US9518275B2 - Method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes - Google Patents

Method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes Download PDF

Info

Publication number
US9518275B2
US9518275B2 US14/583,260 US201414583260A US9518275B2 US 9518275 B2 US9518275 B2 US 9518275B2 US 201414583260 A US201414583260 A US 201414583260A US 9518275 B2 US9518275 B2 US 9518275B2
Authority
US
United States
Prior art keywords
lipolytica
glabrata
dihydrolipoamide acetyltransferase
pyruvate
lat1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US14/583,260
Other versions
US20160138054A1 (en
Inventor
Jian Chen
Jingwen Zhou
Hongwei Guo
Yongkun Lv
Guocheng Du
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Assigned to JIANGNAN UNIVERSITY reassignment JIANGNAN UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHEN, JIAN, DU, GUOCHENG, GUO, HONGWEI, LV, YONGKUN, ZHOU, JINGWEN
Publication of US20160138054A1 publication Critical patent/US20160138054A1/en
Application granted granted Critical
Publication of US9518275B2 publication Critical patent/US9518275B2/en
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01012Dihydrolipoyllysine-residue acetyltransferase (2.3.1.12)

Definitions

  • the present invention relates to the field of metabolic engineering, and more particularly relates to a method for weakening pyruvate catabolism and improving the accumulation of pyruvate in microbes.
  • Pyruvate (Pyruvic acid) is one of the important intermediates in the tricarboxylic acid cycle (TCA cycle). It not only plays a key role in microbial metabolisms, such as energy metabolism and synthesis of amino acids, proteins and vitamins, but also occupies the key regulation point of TCA cycle. Compared with the other intermediates in the TCA cycle, regulations for pyruvate metabolism are much more complicated.
  • pyruvic acid As an essential intermediate in fine chemicals and pharmaceutical industry, pyruvic acid is widely used in the synthesis of amino acids, vitamins and other organic molecules. It also has a wide range of applications in pharmaceutics, organic synthesis and nutritional supplement synthesis. In order to meet the rising market demand, more effective methods for synthesizing pyruvic acid are needed.
  • pyruvic acid is at the key position of the energy supply chain. It may cause side effects to cell growth even death if genes of the central metabolic pathway are knocked out.
  • pyruvate producing yeast cells belong to obligate aerobic microorganism, and genomic deletion of key enzymes in TCA cycle pathways could be lethal.
  • the present invention provides a method to decrease the catabolism of pyruvate and thus increase the accumulation of pyruvate in microbes while avoiding lethal effects caused by modification of key TCA components in the engineered microbes.
  • the goal of the present invention is to provide a method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes via overexpression of wild-type dihydrolipoamide acetyltransferase or mutants of dihydrolipoamide acetyltransferase.
  • pyruvate dehydrogenase activity is reduced in the recombinant strains, pyruvate catabolism is decreased, thus increasing the accumulation of the carboxylate.
  • the parental strain is yeast or the other fungus.
  • overexpression of dihydrolipoamide acetyltransferase alters the endogenous stoichiometric equilibration of the pyruvate dehydrogenase complex.
  • the increase of dihydrolipoamide acetyltransferase interferes with the balanced assembly of pyruvate dehydrogenase, dihydrolipoamide dehydrogenase and dihydrolipoamide acetyltransferase in the pyruvate dehydrogenase complex, resulting in decreased overall activity of pyruvate dehydrogenase complex in the cells. Decreasing the overall activity of pyruvate dehydrogenase complex leads to less catabolism and more accumulation of pyruvate.
  • overexpression of mutants of dihydrolipoamide acetyltransferase interferes the normal assembly of the pyruvate dehydrogenase complex and reduces the activity of dihydrolipoamide acetyltransferase. This results in the reduced intracellular overall activity of pyruvate dehydrogenase complex and thus increased accumulation of pyruvate.
  • the host cell is Yarrowia lipolytica ( Y. lipolytica ).
  • the amino acid sequence of the wild-type dihydrolipoamide acetyltransferase from Y. lipolytica is set forth in SEQ ID NO.1.
  • the conservative active site residue of the enzyme, His 409 or Asp 413, is mutated into Ala to get mutant H409A or D413A, respectively.
  • the host cell is Torulopsis glabrata ( T. glabrata ).
  • the amino acid sequence of the wild-type dihydrolipoamide acetyltransferase from T. glabrata is set forth in SEQ ID NO: 2.
  • the conservative active site residue of the enzyme, His 442 or Asp 446, is mutated into Ala to get mutant H442A or D446A, respectively.
  • the present invention also provides a series of recombinant Y. lipolytica derived from Y. lipolytica WSH-Z06 CCTCC NO: M20714, in which wild-type dihydrolipoamide acetyltransferase or its mutants is overexpressed.
  • the recombinant Y. lipolytica can be constructed as follows:
  • plasmid p0 The method of constructing plasmid p0 is well documented in Swennen D, Paul M F, Vernis L, Beckerich J M, Fournier A, Gaillardin C. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis . Microbiology-Sgm, 2002. 148: 41-50.
  • biomass of the three recombinants, Y. lipolytica -K, Y. lipolytica -409A and Y. lipolytica -413A was reduced to 86.5%, 22.0% and 26.2%, respectively; intracellular pyruvate dehydrogenase activity was reduced by 13.5%, 35.2% and 32.2%, respectively; pyruvate accumulation was increased from 20.5 g ⁇ L ⁇ 1 to 24.5 g/L, 38.6 g ⁇ L ⁇ 1 and 39.9 g ⁇ L ⁇ 1 respectively.
  • the present invention provides a recombinant T. glabrata which derives from T. glabrata CCTCC M202019 ⁇ ura3 and overexpresses dihydrolipoamide acetyltransferase or its mutation.
  • the recombinant T. glabrata can be constructed as follows:
  • pRS306TEF1-LAT1 is used as template DNA to get recombinant expression plasmid pRS306TEF1-442A and pRS306TEF1-446A.
  • T. glabrata CCTCC M202019 ⁇ ura3 biomass of the three recombinants, T. glabrata -C, T. glabrata -442A and T. glabrata -446A, was reduced to 81.5%, 30.2% and 36.3% respectively; intracellular pyruvate dehydrogenase activity was reduced by 21.2%, 48.2% and 51.8% respectively; pyruvate accumulation was increased from 49.4 g ⁇ L ⁇ 1 to 56.8 g/L, 68.6 g ⁇ L ⁇ 1 and 74.3 g ⁇ L ⁇ 1 .
