with siRNA to improve hepatocyte function in liver failure
WO2021030522A1 (en) 2019-08-13 2021-02-18 Alnylam Pharmaceuticals, Inc. SMALL RIBOSOMAL PROTEIN SUBUNIT 25 (RPS25) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2021046122A1 (en) 2019-09-03 2021-03-11 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2021067747A1 (en) 2019-10-04 2021-04-08 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing ugt1a1 gene expression
WO2021076828A1 (en) 2019-10-18 2021-04-22 Alnylam Pharmaceuticals, Inc. Solute carrier family member irna compositions and methods of use thereof
WO2021081026A1 (en) 2019-10-22 2021-04-29 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof
WO2021087325A1 (en) 2019-11-01 2021-05-06 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing dnajb1-prkaca fusion gene expression
WO2021087036A1 (en) 2019-11-01 2021-05-06 Alnylam Pharmaceuticals, Inc. HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2021096763A1 (en) 2019-11-13 2021-05-20 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
WO2021102373A1 (en) 2019-11-22 2021-05-27 Alnylam Pharmaceuticals, Inc. Ataxin3 (atxn3) rnai agent compositions and methods of use thereof
WO2021119226A1 (en) 2019-12-13 2021-06-17 Alnylam Pharmaceuticals, Inc. Human chromosome 9 open reading frame 72 (c9orf72) irna agent compositions and methods of use thereof
WO2021126734A1 (en) 2019-12-16 2021-06-24 Alnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
WO2021154941A1 (en) 2020-01-31 2021-08-05 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions for use in the treatment of amyotrophic lateral sclerosis (als)
WO2021163066A1 (en) 2020-02-10 2021-08-19 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing vegf-a expression
WO2021167841A1 (en) 2020-02-18 2021-08-26 Alnylam Pharmaceuticals, Inc. Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof
WO2021178607A1 (en) 2020-03-05 2021-09-10 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof for treating or preventing complement component c3-associated diseases
WO2021178736A1 (en) 2020-03-06 2021-09-10 Alnylam Pharmaceuticals, Inc. KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021188611A1 (en) 2020-03-18 2021-09-23 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant
WO2021195307A1 (en) 2020-03-26 2021-09-30 Alnylam Pharmaceuticals, Inc. Coronavirus irna compositions and methods of use thereof
WO2021202443A2 (en) 2020-03-30 2021-10-07 Alnylam Pharmaceucticals, Inc. Compositions and methods for silencing dnajc15 gene expression
WO2021206917A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. ANGIOTENSIN-CONVERTING ENZYME 2 (ACE2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021207167A1 (en) 2020-04-06 2021-10-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing myoc expression
WO2021207189A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing scn9a expression
WO2021206922A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. Transmembrane serine protease 2 (tmprss2) irna compositions and methods of use thereof
WO2021222549A1 (en) 2020-04-30 2021-11-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2021222065A1 (en) 2020-04-27 2021-11-04 Alnylam Pharmaceuticals, Inc. Apolipoprotein e (apoe) irna agent compositions and methods of use thereof
WO2021231685A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of transmembrane channel-like protein 1 (tmc1)
WO2021231675A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of argininosuccinate synthetase (ass1)
WO2021231692A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of otoferlin (otof)
WO2021231673A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of leucine rich repeat kinase 2 (lrrk2)
WO2021231698A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of argininosuccinate lyase (asl)
WO2021231679A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of gap junction protein beta 2 (gjb2)
WO2021231680A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of methyl-cpg binding protein 2 (mecp2)
WO2021231691A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of retinoschisin 1 (rsi)
WO2021237097A1 (en) 2020-05-21 2021-11-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting marc1 gene expression
WO2021234459A2 (en) 2020-05-22 2021-11-25 Wave Life Sciences Ltd. Double stranded oligonucleotide compositions and methods relating thereto
WO2021252557A1 (en) 2020-06-09 2021-12-16 Alnylam Pharmaceuticals, Inc. Rnai compositions and methods of use thereof for delivery by inhalation
WO2021257782A1 (en) 2020-06-18 2021-12-23 Alnylam Pharmaceuticals, Inc. XANTHINE DEHYDROGENASE (XDH) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021262840A1 (en) 2020-06-24 2021-12-30 Vir Biotechnology, Inc. Engineered hepatitis b virus neutralizing antibodies and uses thereof
US11234994B2 (en) 2016-04-14 2022-02-01 Benitec Biopharma Limited Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
WO2022066847A1 (en) 2020-09-24 2022-03-31 Alnylam Pharmaceuticals, Inc. Dipeptidyl peptidase 4 (dpp4) irna compositions and methods of use thereof
WO2022076291A1 (en) 2020-10-05 2022-04-14 Alnylam Pharmaceuticals, Inc. G protein-coupled receptor 75 (gpr75) irna compositions and methods of use thereof
WO2022087041A1 (en) 2020-10-21 2022-04-28 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating primary hyperoxaluria
WO2022087329A1 (en) 2020-10-23 2022-04-28 Alnylam Pharmaceuticals, Inc. Mucin 5b (muc5b) irna compositions and methods of use thereof
WO2022103999A1 (en) 2020-11-13 2022-05-19 Alnylam Pharmaceuticals, Inc. COAGULATION FACTOR V (F5) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022119873A1 (en) 2020-12-01 2022-06-09 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression
WO2022125490A1 (en) 2020-12-08 2022-06-16 Alnylam Pharmaceuticals, Inc. Coagulation factor x (f10) irna compositions and methods of use thereof
WO2022140702A1 (en) 2020-12-23 2022-06-30 Flagship Pioneering, Inc. Compositions of modified trems and uses thereof
WO2022150260A1 (en) 2021-01-05 2022-07-14 Alnylam Pharmaceuticals, Inc. COMPLEMENT COMPONENT 9 (C9) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US11408000B2 (en) 2020-06-03 2022-08-09 Triplet Therapeutics, Inc. Oligonucleotides for the treatment of nucleotide repeat expansion disorders associated with MSH3 activity
EP4043567A1 (en) 2014-08-29 2022-08-17 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
WO2022174000A2 (en) 2021-02-12 2022-08-18 Alnylam Pharmaceuticals, Inc. Superoxide dismutase 1 (sod1) irna compositions and methods of use thereof for treating or preventing superoxide dismutase 1- (sod1-) associated neurodegenerative diseases
WO2022182864A1 (en) 2021-02-25 2022-09-01 Alnylam Pharmaceuticals, Inc. Prion protein (prnp) irna compositions and methods and methods of use thereof
WO2022182574A1 (en) 2021-02-26 2022-09-01 Alnylam Pharmaceuticals, Inc. KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022187435A1 (en) 2021-03-04 2022-09-09 Alnylam Pharmaceuticals, Inc. Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof
WO2022192519A1 (en) 2021-03-12 2022-09-15 Alnylam Pharmaceuticals, Inc. Glycogen synthase kinase 3 alpha (gsk3a) irna compositions and methods of use thereof
WO2022212231A2 (en) 2021-03-29 2022-10-06 Alnylam Pharmaceuticals, Inc. Huntingtin (htt) irna agent compositions and methods of use thereof
WO2022212153A1 (en) 2021-04-01 2022-10-06 Alnylam Pharmaceuticals, Inc. Proline dehydrogenase 2 (prodh2) irna compositions and methods of use thereof
WO2022232343A1 (en) 2021-04-29 2022-11-03 Alnylam Pharmaceuticals, Inc. Signal transducer and activator of transcription factor 6 (stat6) irna compositions and methods of use thereof
WO2022231999A1 (en) 2021-04-26 2022-11-03 Alnylam Pharmaceuticals, Inc. Transmembrane protease, serine 6 (tmprss6) irna compositions and methods of use thereof
WO2022245583A1 (en) 2021-05-18 2022-11-24 Alnylam Pharmaceuticals, Inc. Sodium-glucose cotransporter-2 (sglt2) irna compositions and methods of use thereof
WO2022246023A1 (en) 2021-05-20 2022-11-24 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2022256290A2 (en) 2021-06-04 2022-12-08 Alnylam Pharmaceuticals, Inc. HUMAN CHROMOSOME 9 OPEN READING FRAME 72 (C9ORF72) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2022256395A1 (en) 2021-06-02 2022-12-08 Alnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
WO2022256283A2 (en) 2021-06-01 2022-12-08 Korro Bio, Inc. Methods for restoring protein function using adar
WO2022260939A2 (en) 2021-06-08 2022-12-15 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating or preventing stargardt's disease and/or retinal binding protein 4 (rbp4)-associated disorders
WO2023278576A1 (en) 2021-06-30 2023-01-05 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
WO2023278410A1 (en) 2021-06-29 2023-01-05 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2023278407A1 (en) 2021-06-29 2023-01-05 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2023003995A1 (en) 2021-07-23 2023-01-26 Alnylam Pharmaceuticals, Inc. Beta-catenin (ctnnb1) irna compositions and methods of use thereof
WO2023003805A1 (en) 2021-07-19 2023-01-26 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder
WO2023009687A1 (en) 2021-07-29 2023-02-02 Alnylam Pharmaceuticals, Inc. 3-hydroxy-3-methylglutaryl-coa reductase (hmgcr) irna compositions and methods of use thereof
WO2023014677A1 (en) 2021-08-03 2023-02-09 Alnylam Pharmaceuticals, Inc. Transthyretin (ttr) irna compositions and methods of use thereof
WO2023014765A1 (en) 2021-08-04 2023-02-09 Alnylam Pharmaceuticals, Inc. iRNA COMPOSITIONS AND METHODS FOR SILENCING ANGIOTENSINOGEN (AGT)
WO2023019246A1 (en) 2021-08-13 2023-02-16 Alnylam Pharmaceuticals, Inc. Factor xii (f12) irna compositions and methods of use thereof
WO2023044094A1 (en) 2021-09-20 2023-03-23 Alnylam Pharmaceuticals, Inc. Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof
WO2023044370A2 (en) 2021-09-17 2023-03-23 Alnylam Pharmaceuticals, Inc. Irna compositions and methods for silencing complement component 3 (c3)
WO2023069603A1 (en) 2021-10-22 2023-04-27 Korro Bio, Inc. Methods and compositions for disrupting nrf2-keap1 protein interaction by adar mediated rna editing
WO2023076451A1 (en) 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2023076450A2 (en) 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
EP4209592A1 (en) 2012-04-26 2023-07-12 Genzyme Corporation Serpinc1 irna compositions and methods of use thereof
WO2023141314A2 (en) 2022-01-24 2023-07-27 Alnylam Pharmaceuticals, Inc. Heparin sulfate biosynthesis pathway enzyme irna agent compositions and methods of use thereof
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
EP4269601A2 (en) 2015-03-27 2023-11-01 President and Fellows of Harvard College Modified t cells and methods of making and using the same
EP4286517A2 (en) 2013-04-04 2023-12-06 President and Fellows of Harvard College Therapeutic uses of genome editing with crispr/cas systems
WO2024039776A2 (en) 2022-08-18 2024-02-22 Alnylam Pharmaceuticals, Inc. Universal non-targeting sirna compositions and methods of use thereof
WO2024059165A1 (en) 2022-09-15 2024-03-21 Alnylam Pharmaceuticals, Inc. 17b-hydroxysteroid dehydrogenase type 13 (hsd17b13) irna compositions and methods of use thereof
EP4385568A2 (en) 2010-04-06 2024-06-19 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of cd274/pd-l1 gene
WO2024168010A2 (en) 2023-02-09 2024-08-15 Alnylam Pharmaceuticals, Inc. Reversir molecules and methods of use thereof
EP4424828A1 (en) 2015-12-07 2024-09-04 Genzyme Corporation Methods and compositions for treating a serpinc1-associated disorder
WO2024220746A2 (en) 2023-04-21 2024-10-24 Flagship Pioneering Innovations Vii, Llc Rnai agents targeting fatty acid synthase and related methods
WO2025015335A1 (en) 2023-07-13 2025-01-16 Korro Bio, Inc. Rna-editing oligonucleotides and uses thereof
WO2025024334A1 (en) 2023-07-21 2025-01-30 Marrow Therapeutics, Inc. Hematopoietic cell targeting conjugates and related methods
WO2025024486A2 (en) 2023-07-25 2025-01-30 Flagship Pioneering Innovations Vii, Llc Cas endonucleases and related methods
WO2025024493A1 (en) 2023-07-25 2025-01-30 Flagship Pioneering Innovations Vii, Llc Cas endonucleases and related methods
WO2025034422A1 (en) 2023-08-04 2025-02-13 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating ctnnb1-associated disorders
WO2025072672A2 (en) 2023-09-27 2025-04-03 Judo Bio, Inc. Slc6a19-targeting modulatory nucleic acid agents
WO2025072699A1 (en) 2023-09-27 2025-04-03 Judo Bio, Inc. Aminoglycosides for delivery of agents to the kidney
WO2025072331A1 (en) 2023-09-26 2025-04-03 Flagship Pioneering Innovations Vii, Llc Cas nucleases and related methods
WO2025072713A1 (en) 2023-09-27 2025-04-03 Judo Bio, Inc. Polymyxins for delivery of agents to the kidney
WO2025076031A2 (en) 2023-10-03 2025-04-10 Alnylam Pharmaceuticals, Inc. Peritoneal macrophages comprising a nanoparticle encapsulating a nucleic acid molecule and methods of use thereof
WO2025117877A2 (en) 2023-12-01 2025-06-05 Flagship Pioneering Innovations Vii, Llc Cas nucleases and related methods
WO2025128799A1 (en) 2023-12-12 2025-06-19 Korro Bio, Inc. Double-stranded rna-editing oligonucleotides and uses thereof
EP4588512A2 (en) 2017-07-10 2025-07-23 Genzyme Corporation Methods and compositions for treating a bleeding event in a subject having hemophilia
US12378302B2 (en) 2012-11-05 2025-08-05 Foundation Medicine, Inc. Fusion molecules and uses thereof
WO2025178854A2 (en) 2024-02-19 2025-08-28 Flagship Pioneering Innovations Vii, Llc Rnai agents targeting cideb and related methods
US12416006B2 (en) 2021-08-31 2025-09-16 Alnylam Pharmaceuticals, Inc. Cell death-inducing DFFA-like effector B (CIDEB) iRNA compositions and methods of use thereof
WO2025199231A2 (en) 2024-03-20 2025-09-25 Vertex Pharmaceuticals Incorporated Mucin-5b (muc5b) targeted sirna and antisense oligonucleotides and methods of use thereof
WO2025217275A2 (en) 2024-04-10 2025-10-16 Flagship Pioneering Innovations Vii, Llc Immune cell targeted compositions and related methods
EP4649951A2 (en) 2020-06-09 2025-11-19 Alnylam Pharmaceuticals, Inc. Sirna compositions and methods for silencing gpam (glycerol-3-phosphate acyltransferase 1, mitochondrial) expression
US12485136B2 (en) 2018-12-03 2025-12-02 Takeda Pharmaceuticals U.S.A., Inc. Methods for the treatment of trinucleotide repeat expansion disorders associated with MLH3 activity
WO2025259743A1 (en) 2024-06-12 2025-12-18 Alnylam Pharmaceuticals, Inc. Dual conjugate compounds for extrahepatic delivery
WO2025259747A2 (en) 2024-06-12 2025-12-18 Alnylam Pharmaceuticals, Inc. Dystrophy myotonic protein kinase (dmpk) irna compositions and methods of use thereof
US12516322B2 (en) 2021-09-24 2026-01-06 Alnylam Pharmaceuticals, Inc. Microtubule associated protein Tau (MAPT) iRNA agent compositions and methods of use thereof
US12522873B2 (en) 2011-10-21 2026-01-13 Foundation Medicine, Inc. ALK and NTRK1 fusion molecules and uses thereof
US12534731B2 (en) 2020-04-01 2026-01-27 Alnylam Pharmaceuticals, Inc. Alpha-2A adrenergic receptor (ADRA2A) iRNA agent compositions and methods of use thereof