  • the present invention also provides a method for producing pyruvate using the genetically engineered strain.
  • the genetically engineered strain overexpresses wild-type dihydrolipoamide acetyltransferase or the mutants of dihydrolipoamide acetyltransferase of which its conserved active site residues are mutated.
  • the host cells for constructing genetically engineered strain is Y. lipolytica , particularly Y. lipolytica WSH-Z06.
  • the amino acid sequence of the wild-type dihydrolipoamide acetyltransferase from Y. lipolytica is shown as SEQ ID NO:1.
  • the conservative active site residue of wild-type enzyme, His 409 or Asp 413 was individually mutated into Ala to get mutant H409A or D413A, respectively.
  • the genetically engineered Y. lipolytica is cultured as follows.
  • the seed medium contains 20 g ⁇ L ⁇ 1 glucose, 10 g ⁇ L ⁇ 1 peptone, 1 g ⁇ L ⁇ 1 KH 2 PO 4 , 0.5 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, and is adjusted to pH 5.5; the fermentation medium contains 100 g ⁇ L ⁇ 1 glycerol, 3 g ⁇ L ⁇ 1 (NH 4 ) 2 SO 4 , 3 g ⁇ L ⁇ 1 KH 2 PO 4 , 1.2 g.
  • the recombinant strain is inoculated to the seed culture medium at 28° C., 200 rpm, and cultured for 16-18 hours.
  • 150 ml seed culture medium (10%) is inoculated into 1.5 Liter fermentation medium in a 3 Liter fermentor, cultured at 28° C., 200 rpm for 144 hours.
  • the host cells for constructing genetically engineered strain is Torulopsis glabrata , especially T. glabrata CCTCC M202019 ⁇ ura3.
  • the amino acid sequence of the wild type dihydrolipoamide acetyltransferase from T. glabrata is shown as SEQ ID NO:2.
  • the conservative active site residue of wild type enzyme, His 442 or Asp 446 is individually mutated into Ala to get mutation H442A or D446A.
  • the genetically engineered T. glabrata is cultured as follows.
  • the seed medium contains 20 g ⁇ L ⁇ 1 glucose, 10 g ⁇ L ⁇ 1 peptone, 1 g ⁇ L ⁇ 1 KH 2 PO 4 , 0.5 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, and is adjusted to pH 5.5;
  • the fermentation medium contains 120 g ⁇ L ⁇ 1 glucose, 7 g ⁇ L ⁇ 1 NH 4 Cl, 5 g ⁇ L ⁇ 1 KH 2 PO 4 , 0.8 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, 6 g ⁇ L ⁇ 1 sodium acetate, 4 mg ⁇ L ⁇ 1 niacin, 30 ⁇ g ⁇ L ⁇ 1 thiamine, 100 ⁇ g ⁇ L ⁇ 1 pyridoxine hydrochloride, 10 ⁇ g ⁇ L ⁇ 1 biotin, 50 ⁇ g ⁇ L ⁇ 1 riboflavin, and is adjusted to pH 5.0.
  • Vitamins are added to the fermentation medium after they are sterilized by filtration.
  • the recombinant T. glabrata is inoculated into 25 mL seed medium in a 250 mL triangular flasks, and cultured at 28° C., 200 rpm for 24 hours.
  • the seed culture is inoculated at a ratio of 10% (v/v) into 1.5 Liter fermentation medium in a 3 Liter fermentation tank, and cultured at 30° C., 400 rpm with a ventilation rate of 4 vvm for 80 hours.
  • the pH is maintained at pH 5.0 by automatically feeding the fermentation medium with 8 M NaOH and 2 M HCl using a feed pump.
  • the present invention provides a method of increasing the accumulation of pyruvate in microbes through overexpressing wild-type dihydrolipoamide acetyltransferase or mutant dihydrolipoamide acetyltransferases that have a mutation at conservative active sites.
  • the method decreases the intracellular activity of pyruvate dehydrogenase, thus decreases the catabolism and increase the accumulation of pyruvate in microbes.
  • This method leads to increased extracellular accumulation of pyruvate, which can simplify the downstream isolation and purification processes, reduce the production cost and increase the final yield.
  • FIG. 1 Cell growth curves.
  • A Y. lipolytica -WSH Z06 ( ⁇ ), Y. lipolytica -C ( ⁇ ), Y. lipolytica -409A ( ⁇ ), Y. lipolytica -413A ( ⁇ );
  • B T. glabrata CCTCC M202019 ⁇ ura3 ( ⁇ ), T. glabrata -C ( ⁇ ), T. glabrata -442A ( ⁇ ), T. glabrata -446A ( ⁇ ).
  • FIG. 2 Activities of pyruvate dehydrogenase and dihydrolipoamide acetyltransferase.
  • A intracellular overall activity of pyruvate dehydrogenase complex in recombinant Y. lipolytica strains;
  • B intracellular dihydrolipoamide acetyltransferase activity in recombinant Y. lipolytica strains;
  • C intracellular pyruvate dehydrogenase activity of different T. glabrata strains;
  • D intracellular dihydrolipoamide acetyltransferase activity of different T. glabrata strains.
  • FIG. 3 Extracellular pyruvate concentrations of different Y. lipolytica strains; (A) Y. lipolytica WSH-Z06, (B) Y lipolytica -K, (C) Y. lipolytica -409A, (D) Y. lipolytica -413A; dry cell weight ( ⁇ ), pyruvate( ⁇ ), glycerol ( ⁇ ).
  • FIG. 4 Extracellular pyruvate concentrations of different T. glabrata strains; (A) T. glabrata CCTCC M202019 ⁇ ura3, (B) T. glabrata -C, (C) T. glabrata -442A, (D) T. glabrata -446A; dry cell weight ( ⁇ ), pyruvate ( ⁇ ), glucose ( ⁇ ).
  • YPD medium 5 g ⁇ L ⁇ 1 yeast extract, 10 g ⁇ L ⁇ 1 peptone, 10 g ⁇ L ⁇ 1 glucose.
  • To make solid medium add 20 g ⁇ L ⁇ 1 Agar.
  • Hygromycin B was added to the concentration of 400 mg ⁇ L ⁇ 1 for selection of positive recombinant transformants.
  • YNB medium 10 g ⁇ L ⁇ 1 glucose, 0.67 g ⁇ L ⁇ 1 (NH 4 ) 2 SO 4 , pH 6.
  • Seed medium for Y. lipolytica 20 g ⁇ L ⁇ 1 glucose, 10 g ⁇ L ⁇ 1 peptone, 1 g ⁇ L ⁇ 1 KH 2 PO 4 , 0.5 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, pH 5.5.
  • To make solid medium add 20 g ⁇ L ⁇ 1 agar.
  • Fermentation medium for Y. lipolytica 100 g ⁇ L ⁇ 1 glycerol, 3 g ⁇ L ⁇ 1 (NH 4 ) 2 SO 4 , 3 g ⁇ L ⁇ 1 KH 2 PO 4 , 1.2 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, 0.1 g ⁇ L ⁇ 1 K 2 HPO 4 , 0.5 g ⁇ L ⁇ 1 NaCl, 2 ⁇ 10 ⁇ 7 g ⁇ L ⁇ 1 thiamine pH 5.5. 20 g ⁇ L ⁇ 1 CaCO 3 was added as a neutralizing agent before inoculation.
  • Seed medium for T. glabrata 20 g ⁇ L ⁇ 1 glucose, 10 g ⁇ L ⁇ 1 peptone, 1 g ⁇ L ⁇ 1 KH 2 PO 4 , 0.5 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, pH 5.5.
  • To make solid medium add 20 g ⁇ L ⁇ 1 agar.
  • Fermentation medium for T. glabrata 120 g ⁇ L ⁇ 1 glucose, 7 g ⁇ L ⁇ 1 NH 4 Cl, 5 g ⁇ L ⁇ 1 KH 2 PO 4 , 0.8 g ⁇ L ⁇ 1 MgSO 4 .7H 2 O, 6 g ⁇ L ⁇ 1 sodium acetate, 4 mg ⁇ L ⁇ 1 niacin, 30 ⁇ g ⁇ L ⁇ 1 thiamine, 100 ⁇ g ⁇ L ⁇ 1 pyridoxine hydrochloride, 10 ⁇ g ⁇ L ⁇ 1 biotin, 50 ⁇ g ⁇ L ⁇ 1 riboflavin, pH 5.0. 20 g ⁇ L ⁇ 1 CaCO 3 was added as a neutralizing agent before inoculation.