Families Citing this family (72)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7480382B2 (en) * 2003-09-30 2009-01-20 Microsoft Corporation Image file container
US7314714B2 (en) * 2003-12-19 2008-01-01 Affymetrix, Inc. Method of oligonucleotide synthesis
WO2007087113A2 (en) * 2005-12-28 2007-08-02 The Scripps Research Institute Natural antisense and non-coding rna transcripts as drug targets
WO2007120883A2 (en) * 2006-04-12 2007-10-25 Isis Pharmaceuticals, Inc. Compositions and their uses directed to hepcidin
WO2009146417A1 (en) * 2008-05-30 2009-12-03 Sigma-Aldrich Co. Compositions and methods for specifically silencing a target nucleic acid
MY188457A (en) * 2008-10-03 2021-12-10 Opko Curna Llc Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoprotein-a1
EP2370581B1 (en) 2008-12-04 2016-08-03 CuRNA, Inc. Treatment of vascular endothelial growth factor (vegf) related diseases by inhibition of natural antisense transcript to vegf
JP6091752B2 (en) 2008-12-04 2017-03-08 クルナ・インコーポレーテッド Treatment of erythropoietin (EPO) -related diseases by suppression of natural antisense transcripts against EPO
JP5923306B2 (en) 2008-12-04 2016-05-24 クルナ・インコーポレーテッド Treatment of tumor suppressor gene-related diseases by suppression of natural antisense transcripts against tumor suppressor genes
EP3009150B1 (en) 2009-02-12 2019-11-13 CuRNA, Inc. Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
EP2408919B1 (en) 2009-03-16 2017-10-18 CuRNA, Inc. Treatment of nuclear factor (erythroid-derived 2)-like 2 (nrf2) related diseases by inhibition of natural antisense transcript to nrf2
US9708604B2 (en) 2009-03-17 2017-07-18 Curna, Inc. Treatment of delta-like 1 homolog (DLK1) related diseases by inhibition of natural antisense transcript to DLK1
EP2427553A4 (en) 2009-05-06 2012-11-07 Opko Curna Llc Treatment of lipid transport and metabolism gene related diseases by inhibition of natural antisense transcript to a lipid transport and metabolism gene
WO2010129746A2 (en) 2009-05-06 2010-11-11 Curna, Inc. Treatment of tristetraproline (ttp) related diseases by inhibition of natural antisense transcript to ttp
EP2427554B1 (en) 2009-05-08 2016-11-16 CuRNA, Inc. Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to dmd family
CA2762369C (en) 2009-05-18 2021-12-28 Joseph Collard Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
CN102549158B (en) 2009-05-22 2017-09-26 库尔纳公司 By suppressing to treat the disease that TFE3 is related to IRS albumen 2 (IRS2) for transcription factor E3 (TFE3) natural antisense transcript
CA2764683A1 (en) 2009-05-28 2010-12-02 Joseph Collard Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
EP2443237B1 (en) 2009-06-16 2017-02-22 CuRNA, Inc. Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
KR101702689B1 (en) 2009-06-16 2017-02-06 큐알엔에이, 인크. Treatment of paraoxonase 1 (pon1) related diseases by inhibition of natural antisense transcript to pon1
EP2446036B1 (en) 2009-06-24 2017-03-01 CuRNA, Inc. Treatment of tumor necrosis factor receptor 2 (tnfr2) related diseases by inhibition of natural antisense transcript to tnfr2
CA2765815A1 (en) 2009-06-26 2010-12-29 Opko Curna, Llc Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
WO2011011700A2 (en) 2009-07-24 2011-01-27 Curna, Inc. Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
CN102762731B (en) 2009-08-05 2018-06-22 库尔纳公司 By inhibiting to treat insulin gene (INS) relevant disease for the natural antisense transcript of insulin gene (INS)
CN102625841A (en) 2009-08-11 2012-08-01 欧科库尔纳有限责任公司 Treatment of adiponectin (ADIPOQ)-associated diseases by inhibiting natural antisense transcripts of adiponectin (ADIPOQ)
CA2771228C (en) 2009-08-21 2020-12-29 Opko Curna, Llc Treatment of 'c terminus of hsp70-interacting protein' (chip) related diseases by inhibition of natural antisense transcript to chip
WO2011031482A2 (en) 2009-08-25 2011-03-17 Curna, Inc. Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap
EP2480669B1 (en) 2009-09-25 2017-11-08 CuRNA, Inc. Treatment of filaggrin (flg) related diseases by modulation of flg expression and activity
EP2513310B1 (en) 2009-12-16 2017-11-01 CuRNA, Inc. Treatment of membrane bound transcription factor peptidase, site 1 (mbtps1) related diseases by inhibition of natural antisense transcript to mbtps1
ES2661387T3 (en) 2009-12-23 2018-03-28 Curna, Inc. Treatment of diseases related to hepatocyte growth factor (hgf) by inhibition of the natural antisense transcript to hgf
EP2515947B1 (en) 2009-12-23 2021-10-06 CuRNA, Inc. Treatment of uncoupling protein 2 (ucp2) related diseases by inhibition of natural antisense transcript to ucp2
JP5982288B2 (en) 2009-12-29 2016-08-31 カッパーアールエヌエー,インコーポレイテッド Treatment of tumor protein 63-related diseases by inhibition of natural antisense transcripts against tumor protein 63 (p63)
EP2519633B1 (en) 2009-12-29 2017-10-25 CuRNA, Inc. Treatment of nuclear respiratory factor 1 (nrf1) related diseases by inhibition of natural antisense transcript to nrf1
EP2519632B1 (en) 2009-12-31 2018-04-11 CuRNA, Inc. Treatment of insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to irs2 and transcription factor e3 (tfe3)
JP5886757B2 (en) 2010-01-04 2016-03-16 カッパーアールエヌエー,インコーポレイテッド Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcripts against interferon regulatory factor 8 (IRF8)
KR101853509B1 (en) 2010-01-06 2018-04-30 큐알엔에이, 인크. Treatment of Pancreatic Developmental Gene Related Diseases By Inhibition of Natural Antisense Transcript to A Pancreatic Developmental Gene
DK2524039T3 (en) 2010-01-11 2018-03-12 Curna Inc TREATMENT OF GENDER HORMON-BINDING GLOBULIN (SHBG) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENCE TRANSCRIPTS TO SHBG
RU2611192C2 (en) 2010-01-25 2017-02-21 Курна, Инк. TREATMENT OF RNase H1 RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO RNase H1
EP2539452B1 (en) 2010-02-22 2016-07-27 CuRNA, Inc. Treatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1
CA2795145C (en) 2010-04-02 2019-01-22 Curna, Inc. Treatment of colony-stimulating factor 3 (csf3) related diseases by inhibition of natural antisense transcript to csf3
TWI644675B (en) 2010-04-09 2018-12-21 可娜公司 Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21
KR101936011B1 (en) 2010-05-03 2019-01-07 큐알엔에이, 인크. Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
TWI531370B (en) 2010-05-14 2016-05-01 可娜公司 Treatment of PAR4-related diseases by inhibiting PAR4 natural anti-strand transcript
US8980858B2 (en) 2010-05-26 2015-03-17 Curna, Inc. Treatment of methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
KR101857090B1 (en) 2010-05-26 2018-06-26 큐알엔에이, 인크. Treatment of atonal homolog 1 (atoh1) related diseases by inhibition of natural antisense transcript to atoh1
WO2011156278A1 (en) 2010-06-07 2011-12-15 Isis Pharmaceuticals, Inc. Bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2011163499A2 (en) 2010-06-23 2011-12-29 Opko Curna, Llc Treatment of sodium channel, voltage-gated, alpha subunit (scna) related diseases by inhibition of natural antisense transcript to scna
CA2805318A1 (en) 2010-07-14 2012-01-19 Curna, Inc. Treatment of discs large homolog (dlg) related diseases by inhibition of natural antisense transcript to dlg
US8993533B2 (en) 2010-10-06 2015-03-31 Curna, Inc. Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
US9222088B2 (en) 2010-10-22 2015-12-29 Curna, Inc. Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
WO2012068340A2 (en) 2010-11-18 2012-05-24 Opko Curna Llc Antagonat compositions and methods of use
KR102010598B1 (en) 2010-11-23 2019-08-13 큐알엔에이, 인크. Treatment of nanog related diseases by inhibition of natural antisense transcript to nanog
WO2012170347A1 (en) 2011-06-09 2012-12-13 Isis Pharmaceuticals, Inc. Bicyclic nucleosides and oligomeric compounds prepared therefrom
RU2620980C2 (en) 2011-06-09 2017-05-30 Курна, Инк. Treatment of diseases associated with frataxin (fxn), by inhibiting natural antisense fxn transcript
WO2013036403A1 (en) 2011-09-06 2013-03-14 Curna, Inc. TREATMENT OF DISEASES RELATED TO ALPHA SUBUNITS OF SODIUM CHANNELS, VOLTAGE-GATED (SCNxA) WITH SMALL MOLECULES
JP2015511494A (en) 2012-03-15 2015-04-20 キュアナ,インク. Treatment of BDNF-related diseases by inhibition of natural antisense transcripts against brain-derived neurotrophic factor (BDNF)
US9403865B2 (en) 2012-08-15 2016-08-02 Ionis Pharmaceuticals, Inc. Method of preparing oligomeric compounds using modified capping protocols
US9029335B2 (en) 2012-10-16 2015-05-12 Isis Pharmaceuticals, Inc. Substituted 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
EP2912179A4 (en) * 2012-10-26 2016-10-12 Geron Corp C-MYC ANTISENSE OLIGONUCLEOTIDES AND METHODS OF USE FOR THE TREATMENT OF CELL PROLIFERATION DISORDERS
US9228189B2 (en) * 2012-10-26 2016-01-05 Geron Corporation C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders
WO2014120861A2 (en) 2013-01-31 2014-08-07 Isis Pharmaceuticals, Inc. Method of preparing oligomeric compounds using modified coupling protocols
US9758546B2 (en) 2013-10-21 2017-09-12 Ionis Pharmaceuticals, Inc. Method for solution phase detritylation of oligomeric compounds
WO2015089368A2 (en) 2013-12-12 2015-06-18 Alnylam Pharmaceuticals, Inc. Complement component irna compositions and methods of use thereof
WO2015142910A1 (en) 2014-03-17 2015-09-24 Isis Pharmaceuticals, Inc. Bicyclic carbocyclic nucleosides and oligomeric compounds prepared therefrom
US10221416B2 (en) 2014-04-24 2019-03-05 Ionis Pharmaceuticals, Inc. Oligomeric compounds comprising alpha-beta-constrained nucleic acid
US10450342B2 (en) 2015-02-23 2019-10-22 Ionis Pharmaceuticals, Inc. Method for solution phase detritylation of oligomeric compounds
CN114685589A (en) 2016-03-13 2022-07-01 波涛生命科学有限公司 Compositions and methods for phosphoramidite and oligonucleotide synthesis
CN109562122A (en) 2016-06-03 2019-04-02 波涛生命科学有限公司 Oligonucleotides, composition and its method
GB201612011D0 (en) 2016-07-11 2016-08-24 Glaxosmithkline Ip Dev Ltd Novel processes for the production of oligonucleotides
JP7296882B2 (en) 2016-11-23 2023-06-23 ウェイブ ライフ サイエンシズ リミテッド Compositions and methods for phosphoramidite and oligonucleotide synthesis
CN110770345A (en) 2017-04-14 2020-02-07 托尔奈公司 Immunomodulatory polynucleotides, antibody conjugates, and methods of use thereof
WO2019122277A1 (en) * 2017-12-22 2019-06-27 Roche Innovation Center Copenhagen A/S Novel thiophosphoramidites