  • the Y. lipolytica WSH-Z06 was obtained from China Center for Type Culture Collection (CCTCC) with CCTCC NO: M20714.
  • 3 ml enzyme activity assay system includes 0.5 ml supernatant, 50 mM HEPES, 0.1% Triton X-100, 1.0 mM MgCl 2 , 5.0 mM pyruvate, 0.2 mM diphosphothiamin, 2.0 mM NAD + and 0.1 mM CoA, pH 7.4. Concentration change of NADH was determined by measuring OD 340 at 30° C. 1 U pyruvate dehydrogenase activity is defined as the enzyme needed to generate 1 ⁇ mol NADH within one minute.
  • 3 ml enzyme activity assay system includes 0.5 ml supernatant of cells lysate, 1.19 mM Tris-HCL buffer (pH 8.0), 0.07 mM acetyl phosphate, 0.042 mM 95% ethanol solution of dihydrolipoamide, 0.07 ⁇ M CoA, 7 U Phosphate acetyltransferase, 0.83 mM Sodium acetate.
  • Concentration change of S-acetyldihydrolipoamide is determined by measuring OD 240 .
  • 1 U dihydrolipoamide acetyltransferase activity is defined as the enzyme needed to generate 1 ⁇ mol S-acetyldihydrolipoamide within one minute.
  • pyruvate was determined by HPLC (Agilent 1200 series, Santa Clara, Calif.) with a Aminex HPX-87H ion exchange column (300 mm ⁇ 7.8 mm; Bio-Rad Laboratories Inc., Hercules, Calif.).
  • the mobile phase was 5 mmol ⁇ L ⁇ 1 sulfuric acid in distilled, de-ionized water filtered through a 0.22 ⁇ m pore size membrane.
  • the mobile phase flow rate was 0.6 mL ⁇ min ⁇ 1 .
  • the column temperature was maintained at 35° C., and the injection volume was 10 ⁇ L.
  • the pyruvate was detected by UV (wavelength at 210 nm) detector.
  • Transformation of Y. lipolytica A freshly grown single colony was transferred into liquid YPD medium and cultured at 28° C., 200 rpm for overnight.
  • the linearized integrative recombinant plasmid was added to the cell suspension, incubated on ice for 5 mM, and transferred to a ice-chilled 0.2-cm electric rotor.
  • the electroporation shock was performed at 2.5 KV, 25 ⁇ F, 200 ⁇ , and 1 mL ice-chilled 1 M sorbitol solution was immediately added afterwards. The mixture was incubated at room temperature for 1 h. For selection of recombinant Y.
  • 0.2 mL cells which have been electrically shocked, were spread on the YPD plates with 400 mg ⁇ L ⁇ 1 Hygromycin B, and cultured at 28° C. for 48-72 h.
  • 0.2 mL cells which have been electrically shocked, were spread on the YNB plates and cultured at 28° C. for 48-72 h. The colonies grown on selective plates were further verified by PCR.
  • the recombinant Y. lipolytica can be constructed using the following method:
  • amino acid sequence of the wild type dihydrolipoamide acetyltransferase from Y. lipolytica is shown as SEQ ID NO: 1.
  • plasmid p0 The method of constructing plasmid p0 is well documented in Swennen D, Paul M F, Vernis L, Beckerich J M, Fournier A, Gaillardin C. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis . Microbiology-Sgm, 2002. 148: 41-50.
  • Y. lipolytica -K, Y. lipolytica -409A and Y. lipolytica -413A were inoculated into 0.2 ml YPD medium in 96-well plates and cultured at 28° C., 200 rpm for 10 h.
  • biomass of the three recombinants, Y. lipolytica -K, Y. lipolytica -409A and Y. lipolytica -413A was reduced to 86.5%, 22.0% and 26.2%, respectively ( FIG. 1A ).
  • the recombinant T. glabrata can be constructed using the following method:
  • amino acid sequence of the wild type dihydrolipoamide acetyltransferase from T. glabrata is shown as SEQ ID NO:2.
  • pRS306TEF1-LAT1 was used as template DNA to get recombinant expression plasmid pRS306TEF1-442A and pRS306TEF1-446A.
  • T. glabrata CCTCC M202019 ⁇ ura3 The method of constructing T. glabrata CCTCC M202019 ⁇ ura3 is well documented in Zhou J, Dong Z, Liu L, Du G, Chen J. A reusable method for construction of non-marker large fragment deletion yeast auxotroph strains: A practice in Torulopsis glabrata . Journal of Microbiological Methods. 2009; 76:70-74.
  • Y. lipolytica WSH-Z06, Y. lipolytica -K, Y. lipolytica -409A and Y. lipolytica -413A were inoculated into YPD medium (20/250 mL) and cultured at 28° C., 200 rpm. Cells at logarithmic growth phase were collected, and the intracellular pyruvate dehydrogenase activity was determined.
  • the intracellular overall activity of pyruvate dehydrogenase complex in three recombinants was reduced by 13.5%, 35.2% and 32.2%, to 26.3 U/mg protein, 19.7 U/mg protein and 20.6 U/mg protein, respectively ( FIG. 2A ).
  • T. glabrata CCTCC M202019 ⁇ ura3, T. glabrata -C, T. glabrata -442A and T. glabrata -446A were cultured in the same way as Y. lipolytica was.
  • T. glabrata CCTCC M202019 ⁇ ura3 the enzyme activity of T. glabrata -C was increased to 151.5%, while the intracellular dihydrolipoamide acetyltransferase activity of T. glabrata -442A and T. glabrata -446A were reduced to 42.3% and 46.7% respectively ( FIG. 2D ).
  • T. glabrata CCTCC M202019 ⁇ ura3 that of T. glabrata -C, T. glabrata -442A and T. glabrata -446A, were reduced by 21.2%, 48.2% and 51.8%, to 17.8 U/mg protein, 11.7 U/mg protein and 10.9 U/mg protein, respectively ( FIG. 2C ).
  • Y. lipolytica WSH-Z06, Y. lipolytica -K, Y. lipolytica -409A and Y. lipolytica -413A were inoculated into fermentation medium (1.5 L medium/3 L fermentor) and cultured at 28° C., 200 rpm for 144 hours.
  • lipolytica -413A were 20.5 g ⁇ L ⁇ 1 , 38.6 g ⁇ L ⁇ 1 , 38.6 g ⁇ L ⁇ 1 and 39.9 g ⁇ L ⁇ 1 , respectively ( FIG. 3 ).
  • T. glabrata CCTCC M202019 ⁇ ura3, T. glabrata -C, T. glabrata -442A and T. glabrata -446A were inoculated into fermentation medium (1.5 L medium/3 L fermentor) and cultured at 28° C., 200 rpm for 144 hours.
  • glabrata -446A were 49.4 g ⁇ L ⁇ 1 , 56.8 g ⁇ L ⁇ 1 , 68.6 g ⁇ L ⁇ 1 and 74.3 g ⁇ L ⁇ 1 , respectively ( FIG. 4 ).
  • Overexpressing dihydrolipoamide acetyltransferase or its mutations in T. glabrata enormously increased pyruvate yield.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes. By overexpressing wild type dihydrolipoamide acetyltransferase or dihydrolipoamide acetyltransferase mutants which have mutations at conservative active sites, the present invention provide a method to decrease overall activity of pyruvate dehydrogenase complex and pyruvate catabolism, and thus increase the accumulation of extracellular pyruvate without killing the pyruvate-producing microbes. Overexpressing dihydrolipoamide acetyltransferase mutants is an effective way to increase pyruvate accumulation.