Citations (88)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4415732A (en) * 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US4458066A (en) * 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4476301A (en) * 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4500707A (en) * 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4668777A (en) * 1981-03-27 1987-05-26 University Patents, Inc. Phosphoramidite nucleoside compounds
US4689320A (en) * 1983-10-17 1987-08-25 Akira Kaji Method for inhibiting propagation of virus and anti-viral agent
US4725677A (en) * 1983-08-18 1988-02-16 Biosyntech Gmbh Process for the preparation of oligonucleotides
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US4816571A (en) * 1987-06-04 1989-03-28 Applied Biosystems, Inc. Chemical capping by phosphitylation during oligonucleotide synthesis
US4973679A (en) * 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US5004810A (en) * 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5132418A (en) * 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
USRE34069E (en) * 1983-08-18 1992-09-15 Biosyntech Gmbh Process for the preparation of oligonucleotides
US5166315A (en) * 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5166195A (en) * 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
US5177196A (en) * 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5185444A (en) * 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5188897A (en) * 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5194428A (en) * 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5235033A (en) * 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5242906A (en) * 1991-04-22 1993-09-07 University Of North Carolina At Chapel Hill Antisense oligonucleotides against Epstein-Barr virus
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5264562A (en) * 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) * 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264423A (en) * 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
WO1994008003A1 (en) * 1991-06-14 1994-04-14 Isis Pharmaceuticals, Inc. ANTISENSE OLIGONUCLEOTIDE INHIBITION OF THE ras GENE
US5321131A (en) * 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5405939A (en) * 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5434257A (en) * 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5442049A (en) * 1992-11-19 1995-08-15 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating the effects of cytomegalovirus infections
US5455233A (en) * 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5457189A (en) * 1989-12-04 1995-10-10 Isis Pharmaceuticals Antisense oligonucleotide inhibition of papillomavirus
US5466677A (en) * 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5470967A (en) * 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5476925A (en) * 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5506212A (en) * 1990-01-11 1996-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides with substantially chirally pure phosphorothioate linkages
US5512668A (en) * 1991-03-06 1996-04-30 Polish Academy Of Sciences Solid phase oligonucleotide synthesis using phospholane intermediates
US5514788A (en) * 1993-05-17 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5519126A (en) * 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5523389A (en) * 1992-09-29 1996-06-04 Isis Pharmaceuticals, Inc. Inhibitors of human immunodeficiency virus
US5541307A (en) * 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5550111A (en) * 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5561225A (en) * 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5571799A (en) * 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
WO1996037504A1 (en) * 1995-05-23 1996-11-28 Hybridon, Inc. Novel synthons for stereoselective oligonucleotide synthesis
US5580767A (en) * 1990-08-14 1996-12-03 Isis Pharmaceuticals, Inc. Inhibition of influenza viruses by antisense oligonucleotides
US5582972A (en) * 1991-06-14 1996-12-10 Isis Pharmaceuticals, Inc. Antisense oligonucleotides to the RAS gene
US5582986A (en) * 1991-06-14 1996-12-10 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of the ras gene
WO1996039154A1 (en) * 1995-06-06 1996-12-12 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5587361A (en) * 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5591720A (en) * 1990-08-16 1997-01-07 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating the effects of cytomegalovirus infections
US5591623A (en) * 1990-08-14 1997-01-07 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US5596086A (en) * 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5599797A (en) * 1991-10-15 1997-02-04 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5607923A (en) * 1991-10-15 1997-03-04 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating cytomegalovirus having phosphorothioate linkages of high chiral purity
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5618704A (en) * 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5620963A (en) * 1991-10-15 1997-04-15 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating protein kinase C having phosphorothioate linkages of high chiral purity
US5623070A (en) * 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5625050A (en) * 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5661134A (en) * 1991-10-15 1997-08-26 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity
US5663312A (en) * 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5670633A (en) * 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5677439A (en) * 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5677437A (en) * 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5681747A (en) * 1992-03-16 1997-10-28 Isis Pharmaceuticals, Inc. Nucleic acid sequences encoding protein kinase C and antisense inhibition of expression thereof
US5691461A (en) * 1990-08-16 1997-11-25 Isis Pharmaceuticals, Inc. Oligonucleotides inhibiting candida germ tube formation
US5734041A (en) * 1995-10-20 1998-03-31 Mcgill University Preparation of chiral phosphorothioate oligomers
WO1999005160A2 (en) * 1997-07-25 1999-02-04 Hybridon, Inc. Oligonuclotides having 3' terminal stereospecific phosphorothioates
US6060456A (en) * 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
US6111094A (en) * 1990-08-14 2000-08-29 Isis Pharmaceuticals Inc. Enhanced antisense modulation of ICAM-1
US6242589B1 (en) * 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages

Family Cites Families (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5118800A (en) 1983-12-20 1992-06-02 California Institute Of Technology Oligonucleotides possessing a primary amino group in the terminal nucleotide
FR2567892B1 (en) 1984-07-19 1989-02-17 Centre Nat Rech Scient NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
FR2575751B1 (en) 1985-01-08 1987-04-03 Pasteur Institut NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS
EP0216860B1 (en) 1985-03-15 1992-10-28 SUMMERTON, James Stereoregular polynucleotide-binding polymers
EP0366685B1 (en) 1987-06-24 1994-10-19 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
CA2058632C (en) 1989-06-05 2004-08-24 Brian C. Froehler Exonuclease-resistant oligonucleotides and methods for preparing the same
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
CA2071510C (en) 1989-10-24 2004-07-06 Chris A. Buhr 2' modified oligonucleotides
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5623065A (en) 1990-08-13 1997-04-22 Isis Pharmaceuticals, Inc. Gapped 2' modified oligonucleotides
US5852188A (en) * 1990-01-11 1998-12-22 Isis Pharmaceuticals, Inc. Oligonucleotides having chiral phosphorus linkages
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5859221A (en) 1990-01-11 1999-01-12 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
HUT63170A (en) 1990-01-11 1993-07-28 Isis Pharmaceuticals Inc Process and composition for detecting and modifying rna activity and gene expression
US5506351A (en) 1992-07-23 1996-04-09 Isis Pharmaceuticals Process for the preparation of 2'-O-alkyl guanosine and related compounds
US5457191A (en) 1990-01-11 1995-10-10 Isis Pharmaceuticals, Inc. 3-deazapurines
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5646265A (en) 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
GB9009980D0 (en) 1990-05-03 1990-06-27 Amersham Int Plc Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides
EP0745689A3 (en) 1990-05-11 1996-12-11 Microprobe Corporation A dipstick for a nucleic acid hybridization assay
CA2083719A1 (en) 1990-05-25 1991-11-26 Mark D. Matteucci "sequence-specific non-photoactivated crosslinking agents which bind to the major groove of duplex dna
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5386023A (en) 1990-07-27 1995-01-31 Isis Pharmaceuticals Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling
US5378825A (en) 1990-07-27 1995-01-03 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs
US5223618A (en) 1990-08-13 1993-06-29 Isis Pharmaceuticals, Inc. 4'-desmethyl nucleoside analog compounds
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
JPH0813274B2 (en) 1990-08-13 1996-02-14 アイシス・ファーマシューティカルス・インコーポレーテッド Sugar modified oligonucleotides for detecting and modulating gene expression
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5124047A (en) 1990-11-01 1992-06-23 W. R. Grace & Co.-Conn. Method of inhibiting scale deposits
US5359052A (en) * 1991-08-05 1994-10-25 Polish Academy Of Sciences Chalcophospholanes useful in the synthesis of oligonucleoside phosphorothioates, phosphorodithioates and related selenates
DE59208572D1 (en) 1991-10-17 1997-07-10 Ciba Geigy Ag Bicyclic nucleosides, oligonucleotides, processes for their preparation and intermediates
CA2122030C (en) 1991-10-24 1997-03-04 Muthiah Manoharan Derivatized oligonucleotides having improved uptake and other properties
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
FR2687679B1 (en) 1992-02-05 1994-10-28 Centre Nat Rech Scient OLIGOTHIONUCLEOTIDES.
US5543507A (en) 1992-03-05 1996-08-06 Isis Pharmaceuticals, Inc. Covalently cross-linked oligonucleotides
US5817781A (en) 1992-06-01 1998-10-06 Gilead Sciences, Inc. Modified internucleoside linkages (II)
EP0577558A2 (en) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
US5516664A (en) 1992-12-23 1996-05-14 Hyman; Edward D. Enzymatic synthesis of repeat regions of oligonucleotides
WO1994022864A1 (en) 1993-03-30 1994-10-13 Sterling Winthrop Inc. Acyclic nucleoside analogs and oligonucleotide sequences containing them
DE4311944A1 (en) 1993-04-10 1994-10-13 Degussa Coated sodium percarbonate particles, process for their preparation and detergent, cleaning and bleaching compositions containing them
US5532130A (en) * 1993-07-20 1996-07-02 Dyad Pharmaceutical Corporation Methods and compositions for sequence-specific hybridization of RNA by 2'-5' oligonucleotides
US5571902A (en) 1993-07-29 1996-11-05 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US5808040A (en) 1995-01-30 1998-09-15 Yale University L-nucleosides incorporated into polymeric structure for stabilization of oligonucleotides
US5986084A (en) 1997-08-18 1999-11-16 Pitsch; Stefan Ribonucleoside-derivative and method for preparing the same

Patent Citations (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4500707A (en) * 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US5132418A (en) * 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4458066A (en) * 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4668777A (en) * 1981-03-27 1987-05-26 University Patents, Inc. Phosphoramidite nucleoside compounds
US4973679A (en) * 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4415732A (en) * 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) * 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4725677A (en) * 1983-08-18 1988-02-16 Biosyntech Gmbh Process for the preparation of oligonucleotides
USRE34069E (en) * 1983-08-18 1992-09-15 Biosyntech Gmbh Process for the preparation of oligonucleotides
US4689320A (en) * 1983-10-17 1987-08-25 Akira Kaji Method for inhibiting propagation of virus and anti-viral agent
US5550111A (en) * 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5235033A (en) * 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) * 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5194428A (en) * 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5286717A (en) * 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) * 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4816571A (en) * 1987-06-04 1989-03-28 Applied Biosystems, Inc. Chemical capping by phosphitylation during oligonucleotide synthesis
US5405939A (en) * 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5188897A (en) * 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5519126A (en) * 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5453496A (en) * 1988-05-26 1995-09-26 University Patents, Inc. Polynucleotide phosphorodithioate
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5004810A (en) * 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) * 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) * 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5455233A (en) * 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5457189A (en) * 1989-12-04 1995-10-10 Isis Pharmaceuticals Antisense oligonucleotide inhibition of papillomavirus
US5681944A (en) * 1989-12-04 1997-10-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides directed to papillomavirus
US5166315A (en) * 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5405938A (en) * 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5670633A (en) * 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5506212A (en) * 1990-01-11 1996-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides with substantially chirally pure phosphorothioate linkages
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
US5658891A (en) * 1990-02-26 1997-08-19 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpesviruses
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5321131A (en) * 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5563253A (en) * 1990-03-08 1996-10-08 Worcester Foundation For Biomedical Research Linear aminoalkylphosphoramidate oligonucleotide derivatives
US5541306A (en) * 1990-03-08 1996-07-30 Worcester Foundation For Biomedical Research Aminoalkylphosphotriester oligonucleotide derivatives
US5536821A (en) * 1990-03-08 1996-07-16 Worcester Foundation For Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
US5470967A (en) * 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5591600A (en) * 1990-05-11 1997-01-07 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus
US5166195A (en) * 1990-05-11 1992-11-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus phosphorothioate oligonucleotides
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5623070A (en) * 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5541307A (en) * 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5677437A (en) * 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) * 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5677439A (en) * 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5580767A (en) * 1990-08-14 1996-12-03 Isis Pharmaceuticals, Inc. Inhibition of influenza viruses by antisense oligonucleotides
US6111094A (en) * 1990-08-14 2000-08-29 Isis Pharmaceuticals Inc. Enhanced antisense modulation of ICAM-1
US5591623A (en) * 1990-08-14 1997-01-07 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US5591720A (en) * 1990-08-16 1997-01-07 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating the effects of cytomegalovirus infections
US5177196A (en) * 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5691461A (en) * 1990-08-16 1997-11-25 Isis Pharmaceuticals, Inc. Oligonucleotides inhibiting candida germ tube formation
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) * 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5596086A (en) * 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5512668A (en) * 1991-03-06 1996-04-30 Polish Academy Of Sciences Solid phase oligonucleotide synthesis using phospholane intermediates
US5242906A (en) * 1991-04-22 1993-09-07 University Of North Carolina At Chapel Hill Antisense oligonucleotides against Epstein-Barr virus
US5582972A (en) * 1991-06-14 1996-12-10 Isis Pharmaceuticals, Inc. Antisense oligonucleotides to the RAS gene
US5582986A (en) * 1991-06-14 1996-12-10 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of the ras gene
WO1994008003A1 (en) * 1991-06-14 1994-04-14 Isis Pharmaceuticals, Inc. ANTISENSE OLIGONUCLEOTIDE INHIBITION OF THE ras GENE
US5571799A (en) * 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5599797A (en) * 1991-10-15 1997-02-04 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5607923A (en) * 1991-10-15 1997-03-04 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating cytomegalovirus having phosphorothioate linkages of high chiral purity
US5587361A (en) * 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5661134A (en) * 1991-10-15 1997-08-26 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity
US5620963A (en) * 1991-10-15 1997-04-15 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating protein kinase C having phosphorothioate linkages of high chiral purity
US5681747A (en) * 1992-03-16 1997-10-28 Isis Pharmaceuticals, Inc. Nucleic acid sequences encoding protein kinase C and antisense inhibition of expression thereof
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) * 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5523389A (en) * 1992-09-29 1996-06-04 Isis Pharmaceuticals, Inc. Inhibitors of human immunodeficiency virus
US5442049A (en) * 1992-11-19 1995-08-15 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating the effects of cytomegalovirus infections
US5476925A (en) * 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5466677A (en) * 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5663312A (en) * 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5514788A (en) * 1993-05-17 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide modulation of cell adhesion
US6060456A (en) * 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
US5625050A (en) * 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
WO1996037504A1 (en) * 1995-05-23 1996-11-28 Hybridon, Inc. Novel synthons for stereoselective oligonucleotide synthesis
WO1996039154A1 (en) * 1995-06-06 1996-12-12 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5734041A (en) * 1995-10-20 1998-03-31 Mcgill University Preparation of chiral phosphorothioate oligomers
WO1999005160A2 (en) * 1997-07-25 1999-02-04 Hybridon, Inc. Oligonuclotides having 3' terminal stereospecific phosphorothioates
US6242589B1 (en) * 1998-07-14 2001-06-05 Isis Pharmaceuticals, Inc. Phosphorothioate oligonucleotides having modified internucleoside linkages

Non-Patent Citations (99)