Description

CROSS-REFERENCES AND RELATED APPLICATIONS
This application claims the benefit of priority to Chinese Application No. 201410665313.9, entitled “A Method for Weakening Pyruvate Catabolism and Improving the Accumulation of Pyruvate in Microbes”, filed Nov. 19, 2014, which is herein incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates to the field of metabolic engineering, and more particularly relates to a method for weakening pyruvate catabolism and improving the accumulation of pyruvate in microbes.
Description of the Related Art
Pyruvate (Pyruvic acid) is one of the important intermediates in the tricarboxylic acid cycle (TCA cycle). It not only plays a key role in microbial metabolisms, such as energy metabolism and synthesis of amino acids, proteins and vitamins, but also occupies the key regulation point of TCA cycle. Compared with the other intermediates in the TCA cycle, regulations for pyruvate metabolism are much more complicated.
As an essential intermediate in fine chemicals and pharmaceutical industry, pyruvic acid is widely used in the synthesis of amino acids, vitamins and other organic molecules. It also has a wide range of applications in pharmaceutics, organic synthesis and nutritional supplement synthesis. In order to meet the rising market demand, more effective methods for synthesizing pyruvic acid are needed.
There are many problems, such as poor efficiency and low yield, when producing pyruvic acid using microbes. Genetic modification is necessary for high level productivity. However, to those obligated aerobes, pyruvic acid is at the key position of the energy supply chain. It may cause side effects to cell growth even death if genes of the central metabolic pathway are knocked out. Particularly, pyruvate producing yeast cells belong to obligate aerobic microorganism, and genomic deletion of key enzymes in TCA cycle pathways could be lethal. The present invention provides a method to decrease the catabolism of pyruvate and thus increase the accumulation of pyruvate in microbes while avoiding lethal effects caused by modification of key TCA components in the engineered microbes.
DETAILED DESCRIPTION
The goal of the present invention is to provide a method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes via overexpression of wild-type dihydrolipoamide acetyltransferase or mutants of dihydrolipoamide acetyltransferase. As the pyruvate dehydrogenase activity is reduced in the recombinant strains, pyruvate catabolism is decreased, thus increasing the accumulation of the carboxylate.
In a preferred embodiment, the parental strain is yeast or the other fungus.
In a preferred embodiment, overexpression of dihydrolipoamide acetyltransferase alters the endogenous stoichiometric equilibration of the pyruvate dehydrogenase complex. The increase of dihydrolipoamide acetyltransferase interferes with the balanced assembly of pyruvate dehydrogenase, dihydrolipoamide dehydrogenase and dihydrolipoamide acetyltransferase in the pyruvate dehydrogenase complex, resulting in decreased overall activity of pyruvate dehydrogenase complex in the cells. Decreasing the overall activity of pyruvate dehydrogenase complex leads to less catabolism and more accumulation of pyruvate.
In a preferred embodiment, overexpression of mutants of dihydrolipoamide acetyltransferase, of which the conservative active site residue Histidine (His) or Aspartate (Asp) is mutated into Alanine (Ala), interferes the normal assembly of the pyruvate dehydrogenase complex and reduces the activity of dihydrolipoamide acetyltransferase. This results in the reduced intracellular overall activity of pyruvate dehydrogenase complex and thus increased accumulation of pyruvate.
In a preferred embodiment, the host cell is Yarrowia lipolytica (Y. lipolytica). The amino acid sequence of the wild-type dihydrolipoamide acetyltransferase from Y. lipolytica is set forth in SEQ ID NO.1. The conservative active site residue of the enzyme, His 409 or Asp 413, is mutated into Ala to get mutant H409A or D413A, respectively.
In a preferred embodiment, the host cell is Torulopsis glabrata (T. glabrata). The amino acid sequence of the wild-type dihydrolipoamide acetyltransferase from T. glabrata is set forth in SEQ ID NO: 2. The conservative active site residue of the enzyme, His 442 or Asp 446, is mutated into Ala to get mutant H442A or D446A, respectively.
The present invention also provides a series of recombinant Y. lipolytica derived from Y. lipolytica WSH-Z06 CCTCC NO: M20714, in which wild-type dihydrolipoamide acetyltransferase or its mutants is overexpressed.
The recombinant Y. lipolytica can be constructed as follows:
(1) Constructing the integrative expression vector: the amplified open reading frame (ORF) of hph encoding hygromycin phosphotransferase and plasmid p0 are digested using restriction enzyme Stu I and Hind III. The digested fragments are ligated to obtain integrative expression vector p0(hph).
(2) Constructing a recombinant expression plasmid: the ORF of LAT1 encoding dihydrolipoamide acetyltransferase is synthesized; ORF of LAT1 and the integrative plasmid p0(hph) are digested by Bam HI and Eco RI simultaneously which is followed by the ligation of the digested fragments to obtain a recombinant expression plasmid p0(hph)-LAT1; Site-directed mutagenesis of conservative active site residue is accomplished using primers H409A-F (SEQ ID NO:4)/H409A-R (SEQ ID NO:5) and D413A-F (SEQ ID NO:6)/D413A-R (SEQ ID NO:7), respectively. The resulted plasmids are p0(hph)-409A and p0(hph)-413A, respectively.
(3) Transforming the recombinant expression plasmid into Y. lipolytica WSH-Z06: The recombinant expression plasmids are linearized and transformed into Y. lipolytica WSH-Z06 using electroporation method. Positive transformants Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A, in which p0(hph)-LAT1, p0(hph)-409A and p0(hph)-413A are introduced into yeast cells, respectively, are screened and verified.
The method of constructing plasmid p0 is well documented in Swennen D, Paul M F, Vernis L, Beckerich J M, Fournier A, Gaillardin C. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis. Microbiology-Sgm, 2002. 148: 41-50.
Compared with Y. lipolytica WSH-Z06, biomass of the three recombinants, Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A, was reduced to 86.5%, 22.0% and 26.2%, respectively; intracellular pyruvate dehydrogenase activity was reduced by 13.5%, 35.2% and 32.2%, respectively; pyruvate accumulation was increased from 20.5 g·L−1 to 24.5 g/L, 38.6 g·L−1 and 39.9 g·L−1 respectively.
The present invention provides a recombinant T. glabrata which derives from T. glabrata CCTCC M202019 Δura3 and overexpresses dihydrolipoamide acetyltransferase or its mutation.
The recombinant T. glabrata can be constructed as follows:
(1) Constructing a recombinant expression plasmid: Open reading frame (ORF) of the gene LAT1 encoding dihydrolipoamide acetyltransferase is synthesized based on the published nucleotide sequence by NCBI; LAT1 ORF and the integrative plasmid pRS306TEF1 are digested by restriction enzyme Spe I and Bam HI simultaneously which is followed by the ligation of the digested fragments to obtain a recombinant expression plasmid pRS306TEF1-LAT1. Site-directed mutagenesis of conservative active site residue is accomplished using primers H442A-F (SEQ ID NO:8)/H442A-R (SEQ ID NO:9) and D446A-F (SEQ ID NO:10)/D446A-R (SEQ ID NO:11). pRS306TEF1-LAT1 is used as template DNA to get recombinant expression plasmid pRS306TEF1-442A and pRS306TEF1-446A.
(2) Transforming the recombinant expression plasmid into T. glabrata CCTCC M202019 Δura3: the recombinant expression plasmid is linearized and transformed into T. glabrata CCTCC M202019 Δura3 using an electroporation method; Positive transformants T. glabrata-C, T. glabrata-442A and T. glabrata-446A, which overexpress dihydrolipoamide acetyltransferase wild type, H442A mutant and D446A mutant, respectively, are screened and verified.
Compared with T. glabrata CCTCC M202019 Δura3, biomass of the three recombinants, T. glabrata-C, T. glabrata-442A and T. glabrata-446A, was reduced to 81.5%, 30.2% and 36.3% respectively; intracellular pyruvate dehydrogenase activity was reduced by 21.2%, 48.2% and 51.8% respectively; pyruvate accumulation was increased from 49.4 g·L−1 to 56.8 g/L, 68.6 g·L−1 and 74.3 g·L−1.
The present invention also provides a method for producing pyruvate using the genetically engineered strain. The genetically engineered strain overexpresses wild-type dihydrolipoamide acetyltransferase or the mutants of dihydrolipoamide acetyltransferase of which its conserved active site residues are mutated.