* Cited by examiner, † Cited by third party
Title
Agrawal et al. (eds.), "Methods of Molecular Biology", in Protocols for Oligonucleotide Conjugates, Agrawal, S. (ed.), Humana Press, New Jersey, 1994, vol. 26, 1-72. *
Albert, P.R. et al., "Antisense knockouts:molecular scalpels for the dissection of signal transduction", Trends Pharmacol. Sci., 1994, 15, 250-254. *
Alul, R.H. et al., "Oxalyl-CPG: a labile support for synthesis of sensitive oligonucleotide derivatives", Nucl. Acid Res., 1991, 19, 1527-1532. *
Ausubel, F.M. et al. (Eds.), Current Protocols in Molecular Biology, Current Publications, 1993. *
Bachelin et al., "Structure of a stereoregular phosphorothioate DNA/RNA duplex," Nat. Struct. Biol., 1998, 5(4), 271-276. *
Baker, B.F. et al., "2'-O-(2-Methoxy)ethyl-modified Anti-intercellular Adhesion Molecule 1 (ICAM-1) Oligonucleotides Selectively Increase the ICAM-1 Translation Initiation Complex in Human Umbilical Vein Endothelial Cells". J. Biol. Chem., 1997, 272, 11994-12000. *
Beaucage, S.L. et al., "Advances in the Synthesis of Oligonucleotides by the Phosphoramidite Approach", Tetrahedron, 1992, 48, 2223-2311. *
Berkow et al. (eds.), The Merck, Manual of Diagnosis and Therapy, Rahway, N.J., 1987, 15th Edition, 2263-2277, 2283-2292, 2301-2310. *
Bernhard et al., "Direct Evidence Linking Expression of Matrix Metalloproteinase 9 (92-kDa gelatinase/collagenase) to the metastatic phenotype in transformed rat embryo cells," Proc. Natl. Acad. Sci. USA, 1994, 91, 4293-4297. *
Birkedal-Hansen, "Proteolytic Remodeling of Extracellular Matrix," Curr. Op. Cell Biol., 1995, 7, 728-735. *
Boggemeyer et al., "Borrelia Burgdorferi Upregulates the Adhesion Molecules E-selecin. P-Selectin. ICAM-1 and VCAM-1 on Mouse Endothelioma Cells in vitro." Cell Adhes. Commun., 1994, 2, 145-157. *
Brown, T. et al., "A New Base-stable Linker for Solid-Phase Oligonucleotide Synthesis," J.Chem. Soc. Chem. Comm., 1989, 891-893. *
Burgers, P.M.J. et al., "A Study of the Mechanism of DNA Polymerase I from Escherichia coli with Diastereometric Phosphorothioate Analogs of Deoxyadenosine Triphosphate", J. Biol. Chem., 1979, 254, 6889-6893. *
Cook, P.D., "Medicinal chemistry of antisense oligonucleotides-future opportunities", Anti-Cancer Drug Design, 1991, 6, 585-607. *
Crooke, S.T. et al., "Kinetic characteristics of Escherichia coli RNase H1: cleavage of various antisense oligonucleotide-RNA duplexes", Biochem. J., 1995, 312, 599-608. *
Crooke, S.T. et al., "Pharmacokinetic Properties of Several Novel Oligonucleotide Analogs in mice", J. Pharmacol. Exp. Therapeutics, 1996, 277, 923-937. *
Crooke, S.T. et al., "Progress in Antisense Oligonucleotide Therapeutic", Ann. Rev. Pharmacol. Toxicol. 1996, 36, 107-129. *
Damha, M.J. et al., "An improved procedure for derivatization of controlled-pore glass beads for solid-phase oligonucleotide synthesis", Nucl. Acids Res., 1990, 18, 3813-3821. *
Dean, N.M. et al., "Inhibition of protein kinase C-alphaexpression in mice after systemic administration of posphorthioate antisense oligodeoxynucledotides", Proc. Natl. Acad. Sci., 1994, 91, 11762-11766. *
Delgado, C. et al., "The Uses and Properties of PEG-Linked Proteins", Crit. Rev. in Therapeutic Drug Carrier Sys., 1992, 9, 249-304. *
DeLisser et al., "Molecular and Functional Aspects of PECAM-1/CD31," Immunol. Today, 1994, 15(10), 490-494. *
Dimock et al., "An efficient multigram synthesis of monomers for the preparation of novel oligonucleotides containing isosteric non-phosphorous backbones", Nucleosides &Nucleotides, 1997, 16(7-9), 1629-1632. *
Downward, "The ras Superfamily of Small GTP-binding proteins," TIBS, 15, 1990, 469-472. *
Efimov, V.A. et al., "New efficient sulfurizing reagents for the preparation of oligodeoxyribonucleotide phosphorothioate analogues", Nucl. Acids Res., 1995, 23, 4029-4033. *
Eliel, E.L. et al. "Highly Stereoselective Syntheses Involving N-Alkyl-4,4,7alpha-trimethyl-trans-octahydro-1,3-benzoxazine Intermediates," J. Org. Chem., 1990, 55, 2114-2119. *
Eliel, E.L. et al., "Asymmetric Syntheses Based on 1,3-Oxathianes. 1. Scope of the Reactions," J. Am. Chem. Soc., 1984, 106(10), 2937-2942. *
Eliel, E.L. et al., "Asymmetric Synthesis of (R)-(+)-Ethylmethyl-n-Propylcarbinol in High Enantiometric Purity. A 1,3-Oxathiane Detrived from (+)-Pulegone as Chiral Adjuvant," Terra Lett., 1981, 22(30), 2855-2858. *
Eliel, E.L. et al., "Neighboring Group Participation by Sulfur Involving Four-Membered-Ring Intermediates (RS-4)," J. Am. Chem. Soc., 1985, 107(10), 2946-2952. *
Eliel, E.L. et al., "Neighboring Group Particiption by Oxygen in the Solvolysis of Acyclic gamma-Alkoxy Substituted rho-Toluensesulfonates," J. Org. Chem., 1985, 50, 2707-2711. *
Englicsh, U. et al., "Chemically Modified Oligonucleotides as Probes and Inhibitors", Angew. Chem. Int. Ed. Eng., 1991, 30, 613-629. *
Froehler, B.C., "Oligodeoxynucleotides Synthesis: H-Phosphonate Approach," in Protocols for Oligonuceleotides and Analogs: Synthesis and Properties, Agrawal S. (ed.), Humana Press, 1993, Ch. 4, 63-80. *
Gait, M. J. ed., "An Introduction to Modern Methods of DNA Synthesis," Oligonucleotide Synthesis, A Practical Approach, IRL Press, Oxford, 1985, IRL Press, Oxford, Ch. 1, 1-22. *
Green and Wuts, Protective Groups in Organic Synthesis, 2d edition, John Wiley & Sons, New York, 1991. *
Griffiths, A.D. et al., "Stereospecificity of nucleases towards phosphorothioate-substituted RNA: stereochemistry of transcription by T7 RNA polymerase," Nucl. Acids Res., 1987, 15(10), 4145-4162. *
Griffiths, C.E.M. et al., "Keratinocyte Intercellular Adhesion Molecule-1 (ICAM-1) Expression Preceedes Derman T Lymphocyte Infiltration in Allegric Contact Dermatitis (Rhus dermatitis )", Am. J. Pathology., 1989, 135, 1045-1053. *
Gum et al., "Stimulation of 92-kDa Gelatinase B Promoter Activity by ras Is Mitogen-activated Protein Kinase Kinase 1-independent and Requires Multiple Transcription Factor Binding Sites Including Closely Spaced PEA3/ets and AP-1 Sequences," J. Biol. Chem., 1996, 271(18), 10672-10680. *
Guzavez et al., "Synthesis of <SUP>14</SUP>C-Radiolabeled Oligonucleotides with a Novel Phosphoramidite Reagent", Bioorg. Med. Chem. Lett. 1998, 8, 1123-1126. *
Hacia, J.G. et al., "Phosphorothioate Oligonucleotide-Directed Triple Helix Formation," Biochem., 1994, 33, 5367-5369. *
Hakugawa et al., "The Inhibitory Effect of Anti-Adhesion Molecule Antibodies on Eosinophil Infiltration in Cutaneous Late Phase Response in Balb/c Mice Sensitized with Oval-bumin (OVA)," J. Dermatol., 1997, 24, 73-79. *
Hamm, M. L. et al., "Incorporation of 2'-Deoxy-2'-mercaptocytidine into Oligonucleotides via Phosphoramidite Chemistry," J. Org. Chem, 1997, 62, 3415-3420. *
He, X-C. et al., "Highly Enantioselective Syntheses of alpha-Hydroxyacids Using N-Benzyl-4,4,7alphaTrimethyl-Trans-Octahydro-1,3-Benzoxazine as a Chiral Adjuvant," Tetrahedron, 1987, 43(21), 4979-4987. *
Hegemann, L. et al. "Biochemical Pharmacology of Protein Kinase C and its Relevance for Dermatology", Pharmacology of the Skin, Mukhtar, H. (ed.), CRC Press, Boca Raton, 1992, Ch.22, 357-268. *
Himelstein et al., "Metalloproteinases in Tumor Progression: The Contribution of MMP-9," Invasion & Metastsis, 1994-95, 14, 246-258. *
Ho, V.C. et al., "Treatment of severe lichen planus with cyclosporine", J. Am. Acad. Dermatol., 1990, 22, 64-68. *
Hua et al., "Inhibition of Matrix Metalloproteinase 9 Expression by a Ribozyme Blocks Metastasis in a Rat Sarcoma Model System," Cancer Res., 1996, 56, 5279-5284. *
Hurtenback et al. "Prednisolone Reduces Experimental Arthritis and Inflammatory Tissue Destruction in Scid Mice Infected with Borrelia Burgdorferi," Int. J. Immunopharmac, 1996, 18(5), 281-288. *
Iyer, R.P. et al., "3H-1,2-Benzodithiole-3-one, 1.1-Dioxide as an Improved Sulfurizing Reagent in the Solid-Phase Synthesis of Oligodeoxyribonucleoside Phosphorothioates", J. Am. Chem, Soc., 1990, 112, 1253-1254. *
Iyer, R.P. et al., "The Automated Synthesis of Sulfur-Containing Oligodeoxyribonucleotides Using 3H-1, 2-Benzodithiol-3-one 1,1-Dioxide as a Sulfur-Transfer Reagent", J. Org. Chem., 1990, 55, 4693-4699. *
Jin, Y. et al., "Stereoselective Synthesis of Dithymidine Phosphorothioates Using Xylose Derivatives as Chiral Auxiliaries," J. Org. Chem., 1998, 63, 3647-3654. *
Jung, M.E., "New Gem- and Vic-Disubstituent Effects on Cyclizations," Synlett, 1999, S1, 843-846. *
Kabanov, A.V., "A new class of antivirals: antisense olgonucleotides combined with a hydrophobic substituent effectively inhibit influenza virus reproduction and synthesis of virus-specific proteins in MDCK cells", FEBS Letts., 1990, 259, 327-330. *
Kamer, P.C.J. et al., "An Efficient Approach Toward the Synthesis of Phosphorotioate Diesters via the Schonberg Reaction", Tetrahedron Letts, 1989, 30, 6757-6760. *
Katocs, A.S. et al., "Biological Testing", Remington's Pharmaceutical Sciences, 18th Ed., Gennaro (ed.). Mack Publishing Co., Easton, PA. 1990. Ch. 27, 484-494. *
Kerr et al., "Growth Factors Regulate Transin Gene Expression by c-fos-Dependent and c-fos-Independent Pathways," Science, 1988, 242, 1424-1427. *
Kerr et al., "TGF-beta1 Inhibition of Transin/Stromelysin Gene Expression is Mediated Through a Fos Binding Sequence," Cell, 1990, 61, 267-278. *
Koziolkewicz, M. et al., "Stability of Stereoregular Oligo-(nucleoside phosphorothioate) s in Human Cells: Diastereoselectivity of Cellular 3'-Exonuclease," Nucleosides & Nucleoides, 1997, 16(7-9), 1677-1682. *
Koziolkewicz, M. et al., "Stereodifferentiation-the effect of P chirality of oligo(nucleoside phosphorothioates) on the activity of bacterial RNase H," Nucl. Acids Res., 1995, 23(24), 5000-5005. *
Koziolkiewicz, M. et al., "Stability of Stereoregular Oligo-(nucleoside Phosphorothioate)s in Human Plasma: Diastereoselectiviy of Plasma 3'-Exonuclease," Antisense Nucl. Acid Drug Dev., 1997, 7, 43-48. *
Koziolkiewicz. M. et al., "Enzymatic Assignment of Diastereomeric Purity of Stereodefined Phosphorothioate Oligonucleotides," Antisense Nucl. Acid Drug Dev., 1999, 9, 171-181. *
Kroschwitz, J.I., "Polynucleotides", Concise Encyclopedia of Polymer Science and Engineering, 1990, John Wiley & Sons, New York, 858-859. *
Lackey, D.B. et al., "Biochemical synthesis of chirally pure Rp oligonucleotide phosphorothioates," Biotechnol Lett., 1997, 19(5), 475-478. *
Letsinger, R.L. et al., "Cholesteryl-conjugated oligonucleotides: Synthesis, properties and activity as inhibitors of replication of human immunodeficiency virus in cell culture", Proc. Natl. Acad. Sci., 1989, 86, 6553-6556. *
Lima, W.F. et al., "Binding Affinity and Specificity of Escherichia coli Rnas H1: Impact on the Kinetics of Catalysis of Antisense Oligonucleotide-RNA Hybrids," Biochemistry, 1997, 36, 390-398. *
Lisby, S. et al., "Intercellular adhesion molecule-1 (ICAM-1) expression correlated to inflammation", Br. J. Dermatol., 1989, 120, 479-484. *
Litwin et al., "Novel Cytokine-independent Induction of Endothelial Adhesion Molecules Regulated by Platelet/Endothelial Cell Adhesion Molecule (CD31)," J. Cell Biol., 1997, 13911), 219-228. *
Ludwig, J. et al., "Rapid and Efficient Synthesis of Nucleoside 5'-O-(1-Thiotriphosphates), 5'-Triphosphates and 2',3'-Cycloposphorothioates Using 2'Chloro-4H-1,3, 2-benzodioxaphosphorin-4-one", J. Org. Chem., 1989, 54, 631-635. *
Lynch et al., "Asymmetric Synthesis Based on 1,3-Oxathianes. 2. Syntheses of Chiral Ternary alpha-Hydroxy Aldehydes, alpha-Hydroxy Acids, Glycols (RR'C(OH)CH<SUB>2</SUB>OH), and Carbinols (RR'C(OH)CH<SUB>3 </SUB>) in High Enantiomeric Purity," J. Am. Chem. Soc., 1984, 106, 2943-2948. *
Manoharan M. et al., "Cholic Acid-Oligonucleotide Conjugates for Antisense Applications", Bioorganic Med. Chem. Letts. 1994, 4, 1053-1060. *
Manoharan M. et al., "Oligonucleotide Conjugates: Alteration of the Pharmacokinetic Properties of Antisense Agents", Nucleosides and Nucleotides, 1995, 14, 969-973. *
Manoharan, M. et al., "Chemical Modifications to Improve Uptake and Bioavailability of Antisense Oligonucleotides", Annals NY Acad. Sciences, 1992, 660, 306-309. *
Manoharan, M. et al., "Introduction of a Lipophilic Thioether Tether in the Minor Groove of Nucleic Acids for Antisense Applications", Bioorg. Med. Chem. Letts., 1993, 3, 2765-2770. *
Manoharan, M. et al., "Lipidic Nucleic Acids", Tetrahedron Letts., 1995, 36, 3651-3654. *
Martin P., "Ein neuer Zugang zu 2-40 -O-Alkylribonucleosiden und Eigenschaften deren Oligonucleotide", Helvetica Chemica Acta, 1995, 78, 486-504. *
Minshull, J. et al., "The use of single-stranded DNA and RNase H to promote quantitative 'hybrid arrest of translation' of mRNA/DNA hybrids in reticulocyte lysate cell-free translations", Nucl. Acids. Res., 1986, 14., 6433-6451. *
Mishra, R.K. et al., "Improved leishmanicidal effect of phosphorotioate antisense oligonucleotides by LDL-medicated delivery", Biochim. Et Biophysica. 1995, 1264, 229-237. *
Newman, "Perspective Series: Cell Adhesion in Vascular Biology," The Biology of PECAM-1J. Clin.Invest., 1997, 99(1), 3-7. *
Nies, A.S. et al., "Principles of Therapeutics", Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. (eds.), McGraw-Hill, New York, NY, 1996. Ch. 3, 43-62. *
Oberhauser, B. et al., "Effective incorporation of 2'-O-methyl-oligonucleotides into liposomes and enhanced cell association through modification with thiocholesterol", Nucl. Acids Res., 1992, 20, 533-538. *
Ouchi, T. et al., "Synthesis and Antitumor Activity of Poly (Ethylene Glycol)s Linked to 5'-Fluorouracil via a Urethane or Urea Bond", Drug Des. & Disc., 1992, 9, 93-105. *
Polushin, N. N. et al., "Synthesis of Oligonucleotides Containing 2'-Azido-and 2'-Amino-2'-deoxyuridine Using Phosphotriester Chemistry," Tetrahedron Letts., 1996, 37(19), 3227-3230. *
Rao, M.W. et al., "Dibenzoyl Terrasulphide-A Rapid Sulphur Transfer Agent in the Synthesis of Phosphorothioate Analogues of Oligonucleotides", Tetrahedron Letts., 1992, 33, 4839-4842. *
Ravasio, N. et al., "Selective Hydrogenations Promoted by Copper Catalysts 1. Chemoselectivity, Regioselectivity, and Stereoselectivity in the Hydrogenation of 3-Substituted Steroids", J. Org. Chem., 1991, 56, 4329-4333. *
Regezi et al., "Vascular adhesion molecules in oral lichen planus", Oral Surg. Oral Med. Oral Pathol., 1996, 81, 682-690. *
Ruoslahti, "How Cancer Spreads," Sci. Am., 1996, 72-77. *
Saison-Behmoaras, T. et al., "Short modified antisense oligonucleotides directed against Ha-ras point mutation induce selective cleavage of the mRNA and inhibit T24 cells proliferation", EMBO J., 1991, 10, 1111-1118. *
Sambrook, J. et al. (Eds.), Molecular Cloning, A Laboratory Manual, Second Ed., Cold Spring Harbor Laboratory Press, 1989. *
Sanghvi et al., "Concept, Discovery and Development of MMI Linkage: Story of a Novel Linkage for Antisense Contructs", Nucleosides & Nucleotides, 1997, 16(7-9), 907-916. *
Sanghvi, Y.S., "Heterocyclic Base Modifications in Nucleic acids and their Applications in Antisense Oligonucleotides", Antisense Research and Applications, Crooke et al. (Eds.), CRC Press, Boco Raton, 1993, Chapter 15, 273-288. *
Secrist, J.A. et al., "Synthesis and Biological Activity of 4'-Thionucleosides", 10th International Rowntable: Nucleosides. Nucleotides and their Biological ApplicationsSep. 16-20 1992, Abstract 21, Park City, Utah, 40. *
Shea, R.G. et al., "Synthesis, hybridization properties and antiviral activity of lipid-oligodeoxynucletide conjugates", Nucl. Acids Res., 1990, 18, 3777-3783. *
Shiohara et al., "Fixed drug Eruption: Expression of Epidermal Keratinocyte Intercellular Adhesion Molecule-1 (ICAM-1)", Arch. Dermatol., 1989, 125, 1371-1376. *
Sierzchala, A. et al., "Oxathiaphospholane Method of Stereocontrolled Synthesis of Diribonucleoside 3', 5'-Phosphorotiates," J. Org. Chem., 1996, 61, 6713-6716. *
Stetler-Stevenson et al., "Tumor Cell Interactions with the Extracellular Matrix During Invasion and Metastasis, " Annu. Rev. Cell Biol., Palade, G.E. et al. (eds.), 1993, 9, 541-573. *
Svinarchuk, F.P. et al., "Inhibition of HIV proliferation in MT-4 cells by antisense oligonucleotide conjugated to lipophilic groups", Biochimie, 1993, 79, 49-54. *
Swayze et al., "The Synthesis of N,N'-O-Trisubstituted Hydroxylamines via a Mild Reductive Aklylation Procedure: An Improved Synthesis of the MMI Backbone", Synlett, 1997, 859-861. *
Swayze et al., "The Synthesis of the Sixteen Possible 2'-O-Methyl MMI Dimer Phosphoramidites: Building Blocks for the Synthesis of Novel Antisense Oligonucleotides", Nucleosides & Nucleotides, 1997, 16(7-9), 971-972. *
U.S. Congress, Office of Technology Assessment, "The State-of-the-art in Genetic Screening", Genetic Monitoring and Screening in the Workplace, OTA-BA-455, U.S. Government Printing Office, Washington, D.C., 1990, Ch. 5, 75-99. *
Wahlestedt, C. et al., "Antisense oligodeoxynucleotides to NMDA-R1 receptor channel protect cortical neurons from excitotoxicity and reduce focal ischaemic infarctions", Nature, 1993, 363, 260-263. *
Wahlestedt, C. et al., "Modulation of Anxiety and Neuropeptide Y-Y1 Receptors by Antisense Oligodeoxynucleotides", Science, 1993, 259, 528-531. *