In a preferred embodiment, the host cells for constructing genetically engineered strain is Y. lipolytica, particularly Y. lipolytica WSH-Z06. The amino acid sequence of the wild-type dihydrolipoamide acetyltransferase from Y. lipolytica is shown as SEQ ID NO:1. With regard to the mutation, the conservative active site residue of wild-type enzyme, His 409 or Asp 413, was individually mutated into Ala to get mutant H409A or D413A, respectively. The genetically engineered Y. lipolytica is cultured as follows. The seed medium contains 20 g·L−1 glucose, 10 g·L−1 peptone, 1 g·L−1 KH2PO4, 0.5 g·L−1 MgSO4.7H2O, and is adjusted to pH 5.5; the fermentation medium contains 100 g·L−1 glycerol, 3 g·L−1 (NH4)2SO4, 3 g·L−1 KH2PO4, 1.2 g. MgSO4.7H2O, 0.1 g·L−1 K2HPO4, 0.5 g·L−1 NaCl and 2×10−7 g·L−1 thiamine, and is adjusted to pH 5.0 and is then added with 20 g·L−1 CaCO3. The recombinant strain is inoculated to the seed culture medium at 28° C., 200 rpm, and cultured for 16-18 hours. 150 ml seed culture medium (10%) is inoculated into 1.5 Liter fermentation medium in a 3 Liter fermentor, cultured at 28° C., 200 rpm for 144 hours.
In a preferred embodiment, the host cells for constructing genetically engineered strain is Torulopsis glabrata, especially T. glabrata CCTCC M202019 Δura3. The amino acid sequence of the wild type dihydrolipoamide acetyltransferase from T. glabrata is shown as SEQ ID NO:2. With regard to the mutation, the conservative active site residue of wild type enzyme, His 442 or Asp 446, is individually mutated into Ala to get mutation H442A or D446A.
The genetically engineered T. glabrata is cultured as follows. The seed medium contains 20 g·L−1 glucose, 10 g·L−1 peptone, 1 g·L−1 KH2PO4, 0.5 g·L−1 MgSO4.7H2O, and is adjusted to pH 5.5; The fermentation medium contains 120 g·L−1 glucose, 7 g·L−1 NH4Cl, 5 g·L−1 KH2PO4, 0.8 g·L−1 MgSO4.7H2O, 6 g·L−1 sodium acetate, 4 mg·L−1 niacin, 30 μg·L−1 thiamine, 100 μg·L−1 pyridoxine hydrochloride, 10 μg·L−1 biotin, 50 μg·L−1 riboflavin, and is adjusted to pH 5.0. Vitamins are added to the fermentation medium after they are sterilized by filtration. The recombinant T. glabrata is inoculated into 25 mL seed medium in a 250 mL triangular flasks, and cultured at 28° C., 200 rpm for 24 hours. The seed culture is inoculated at a ratio of 10% (v/v) into 1.5 Liter fermentation medium in a 3 Liter fermentation tank, and cultured at 30° C., 400 rpm with a ventilation rate of 4 vvm for 80 hours. The pH is maintained at pH 5.0 by automatically feeding the fermentation medium with 8 M NaOH and 2 M HCl using a feed pump.
The present invention provides a method of increasing the accumulation of pyruvate in microbes through overexpressing wild-type dihydrolipoamide acetyltransferase or mutant dihydrolipoamide acetyltransferases that have a mutation at conservative active sites. The method decreases the intracellular activity of pyruvate dehydrogenase, thus decreases the catabolism and increase the accumulation of pyruvate in microbes. This method leads to increased extracellular accumulation of pyruvate, which can simplify the downstream isolation and purification processes, reduce the production cost and increase the final yield.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1. Cell growth curves. (A) Y. lipolytica-WSH Z06 (□), Y. lipolytica-C (∘), Y. lipolytica-409A (Δ), Y. lipolytica-413A (∇); (B) T. glabrata CCTCC M202019 Δura3 (□), T. glabrata-C (∘), T. glabrata-442A (Δ), T. glabrata-446A (∇).
FIG. 2. Activities of pyruvate dehydrogenase and dihydrolipoamide acetyltransferase. (A) intracellular overall activity of pyruvate dehydrogenase complex in recombinant Y. lipolytica strains; (B) intracellular dihydrolipoamide acetyltransferase activity in recombinant Y. lipolytica strains; (C) intracellular pyruvate dehydrogenase activity of different T. glabrata strains; (D) intracellular dihydrolipoamide acetyltransferase activity of different T. glabrata strains.
FIG. 3. Extracellular pyruvate concentrations of different Y. lipolytica strains; (A) Y. lipolytica WSH-Z06, (B) Y lipolytica-K, (C) Y. lipolytica-409A, (D) Y. lipolytica-413A; dry cell weight (□), pyruvate(∘), glycerol (Δ).
FIG. 4. Extracellular pyruvate concentrations of different T. glabrata strains; (A) T. glabrata CCTCC M202019 Δura3, (B) T. glabrata-C, (C) T. glabrata-442A, (D) T. glabrata-446A; dry cell weight (□), pyruvate (∘), glucose (Δ).
Table 1. Primers used in this invention.
EXAMPLES
Materials and Methods:
YPD medium: 5 g·L−1 yeast extract, 10 g·L−1 peptone, 10 g·L−1 glucose. To make solid medium, add 20 g·L−1 Agar. Hygromycin B was added to the concentration of 400 mg·L−1 for selection of positive recombinant transformants.
YNB medium: 10 g·L−1 glucose, 0.67 g·L−1 (NH4)2SO4, pH 6.
Seed medium for Y. lipolytica: 20 g·L−1 glucose, 10 g·L−1 peptone, 1 g·L−1 KH2PO4, 0.5 g·L−1 MgSO4.7H2O, pH 5.5. To make solid medium, add 20 g·L−1 agar.
Fermentation medium for Y. lipolytica: 100 g·L−1 glycerol, 3 g·L−1 (NH4)2SO4, 3 g·L−1 KH2PO4, 1.2 g·L−1 MgSO4.7H2O, 0.1 g·L−1 K2HPO4, 0.5 g·L−1 NaCl, 2×10−7 g·L−1 thiamine pH 5.5. 20 g·L−1 CaCO3 was added as a neutralizing agent before inoculation.
Seed medium for T. glabrata: 20 g·L−1 glucose, 10 g·L−1 peptone, 1 g·L−1 KH2PO4, 0.5 g·L−1 MgSO4.7H2O, pH 5.5. To make solid medium, add 20 g·L−1 agar.
Fermentation medium for T. glabrata: 120 g·L−1 glucose, 7 g·L−1 NH4Cl, 5 g·L−1 KH2PO4, 0.8 g·L−1 MgSO4.7H2O, 6 g·L−1 sodium acetate, 4 mg·L−1 niacin, 30 μg·L−1 thiamine, 100 μg·L−1 pyridoxine hydrochloride, 10 μg·L−1 biotin, 50 μg·L−1 riboflavin, pH 5.0. 20 g·L−1 CaCO3 was added as a neutralizing agent before inoculation.
The Y. lipolytica WSH-Z06 was obtained from China Center for Type Culture Collection (CCTCC) with CCTCC NO: M20714.
Determination of biomass: dry cell weight (g·L−1)=0.223*OD570.
Determination of intercellular pyruvate dehydrogenase activity: cells were collected by centrifugation and washed by 0.9% physiological saline. Cell were resuspended in 10 mL buffer solution containing 0.1 mol·L−1 KH2PO4—K2HPO4, 1 mmol·L−1 EDTA, 0.01 mmol·L−1 DTT (pH 7.5). After addition of one volume of acid-washed quartz sand, cells were disrupted using Tissuelyser for 5 minutes, which was followed by centrifuged at 13,000 g for 10 minutes to remove the precipitation. 0.5 ml supernatant was used for the determination of enzyme activity. 3 ml enzyme activity assay system includes 0.5 ml supernatant, 50 mM HEPES, 0.1% Triton X-100, 1.0 mM MgCl2, 5.0 mM pyruvate, 0.2 mM diphosphothiamin, 2.0 mM NAD+ and 0.1 mM CoA, pH 7.4. Concentration change of NADH was determined by measuring OD340 at 30° C. 1 U pyruvate dehydrogenase activity is defined as the enzyme needed to generate 1 μmol NADH within one minute.
Determination of intercellular dihydrolipoamide acetyltransferase activity: 3 ml enzyme activity assay system includes 0.5 ml supernatant of cells lysate, 1.19 mM Tris-HCL buffer (pH 8.0), 0.07 mM acetyl phosphate, 0.042 mM 95% ethanol solution of dihydrolipoamide, 0.07 μM CoA, 7 U Phosphate acetyltransferase, 0.83 mM Sodium acetate. Concentration change of S-acetyldihydrolipoamide is determined by measuring OD240. 1 U dihydrolipoamide acetyltransferase activity is defined as the enzyme needed to generate 1 μmol S-acetyldihydrolipoamide within one minute.
Determination of extracellular pyruvate concentration: fermentation samples were centrifuged at 13000 g for 5 minutes. The supernatant was diluted 50 times with ultrapure water and filtered through 0.22 mm filter paper, and pyruvate concentration of the sample was determined using HPLC.
Conditions for HPLC analysis: pyruvate was determined by HPLC (Agilent 1200 series, Santa Clara, Calif.) with a Aminex HPX-87H ion exchange column (300 mm×7.8 mm; Bio-Rad Laboratories Inc., Hercules, Calif.). The mobile phase was 5 mmol·L−1 sulfuric acid in distilled, de-ionized water filtered through a 0.22 μm pore size membrane. The mobile phase flow rate was 0.6 mL·min−1. The column temperature was maintained at 35° C., and the injection volume was 10 μL. The pyruvate was detected by UV (wavelength at 210 nm) detector.
Transformation of Y. lipolytica: A freshly grown single colony was transferred into liquid YPD medium and cultured at 28° C., 200 rpm for overnight. The yeast cells were transferred into new liquid YPD medium by an inoculum size of 10% (v/v), cultured at 28° C., 200 rpm until the OD600=1.2. The cells were collected by centrifugation, and 8×108 cells·mL−1 were resuspended in 8 mL buffer solution (100 mM LiAc, 10 mM DTT, 0.6 M sorbitol, 10 mM Tris-HCL, pH=7.5) and incubated at 30° C. for 30 minutes. Collect cells again by centrifugation and wash the cells by ice-chilled 5 mL 1 M sorbitol solution three times, and were resuspended to the concentration of 1010 cell·mL−1 in the sorbitol solution. The linearized integrative recombinant plasmid was added to the cell suspension, incubated on ice for 5 mM, and transferred to a ice-chilled 0.2-cm electric rotor. The electroporation shock was performed at 2.5 KV, 25 μF, 200Ω, and 1 mL ice-chilled 1 M sorbitol solution was immediately added afterwards. The mixture was incubated at room temperature for 1 h. For selection of recombinant Y. lipolytica, 0.2 mL cells, which have been electrically shocked, were spread on the YPD plates with 400 mg·L−1 Hygromycin B, and cultured at 28° C. for 48-72 h. For recombinant T. glabrata, 0.2 mL cells, which have been electrically shocked, were spread on the YNB plates and cultured at 28° C. for 48-72 h. The colonies grown on selective plates were further verified by PCR.
Example 1 Effects of Overexpressing Dihydrolipoamide Acetyltransferase or its Mutations on Cell Growth
1. The recombinant Y. lipolytica can be constructed using the following method:
The amino acid sequence of the wild type dihydrolipoamide acetyltransferase from Y. lipolytica is shown as SEQ ID NO: 1. Conservative amino acids at the active site of the enzyme, His 409 and Asp 413, were mutated into Ala to get mutation H409A and D413A, respectively.
(1) Constructing the integrative expression vector: The amplified open reading frame (ORF) of hph encoding hygromycin phosphotransferase and plasmid p0 are digested using restriction enzyme Stu I and Hind III simultaneously. The digested fragments were ligated to obtain integrative expression vector p0(hph).
(2) Constructing a recombinant expression plasmid: the ORF of LAT1 encoding dihydrolipoamide acetyltransferase was synthesized; ORF of LAT1 and the integrative plasmid p0(hph) were digested by Bam HI and Eco RI simultaneously which was followed by the ligation of the digested fragments to obtain a recombinant expression plasmid p0(hph)-LAT1; Site-directed mutagenesis of conservative active site residue was accomplished using primers H409A-F (SEQ ID:4)/H409A-R (SEQ ID NO:5) and D413A-F (SEQ ID NO:6)/D413A-R (SEQ ID NO:7), respectively. The resulted plasmids were p0(hph)-409A and p0(hph)-413A, respectively.
(3) Transforming the recombinant expression plasmid into Y. lipolytica WSH-Z06: The recombinant expression plasmid was linearized and transformed into Y. lipolytica WSH-Z06 using electroporation method. Positive transformants Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A, which overexpress dihydrolipoamide acetyltransferase wild type, mutant H409A and mutant D413A, respectively, are screened using selective plates. The colonies grown on selective plates were further verified by PCR using primers VBF (SEQ ID NO:12)/VBK (SEQ ID NO:13) in Table 1.
The method of constructing plasmid p0 is well documented in Swennen D, Paul M F, Vernis L, Beckerich J M, Fournier A, Gaillardin C. Secretion of active anti-Ras single-chain Fv antibody by the yeasts Yarrowia lipolytica and Kluyveromyces lactis. Microbiology-Sgm, 2002. 148: 41-50.
Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A were inoculated into 0.2 ml YPD medium in 96-well plates and cultured at 28° C., 200 rpm for 10 h. Compared with biomass of Y. lipolytica WSH-Z06, biomass of the three recombinants, Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A, was reduced to 86.5%, 22.0% and 26.2%, respectively (FIG. 1A).
The recombinant T. glabrata can be constructed using the following method:
The amino acid sequence of the wild type dihydrolipoamide acetyltransferase from T. glabrata is shown as SEQ ID NO:2. Conservative residues at the active site of the enzyme, His 442 and Asp 446, are mutated into Ala to get mutation H442A and D446A, respectively.
(1) Constructing a recombinant expression plasmid: Open reading frame (ORF) of the gene LAT1 encoding dihydrolipoamide acetyltransferase was synthesized based on the published nucleotide sequence by NCBI; LAT1 ORF and the integrative plasmid pRS306TEF1 were digested by restriction enzyme Spe I and Bam HI simultaneously which was followed by the ligation of the digested fragments to obtain a recombinant expression plasmid pRS306TEF1-LAT1. Site-directed mutagenesis of conservative active site residue was accomplished using primers H442A-F (SEQ ID NO:8)/H442A-R (SEQ ID NO:9) and D446A-F (SEQ ID NO:10)/D446A-R (SEQ ID NO:11). pRS306TEF1-LAT1 was used as template DNA to get recombinant expression plasmid pRS306TEF1-442A and pRS306TEF1-446A.
(2) Transforming the recombinant expression plasmid into T. glabrata CCTCC M202019 Δura3: the recombinant expression plasmid was linearized and transformed into T. glabrata CCTCC M202019 Δura3 by electroporation; Positive transformants T. glabrata-C, T. glabrata-442A and T. glabrata-446A, which overexpress dihydrolipoamide acetyltransferase wild type, mutant H442A and mutant D446A, respectively, were screened using selective plates. The colonies grown on selective plates were further verified by PCR using primers VTB (SEQ ID NO:14)/VTC (SEQ ID NO:15) in Table 1.
The method of constructing T. glabrata CCTCC M202019 Δura3 is well documented in Zhou J, Dong Z, Liu L, Du G, Chen J. A reusable method for construction of non-marker large fragment deletion yeast auxotroph strains: A practice in Torulopsis glabrata. Journal of Microbiological Methods. 2009; 76:70-74.
Compared with biomass of T. glabrata CCTCC M202019 Δura3, biomass of the three recombinants, T. glabrata-C, T. glabrata-442A and T. glabrata-446A, were reduced to 81.5%, 30.2% and 36.3%, respectively (FIG. 1B).
Example 2 Effects of Overexpressing Dihydrolipoamide Acetyltransferase or its Mutants on Intracellular Pyruvate Dehydrogenase Activity
1. Y. lipolytica
Y. lipolytica WSH-Z06, Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A were inoculated into YPD medium (20/250 mL) and cultured at 28° C., 200 rpm. Cells at logarithmic growth phase were collected, and the intracellular pyruvate dehydrogenase activity was determined.
Compared with the intracellular dihydrolipoamide acetyltransferase activity of Y. lipolytica WSH-Z06, the activity of dihydrolipoamide acetyltransferase in Y. lipolytica-409A and Y. lipolytica-413A was reduced to 40.7% and 39.1% respectively, while intracellular dihydrolipoamide acetyltransferase activity of Y. lipolytica-K was increased to 256.2% (FIG. 2B).
Compared with the intracellular overall activity of pyruvate dehydrogenase complex in Y. lipolytica WSH-Z06, the intracellular overall activity of pyruvate dehydrogenase complex in three recombinants, Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A, was reduced by 13.5%, 35.2% and 32.2%, to 26.3 U/mg protein, 19.7 U/mg protein and 20.6 U/mg protein, respectively (FIG. 2A).
2. T. glabrata
T. glabrata CCTCC M202019 Δura3, T. glabrata-C, T. glabrata-442A and T. glabrata-446A were cultured in the same way as Y. lipolytica was.
Compared with the intracellular dihydrolipoamide acetyltransferase activity of T. glabrata CCTCC M202019 Δura3, the enzyme activity of T. glabrata-C was increased to 151.5%, while the intracellular dihydrolipoamide acetyltransferase activity of T. glabrata-442A and T. glabrata-446A were reduced to 42.3% and 46.7% respectively (FIG. 2D).
Compared with the intracellular pyruvate dehydrogenase activity of T. glabrata CCTCC M202019 Δura3, that of T. glabrata-C, T. glabrata-442A and T. glabrata-446A, were reduced by 21.2%, 48.2% and 51.8%, to 17.8 U/mg protein, 11.7 U/mg protein and 10.9 U/mg protein, respectively (FIG. 2C).
Example 3 Effects of Overexpressing Dihydrolipoamide Acetyltransferase or its Mutants on Pyruvate Accumulation
Y. lipolytica WSH-Z06, Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A were inoculated into fermentation medium (1.5 L medium/3 L fermentor) and cultured at 28° C., 200 rpm for 144 hours. The pyruvate concentration in the supernatant produced by Y. lipolytica WSH-Z06, Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A were 20.5 g·L−1, 38.6 g·L−1, 38.6 g·L−1 and 39.9 g·L−1, respectively (FIG. 3). Overexpressing dihydrolipoamide acetyltransferase or its mutations in Y. lipolytica WSH-Z06 greatly increased pyruvate yield.
T. glabrata CCTCC M202019 Δura3, T. glabrata-C, T. glabrata-442A and T. glabrata-446A were inoculated into fermentation medium (1.5 L medium/3 L fermentor) and cultured at 28° C., 200 rpm for 144 hours. The pyruvate concentration in the supernatant produced by T. glabrata CCTCC M202019 Δura3, T. glabrata-C
Figure US09518275-20161213-P00001
T. glabrata-442A and T. glabrata-446A were 49.4 g·L−1, 56.8 g·L−1, 68.6 g·L−1 and 74.3 g·L−1, respectively (FIG. 4). Overexpressing dihydrolipoamide acetyltransferase or its mutations in T. glabrata enormously increased pyruvate yield.
While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All figures, tables, appendices, patents, patent applications and publications, referred to above, are hereby incorporated by reference.
TABLE 1
Primers used in this invention
Primers Sequence (5′-3′)
H409A-F CTGACCACCTCTTTCGACGCTCGAGTCGTCG
SEQ ID NO: 4 ATGGAGCT
H409A-R AGCTCCATCGACGACTCGAGCGTCGAAAGAG
SEQ ID NO: 5 GTGGTCAG
D413A-F TTCGACCACCGAGTCGTCGCTGGAGCTGTTG
SEQ ID NO: 6 GAGGCGAG
D413A-R CTCGCCTCCAACAGCTCCAGCGACGACTCGG
SEQ ID NO: 7 TGGTCGAA
H442A-F ATAACAGGTACATTTGACGCTAGAACCATTG
SEQ ID NO: 8 ACGGTGCT
H442A-R AGCACCGTCAATGGTTCTAGCGTCAAATGTA
SEQ ID NO: 9 CCTGTTAT
D446A-F TTTGACCACAGAACCATTGCTGGTGCTAAAG
SEQ ID NO: 10 GTGCTGAT
D446A-R ATCAGCACCTTTAGCACCAGCAATGGTTCTG
SEQ ID NO: 11 TGGTCAAA
VBF CGTTTGCCAGCCACAGATT
SEQ ID NO: 12
VBK GCAACGGCGACAGAAACG
SEQ ID NO: 13
VTB TGAAGTGGTACGGCGATGC
SEQ ID NO: 14
VTC CACCGTCAATGGTTCTGTGG
SEQ ID NO: 15