Cited By (232)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080103137A1 (en) * 2002-01-07 2008-05-01 Eisai Co., Ltd. Deazapurines and uses thereof
US7868002B2 (en) 2002-01-07 2011-01-11 Eisai R&D Management Co., Ltd. Deazapurines and uses thereof
US20110105427A1 (en) * 2002-01-07 2011-05-05 Jane Daun Deazapurines and uses thereof
US8691814B2 (en) 2002-01-07 2014-04-08 Eisai R&D Management Co., Ltd. Deazapurines and uses thereof
US7314936B2 (en) 2002-01-07 2008-01-01 Eisai Co., Ltd. Deazapurines and uses thereof
US9394333B2 (en) 2008-12-02 2016-07-19 Wave Life Sciences Japan Method for the synthesis of phosphorus atom modified nucleic acids
US10329318B2 (en) 2008-12-02 2019-06-25 Wave Life Sciences Ltd. Method for the synthesis of phosphorus atom modified nucleic acids
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
US10307434B2 (en) 2009-07-06 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
EP4385568A2 (en) 2010-04-06 2024-06-19 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of cd274/pd-l1 gene
EP3456827A2 (en) 2010-06-02 2019-03-20 Alnylam Pharmaceuticals, Inc. Compositions and methods directed to treating liver fibrosis
WO2011153323A2 (en) 2010-06-02 2011-12-08 Alnylam Pharmaceuticals, Inc. Compositions and methods directed to treating liver fibrosis
US10428019B2 (en) 2010-09-24 2019-10-01 Wave Life Sciences Ltd. Chiral auxiliaries
WO2012079046A2 (en) 2010-12-10 2012-06-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of klf-1 and bcl11a genes
WO2012078967A2 (en) 2010-12-10 2012-06-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for increasing erythropoietin (epo) production
EP3674409A1 (en) 2011-03-29 2020-07-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of tmprss6 gene
EP3460064A1 (en) 2011-04-03 2019-03-27 The General Hospital Corporation d/b/a Massachusetts General Hospital Efficient protein expression in vivo using modified rna (mod-rna)
WO2012138453A1 (en) 2011-04-03 2012-10-11 The General Hospital Corporation Efficient protein expression in vivo using modified rna (mod-rna)
EP3444348A1 (en) 2011-06-21 2019-02-20 Alnylam Pharmaceuticals, Inc. Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof
WO2012177784A2 (en) 2011-06-21 2012-12-27 Alnylam Pharmaceuticals Angiopoietin-like 3 (angptl3) irna compostions and methods of use thereof
EP4092120A1 (en) 2011-06-21 2022-11-23 Alnylam Pharmaceuticals, Inc. Angiopoietin-like 3 (anglptl3) irna compositions and methods of use thereof
EP3656860A1 (en) 2011-06-21 2020-05-27 Alnylam Pharmaceuticals, Inc. Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof
EP3366312A1 (en) 2011-06-23 2018-08-29 Alnylam Pharmaceuticals, Inc. Serpina 1 sirnas: compositions of matter and methods of treatment
EP4134433A1 (en) 2011-06-23 2023-02-15 Alnylam Pharmaceuticals, Inc. Serpina1 sirnas: compositions of matter and methods of treatment
EP3597750A1 (en) 2011-06-23 2020-01-22 Alnylam Pharmaceuticals, Inc. Serpina1 sirnas: compositions of matter and methods of treatment
WO2012178033A2 (en) 2011-06-23 2012-12-27 Alnylam Pharmaceuticals, Inc. Serpina1 sirnas: compositions of matter and methods of treatment
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
WO2013019857A2 (en) 2011-08-01 2013-02-07 Alnylam Pharmaceuticals, Inc. Method for improving the success rate of hematopoietic stem cell transplants
US12522873B2 (en) 2011-10-21 2026-01-13 Foundation Medicine, Inc. ALK and NTRK1 fusion molecules and uses thereof
EP3868883A1 (en) 2012-04-10 2021-08-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
EP3284824A1 (en) 2012-04-10 2018-02-21 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
WO2013155204A2 (en) 2012-04-10 2013-10-17 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
EP4209592A1 (en) 2012-04-26 2023-07-12 Genzyme Corporation Serpinc1 irna compositions and methods of use thereof
US9598458B2 (en) 2012-07-13 2017-03-21 Wave Life Sciences Japan, Inc. Asymmetric auxiliary group
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
WO2014012081A3 (en) * 2012-07-13 2014-03-06 Ontorii, Inc. Chiral control
US10590413B2 (en) 2012-07-13 2020-03-17 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
WO2014071358A2 (en) 2012-11-05 2014-05-08 Foundation Medicine, Inc. Novel ntrk1 fusion molecules and uses thereof
US12378302B2 (en) 2012-11-05 2025-08-05 Foundation Medicine, Inc. Fusion molecules and uses thereof
US11578372B2 (en) 2012-11-05 2023-02-14 Foundation Medicine, Inc. NTRK1 fusion molecules and uses thereof
US11771698B2 (en) 2013-01-18 2023-10-03 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
US12274699B2 (en) 2013-01-18 2025-04-15 Foundation Medicine, Inc. Methods of treating cholangiocarcinoma
WO2014130922A1 (en) 2013-02-25 2014-08-28 Trustees Of Boston University Compositions and methods for treating fungal infections
EP4649950A2 (en) 2013-03-14 2025-11-19 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
EP3312281A2 (en) 2013-03-14 2018-04-25 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
EP4286517A2 (en) 2013-04-04 2023-12-06 President and Fellows of Harvard College Therapeutic uses of genome editing with crispr/cas systems
EP3587578A1 (en) 2013-05-22 2020-01-01 Alnylam Pharmaceuticals, Inc. Tmprss6 irna compositions and methods of use thereof
EP3828276A1 (en) 2013-05-22 2021-06-02 Alnylam Pharmaceuticals, Inc. Tmprss6 irna compositions and methods of use thereof
WO2014190157A1 (en) 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. Tmprss6 compositions and methods of use thereof
WO2014190137A1 (en) 2013-05-22 2014-11-27 Alnylam Pharmaceuticals, Inc. SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2014197835A2 (en) 2013-06-06 2014-12-11 The General Hospital Corporation Methods and compositions for the treatment of cancer
WO2015050990A1 (en) 2013-10-02 2015-04-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
EP3693463A1 (en) 2013-10-04 2020-08-12 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the alas1 gene
EP3502270A1 (en) 2013-10-21 2019-06-26 The General Hospital Corporation Methods relating to circulating tumor cell clusters and the treatment of cancer
EP3967770A1 (en) 2013-10-21 2022-03-16 The General Hospital Corporation Methods relating to circulating tumor cell clusters and the treatment of cancer
EP3683321A2 (en) 2013-10-21 2020-07-22 The General Hospital Corporation Methods relating to circulating tumor cell clusters and the treatment of cancer
WO2015061091A1 (en) 2013-10-21 2015-04-30 The General Hospital Corporation Methods relating to circulating tumor cell clusters and the treatment of cancer
EP3865144A1 (en) 2013-12-20 2021-08-18 The General Hospital Corporation Methods and assays relating to circulating tumor cells
WO2015095527A1 (en) 2013-12-20 2015-06-25 The General Hosptial Corporation Methods and assays relating to circulating tumor cells
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
EP3960860A2 (en) 2014-02-11 2022-03-02 Alnylam Pharmaceuticals, Inc. Ketohexokinase (khk) irna compositions and methods of use thereof
WO2015123264A1 (en) 2014-02-11 2015-08-20 Alnylam Pharmaceuticals, Inc. Ketohexokinase (khk) irna compositions and methods of use thereof
WO2015175510A1 (en) 2014-05-12 2015-11-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating a serpinc1-associated disorder
WO2015179724A1 (en) 2014-05-22 2015-11-26 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
EP3739048A1 (en) 2014-05-22 2020-11-18 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2015187541A1 (en) 2014-06-02 2015-12-10 Children's Medical Center Corporation Methods and compositions for immunomodulation
EP4043567A1 (en) 2014-08-29 2022-08-17 Children's Medical Center Corporation Methods and compositions for the treatment of cancer
WO2016040589A1 (en) 2014-09-12 2016-03-17 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting complement component c5 and methods of use thereof
EP4039809A1 (en) 2014-10-10 2022-08-10 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression
WO2016057893A1 (en) 2014-10-10 2016-04-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression
WO2016061487A1 (en) 2014-10-17 2016-04-21 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting aminolevulinic acid synthase-1 (alas1) and uses thereof
EP3904519A1 (en) 2014-10-30 2021-11-03 Genzyme Corporation Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
WO2016069694A2 (en) 2014-10-30 2016-05-06 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting serpinc1 (at3) and methods of use thereof
WO2016077321A1 (en) 2014-11-10 2016-05-19 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
EP4647079A2 (en) 2014-11-10 2025-11-12 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
EP3647424A1 (en) 2014-11-10 2020-05-06 Alnylam Pharmaceuticals, Inc. Hepatitis b virus (hbv) irna compositions and methods of use thereof
WO2016081444A1 (en) 2014-11-17 2016-05-26 Alnylam Pharmaceuticals, Inc. Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof
WO2016130806A2 (en) 2015-02-13 2016-08-18 Alnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
EP4269601A2 (en) 2015-03-27 2023-11-01 President and Fellows of Harvard College Modified t cells and methods of making and using the same
WO2016164746A1 (en) 2015-04-08 2016-10-13 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2016176745A1 (en) 2015-05-06 2016-11-10 Benitec Biopharma Limited Reagents for treatment of hepatitis b virus (hbv) infection and use thereof
WO2016201301A1 (en) 2015-06-12 2016-12-15 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions and methods of use thereof
WO2016205323A1 (en) 2015-06-18 2016-12-22 Alnylam Pharmaceuticals, Inc. Polynucleotde agents targeting hydroxyacid oxidase (glycolate oxidase, hao1) and methods of use thereof
WO2016209862A1 (en) 2015-06-23 2016-12-29 Alnylam Pharmaceuticals, Inc. Glucokinase (gck) irna compositions and methods of use thereof
WO2017011286A1 (en) 2015-07-10 2017-01-19 Alnylam Pharmaceuticals, Inc. Insulin-like growth factor binding protein, acid labile subunit (igfals) and insulin-like growth factor 1 (igf-1) irna compositions and methods of use thereof
US10479995B2 (en) 2015-07-22 2019-11-19 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
CN108135921B (en) * 2015-07-22 2023-10-17 波涛生命科学有限公司 Oligonucleotide compositions and methods
US12486505B2 (en) 2015-07-22 2025-12-02 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
US11634710B2 (en) * 2015-07-22 2023-04-25 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
CN108135921A (en) * 2015-07-22 2018-06-08 波涛生命科学有限公司 Oligonucleotide compositions and methods thereof
WO2017040078A1 (en) 2015-09-02 2017-03-09 Alnylam Pharmaceuticals, Inc. PROGRAMMED CELL DEATH 1 LIGAND 1 (PD-L1) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
EP4393495A2 (en) 2015-09-02 2024-07-03 Alnylam Pharmaceuticals, Inc. Programmed cell death 1 ligand 1 (pd-l1) irna compositions and methods of use thereof
EP4424828A1 (en) 2015-12-07 2024-09-04 Genzyme Corporation Methods and compositions for treating a serpinc1-associated disorder
US11234994B2 (en) 2016-04-14 2022-02-01 Benitec Biopharma Limited Reagents for treatment of oculopharyngeal muscular dystrophy (OPMD) and use thereof
WO2017184689A1 (en) 2016-04-19 2017-10-26 Alnylam Pharmaceuticals, Inc. High density lipoprotein binding protein (hdlbp/vigilin) irna compositions and methods of use thereof
US10724035B2 (en) 2016-05-04 2020-07-28 Wave Life Sciences Ltd. Oligonucleotide compositions and methods thereof
WO2017214518A1 (en) 2016-06-10 2017-12-14 Alnylam Pharmaceuticals, Inc. COMPLETMENT COMPONENT C5 iRNA COMPOSTIONS AND METHODS OF USE THEREOF FOR TREATING PAROXYSMAL NOCTURNAL HEMOGLOBINURIA (PNH)
WO2018112320A1 (en) 2016-12-16 2018-06-21 Alnylam Pharmaceuticals, Inc. Methods for treating or preventing ttr-associated diseases using transthyretin (ttr) irna compositions
WO2018195165A1 (en) 2017-04-18 2018-10-25 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (hbv) infection
EP4588512A2 (en) 2017-07-10 2025-07-23 Genzyme Corporation Methods and compositions for treating a bleeding event in a subject having hemophilia
WO2019014530A1 (en) 2017-07-13 2019-01-17 Alnylam Pharmaceuticals Inc. Lactate dehydrogenase a (ldha) irna compositions and methods of use thereof
WO2019089922A1 (en) 2017-11-01 2019-05-09 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof
WO2019099610A1 (en) 2017-11-16 2019-05-23 Alnylam Pharmaceuticals, Inc. Kisspeptin 1 (kiss1) irna compositions and methods of use thereof
WO2019100039A1 (en) 2017-11-20 2019-05-23 Alnylam Pharmaceuticals, Inc. Serum amyloid p component (apcs) irna compositions and methods of use thereof
WO2019126097A1 (en) 2017-12-18 2019-06-27 Alnylam Pharmaceuticals, Inc. High mobility group box-1 (hmgb1) irna compositions and methods of use thereof
EP4324520A2 (en) 2018-05-14 2024-02-21 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2019222166A1 (en) 2018-05-14 2019-11-21 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2020036862A1 (en) 2018-08-13 2020-02-20 Alnylam Pharmaceuticals, Inc. HEPATITIS B VIRUS (HBV) dsRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2020037125A1 (en) 2018-08-16 2020-02-20 Alnylam Pharmaceuticals Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2020060986A1 (en) 2018-09-18 2020-03-26 Alnylam Pharmaceuticals, Inc. Ketohexokinase (khk) irna compositions and methods of use thereof
US10913951B2 (en) 2018-10-31 2021-02-09 University of Pittsburgh—of the Commonwealth System of Higher Education Silencing of HNF4A-P2 isoforms with siRNA to improve hepatocyte function in liver failure
US12485136B2 (en) 2018-12-03 2025-12-02 Takeda Pharmaceuticals U.S.A., Inc. Methods for the treatment of trinucleotide repeat expansion disorders associated with MLH3 activity
EP4656656A2 (en) 2018-12-20 2025-12-03 Humabs BioMed SA Combination hbv therapy
WO2020132521A1 (en) 2018-12-20 2020-06-25 Praxis Precision Medicines, Inc. Compositions and methods for the treatment of kcnt1 related disorders
WO2020132346A1 (en) 2018-12-20 2020-06-25 Vir Biotechnology, Inc. Combination hbv therapy
EP4285929A2 (en) 2018-12-20 2023-12-06 Humabs Biomed SA Combination hbv therapy
WO2020150431A1 (en) 2019-01-16 2020-07-23 Genzyme Corporation Serpinc1 irna compositions and methods of use thereof
WO2020232024A1 (en) 2019-05-13 2020-11-19 Vir Biotechnology, Inc. Compositions and methods for treating hepatitis b virus (hbv) infection