Claims (9)

What is claimed is:
1. A genetically engineered microbe strain with enhanced secretion of pyruvate, wherein said microbe strain overexpresses wild type dihydrolipoamide acetyltransferase or dihydrolipoamide acetyltransferase mutant which has mutation at its conservative active site, which is selected from the group consisting of wild type dihydrolipoamide acetyltransferase of SEQ ID NO: 1 or SEQ ID NO: 2, dihydrolipoamide acetyltransferase mutant H409A or D413A of SEQ ID NO: 1, and dihydrolipoamide acetyltransferase mutant H442A or D446A of SEQ ID NO: 2.
2. The genetically engineered microbe strain of claim 1, wherein said microbe strain is Y. lipolytica.
3. The genetically engineered microbe strain of claim 2, wherein the amino acid sequence of said wild type dihydrolipoamide acetyltransferase is SEQ ID NO: 1.
4. The genetically engineered microbe strain of claim 3, wherein said mutation at conservative active site of said dihydrolipoamide acetyltransferase mutant is H409A or D413A.
5. The genetically engineered microbe strain of claim 1, wherein said genetically engineered microbe strain is constructed as follows:
(1) Constructing an integrative expression vector: the gene hph encoding hygromycin phosphotransferase and plasmid p0 are digested at the same time using restriction enzyme Stu I and Hind III; The digested fragments are connected to obtain the integrative expression vector p0(hph);
(2) Constructing a recombinant expression plasmid: The open reading frame of the gene LAT1 encoding dihydrolipoamide acetyltransferase is synthesized; The LAT1 ORF and the integrative plasmid p0(hph) are digested by restriction enzyme Bam HI and Eco RI simultaneously which is followed by the ligation of the digested fragments to obtain a recombinant expression plasmid p0(hph)-LAT1; Site-directed mutagenesis is accomplished using primers H409A-F/H409A-R and D413A-F/D413A-R; p0(hph)-LAT1 is used as template DNA to get recombinant expression plasmid p0(hph)-409A and p0(hph)-413A;
(3) Transforming the recombinant expression plasmid into Y. lipolytica WSH-Z06: The recombinant expression plasmid p0(hph)-LAT1, p0(hph)-409A or p0(hph)-413A is linearized and transformed into Y. lipolytica WSH-Z06 by electroporation; positive transformants Y. lipolytica-K, Y. lipolytica-409A and Y. lipolytica-413A, which overexpress dihydrolipoamide acetyltransferase wild type, H409A mutant and D413A mutant, respectively, are screened and verified.
6. The genetically engineered microbe strain of claim 1, wherein said genetically engineered microbe strain is T. glabrata.
7. The genetically engineered microbe strain of claim 6, wherein the amino acid sequence of said wild type dihydrolipoamide acetyltransferase is SEQ ID NO: 2.
8. The genetically engineered microbe strain of claim 7, wherein said mutation at conservative active site of said dihydrolipoamide acetyltransferase mutant is H442A or D446A.
9. The genetically engineered microbe strain of claim 6, wherein said genetically engineered microbe strain is constructed as follows:
(1) Constructing a recombinant expression plasmid: The open reading frame of the gene LAT1 encoding dihydrolipoamide acetyltransferase is synthesized; The LAT1 ORF and the integrative plasmid pRS306TEF1 are digested by restriction enzyme Spe I and Bam HI simultaneously which is followed by the ligation of the digested fragments to obtain a recombinant expression plasmid pRS306TEF1-LAT1; Site-directed mutagenesis is accomplished using primers H442A-F/H442A-R and D446A-F/D446A-R; pRS306TEF1-LAT1 is used as template DNA to get recombinant expression plasmid pRS306TEF1-442A and pRS306TEF1-446A;
(2) Transforming the recombinant expression plasmid into T. glabrata CCTCC M202019 Δura3: The recombinant expression plasmid pRS306TEF1-LAT1, pRS306TEF1-442A or pRS306TEF1-446A is linearized and transformed into T. glabrata CCTCC M202019 Δura3 by electroporation; positive transformants T. glabrata-C, T. glabrata-442A and T. glabrata-446A, which overexpress dihydrolipoamide acetyltransferase wild type, H442A mutant and D446A mutant, respectively, are screened and verified.
US14/583,260 2014-11-19 2014-12-26 Method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes Expired - Fee Related US9518275B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN201410665313.9 2014-11-19
CN201410665313 2014-11-19
CN201410665313.9A CN104450804B (en) 2014-11-19 2014-11-19 A method for weakening pyruvate catabolism and enhancing pyruvate accumulation