WO2021022109A1 (en) 2019-08-01 2021-02-04 Alnylam Pharmaceuticals, Inc. SERPIN FAMILY F MEMBER 2 (SERPINF2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021022108A2 (en) 2019-08-01 2021-02-04 Alnylam Pharmaceuticals, Inc. CARBOXYPEPTIDASE B2 (CPB2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021030522A1 (en) 2019-08-13 2021-02-18 Alnylam Pharmaceuticals, Inc. SMALL RIBOSOMAL PROTEIN SUBUNIT 25 (RPS25) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2021046122A1 (en) 2019-09-03 2021-03-11 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of the lect2 gene
WO2021067747A1 (en) 2019-10-04 2021-04-08 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing ugt1a1 gene expression
US12503699B2 (en) 2019-10-04 2025-12-23 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing UGT1a1 gene expression
WO2021076828A1 (en) 2019-10-18 2021-04-22 Alnylam Pharmaceuticals, Inc. Solute carrier family member irna compositions and methods of use thereof
WO2021081026A1 (en) 2019-10-22 2021-04-29 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof
WO2021087325A1 (en) 2019-11-01 2021-05-06 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing dnajb1-prkaca fusion gene expression
WO2021087036A1 (en) 2019-11-01 2021-05-06 Alnylam Pharmaceuticals, Inc. HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2021096763A1 (en) 2019-11-13 2021-05-20 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
WO2021102373A1 (en) 2019-11-22 2021-05-27 Alnylam Pharmaceuticals, Inc. Ataxin3 (atxn3) rnai agent compositions and methods of use thereof
WO2021119226A1 (en) 2019-12-13 2021-06-17 Alnylam Pharmaceuticals, Inc. Human chromosome 9 open reading frame 72 (c9orf72) irna agent compositions and methods of use thereof
WO2021126734A1 (en) 2019-12-16 2021-06-24 Alnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
WO2021154941A1 (en) 2020-01-31 2021-08-05 Alnylam Pharmaceuticals, Inc. Complement component c5 irna compositions for use in the treatment of amyotrophic lateral sclerosis (als)
WO2021163066A1 (en) 2020-02-10 2021-08-19 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing vegf-a expression
WO2021167841A1 (en) 2020-02-18 2021-08-26 Alnylam Pharmaceuticals, Inc. Apolipoprotein c3 (apoc3) irna compositions and methods of use thereof
WO2021178607A1 (en) 2020-03-05 2021-09-10 Alnylam Pharmaceuticals, Inc. Complement component c3 irna compositions and methods of use thereof for treating or preventing complement component c3-associated diseases
WO2021178736A1 (en) 2020-03-06 2021-09-10 Alnylam Pharmaceuticals, Inc. KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021188611A1 (en) 2020-03-18 2021-09-23 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating subjects having a heterozygous alanine-glyoxylate aminotransferase gene (agxt) variant
WO2021195307A1 (en) 2020-03-26 2021-09-30 Alnylam Pharmaceuticals, Inc. Coronavirus irna compositions and methods of use thereof
WO2021202443A2 (en) 2020-03-30 2021-10-07 Alnylam Pharmaceucticals, Inc. Compositions and methods for silencing dnajc15 gene expression
US12534731B2 (en) 2020-04-01 2026-01-27 Alnylam Pharmaceuticals, Inc. Alpha-2A adrenergic receptor (ADRA2A) iRNA agent compositions and methods of use thereof
WO2021207167A1 (en) 2020-04-06 2021-10-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing myoc expression
WO2021207189A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing scn9a expression
WO2021206922A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. Transmembrane serine protease 2 (tmprss2) irna compositions and methods of use thereof
WO2021206917A1 (en) 2020-04-07 2021-10-14 Alnylam Pharmaceuticals, Inc. ANGIOTENSIN-CONVERTING ENZYME 2 (ACE2) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021222065A1 (en) 2020-04-27 2021-11-04 Alnylam Pharmaceuticals, Inc. Apolipoprotein e (apoe) irna agent compositions and methods of use thereof
WO2021222549A1 (en) 2020-04-30 2021-11-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2021231679A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of gap junction protein beta 2 (gjb2)
WO2021231685A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of transmembrane channel-like protein 1 (tmc1)
WO2021231675A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of argininosuccinate synthetase (ass1)
WO2021231692A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of otoferlin (otof)
WO2021231673A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of leucine rich repeat kinase 2 (lrrk2)
WO2021231698A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of argininosuccinate lyase (asl)
WO2021231680A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of methyl-cpg binding protein 2 (mecp2)
WO2021231691A1 (en) 2020-05-15 2021-11-18 Korro Bio, Inc. Methods and compositions for the adar-mediated editing of retinoschisin 1 (rsi)
WO2021237097A1 (en) 2020-05-21 2021-11-25 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting marc1 gene expression
WO2021234459A2 (en) 2020-05-22 2021-11-25 Wave Life Sciences Ltd. Double stranded oligonucleotide compositions and methods relating thereto
US12297432B2 (en) 2020-06-03 2025-05-13 Takeda Pharmaceuticals U.S.A., Inc. Oligonucleotides for the treatment of nucleotide repeat expansion disorders associated with MSH3 activity
US11408000B2 (en) 2020-06-03 2022-08-09 Triplet Therapeutics, Inc. Oligonucleotides for the treatment of nucleotide repeat expansion disorders associated with MSH3 activity
WO2021252557A1 (en) 2020-06-09 2021-12-16 Alnylam Pharmaceuticals, Inc. Rnai compositions and methods of use thereof for delivery by inhalation
EP4649951A2 (en) 2020-06-09 2025-11-19 Alnylam Pharmaceuticals, Inc. Sirna compositions and methods for silencing gpam (glycerol-3-phosphate acyltransferase 1, mitochondrial) expression
WO2021257782A1 (en) 2020-06-18 2021-12-23 Alnylam Pharmaceuticals, Inc. XANTHINE DEHYDROGENASE (XDH) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2021262840A1 (en) 2020-06-24 2021-12-30 Vir Biotechnology, Inc. Engineered hepatitis b virus neutralizing antibodies and uses thereof
WO2022066847A1 (en) 2020-09-24 2022-03-31 Alnylam Pharmaceuticals, Inc. Dipeptidyl peptidase 4 (dpp4) irna compositions and methods of use thereof
WO2022076291A1 (en) 2020-10-05 2022-04-14 Alnylam Pharmaceuticals, Inc. G protein-coupled receptor 75 (gpr75) irna compositions and methods of use thereof
WO2022087041A1 (en) 2020-10-21 2022-04-28 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating primary hyperoxaluria
WO2022087329A1 (en) 2020-10-23 2022-04-28 Alnylam Pharmaceuticals, Inc. Mucin 5b (muc5b) irna compositions and methods of use thereof
WO2022103999A1 (en) 2020-11-13 2022-05-19 Alnylam Pharmaceuticals, Inc. COAGULATION FACTOR V (F5) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022119873A1 (en) 2020-12-01 2022-06-09 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhibition of hao1 (hydroxyacid oxidase 1 (glycolate oxidase)) gene expression
WO2022125490A1 (en) 2020-12-08 2022-06-16 Alnylam Pharmaceuticals, Inc. Coagulation factor x (f10) irna compositions and methods of use thereof
WO2022140702A1 (en) 2020-12-23 2022-06-30 Flagship Pioneering, Inc. Compositions of modified trems and uses thereof
WO2022150260A1 (en) 2021-01-05 2022-07-14 Alnylam Pharmaceuticals, Inc. COMPLEMENT COMPONENT 9 (C9) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022174000A2 (en) 2021-02-12 2022-08-18 Alnylam Pharmaceuticals, Inc. Superoxide dismutase 1 (sod1) irna compositions and methods of use thereof for treating or preventing superoxide dismutase 1- (sod1-) associated neurodegenerative diseases
WO2022182864A1 (en) 2021-02-25 2022-09-01 Alnylam Pharmaceuticals, Inc. Prion protein (prnp) irna compositions and methods and methods of use thereof
WO2022182574A1 (en) 2021-02-26 2022-09-01 Alnylam Pharmaceuticals, Inc. KETOHEXOKINASE (KHK) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2022187435A1 (en) 2021-03-04 2022-09-09 Alnylam Pharmaceuticals, Inc. Angiopoietin-like 3 (angptl3) irna compositions and methods of use thereof
WO2022192519A1 (en) 2021-03-12 2022-09-15 Alnylam Pharmaceuticals, Inc. Glycogen synthase kinase 3 alpha (gsk3a) irna compositions and methods of use thereof
WO2022212231A2 (en) 2021-03-29 2022-10-06 Alnylam Pharmaceuticals, Inc. Huntingtin (htt) irna agent compositions and methods of use thereof
WO2022212153A1 (en) 2021-04-01 2022-10-06 Alnylam Pharmaceuticals, Inc. Proline dehydrogenase 2 (prodh2) irna compositions and methods of use thereof
WO2022231999A1 (en) 2021-04-26 2022-11-03 Alnylam Pharmaceuticals, Inc. Transmembrane protease, serine 6 (tmprss6) irna compositions and methods of use thereof
WO2022232343A1 (en) 2021-04-29 2022-11-03 Alnylam Pharmaceuticals, Inc. Signal transducer and activator of transcription factor 6 (stat6) irna compositions and methods of use thereof
WO2022245583A1 (en) 2021-05-18 2022-11-24 Alnylam Pharmaceuticals, Inc. Sodium-glucose cotransporter-2 (sglt2) irna compositions and methods of use thereof
WO2022246023A1 (en) 2021-05-20 2022-11-24 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2022256283A2 (en) 2021-06-01 2022-12-08 Korro Bio, Inc. Methods for restoring protein function using adar
WO2022256395A1 (en) 2021-06-02 2022-12-08 Alnylam Pharmaceuticals, Inc. Patatin-like phospholipase domain containing 3 (pnpla3) irna compositions and methods of use thereof
WO2022256290A2 (en) 2021-06-04 2022-12-08 Alnylam Pharmaceuticals, Inc. HUMAN CHROMOSOME 9 OPEN READING FRAME 72 (C9ORF72) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2022260939A2 (en) 2021-06-08 2022-12-15 Alnylam Pharmaceuticals, Inc. Compositions and methods for treating or preventing stargardt's disease and/or retinal binding protein 4 (rbp4)-associated disorders
WO2023278407A1 (en) 2021-06-29 2023-01-05 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2023278410A1 (en) 2021-06-29 2023-01-05 Korro Bio, Inc. Methods and compositions for adar-mediated editing
WO2023278576A1 (en) 2021-06-30 2023-01-05 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
WO2023003805A1 (en) 2021-07-19 2023-01-26 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluria disease or disorder
WO2023003995A1 (en) 2021-07-23 2023-01-26 Alnylam Pharmaceuticals, Inc. Beta-catenin (ctnnb1) irna compositions and methods of use thereof
WO2023009687A1 (en) 2021-07-29 2023-02-02 Alnylam Pharmaceuticals, Inc. 3-hydroxy-3-methylglutaryl-coa reductase (hmgcr) irna compositions and methods of use thereof
WO2023014677A1 (en) 2021-08-03 2023-02-09 Alnylam Pharmaceuticals, Inc. Transthyretin (ttr) irna compositions and methods of use thereof
WO2023014765A1 (en) 2021-08-04 2023-02-09 Alnylam Pharmaceuticals, Inc. iRNA COMPOSITIONS AND METHODS FOR SILENCING ANGIOTENSINOGEN (AGT)
WO2023019246A1 (en) 2021-08-13 2023-02-16 Alnylam Pharmaceuticals, Inc. Factor xii (f12) irna compositions and methods of use thereof
US12416006B2 (en) 2021-08-31 2025-09-16 Alnylam Pharmaceuticals, Inc. Cell death-inducing DFFA-like effector B (CIDEB) iRNA compositions and methods of use thereof
WO2023044370A2 (en) 2021-09-17 2023-03-23 Alnylam Pharmaceuticals, Inc. Irna compositions and methods for silencing complement component 3 (c3)
WO2023044094A1 (en) 2021-09-20 2023-03-23 Alnylam Pharmaceuticals, Inc. Inhibin subunit beta e (inhbe) modulator compositions and methods of use thereof
US12516322B2 (en) 2021-09-24 2026-01-06 Alnylam Pharmaceuticals, Inc. Microtubule associated protein Tau (MAPT) iRNA agent compositions and methods of use thereof
WO2023069603A1 (en) 2021-10-22 2023-04-27 Korro Bio, Inc. Methods and compositions for disrupting nrf2-keap1 protein interaction by adar mediated rna editing
WO2023076451A1 (en) 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. Complement factor b (cfb) irna compositions and methods of use thereof
WO2023076450A2 (en) 2021-10-29 2023-05-04 Alnylam Pharmaceuticals, Inc. HUNTINGTIN (HTT) iRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF
WO2023141314A2 (en) 2022-01-24 2023-07-27 Alnylam Pharmaceuticals, Inc. Heparin sulfate biosynthesis pathway enzyme irna agent compositions and methods of use thereof
WO2024039776A2 (en) 2022-08-18 2024-02-22 Alnylam Pharmaceuticals, Inc. Universal non-targeting sirna compositions and methods of use thereof
WO2024059165A1 (en) 2022-09-15 2024-03-21 Alnylam Pharmaceuticals, Inc. 17b-hydroxysteroid dehydrogenase type 13 (hsd17b13) irna compositions and methods of use thereof
WO2024168010A2 (en) 2023-02-09 2024-08-15 Alnylam Pharmaceuticals, Inc. Reversir molecules and methods of use thereof
WO2024220746A2 (en) 2023-04-21 2024-10-24 Flagship Pioneering Innovations Vii, Llc Rnai agents targeting fatty acid synthase and related methods
WO2025015335A1 (en) 2023-07-13 2025-01-16 Korro Bio, Inc. Rna-editing oligonucleotides and uses thereof
WO2025024334A1 (en) 2023-07-21 2025-01-30 Marrow Therapeutics, Inc. Hematopoietic cell targeting conjugates and related methods
WO2025024486A2 (en) 2023-07-25 2025-01-30 Flagship Pioneering Innovations Vii, Llc Cas endonucleases and related methods
WO2025024493A1 (en) 2023-07-25 2025-01-30 Flagship Pioneering Innovations Vii, Llc Cas endonucleases and related methods
WO2025034422A1 (en) 2023-08-04 2025-02-13 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating ctnnb1-associated disorders
WO2025072331A1 (en) 2023-09-26 2025-04-03 Flagship Pioneering Innovations Vii, Llc Cas nucleases and related methods
WO2025072699A1 (en) 2023-09-27 2025-04-03 Judo Bio, Inc. Aminoglycosides for delivery of agents to the kidney
WO2025072672A2 (en) 2023-09-27 2025-04-03 Judo Bio, Inc. Slc6a19-targeting modulatory nucleic acid agents
WO2025072713A1 (en) 2023-09-27 2025-04-03 Judo Bio, Inc. Polymyxins for delivery of agents to the kidney
WO2025076031A2 (en) 2023-10-03 2025-04-10 Alnylam Pharmaceuticals, Inc. Peritoneal macrophages comprising a nanoparticle encapsulating a nucleic acid molecule and methods of use thereof
WO2025117877A2 (en) 2023-12-01 2025-06-05 Flagship Pioneering Innovations Vii, Llc Cas nucleases and related methods
WO2025128799A1 (en) 2023-12-12 2025-06-19 Korro Bio, Inc. Double-stranded rna-editing oligonucleotides and uses thereof
WO2025178854A2 (en) 2024-02-19 2025-08-28 Flagship Pioneering Innovations Vii, Llc Rnai agents targeting cideb and related methods
WO2025199231A2 (en) 2024-03-20 2025-09-25 Vertex Pharmaceuticals Incorporated Mucin-5b (muc5b) targeted sirna and antisense oligonucleotides and methods of use thereof
WO2025217275A2 (en) 2024-04-10 2025-10-16 Flagship Pioneering Innovations Vii, Llc Immune cell targeted compositions and related methods
WO2025259743A1 (en) 2024-06-12 2025-12-18 Alnylam Pharmaceuticals, Inc. Dual conjugate compounds for extrahepatic delivery
WO2025259747A2 (en) 2024-06-12 2025-12-18 Alnylam Pharmaceuticals, Inc. Dystrophy myotonic protein kinase (dmpk) irna compositions and methods of use thereof