Publications (2)

Publication Number Publication Date
US20160138054A1 US20160138054A1 (en) 2016-05-19
US9518275B2 true US9518275B2 (en) 2016-12-13

Family

ID=52897551

Family Applications (1)

Application Number Title Priority Date Filing Date
US14/583,260 Expired - Fee Related US9518275B2 (en) 2014-11-19 2014-12-26 Method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes

Country Status (2)

Country Link
US (1) US9518275B2 (en)
CN (1) CN104450804B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104450804B (en) * 2014-11-19 2019-05-17 江南大学 A method for weakening pyruvate catabolism and enhancing pyruvate accumulation
CN105368884B (en) * 2015-12-10 2019-01-04 江南大学 The recombinant bacterium and its application that a kind of Pyruvate production intensity improves
CN106635852B (en) * 2016-12-07 2019-11-26 江南大学 A kind of recombination torulopsis glabrata of cogeneration of propanone acid and α-ketoglutaric acid
CN110499259B (en) * 2019-07-22 2021-07-27 浙江工业大学 A kind of Yarrowia Yarrowia YW100-1 and its application
KR102281369B1 (en) * 2021-04-07 2021-07-22 씨제이제일제당 (주) Novel dihydrolipoamide acetyltransferase variant and a method for producing L-valine using the same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160138054A1 (en) * 2014-11-19 2016-05-19 Jiangnan University Method for Decreasing Pyruvate Catabolism and Increasing the Accumulation of Pyruvate in Microbes

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103087950A (en) * 2013-01-10 2013-05-08 江南大学 Construction and application of escherichia coli strain for high production of pyruvic acid

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160138054A1 (en) * 2014-11-19 2016-05-19 Jiangnan University Method for Decreasing Pyruvate Catabolism and Increasing the Accumulation of Pyruvate in Microbes

Also Published As

Publication number Publication date
CN104450804A (en) 2015-03-25
US20160138054A1 (en) 2016-05-19
CN104450804B (en) 2019-05-17

Similar Documents

Publication Publication Date Title
US9518275B2 (en) Method for decreasing pyruvate catabolism and increasing the accumulation of pyruvate in microbes
US10738332B2 (en) Genetically modified yeasts and fermentation processes using genetically modified yeasts
JP2020526213A (en) Ectoine-producing yeast
CN115927436B (en) Construction method and application of a fungus for synthesizing 24-epiergosterol
Fei et al. Improved glutathione production by gene expression in Pichia pastoris
EP4549453A1 (en) Recombinant amycolatopsis for improving vanillin yield, construction method and application thereof
WO2025227891A1 (en) Recombinant yarrowia lipolytica strain with high yield of tetraacetyl phytosphingosine and use thereof
US9273328B2 (en) Yeast mutant of kluyveromyces and method for ethanol production using the same
CN116064266B (en) Recombinant saccharomyces cerevisiae with enhanced salt stress resistance, and construction method and application thereof
CN109266566B (en) Method for adjusting osmotic pressure stress of Torulopsis glabrata
US9328363B2 (en) Genetically engineered Yarrowia lipolytica with enhanced extracellular secretion of α-ketoglutarate
CN112218941A (en) Microbial and fine chemical production
CN110923261B (en) Method for increasing content of fatty acid C20:0 and/or C22:0 in cell membrane of saccharomyces cerevisiae
US9765347B2 (en) Transformant of Schizosaccharomyces pombe mutant and cloning vector
CN103131718A (en) Cloning of hypertonicity-resistant functional gene CgHog1 from Candida glycerinogenes and application thereof
US9796992B2 (en) Gene cluster for biosynthesis of cornexistin and hydroxycornexistin
CN117925430A (en) Oxidation stress resistant saccharomyces cerevisiae engineering strain, construction method and application thereof
CN105368884A (en) Recombinant bacterium with function of pyruvate production intensity improvement and application of recombinant bacterium with function of pyruvate production intensity improvement
CN110616161B (en) A method for regulating oxygen stress in Saccharomyces cerevisiae using Y-family polymerase Rev1
CN104745602B (en) A kind of transcription factor Asg1p of the regulation and control resistance to acid stress ability of torulopsis glabrata
CN109576287B (en) CrpMApplication of gene in improving DHA stress tolerance of Gluconobacter strains
CN101245322A (en) Construction of a pyruvate-producing recombinant bacterium and method of using it to increase pyruvate production intensity
Thomé Heterologous Expression of Glycerol 3-Phosphate Dehydrogenase Gene [DhGPD1] from the Osmotolerant Yeast Debaryomyces hansenii in Saccharomyces cerevisiae: Thomé
CN105907730A (en) Enzymatic activity improved pyruvate carboxylase mutant N1078F and application thereof
CN118755769B (en) Recombinant Yarrowia lipolytica with high lycopene production, construction method and application thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: JIANGNAN UNIVERSITY, CHINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHEN, JIAN;ZHOU, JINGWEN;GUO, HONGWEI;AND OTHERS;REEL/FRAME:037445/0408

Effective date: 20160104

ZAAA Notice of allowance and fees due

Free format text: ORIGINAL CODE: NOA

ZAAB Notice of allowance mailed

Free format text: ORIGINAL CODE: MN/=.

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20241213