Also Published As

Publication number Publication date
US6867294B1 (en) 2005-03-15

Similar Documents

Publication Publication Date Title
USRE39464E1 (en) Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages
US6440943B1 (en) Oligonucleotides having site specific chiral phosphorothioate internucleoside linkages
US6737520B2 (en) Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US6147200A (en) 2&#39;-O-acetamido modified monomers and oligomers
EP1100809B1 (en) Rna targeted 2&#39;-modified oligonucleotides that are conformationally preorganized
US6531590B1 (en) Processes for the synthesis of oligonucleotide compounds
US20070292875A1 (en) Human RNase H1 oligonucleotide compositions thereof
WO2001040515A1 (en) Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US7119184B2 (en) Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US20030190626A1 (en) Phosphorothioate monoester modified oligomers
US6414135B1 (en) C3′-methylene hydrogen phosphonate monomers and related compounds
US6858722B2 (en) Oligomer phosphoramidite compositions and processes for synthesizing the same
US6974865B2 (en) C3′ -methylene hydrogen phosphonate oligomers and related compounds
US6919437B1 (en) Synthetic methods and intermediates for triester oligonucleotides

Legal Events

Date Code Title Description
CC Certificate of correction
FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12

AS Assignment

Owner name: IONIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:043341/0557

Effective date: 20151218